Top results
intelligo semantic similarity measure for gene ontology annotations marie-dominique devignes laboratoire lorrain de recherche en informatique et ses applications loria equipe…
a framework for ontology-driven similarity measuring using vector learning tricks mengxiang chen, beixiong liu, desheng zeng and wei gao, abstract—ontology learning problem…
abstract—ontology similarity calculation and ontology mapping are important research topics in information retrieval. by learning optimization similarity function, we propose…
sigir2019-radsumontology-aware clinical abstractive summarization sean macavaney*, sajad sotudeh*, arman cohan, nazli goharian, ross filice, ish talati to appear at sigir
slide 1 1 gene ontology and semantic similarity measures slide 2 2 copyright notice many of the images in this power point presentation are from bioinformatics and functional…
powerpoint presentationfunctional networks university of ulster, ukuniversity of ulster, uk goals of this researchgoals of this research to propose a method to incorporate
journal of king saud university – computer and information sciences 2015 27 1–12 king saud university journal of king saud university – computer and information sciences…
author:reformat, m.; golmohammadi, s.k. department of electrical and computer engineering, university of alberta, canada content type:conferences this paper appears in: fuzzy…
context aware ontology based information extractionsapan shah and sreedhar reddy tata research development and design center, tata consultancy services limited, information
optimizing similarity computations for ontology matching - experiences from gomma optimizing similarity computations for ontology matching - experiences from gomma michael…
using semantic similarity in ontology alignment valerie cross and xueheng hu computer science and software engineering department, miami university, oxford, oh 45056 [email protected]…
1.similarity search in large datasets using gene ontology computational informatics heiko müller, david rozado, mat cook, ashfaqur rahman 2. gene01: acggtaggctagactagatattaacg…
similarity-based learning methods for the semantic web claudia d’amato dipartimento di informatica • università degli studi di bari campus universitario via orabona…
proceedings ofproceedings of detc ‘09 asme 2009 design engineering technical conferences august 30- september 2, 2009, san diego, ca, usa detc2009-87711 a method for
similarity aware shuffling for the distributed execution of sql window functions fabio coelho1, miguel matos2, jose pereira1, and rui oliveira1 1 inesc tec & universidade
graduate school of engineering osaka university#1 the institute of scientific and industrial research (isir) osaka university#2 abstract. quality of ontology is important
an ontology for context-aware pervasive computing environments∗ harry chen, tim finin, and anupam joshi department of computer science and electrical engineering university…
ontology-aware prediction from rules: a reconciliation-based approach fatiha saïsa,, rallou thomopoulosb,c, alri, paris sud university cnrs, bât. ada lovelace, f-91190…
plpd: protein localization prediction for imbalanced and overlapped datasets semantic similarity over gene ontology for multi-label protein subcellular localization shibiao…
                                               …