sect translation

Download Sect Translation

Post on 06-Apr-2018

222 views

Category:

Documents

0 download

Embed Size (px)

TRANSCRIPT

  • 8/2/2019 Sect Translation

    1/21

    Gene Expression: Translation

  • 8/2/2019 Sect Translation

    2/21

    Reminder

    Genes that encode proteins are transcribed and the transcript is

    processed to make mRNA.

    Next the base sequence in the mRNA must be translated into aminoacid sequences in a polypeptide.

    Once polypeptides are formed, they fold up and combine with other

    molecules, but this is the realm of biochemistry, not genetics.

    Review structure of polypeptides; a protein consists of one or more

    polypeptides.

  • 8/2/2019 Sect Translation

    3/21

    The Code Problem

    DNA and RNA sequences are writtenin an alphabet of 4 different bases: G,A, T (U), C.

    Protein sequences are written in analphabet of 20 different amino acids.

    Therefore there must be a code thatrelates a base sequence to an aminoacid sequence.

    Francis Crick, Leslie Orgel

    Alex Rich, Jim Watson

    (and RNA Tie Club ties)

    George Gamow

    Sidney Brenner

    J. Heinrich MattheiMarshall Nirenberg

    Severo Ochoa

  • 8/2/2019 Sect Translation

    4/21

    The 20 Amino AcidsImportantfeatures:Differ only inside chainsEach has three-letter and one-letterabbreviations

    You shouldunderstand thatthe sequence ofamino acids in apolypeptide(protein) can be

    written twoways:Arg Thr Ser SerR T S S

    Polypeptideshave an N- and a

    C-terminal AA

    You dont have to memorize these but you

    do have to know there are 20 and recognize

    amino acid sequences.

  • 8/2/2019 Sect Translation

    5/21

    The Genetic CodeThe code is:

    Written in RNA becauseit is the mRNA sequencethat is read.

    Universal (almost)Exceptions (small):Vertebrate mitochondriaInvertebrate mitochondriaChloroplastsCiliate nuclear

    Mycoplasma nuclear

    Candida nuclearetc.

    TripletNonoverlappingCommalessDegenerate

  • 8/2/2019 Sect Translation

    6/21

    The Genetic CodeThe code is:

    Universal (almost) TripletDegenerateNonoverlappingCommaless

    CACCAUGGUGCACCUGACUCCUGAGCACUAAGCU

    Quadruplet: AUGGUGCACCUGACUC

    Comma: AUGCCGUGCCCACCCUGG

    Overlaping: AUGGUGCACCUGACUC

  • 8/2/2019 Sect Translation

    7/21

    The Genetic Code

    CACCAUGGUGCACCUGACUCCUGAGCACUAAGCU

    Met Val His Leu Thr Pro Glu . His Stop

    Start

    UAA, UAG, and UGA arenonsense codons; they do not

    code for any amino acid and

    hence are stop or

    termination codons.

    All the rest are sense codons.

    AUG is the start codon and

    codes for methionine (Met,

    M).

    (only one to memorize)

  • 8/2/2019 Sect Translation

    8/21

    Open Reading Frames

    CACCAUGGUGCACCUGACUCCUGAGCACUAAGCU

    Met Val His Leu Thr Pro Glu . His Stop

    Start

    An open reading frame (ORF) is a string of sense codons

    starting with the start codon ATG and flanked at the 3 end

    by a stop codon.

    All genes that code for proteins must have an ORF.

  • 8/2/2019 Sect Translation

    9/21

    Using Open ReadingFrames to Find Genes

    CACCAUGGUGCACCUGACUCCUGAGCACUAAGCU

    Met Val His Leu Thr Pro Glu . His Stop

    Start

    A computer program can search a sequence of bases for open reading

    frames. These are candidates for genes encoding proteins.

    Problems:

  • 8/2/2019 Sect Translation

    10/21

    Using Open Reading Frames to Find GenesA computer program can search a sequence of bases for open reading

    frames. These are candidates for genes encoding proteins.

    Problems:

    A gene can be on either strand, but the sequence is only written for one strand.Solution: search both complementary sequences.

    A random sequence of bases can have an ORF. Partial solutions: look for long

    ORFs starting with ATG.

    Introns can interrupt ORFs. The introns are spliced out of the mRNA leaving

    only the exons which form a continuous ORF; but DNA sequences will still havethe introns. Partial solution: look for sequences that often flank introns.

    Designing computer programs to seach complete genome sequences is a major

    problem in bioinformatics.

  • 8/2/2019 Sect Translation

    11/21

    The Mechanics of Translation1. Translation requires:

    Small ribosomal subunit = SSUrRNA + ribosomal proteins Large ribosomal subunit = LSUrRNA + ribosomal proteins +

    5SrRNA (eukaryotes) (Small and large subunits also have S names: 16S, 18S, 23S, etc. S

    is for Svedberg units describing how fast something moves in acentrifugal field.)

    Aminoacyl tRNAs = transfer RNAs + amino acids Accessory proteins that promote various steps2. mRNA is translated 5 to 33. Polypeptide is made N-terminal to C-terminal

  • 8/2/2019 Sect Translation

    12/21

    Cellular Sites of Transcription & Translation

    After eukaryotic nuclear genes aretranscribed and processed, themRNA must be moved to the

    cytoplasm for translation.

    Prokaryotic genes, and those in the

    chloroplasts and mitochondria, arenot separated from the sites ofprotein synthesis. Transcriptionand translation proceedsimultaneously.

    mitochondria

    genes

    mRNAprotein mRNA

    chloroplast

  • 8/2/2019 Sect Translation

    13/21

    Making Aminoacyl tRNAsEach tRNA has a specific basesequence, including an anticodonthat can base pair with a codon.

  • 8/2/2019 Sect Translation

    14/21

    A A A A A U

    U U U U U A

    AsnLys

    A A A A A U

    U U U U U A

    AsnLys

    A A A A A U

    U U U

    Asn

    Lys

    Asn

    U U A

    U U AAn aminoacyl tRNA synthase recognizes a

    tRNA and its corresponding amino acid andjoins them.

    The anticodon on the aminoacyl tRNA base-

    pairs with its codon on the mRNA.

    A new peptide bond is formed to join the

    amino acids.

  • 8/2/2019 Sect Translation

    15/21

    WobbleThere are 61 sense codons.However, organisms may not have 61 different tRNAs.

    1st (5) base in anticodon can sometimes pair with 2 or 3 bases:

    pairs with 3rd (3) base in codon5 anticodon base E. coli S. cerevisiae

    A U -C G GU A or G AG C or U C or U

    Inosine A, C, or U C or U

    Dont need to memorize these; just know basic principle.

  • 8/2/2019 Sect Translation

    16/21

    Translation in More Detail than You Wanted or Need to Know

    (see text Figure 10.17 for a better diagram)

    $$

    ribosomesmallsubunit

  • 8/2/2019 Sect Translation

    17/21

    Ribosome Binding, Translation Initiation, andTermination Signals on mRNAs

    Prokaryotes: a special sequence (the Shine-Delgarno sequence) isthe ribosome binding site.

    Eukaryotes: the 5 end of the mRNA is modified to form the 5 capthat initiates ribosome binding.

    Prokaryotes and eukaryotes: the AUG start codon is the signal toinitiate translation; the nonsense stop codon binds no tRNA and thisstops translation.

  • 8/2/2019 Sect Translation

    18/21

    5 UTR 3 UTR

  • 8/2/2019 Sect Translation

    19/21

    Unique Features of Translation in ProkaryotesOne mRNA can encode more than one polypeptide.

    2

  • 8/2/2019 Sect Translation

    20/21

  • 8/2/2019 Sect Translation

    21/21

    Where the Machinery Comes FromThe machinery for DNA replication and repair, transcription,and translation includes various enzymes and other proteins,as well as rRNAs and tRNAs.

    Each of these is encoded by genes, which in turn aretranscribed to make RNAs and these are processed in various

    ways.

    The enzymes and proteins are themselves translated frommRNAs using the machinery of which they are components.

    Like all genes, they are subject to mutations that can changethe rate or manner in which they act.

    Like all genes, they are the product of evolution.