s takashima et al. nature 000 , 1-5 (2008) doi:10.1038/nature07156

1

S Takashima et al. Nature 000, 1-5 (2008) doi:10.1038/nature07156 Proliferating cells of the Drosophila hindgut are confined to a morphologically and molecularly defined zone (HPZ).

Upload: maile-greene

Post on 31-Dec-2015

18 views

Category:

Documents

1 download

Report

Download

Embed Size (px):

DESCRIPTION

Proliferating cells of the Drosophila hindgut are confined to a morphologically and molecularly defined zone (HPZ). S Takashima et al. Nature 000 , 1-5 (2008) doi:10.1038/nature07156. - PowerPoint PPT Presentation

TRANSCRIPT

Page 1: S Takashima et al. Nature 000 , 1-5 (2008) doi:10.1038/nature07156

S Takashima et al. Nature 000, 1-5 (2008) doi:10.1038/nature07156

Proliferating cells of the Drosophila hindgut are confined to amorphologically and molecularly defined zone (HPZ).

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

Nature, 2008, Doi:10.1038/nature07103 Semrah Kati 09.02.2009

doi:10.1038/nature05202 LETTERS

DOI: 10.1038/NMAT4228 - imechanicaimechanica.org/files/nmat4228-s1_0.pdf · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4228. NATURE MATERIALS | . 1. 1. In Situ Atomic-Scale Observation

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor

Nature Photonics 8, 695-700 doi: 10.1038/ (2014). The

Nature Biotechnology: doi:10.1038/nbt › ... › n2 › extref › nbt.3754-S1.pdf · Nature Biotechnology: doi:10.1038/nbt.3754. Supplementary Figure 2 SuRE genome coverage, reproducibility

doi:10.1038/nature05150 LETTERS

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

1 November 2007 doi:10.1038/nature06221 LETTERS

DOI: 10.1038/NMAT4299 Supplementary file for P … · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4299. NATURE MATERIALS | . 1 1 Supplementary file for Photo-oxidation and quantum

DOI: 10.1038/NMAT4204 Supplementary Information · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4204. NATURE MATERIALS | . 1. 1 . Supplementary Information . High-precision realization

Published in Nature Materials (2016) doi:10.1038/nmat4569

doi:10.1038/nature12886 Neanderthal from the Altai

Mucosal Immunology (2013) 6 , 522-534; doi:10.1038/mi.2012.92

Nature , 2008, Doi:10.1038/nature07103

Neuropsychopharmacology (2013) 38 , 2150-2159; doi:10.1038/npp.2013.112

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

DOI: 10.1038/NMAT3074 Maltodextrin based imaging … · and in vivo SUPPLEMENTARY INFORMATION DOI: 10.1038/NMAT3074 ©

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×−

DOI: 10.1038/NMAT4204 Supplementary Information...NATURE MATERIALS | . DOI: 10.1038/NMAT4204. , , – – |

Neuropsychopharmacology (2011) 36, 2406-2421; doi:10.1038/npp.2011.128

Ecosystem turnover in palaeoecological records: …€¦ · Web viewNature Publishing Group: 53–59. DOI: 10.1038/nature08227. DOI: 10.1038/nature08227. Seddon AW, Macias-Fauria

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

DOI: 10.1038/ncomms1280 molecular dynamics of single

doi: 10.1038/nature09205 SupplementaryInformationfor ...projects.iq.harvard.edu/files/ped/files/nature09205-s1.pdf 2 doi: 10.1038/nature09205 SUPPLEMENTARY INFORMATION 10Asexualreproduction

Vol 437 15 September 2005 doi:10.1038/nature03943 LETTERS

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

GI Motility online (May 2006) | doi:10.1038/gimo6

DOI: 10.1038/NPHOTON.2015 - media.nature.com PHOTONICS | . 3. DOI: 10.1038/NPHOTON.2015. 181. SUPPEENTAR INORATION 1 polarized laser beams to …

Nature Biotechnology: doi:10.1038/nbt

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

DOI: 10.1038/NPHYS3211 Supplementary Information for

SCIENTIFIC REPORTS | 2 : 592 | DOI: 10.1038/srep00592