sequence of the small subunit of yeast carbamyl phosphate

0 1984 by The THE JOURNAL

American Society of Biological OF BIOLOGICAL CHEMISTRY

Chemists, Inc. Vol. 259, No. 15, Iasue of August 10, pp. 9790-9798 1984

Printed in ~ . s . A .

Sequence of the Small Subunit of Yeast Carbamyl Phosphate Synthetase and Identification of Its Catalytic Domain*

(Received for publication, November 22,1983)

Hiroshi NyunoyaS and C. J. Lusty From the Molecular Genetics Laboratory, The Public Health Research Institute of The City of New York, Inc., New York, New York 10016

The yeast gene CPAl coding for the small subunit of arginine-specific carbamyl phosphate synthetase has been cloned by complementation of a cpal mutant with a plasmid library of total yeast chromosomal DNA. Two of the plasmids, pJL113/ST4 and pJL113/ST15, contain DNA inserts in opposite orientations with overlapping sequences of 2.6 kilobases. The nucleotide sequence of a 2.2-kilobase region of the DNA insert carrying the CPAl gene has been determined. The CPAI gene has been identified to be 1233 nucleotides long and to code for a polypeptide of 41 1 amino acids with a calculated molecular weight of 45,358. The amino acid sequence encoded in CPAI is homologous to the recently determined sequence of the small subunit of Escherichia coli carbamyl phosphate synthetase (Piette, J., Nyunoya, H., Lusty, C. J., Cunin, R., Wey- ens, G., Crabeel, M., Charlier, D., Glansdorff, N., and Pierard, A. (1984) Proc. Natl. Acad. Sci. U. S. A. 81, 4134-4138) over the entire length of the polypeptide chain. Comparison of the amino acid sequences of the small subunits of yeast and E. coli carbamyl phosphate synthetases to the sequences of Component 11 of anthranilate and p-aminobenzoate synthases suggests that these amidotransferases are evolutionarily related. The most highly conserved region of the yeast and E. coli enzymes includes a cysteine residue previously found to be at the active site of Pseudomonas putida anthranilate synthase Component I1 (Kawa- mura, M., Keim, P. S. , Goto, Y., Z a l k h , H., and Hein- rikson, R. L. (1978) J. Biol. Chem. 253,4669-4668). Based on the observed homologies in the primary sequences of the other amidotransferases examined, we propose a 13-amino acid long sequence to be part of the catalytic domain of this class of enzymes.

Carbamyl phosphate is an essential precursor of both arginine and pyrimidine biosynthesis. In most bacteria capable of arginine and pyrimidine biosynthesis, carbamyl phosphate is synthesized from glutamine, HCO;, and 2 molecules of ATP by a single enzyme, glutamine-dependent carbamyl phosphate synthetase (1, 2). The enzyme is an oligomeric protein composed of two nonidentical subunits, a small subunit (-42 kDA) which functions in the transfer of glutamine amide nitrogen to a large subunit (-130 kDa) that catalyzes carbamyl phosphate formation from NH3, HCOT, and ATP (3).

*These studies were supported by Grant GM 25846 from the National Institutes of Health. The costa of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked ‘‘advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

$ On leave from the Department of Biology, Okayama University, Okayama, Japan.

Two different enzymes, a pyrimidine-specific and an arginine-specific carbamyl phosphate synthetase, are present in yeast (4) and other fungi (5). The two enzymes are located in different subcellular compartments (6-8) and are separately regulated (2, 4, 9). The arginine-specific carbamyl phosphate synthetase catalyzes the same overall reaction and has the same subunit structure as the prokaryotic enzyme. A small subunit (-36 kDa) transfers glutamine amide nitrogen to a large subunit with the catalytic sites for carbamyl phosphate synthesis (10). In Saccharomyces cereuisiae, the small and large subunits are encoded by two unlinked genes, CPAl and CPA2, respectively (4). The CPA2 gene has been cloned (11) and its nucleotide sequence determined (12). The adjacent genes carA and carB coding for the small and large subunits of carbamyl phosphate synthetase of Escherichia coli have also been cloned (13, 14). The amino acid sequence of the large subunit derived from the nucleotide sequence of carB (15) has been shown to be highly homologous to the amino acid sequence of the yeast large subunit of arginine-specific carbamyl phosphate synthetase. The primary sequence homologies of the two proteins indicates the bacterial and fungal arginine-specific carbamyl phosphate synthetases are evolutionarily related and are derived from a common ancestral gene (12).

In the present communication, we present the complete nucleotide sequence of the yeast CPAl gene, coding for the small subunit of arginine-specific carbamyl phosphate synthetase. Comparison of the derived amino acid sequence of the yeast small subunit with the recently determined amino acid sequence of the small subunit of E. coli carbamyl phosphate synthetase (16) shows that these two proteins are also homologous. The small subunits of yeast and E. coli carbamyl phosphate synthetase have significant primary sequence homologies to other amidotransferases, including p-aminobenzoate synthase Component I1 of E. coli (17) and anthranilate synthase Component I1 of enteric bacteria (18), Pseudomonas putida (19), and Neurospora crassa (20). Our analysis of the primary sequences together with published data on affinity labeling of the active site of anthranilate synthases of Serratia marcescens (21) and P. putida (19) has allowed us to identify a catalytic domain common to these enzymes.

MATERIALS AND METHODS

Yeast and Bacterial Strains-The yeast strain S. cerevisiae JL113 (a ku2-3 leu2-112 urd-2 cpal-3) was constructed by crossing S. cereuisine 6028b (a ura2-2 cpal-3) (22) to S. cerevisiue LLl (a ku2-3 ku2-112). E. coli strain RR1 (pro- leu- thi- lacy- hsdR- e&- rpsL20 aru-14 galK2 nyl-5 mtl-1 supE44) was used for amplification of recombinant plasmids. RR1 clones carrying recombinant plasmids were grown in LB broth supplemented with 0.1% glucose and 20 pg/ ml of ampicillin.

DNA Preparations-Plasmid DNA from yeast and E. coli was prepared as previously described (11). For sequence analysis, plasmid

9790

by guest on February 14, 2018http://w

ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

The CPAl Gene of Saccharomyces cerevisiae 9791

DNA was isolated from E. coli RR1 by the cleared lysate method (23) and purified by chromatography on Sepharose 6B.

Cloning of Yeast CPAI-Yeast CPAl was isolated by a previously described protocol (11) from a recombinant plasmid pool of total yeast nuclear DNA ligated to the BarnHI site of the hybrid vector YEpl3 (24). The CPAl gene was selected by transformation of yeast strain JL113 carrying a mutation in the structural gene of the small subunit of arginine-specific carbamyl phosphate synthetase, a mutation in UR42 coding for pyrimidine-specific carbamyl phosphate synthetase, and a double mutation in LEM. JL113 was transformed with 10 pg of the recombinant plasmid pool, and 28 independent clones (Leu+ Cps') were obtained by selection for growth on minimal medium (2% glucose, 0.67% yeast nitrogen base without amino acids (Difco)/l.2 M sorbitol, 3% agar). Plasmid DNA from each of eight different transformants (JL113/Tl-JL113/T8) was used to transform E. coli RR1 to ampicillin-resistance, tetracycline-sensitivity. The transforming plasmids were found by restriction analysis with EcoRI, Sun, and EcoRI plus Sun to contain identical yeast nuclear DNA inserts of 5.7 kb.'

Since the size of the 5.7-kb insert was much larger than the anticipated length of the CPAl gene (-1.5 kb), one of the plasmids, pJL113/Tl, was used to subclone the CPAl gene. Plasmid DNA from pJL113/T1 was partially digested (average size of 2-3 kb) with Sau3A and ligated to the BarnHI site of the YEpl3 vector. Transformation of S. cereuisiue JL113 with the new plasmid pool yielded a large number of Leu+ Cps+ transformants. A screen of 20 independent yeast clones complemented in the cpal mutation by the pool yielded two plasmids with yeast nuclear DNA inserts of 2.6 and 3.1 kb; the other plasmids carried larger inserts. Both plasmids were presumed to have the CPAI gene in view of their ability to complement S. cereuisiue JL113. The growth properties of the transformants (growth on minimal medium, and growth on minimal medium plus uracil (11)) indicated that the cloned genes complemented the cpal rather than the u r d mutation.

DNA Sequence Analysis-The plasmids pJL113/ST4 and pJL113/ ST15 were shown by restriction analysis to have yeast DNA inserts in opposite orientations with overlapping sequences of 2.6 kb. DNA fragments from both plasmids were used to determine the nucleotide sequence of a 2.2-kb region in which the CPAl gene is located. Plasmid DNA digested with Hind11 plus SphI produced two fragments of 10.2 (vector) and 3.6 kb in the case of pJL113/ST4 or 3.2 kb with pJL113/ST15 (cf. Fig. 1). The smaller fragments containing the yeast DNA inserts were separated on preparative agarose gels and isolated. The purified fragments were further digested with EcoRI, DdeI, or BstEII plus MnoI. The isolated fragments were either 5'-end labeled with [Y-~'P]ATP (5000 Ci/mmol, Amersham) and polynucleotide kinase (25) or were labeled after secondary cleavage with appropriate restriction endonucleases. Single strands were obtained by electrophoresis on polyacrylamide gels (25). The nucleotide sequence of the isolated single strands was determined by the method of Maxam and Gilbert (25).

SI Nuclease Mapping and Sizing of Yeast Transcripts-The wild type S. cereuisiue strains D273-10B/Al (a met-6) and LL2 (CY ku2-3 ku2-122) were grown to midlogarithmic phase in 1% yeast extract, 2% peptone, 2% glucose and in minimal medium (2% glucose, 0.67% yeast nitrogen base without amino acids (Difco)) supplemented with 50 rg/ml of methionine or leucine. The transformant strain JL113/ ST15 was grown in minimal medium. Total yeast RNA was obtained from spheroplasts as previously described (12). The poly(A)-containing fraction was isolated by chromatography on poly(Uj-Sepharose 4B (26). SI nuclease mapping of the 5' ends of the yeast transcripts was performed as described previously (12). A 5'-end labeled single- stranded fragment of DNA extending beyond the expected transcriptional start site of the CPAl gene (MnoI-BstEII fragment, nucleotides -510 to +I27 (cf. Fig. 1)) was hybridized with 20-100 pg of total yeast RNA or with 1-10 r g of poly(A)-containing RNA. In other experiments, the DNA probes were Hinfl fragments (nucleotides -290 to -180) and (nucleotides -179 to +134). RNA-DNA hybridization was carried out in a volume of 30 pl of 40% formamide containing 40 mM Pipes, pH 6.4, 0.4 M NaCI, and 1 mM EDTA for 3 h at 37 or 45 "C. The annealed samples were diluted 1:10 into SI nuclease buffer (27) and digested with different amounts of St (50-2500 units/ml in the case of total RNA, 20-2500 units/ml with poly(A)-containing RNA) for 30 min at 37 "C. As a control, the probe was also digested with SI

The abbreviations used are: kb, kilobase pairs; Pipes, l,4-pipera- zinediethanesulfonic acid.

nuclease both in the absence of RNA, and in the presence of 20 pg of total yeast RNA without prior hybridization. After ethanol precipi- tation, the RNA-DNA hybrids were denatured in formamide and the DNA was separated on a sequencing gel adjacent to the chemically derivatized DNA probe. S1 nuclease mapping of the 3' termini of yeast transcripts was performed by using the same protocol. The probe, 3'-end labeled with [c~-~~P]dideoxy-ATP (5000 Ci/mmol, Amersham) and terminal deoxynucleotidyl transferase, was a single- stranded Ban-SphI fragment (588 nucleotides) extending from nucleotide +E14 to the SphI site of the vector (cf. Fig. l).

The size of RNA transcripts was estimated by Northern analysis. Total RNA (2-20 pg) and poly(A)-containing RNA (0.2-2 pg) were denatured in 2.2 M formaldehyde and separated on 1.3% agarose gels containing 2.2 M formaldehyde (28). E. coli 16 and 23 S and yeast 18 and 26 S rRNAs were used as calibrating standards. After electrophoresis, RNA was transferred to nitrocellulose filters and hybridized as described by Thomas (29) with a radiolabeled probe prepared by nick-translation (30) of a 1088-nucleotide long BstEII-Ban fragment containing almost all the coding sequence of the CPAl gene.

RESULTS

Nucleotide Sequence of CPAl-The yeast gene CPAl coding for the small subunit of arginine-specific carbamyl phosphate synthetase (4) was isolated as described under "Materials and Methods." The two recombinant plasmids pJL113/ST4 and pJL113/ST15 with the CPAl gene have 3.1- and 2.6-kb yeast DNA inserts, respectively, in the YEpl3 shuttle vector (24) (Fig. 1). The presence of the CPAl gene in the recombinant clones was confirmed by in uiuo complementation of yeast strains with mutations in the structural genes of the small subunit of arginine-specific carbamyl phosphate synthetase and in the pyrimidine-specific carbamyl phosphate synthetase. The fact that uracil did not inhibit growth of the transformants indicated complementation of the cpul rather than the uru2 mutation (11).

The nucleotide sequence of the CPAl gene was derived

d I

SphI pJL113/ST4 fi

p J L I I J / S T I J 3

H l n d m

nindm spnx

Sphl

EeoRI

AccI - c

"

BstEII 7

I 500 1000 I500

NUCLEOTIDES

FIG. 1. Restriction map of the DNA inserts carrying the CPAl gene in the recombinant plasmids, pJL113/ST4 and pJL113/ST16. Yeast chromosomal DNA, approximately 3.1 and 2.6 kb long, respectively, is indicated by the thin l ine ; the YEpl3 vector is shown as the dark bar. The sequencing strategy is illustrated in the lower part of the figure. The arrows above the restriction sites indicate the direction and the lengths of the sequences obtained. The coding region of the CPAl gene is indicated by the open bar above the restriction map. The arrow at the top of the figure indicates the direction of transcription.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

9792 The CPAl Gene of Saccharomyces cerevisiae

from a 2.2-kb region of the yeast DNA inserts of both pJL113/ ST4 and pJL113/ST15. Almost the entire sequence of both strands was obtained by using the restriction sites shown in Fig. 1 for 5‘-end labeling. The nucleotide sequence across each of the labeled sites was confirmed with a second set of overlapping fragments. The sequence presented in Fig. 2 represents approximately 85% of the cloned fragment. It has a continuous reading frame of 1233 nucleotides. The other five frames of the sequence are interrupted by frequent termination codons, suggesting that the open reading frame codes for the small subunit of yeast carbamyl phosphate synthetase. The CPAl gene starts with an ATG initiation codon at nucleotide +1 and ends with the termination codon TAA at nucleotide +1234. The open reading frame shown in Fig. 2 codes for a protein of 411 amino acid residues with a calculated molecular weight of 45,358. This value is larger than the size (-36 kDa) of the yeast small subunit estimated by gel filtra- tion (lo), but is consistent with the size of the small subunit of E. coli carbamyl phosphate synthetase (3). As discussed later, the identification of the coding sequence is strongly supported by the homology of the encoded amino acid sequence with the E. coli small subunit (16). The assignment of the ATG codon at +1 as the translational start site of the CPAl gene is consistent with the results of Northern analysis and S1 mapping of the 5’ termini of yeast transcripts discussed below.

SI Mapping of CPAl Transcripts-The 5’ termini of the CPAl transcripts were studied in the wild type strains D273- 10B/A1 and LL2 grown under repressed and derepressed conditions. Messenguy et al. (31) have reported a substantive increase in the level of CPAl message when yeast are grown in the absence of amino acids (derepressed) compared to rich medium (repressed) where the general control of amino acid biosynthesis operates. SI analyses of CPAl transcripts were also extended to the transformant JL113/ST15 grown in minimal medium. The initial experiments using a MnoI- BstEII probe (nucleotides -510 to +127) showed that the major transcripts had 5’ starts between -244 and -231 (Fig. 3A). Fig. 3A also shows less prominent 5‘ starts downstream of -231. The significance of the minor transcripts is not clear. They do not appear to be artifacts, since they are more abundant under derepressed conditions and in the transformant strain harboring the gene on a multicopied plasmid (data not shown). The major transcripts starting at -244 and their relative abundance was gauged more accurately by using a HinfI probe extending from nucleotides -290 to -180 as shown in Fig. 3B. RNA from both wild type and transformant strains grown in minimal medium exhibited strongest 5’ termini at -244, -243, -241, -236, and -231. Lower abundance transcripts were also observed with 5’ starts at inter- mediate positions. That all of these starts are real is supported by the following observations: 1) probes incubated with SI in the absence of RNA were completely degraded; 2) increased concentrations of S , to as much as 2500 units/ml did not change the basic S1 pattern; and 3) identical 5’ starts were observed under repressed conditions (Lane 8), although their relative abundance was much lower. This was true of the transformant ( L a n e 9) and of wild type yeast (compare Lanes 7 and 8). It is of interest that in the wild type strain LL2, a prominent 5’ end was seen at -123. The absence of this transcript in the transformant and in the other wild type strain studied suggests some strain-specific heterogeneity in the DNA sequence.

Although the 5’ leader of the CPAI message has an ATG codon, the reading frame initiated by this codon is very short. Several features in the 5’ leader sequence support the idea

that the CPAl gene starts at the ATG codon (+I) that initiates the 1233-nucleotide long reading frame. Upstream of the initiation codon are found transcription- and translation- related sequences common to other known yeast genes (33). Nucleotides -1 to -25 of the initiation codon are adenine- rich (33, 34) and contain a sequence CACAAA similar to the CACACA sequence noted in other yeast genes (33). Though located 143 nucleotides upstream of the major transcriptional start, a sequence TATATAA at -387 resembles the Goldberg- Hogness box. Another TATAT sequence is observed at -133.

SI nuclease mapping of the 3’ termini showed protected ends spaced within 21 nucleotides (+1291 to +1312). These results indicate CPAl transcripts to have a 3‘ untranslated sequence of 58-79 nucleotides. Assuming 50 residues of poly(A) (35), and a 5’ leader sequence of 231-244 nucleotides, the length of the major CPAl message is 1.6 kilobases. This value is in good agreement with the results of Northern blot analyses that show RNA transcripts of 1.2-1.6 kilobases in size (Fig. 4).

Codon Usage in CPAI-Codon utilization in CPAl is sum- marized in Table I. Only four of the possible 61 codons are absent in the sequence; CGA and CGG (Arg), GCG (Ala), and AGC (Ser). AGA is preferred for arginine, GGU for glycine, and the UUA and UUG codons for leucine. Based on the method of Ikemura (40), the frequency of optimal codon usage in the CPAl gene was calculated to be 0.63. This value is similar to the values calculated for CPAQ (12), TRPS (41), and CYC1 (40) and is typical of moderately expressed genes in yeast.

Amino Acid Sequence Derived from Nucleotide Sequence- Yeast carbamyl phosphate synthetase is extremely labile and has not been purified (10); therefore, no protein sequence data are available. That the 1233-nucleotide long reading frame codes for the small subunit of yeast arginine-specific carbamyl phosphate synthetase is substantiated by the extensive homology of the derived amino acid sequence to the amino acid sequence of the small subunit of E. coli carbamyl phosphate synthetase (16). The amino acid sequences of the two proteins are shown in Fig. 5. The two sequences exhibit an overall homology of 65.3% over the entire length of the polypeptide chain, with an average of only two deletions or insertions/100 amino acid residues. Of 357 possible matches, 148 (41.6%) amino acid residues are identical and 85 (23.8%) represent conservative replacements. Of particular significance is the homology at the NH2-terminal end, showing the amino acid sequence is strongly conserved up to the NH2 terminus of the E. coli protein. The extensive amino acid sequence homology shows the small subunits of yeast and E. coli to be as homologous as the large subunits of this enzyme (12).

Catalytic Domain of Small Subunit of Carbamyl Phosphate Synthetase and Other Amidotransferases-The small subunits of E. coli (42,43) and yeast (10) carbamyl phosphate synthetase have been shown to function in glutamine amide transfer. The glutamine amidotransferases, which also include anthranilate synthase (44), formylglycinamide ribonucleotide amidotransferase (&), p-aminobenzoate synthase (46, 47), and glutamine phosphoribosylpyrophosphate amidotransferase (48), catalyze the hydrolysis of glutamine and transfer of NH, to a distant ammonia site located either on a nonidentical subunit or in a different catalytic domain of the same polypeptide chain. The small subunit of E. coli carbamyl phosphate synthetase has been shown to have a reactive cysteine residue at the glutamine catalytic site (49). An active site cysteine has also been identified by affinity labeling studies of anthranilate synthase Component I1 (19,21).

In an attempt to identify the active site responsible for


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


- 5 0 0 A 6 0

AGTGCAGGCTTTACCGAGGGCGCCGGCTGGCGCTTCCCGTGGAAGGGTGTTTGACTCATCATCGCATC~CATTACCTCATGATGAGTAAATAGTTGCGATTTCACTT

ATCACCTCTCGCGGAAAAAAAAGGCGAT~ACATGA.TATATAW;GCTCTCTCGTAAGACACTTAACTATCCAACGTTCATTAGATTATTCGGTCAATTTCTTTTTTCA -400 - 3 5 0

TGCCCCTCCTTTTTCTTTTCTTTTCTTGACTCGTCGTTTCTTTTTCTTTTTTTTTTTTTTTTTTTTCTTCAGAACTATAACACATAGATACACTCGAACATCTAATT -3 0 0 - 2 5 0 f+ f + f

GTTTAAATACTGCAAAGAATACAAGGTAATCGACTCTTCTACATACCCTTTTTGCAGATTTG~~AAAAAAAACATTATATGTTTAGCTTATCGAACTCTCAATAC 2.00

-100 ACCTGCCAAGACTACATATCTGACCACATCTGGAAAACTAGCTCCCACTAATTTCATTGCTTAATAATCAGAAATTCTATCP_CCACTCCTAAAAATATTTCAA

- 5 0 - 1

+l

ATG TCC TCC GCT GCA ACA AAA GCT ACT TTC TGT ATT CAA AAT GGT CCT TCC TTT GAA GGT ATA TCT TTT GGT GCA AAC AAA Met ser ser a l a a l a thr l y s a l a thr p h e c y s i l e g ln a s n g l y p r o ser p h e g l u g l y i l e ser p h e g l y a l a a s n l y s

I 0 0 ser V a l a l a g l y g l u thr Va l phe t h r thr ser l e u val g l y t y r p r o g l u ser met thr a s p p r o ser t y r a r g gl y g l n TCT GTT GCT GGT GAA ACA GTT TTC ACT ACT TCT CTG GTT GGT TAC CCA GAG TCC ATG ACT GAT CCT TCC TAC CGT GGT CAG

i l e l eu Va l phe thr g l n pro l e u i l e g l y a s n t y r g l y V a l p r o ser g l y g l u a l a a r g a s p g l u t y r a s n l e u l e u l y s ATA TTA GTC TTC ACG CAA CCC TTG ATT GGT AAC TAC GST GTC CCA TCC GGC GAA GCC CGC GAT GAA TAC AAT TTA CTG AAG

t y r p h e g l u ser p r o h i s i l e his Va l Va l g l y i l e v a l V a l a l a g l u t y r a l a t y r g l n t y r ser his t r p thr a l a v a l TAT TTT GAA TCT CCG CAT ATA CAT GTG GTC GGC ATC GTT GTC GCT GAA TAT K T TAT CAA TAT TCG CAT TGG ACC GCT GTT

g l u ser l e u a l a g l n t r p c y s g l n a r y g1u g l y V a l a l a a l a i l e thr g l y V a l a s p thr a r g g l u l e u V a l gln t y r l e u GAA TCT CTG GCA CAA TGG TGT CAG AGA GAA GGT GTT GCT GCT ATT ACT GGC GTA GAC ACC CGT GAA CTA GTG CAA TAC TTG

a r q g l u g l n gly ser ser l e u g l y a r g i l e thr l e u a l a a s p h i s a s p p r o V a l p r o t y r V a l asn p r o m e t l y s t h r a s n AGG GAA CAA GGT TCT TCT TTG GGC CGT ATT ACG TTG GCT GAT CAT GAC CCT GTC CCC TAC GTG AAT CCC ATG AAA ACT AAC

l e u V a l a l a 9111 V a l t h r thr l y s l y s pro phe his Val ser a l a l e u p r o g l y l y s a l a l y s a l a a s n V a l a l a l e u i l e TTG GTT GCT CAA GTC ACC ACA AAA AAG CCT TTC CAC GTC TCT GCC TTA CCT GGG AAG GCT AAG GCA AAT GTG GCT CTT ATT

a s p c y s g l y V a l l y s g l u a s n i l e i l e a r g c y s l e u V a l l y s a r g g l y a l a a s n V a l thr V a l p h e p r o t y r a s p t y r a r g GAC TGT GGT GTT AAA GAA AAC ATT ATC AGA TGC CTA GTC AAA AGA GGT GCC AAT GTA ACT GTT TTC CCC TAT GAT TAC AGA

i l e g l n a s p V a l a l a ser g l u p h e a s p g l y i l e p h e l e u ser a s n g l y p r o g l y a s n p r o g l u l e u c y s g l n a l a t h r i l e ATT CAA GAT GTT GCT TCT GAA TTC GAC GGT ATT TTC TTA TCC AAT GGA CCA GGC AAC CCA GAA CTA TGC CAA GCT ACA ATT

2 0 0

3 0 0

4 0 0

5 0 0

6 0 0

7 0 0

8 0 0

ser a s n V a l a r g g l u l e u l e u a s n asn p r o V a l t y r a s p c y s i l e pro i l e p h e g l y i l e c y s l e u g l y his g l n l e u l e u TCC AAC GTC AGG GAA TTA CTA AAT AAC CCT GTT TAT GAC TGT ATC CCT ATT TTT GGG ATT TGT CTA GGC CFT CAA CTC TTG

a l a l e u a l a ser g l y a l a ser thr his l y s l e u l y s t y r g l y a s n a r g a l a his asn i l e p r o a l a m e t a s p l e u thr thr GCT CTG GCC TCC GGT GCC TCT ACT CAC AAA TTG AAA TAT GGT AAT AGG GCT CAC AAC ATC CCT GCC ATG GAT TTG ACT ACC

g l y g l n c y s his i l e thr ser g l n asn his g l y t y r a l a V a l a s p p r o g l u thr l e u p r o l y s a s p g ln t r p l y s p r o t y r GGC CAG TGC CAC ATT ACA TCT CAA AAT CAT GGC TAT GCA GTT GAT CCT GAG ACC CTA CCA AAG GAC CAA TGG AAA CCT TAT

p h e V a l a s n l e u a s n a s p l y s ser a s n g l u g l y m e t i l e his l e u gln a r g p r o i l e phe ser thr g ln phe his p r o g l u TTT GTT AAT TTA AAC GAC AAA TCA AAC GAA GGC ATG ATA CAC CTT CAA AGA CCC ATA TTT TCT ACC CAA TTT CAC CCA GAG

9 0 0

l o o 0

a l a l y s g l y g l y p r o l e u a s p thr a l a i l e l e u p h e a s p l y s p h e p h e a s p a s n i l e g l u l y s t y r g l n l e u g l n ser g l n GCA AAA GGT GGT CCC TTA GAC ACA GCT ATT CTT TTT GAC AAA TTC TTC GAT AAT ATA GAA AAA TAC CAA TTA CAA TCT CAG

I 1 0 0

a l a l y s ser ser i l e ser l e u lys Val thr t y r ser t h r a s p l y s ser a r g l e u g l n ser i l e asn Val thr l y s l e u a l a GCA AAA AGT TCA ATC TCA CTA AAA GTA ACA TAC AGT ACC GAT AAA TCG AGA TTG CAG AGT ATA AAT GTT ACT AAG TTG GCC

l y s g l u a r g V a l l e u p h e *** AAG GAA AGA GTG TTG TTC TAA AAACAAAATTTATACATTACGTAACACATACGTACATCTAAATACGATTCAATTCAGTTCATG~TATTTTGC~CTACTC

1 2 0 0

1 3 0 0

.p 1.1. I.+ GTCGTTGCTTAGTATCTACTCGCAGTTGTCATAATTAACGGGCGCTTCTTGTAATTAAATGAACAAAAAAACGTAACGTACGT~~~~TGGCTCTAATTTCATCCTGC

CATCCTAAAAAAAAAATCAAATAAAGCAGACTCAAAAATTTTCAGCTTCAGTTAAATTTTGATAAGTATATTTGCATAACTCAAGGAGTTTGTGCAAACGGTTTTCT 1 5 0 0

TTCTTTGTGGTTTGTTTTATTTACTTTCCAATAATACCCGTCTTGTTGGTTTAAGTCGTAACAAAAGGA~CTTACAATCAGATC 1600

FIG. 2. Nucleotide sequence of the CPAl gene. The sequence is that of the nontranscribed strand. CPAl begins at nucleotide +1 and ends at nucleotide +1233. The amino acid sequence is shown above the DNA sequence. Pyrimidine-rich blocks are underlined, and the sequence CACAAA is shown by the dashed underline. 1 denote the major transcriptional start sites mapped with SI nuclease. Downstream of the termination codon, t indicate the mapped 3’ termini of CPAl transcripts.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

9794

A .

-244

The CPAl Gene of Saccharomyces cerevisiae

B. ao

I2 k&io “I

Q V

I 2 3 4 5 6 7 0 & ; u 8 9

-300 0 - -250 -200

- I 5 0

- I 00 2 4 4 -

- 50 -231 -

# &-- 9 - - . . . ,

”

- 244

- 2 3 I

FIG. 3. Mapping of the 5’ termini of CPAZ transcripts. SI nuclease mapping of the 5‘ ends of CPAl transcripts was performed as described under “Materials and Methods.” A , poly(A)-enriched RNA (1 pg) from wild type D273-10B/Al grown in minimal medium plus methionine was hybridized with a 5’-end labeled single-stranded MnoI-BstEII fragment (nucleotides -510 to +127) in 30 pl of 40% formamide, 40 mM Pipes, pH 6.4, 0.4 M NaCI, 1 mM EDTA for 3 h (Lane 2 ) and 15 h (Lane 3 ) at 45 “C. The annealed samples were treated with SI nuclease at a concentration of 500 units/ml. In Lune 1, the probe was treated with 500 units/ml of SI nuclease in the absence of RNA. The chemically derivatized probe shown in the last four lanes was used as the sizing ladder. The nucleotides in the ladder have been numbered as shown in the sequence presented in Fig. 2. B, resolution of the 5’ termini by SI nuclease mapping with a 5’-end labeled, single-stranded Hznff fragment (-290 to -180). RNA-DNA hybridization was carried out in a total volume of 30 pl of 40% formamide, 40 mM Pipes, pH 6.4,0.4 M NaCl, 1 mM EDTA for 3 h a t 37 “C. The RNA-DNA hybrids were treated with the indicated amounts of SI nuclease. Lane 1, probe alone, 1/20 the amount used in Lunes 2-9. Lanes 2, 4, and 6, probe treated, respectively, with 20, 100, and 500 units/ml of SI nuclease in the absence of RNA; lanes 3 , 5 , and 7,5 pg of poly(A) RNA from D273-10B/Al grown in minimal medium plus methionine hybridized to the Hinff probe and treated with 20, 100, and 500 units/ml of SI nuclease, respectively. Lane 8,7.5 pg of poly(A) RNA from D273-10B/A1 grown in rich medium hybridized with the probe and treated with 500 units/ml of SI. Lane 9, 10 pg of t o t a l RNA from transformant JL113/ST15 grown in minimal medium was hybridized to the probe and treated with 500 units/ml of SI nuclease. The chemically derivatized probe was used as the sizing ladder. The numbers of the corresponding nucleotides in the DNA sequence are shown for the major starts. One and one-half nucleotides have been subtracted from the sequence positions to correct for the displacement of the 3’ terminus in the sequencing ladder (32).

glutamine amide transfer, we have searched for primary sequence homologies in the cysteine-containing regions of the yeast and E. coli enzymes and anthranilate synthase Compo- nent I1 from various organisms. A comparison of the yeast and bacterial small subunits with the different anthranilate synthases Component I1 revealed a highly conserved region composed of 13 amino acids. This region includes the previously identified active site cysteine residue of anthranilate synthase Component I1 of S. mrcescem (21) and of P. putida (19). As shown in Table 11, eight of the 13 amino acids in this region of the E. coli carbamyl phosphate synthetase and anthranilate synthase Component I1 are identical. Of the remaining five residues, all are conservative substitutions. This highly conserved sequence which we propose to be the active site of yeast and bacterial carbamyl phosphate synthetase is located around Cys-264 of the yeast enzyme and Cys- 269 of the E. coli enzyme. The corresponding cysteine in the E. coli anthranilate synthase Component I1 is Cys-83.

Active site cysteines have also been identified in studies of formylglycinamide ribonucleotide amidotransferase of Sal-

monella typhimurium (50) and chicken liver (51). Although the labeled peptides that were isolated are only five and seven residues long (Table 11), the L-G-V-C sequences are identical to part of the amino acid sequences of anthranilate synthase Component I1 and carbamyl phosphate synthetase. Also shown in Table I1 is the amino acid sequence of the glutamine active site of phosphoribosylpyrophosphate amidotransferase (52, 53). The active site of the bacterial phosphoribosylpyrophosphate amidotransferases appears to be different from that of the other amidotransferases. For example, the active cysteine is the NH2-terminal residue of both proteins (52,53). Furthermore, the sequences distal to the cysteine are quite different from those of the other enzymes. I t may be significant, however, that there is a short sequence I-V-G-I (E. coli) and V-F-G-I (Bacillus subtilis) that do find their counterparts in the active sites of the other amidotransferases.

Evolutionary Relationship of the Small Subunit of Carbamyl Phosphate Synthetase to Anthranilate Synthase Component II and p-Amirwbenzoate Synthase Component II-The finding of a common sequence at the proposed glutamine active sites

*


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

The CPAI Gene of Saccharomyces cerevisiae 9795

1 2 3 4 5 k b

3.39 " 2.90 -

I .79 - I .54 - - 1.6 kb

- 1.2

FIG. 4. Northern analysis of CPAZ transcripts. Total RNA and poly(A) RNA were prepared from wild type D273-10B/Al and from the transformant JL113/ST15 grown on minimal medium. The RNA was denatured in 2.2 M formaldehyde and separated on a 1.3% agarose gel containing 2.2 M formaldehyde (28). After transfer to nitrocellulose, the RNA was hybridized with a radiolabeled, nick- translated probe (1088-nucleotide long BstEII-Ban fragment) con- tained within the coding sequence of the CPAl gene. Lane 2,lO pg of total RNA from wild type D273-10B/Al; Lane 2, 0.2 pg of poly(A) RNA from D273-10B/Al; Lane 3, 1 pg of poly(A) RNA from D273- 10B/A1; Lane 4, 0.2 pg of poly(A) RNA from transformant JL113/ ST15; Lane 5, 1 pg of poly(A) RNA from JL113/ST15. A mixture of E. coli 16 and 23 S and yeast 18 and 26 S rRNAs was used to calibrate the gel; 16 S, 1541 (36); 23 S , 2904 (37); 18 S, 1789 (38), and 26 S, 3393 (39) nucleotides.

TABLE I Frequency of codons in the CPAl gene

The initiation codon is included in the tabulation. UUU Phe 8 UCU Ser 13 UAU Tyr 9 UGU Cys 5 UUC Phe 10 UCC Ser 9 UAC Tyr 9 UGC Cys 3 UUA Leu 8 UCA Ser 3 UAA Term" 1 UGA Term 0 UUG Leu11 UCG Ser 2 UAG Term 0 UGG Trp 3

CUU Leu 3 CCU Pro 10 CAU His 6 CGU Arg 3 CUC Leu 1 CCC Pro 6 CAC His 6 CGC Arg 1 CUA Leu 7 CCA Pro 6 CAA Gln 16 CGAArg 0 CUG Leu 4 CCG Pro 1 CAG Gln 5 CGGArg 0

AUU lle 13 ACU Thr 10 AAU Asn 12 AGU Ser 3 AUC Ile 5 ACC Thr 7 AAC Asn 10 AGC Ser 0 AUA Ile 7 ACA Thr 7 AAA Lys 16 AGA Arg 7 AUG Met 5 ACG Thr 2 AAG Lys 7 AGG Arg 3

GUU Val 14 GCU Ala 17 GAU Asp 9 GGU Gly 17 GUC Val 9 GCC Ala 7 GAC Asp 9 GGC Gly 9 GUA Val 3 GCA Ala 7 GAA Glu 17 GGA Gly 1 GUG Val 5 GCG Ala 0 GAG Glu 3 GGG Gly 2

Term. termination codon.

of carbamyl phosphate synthetase and other amidotransferases suggested that these proteins might be related. Kaplan and Nichols (17) have recently shown that the amidotransferases encoded by the trp(C)D gene and the small subunit of p-aminobenzoate synthase Component I1 encoded by pabA appear to have evolved by gene duplication. Furthermore, there have been speculations that amidotransfereases in general may have evolved from a common glutamine-utilizing enzyme (42,44,54).

Dot matrix analysis (55) of the amino acid sequences of the small subunit of E. coli carbamyl phosphate synthetase and of the amidotransferase segment (residues 1-192) of E. coli anthranilate synthase Component I1 (18) showed unmistak-

L * ""#.t -w " ~ V ) S o 1 X B S I I L T Y I I S m ~ s ~ ~ ~ s , ~ ~ U ~ ~ ~ " ~ ~ -

I -:_ -P\ "IXTAK"

FIG. 5. Primary sequence homology between yeast and E. coli carbamyl phosphate synthetase and E. coli anthranilate synthase Component I1 and p-aminobenzoate synthase Com- ponent 11. Only the sequence of the trp(G)-encoded part (residues 1-192) of anthranilate synthase Component I1 is shown in the figure. The sequences have been aligned for maximal homology. Identical amino acids are indicated by the uertical lines. Gaps in the sequences represent postulated deletions and are indicated by dashes. The dots (.) under the anthranilate synthase sequence denote those amino acids that are conserved in the sequence ofp-aminobenzoate synthase Component I1 (17). The regions of greatest amino acid conservation common to the four protein sequences are indicated by the dark lines and are labeled A , B, and C.

able regions of amino acid homology between residues 220- 382 of carbamyl phosphate synthetase and anthranilate synthase Component 11. The homologies revealed by the dot matrix lie on a diagonal line (data not shown). The extent of the homology is shown in Fig. 5 where the sequences of the yeast and E. coli carbamyl phosphate synthetases have been aligned with anthranilate synthase Component I1 and p - aminobenzoate synthase Component I1 of E. coli. Only the sequence of E. coli anthranilate synthase Component I1 is shown in the figure, although the other bacterial and fungal anthranilate synthases (18-20) were used to maximize the alignment. The deletions shown preserve the alignments of the anthranilate synthase Component I1 with p-aminobenzoate synthase Component I1 previously proposed by Kaplan and Nichols (17). The NH2-terminal region of anthranilate synthase Component I1 was difficult to align because of the lack of significant homology. In fact, it is impossible to align the first 35 residues of anthranilate synthase Component I1 with any part of carbamyl phosphate synthetase without introducing extensive insertions into the carbamyl phosphate synthetase sequence. The alignment shown for this region is tentative and other alignments are equally tenable. Between residues 220 and 382 of carbamyl phosphate synthetase and residues 35 and 192 of anthranilate synthase Component 11, 41 (27%) amino acids are identical and 42 (28%) represent conservative substitutions, giving an overall homology of 55%. The most highly conserved sequences are clustered and fall into three domains of the proteins labeled as A, B, and C in Fig. 5. A relationship of carbamyl phosphate synthetase and anthranilate synthase Component I1 was also evident from an analysis of their gene sequences. A dot matrix program scoring a dot for 50% or greater homology in a scan of 60 nucleotides revealed three homologous sequences in the carA and trp(G)D genes (Fig. 6B). The three conserved DNA sequences lie on a diagonal line and correspond to the conserved regions A, B, and C in the protein sequences.

On the basis of DNA sequence homology, Kaplan and


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


TABLE I1 Amino acid sequence of putative glutamine active site of small subunit of carbamyl phosphate synthetase and other

amidotransferases The boxed residues indicate identical and conserved hydrophobic amino acid residues. The asterisks denote

active sites of amidotransferases at which the cysteine residues become labeled with reactive glutamine analogues such as 6-diazo-5-oxo-~-norleucine (21, 52, 53), ~-2-amino-4-oxo-5-chloropentanoic acid (19), and azaserine (50), or with iodoacetate (51).

~~

Protein" Residues

Yeast CPS 256-271 E . coli CPS 261-276 E . coli AS11 7 5-9 0 S.rnarcescensASI1 E . coli PABSII P . putida AS11 N. c r a s s a AS11

S. typhirnurium FGAR-AT Chickenliver FGAR-AT

7 5-9 0 7 1-86

7 1-86 96-1 11

E . coli PRPP-AT 1-1 4 C G I V G I A G V M P V N Q B . subtilisPRPP-AT 1-1 4 ~ G V F G I W G H E E A P Q El

"References: CPS, small subunit of carbamyl phosphate synthetase of yeast, this work; CPS of E. coli (16); ASII, anthranilate synthase Component 11, of E. coli (18); AS11 of 5'. mrcescens (21); PABSII, p-aminobenzoate synthase Component 11, of E. coli (17); AS11 of P. putida (19); AS11 of N. crassa (20); FGAR-AT, formylglycinamide ribonucleotide amidotransferase of S. typhimurium (50); FGAR-AT of chicken liver (51); PRPP-AT, glutamine phosphoribosylpyrophosphate amidotransferase of E. cofi (52); PRPP-AT of B. subtitis (53).

Nichols (17) have found that trp(G)D is related to pubA, which codes for the small subunit of p-aminobenzoate synthase Component 11. Comparing the nucleotide sequences of trp(G)D andpubA with a program which scored a dot when a minimum of 50% homology occurs in a stretch of 40 nucleotides, these authors reported six regions of homology between the two genes. As shown in Fig. 6A, an even more definitive evolutionary relationship is revealed with a program scoring 50% or greater homology in 60 nucleotides. The two sets of data, namely homology of curA and trp(G)D and of trp(G)D andpubA, suggested that all three genes are related. This was tested by analyzing the sequences of E. coli carbamyl phosphate synthetase and p-aminobenzoate synthase Component 11. As indicated in the previous section, both enzymes are highly homologous in the vicinity of the active site cysteine residue. The protein sequence alignments shown in Fig. 5 indicate that the two proteins are significantly homologous in other regions as well. It is of interest that the greatest homology is seen in the previously mentioned regions A, B, and C.

A dot matrix comparing the gene sequences of curA and pu6A shows a clear line of homology in the region of the active cysteine residue (Fig. 6C). In this region the DNA sequence homology is 67%. Although the two genes have undergone extensive divergence, as evidenced by the absence of a clear diagonal in the dot matrix (Fig. 6C), they, nonetheless, appear to be related. The three regions of amino acid conservation average 49% homology at the nucleotide level. Statistically, this value is significantly above the maximal value of 30% for nonrelated genes in E. coli (17).

DISCUSSION

In previous studies (12), we reported that the large subunits of yeast arginine-specific carbamyl phosphate synthetase and E. coli carbamyl phosphate synthetase are structurally related. The present studies were undertaken to determine the S t N C - ture of the small subunit of yeast carbamyl phosphate synthetase and to establish its relation to the small subunit of the prokaryotic enzyme as well as to other glutamine amidotransferases. The yeast CPAl gene, encoding the small subunit of arginine-specific carbamyl phosphate synthetase was

cloned on a recombinant plasmid and its nucleotide sequence has been determined. The gene is 1233 nucleotides long and codes for a polypeptide of 411 amino acids. The amino acid sequence of the polypeptide derived from the nucleotide sequence is homologous to the derived amino acid sequence of the small subunit of E. coli carbamyl phosphate synthetase. Unlike the large subunit of yeast carbamyl phosphate synthetase whose gene has an internal duplication, there is no evidence for a duplication in CPAl.

The small subunits of E. coli (42) and yeast (10) carbamyl phosphate synthetases function in glutamine amide transfer. The amide N derived from glutamine is transferred to the large subunit of carbamyl phosphate synthetase and is sub- sequently used to form carbamyl phosphate from HCO; and ATP (42). This reaction mechanism is similar to the utilization of glutamine as donor of the amide group for the synthesis of anthranilate (44) and p-aminobenzoate (47). The latter reactions are also dependent on the transfer of glutamine amide N to an active site on another subunit of the synthases (44, 46, 47). These general properties of amidotransferases have raised the intriguing possibility of a common catalytic mechanism that may, in fact, have an evolutionary basis (42- 44,54). These earlier speculations to some extent have been substantiated by recent data clearly indicating that Compo- nent I1 of anthranilate synthase and p-aminobenzoate synthase are closely related both on the basis of their amino acid sequences and also in their gene sequences (17). The latter evidence has been suggested to indicate that these two enzymes arose from a gene duplication event (17).

The gene sequences coding for the small subunit of yeast and E. coli carbamyl phosphate synthetases as well as the derived amino acid sequences of the two proteins reported in this paper suggest that both the prokaryotic and eukaryotic enzymes are also members of a broader class of amidotransferases with a common evolutionary origin.

Both yeast and E. coli carbamyl phosphate synthetase share three regions of homology with E. coli anthranilate synthase Component I1 and p-aminobenzoate synthase Component I1 (A, B, and C in Fig. 5). The common sequences can be aligned in these different enzymes without introducing any major


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


600

400

200

A p a b P

/

trp(G)D I 1

200 400 r

600 -

400 -

200 -

trp(G1 D

I . 0

CYS 4 / /

car A 0

0'

I I 1

200 400 600 800 lo00

600 C

400 -

200 -

pab A

CY s

,>

1 car A I

I I

I I I 1

200 400 600 800 1000

FIG. 6. Nucleotide sequence homologies of E. coli carbamyl phosphate synthetase, anthranilate synthase Component 11, and p-aminobeazoate synthase Component 11. A, dot matrix analysis of trp(G)D and pabA. B, dot matrix of carA and trp(G)D. C, dot matrix of carA and &A. The program used scored a dot at each nucleotide where there is 50% or greater homology in the succeeding 60 nucleotides. The numbers along the abscissa and ordinate correspond to the nucleotide sequence of the coding regions only. Thus, +1 is the A of the initiation codon. The diagonal represents the direct comparison of the two sequences; deletions and/or insertions have not been introduced to maximize the homology. The position of the active site cysteines are indicated by the arrows.

deletions or insertions. Regions A , B , and C of the three enzymes comprising 62 amino acid residues share 18 identities and 11 conservative replacements. Further evidence indicating that the three enzymes have a common ancestry was obtained from a comparison of their gene sequences. Com- puter analysis using a dot matrix program showed three homologous segments in the sequences of trp(G)D and carA. These corresponded to the three regions of amino acid con-

servation. Although a dot matrix comparing carA and pabA revealed only one homologous sequence, the limits set in the scanning program lead to an underestimate of the actual extent of homology of the two genes. Thus, the three regions exhibiting the highest primary sequence conservation average 49% homology in the DNA.

These data strongly argue that carA, trp(G)D, and pabA were derived from a common ancestral gene. A tentative evolutionary scheme of how the present genes of E. coli may have evolved is presented in Fig. 7. This scheme assumes that the size of the ancestral gene was similar in size to that of the present-day pabA gene. Two duplication events are necessary to explain three related genes. To account for the greater sequence divergence of carA, we propose that this gene arose from the first duplication. An early duplication leading to carA is also consistent with the extensive homology of the E. coli and yeast proteins. The duplication event must, therefore, have occurred before the emergence of eukaryotes. That the ancestral forms of trpG and pabA arose from a later duplication is consistent with the higher degree of amino acid and DNA homology as well as the similarity of the catalytic function of the proteins. Further evolution of carA and trpG must have involved fusions and/or insertions of other sequences. In the case of trp(G)D, Component I1 of anthranilate synthase resulted from a fusion of the trpC gene coding for an amidotransferase and the trpD gene for a phosphoribosyl transferase (56-58). In carA, the sequences fused to or inserted into the NH2 terminus are almost the length of the ancestral amidotransferase. The function of the added sequences is not known.

Several lines of evidence point to region B (Fig. 5) as the active site involved in the amidotransferase activity of the three enzymes. It is the most highly conserved region of the proteins. Thirteen amino acid residues are almost identical not only among the various anthranilate synthases Compo- nent I1 but in carbamyl phosphate synthetase and p-aminobenzoate synthase Component 11. Of special significance is the presence of an invariant cysteine residue. Glutamine utilization by most, if not all, amidotransferases depends on the participation of a cysteine residue (19, 44, 48-53, 59-61). In two of the bacterial anthranilate synthases, the active cysteine in the conserved sequence has been shown to be

4 Dupllcot lon

1 Dupllcotlon

Fusion or Insertlone

1 I I"

corA tro(G)D pobA

FIG. 7. Proposed evolutionary derivation of the amidotransferase components of carbamyl phosphate synthetase, anthranilate synthase Component 11, and paminobenzoate synthase Component I1 in E. coli. The dark bar represents the length of the sequences derived from the gene of the ancestral glutamine-utilizing enzyme. The open segment of trp(G)D represents the trpD portion, and of carA is a sequence of still unknown origin.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


labeled with reactive analogues of glutamine (19, 21). These findings imply that region B is part of the catalytic domain of these enzymes. Some sequence data are also available for three other amidotransferases. The partial sequences of formylglycinamide ribonucleotide amidotransferase of S. typhimurium (50) and chicken liver (51) hint that these enzymes are also related to the general class of amidotransferases proposed here. Two short peptides of five to seven amino acids with the active cysteine have been isolated and se- quenced. The sequences reported have a suggestive homology to the proposed catalytic sites of anthranilate synthase Com- ponent I1 and carbamyl phosphate synthetase. Other exam- ples of glutamine-dependent amidotransferases which include phosphoribosylpyrophosphate amidotransferase (52, 53) and GMP synthetase (61) are more difficult to draw conclusions about. Although both transferases have active site cysteines next to a short stretch of hydrophobic residues, in at least one case where the entire protein sequence is known (62), it is not homologous to either anthranilate synthase Component I1 or carbamyl phosphate synthetase. Despite the absence of an evolutionary relatedness of these enzymes to the other amidotransferases, it is conceivable that they may nonetheless have common structural features at the active sites. This will require crystallographic data on the tertiary structure of the enzymes.

Acknowledgments-We thank Drs. Marjolaine Crabeel, Nicolas Glansdorff, and Andre Pierard for generously providing us with yeast strain 6028b. We also thank Esther E. Widgren for her excellent assistance, and Roy Smith and T. J. Koerner (Columbia University) for their help in the computer analyses of the DNA sequences. We are indebted to Dr. Lois T. Hunt of the National Biomedical Foun- dation for DOTMATRIX analyses of the protein sequence.

Note Added in Proof-The sequence that we propose to be the glutamine active site is also present in yeast anthranilate synthase Component I1 whose nucleotide sequence has recently been reported (Zalkin, H., Paluh, J. L., van Cleemput, M., Moye, W. S., and Yanofsky, C. (1984) J. Bwl. Chern. 259,3985-3992).

REFERENCES 1. Pierard, A,, Grenson, M., Glansdorff, N., and Wiame, J. M. (1973) in The

Enzvmes of Glutamine Metabolism (Prusiner, S., and Stadtman, E. R., e& j p p 483-503, Academic Press, New York

2. Makoff. A. J., and Radford, A. (1978) MicmbWL Rev. 42,307-328 3. Trotta. P. P.. Pinkus, L. M., Haschemeyer, R. H., and Meister, A. (1974)

J. Bwl. C k m . 249,492-499 4. Lacroute. F.. Pierard. A.. Grenson. M.. and Wiame. J. M. (1965) J. Gen. .. ~ ~~

Micmbwl.'40,127~142 5. Davis, R. H. (1967) in Organizational Biosynthes+ (Vogel, H. J., Lampen,

J. O., and B son, V., eds) p 303 322, Academc Press, New York 6. Bernhardt, S. x., and Davis, 8; H. (1972) Proc. Natl. Acad. Sci U. S. A.

69,186%1872 7. Urrestarazu. L. A., Vissers. S., and Wiame, J. M. (1977) Eur. J. Biochem.

. .

8. Nagy, M., LaPorte, J., Penveme, B., and Herve, G. (1982) J. Cell Biol. 9 2 ,

9. Williams, L. G., Bernhardt, S., and Davis, R. H. (1970) Biochemistry 9,

79,473-481

790-794

4329-4335 10. Pierard, A., and Schroter, B. (1978) J. Bacterid 134,167-176 11. Lusty, C. J., and Lu, J. (1982) Proc. Natl. Acad. Sci. U. S. A. 7 9 , 2240-

12. Lusty, C. J., Widgren, E. E., Broglie, K. E., and Nyunoya, H. (1983) J. BioL

13. Glansdorff, N., Dambly, C., Palchaudhuri, S., Crabeel, M., Pierard, A., and

14. Crabeel, M., Charlier, D., Weyens, G., Feller, A., Pierard, A., and Glansdorff,

2244

Chem. 258,1446&14477

Halleux, P. (1976) J . Bacterwl. 127,302-308

15. Nyunoya, H., and Lusty, C. J. (1983) Proc. Natl. Acad. Sci. U. S. A. 80. N. (1980) J. Bacteriol. 143,921-925

16. Piette, J., Nyunoya, H., Lusty, C. J., Cunin, R., Weyens, G., Crabeel, M.,, 4629-4633

Charlier, D., Glansdorff, N., and Pierard, A. (1984) Proc. Natl. Acad. Scr. U. S. A. 81,4134-4138

17. Kaplan, J. B., and Nichols, B. P. (1983) J. MOL Biol. 168,451-468 18. Nichols, B. P., Miozzari, G. F., van Cleemput, M., Bennett, G. N., and

19. Kawamura, M., Keim, P. S., Gob, Y., Zalkm, H., and Heinrikson, R. L.

20. Schechtman, M. G., and Yanofsky, C. (1983) J. MOL AppL Genet. 2,83-99 21. Tso,,_J, Y.!-Ijermodson, M. A., and Zalkin, H. (1980) J. Biol. Chem. 2 6 5 ,

Yanofsky, C. (1980) J. Mol. Biol. 142,503-517

(1978) J. BioL Chem. 263,4659-4668

22. Thuriaux, P:, Ramos, F., Pierard, A., Grenson, M., and Wiame, J.-M. (1972)

23. Clewell, D. B., and Helinski, D. R. (1969) Proc. Natl. Acad. Sei. U. S. A.

24. Broach, J. R., Strathem, J. N., and Hicks, J. B. (1979) Gene 8. 121-133 25. Maxam A. M., and Gilbert, W. (1980) Methods Enrymol. 66,499-560 26. Aviv, H., and Leder, P. (1972) Proc. Natl. Acad. Sci. U. S. A. 69. 1408-

1451-1457

J. Mol. Bwt. 67,277-287

6 2 , 1159-1166

1412 27. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) Moleczhr C h i A

Laboratory Manual, pp. 207-209, Cold Spring Harbor Laborabry,yold

28. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) Molecular C h i A Spring Harbor, NY

Laboratory Manual, pp. 202-203, Cold Spring Harbor Laborabry,?old Spring Harbor, NY

I~

29. Thomas, P. S. (1980) Proc. Natl. Acad. Sci. U. S. A. 77,5201-5205 30. Jeffreys A. J., and Flavell, R. A. (1977) Cell 12,429-439 31. Messenhy, F., Feller, A., Crabeel, M., and Pierard, A. (1983) EMBO J. 2.

32. 33.

34.

35.

36.

37.

38.

1249z1254 - ~I

Dobson, M. J:, T h e , M. F., Roberta, N. A., Kingsman, A. J., Kingsman, Sollner-Webb B. and Reeder, R. H. (1979) Cell 18,485-499

S. M., Perkins, R. E., Conroy, S. C., Dunbar, B., and Fothergill, L. A.

Mont ome D. L., Leun , D W Smith, M., Shalit, P., Faye, G., and (1982) Nucleic Acids Res. 10,2625-2637

McLa; hlin C S Warner, J. R., Edmonds, M., Nakazato, H., and Hafi B. 8: (1980) Proc. %ati A&. Sei. U. S. A. 77 , 541-545

Brosius, J., P a h e r , M. L., Kennedy, P. J., and Noller, H. F. (1978) Proc. Vaugtan, h. H. y1973) J. BWL Chem. 248,1466-1471

Brosius, J., Dull, T. J., and Noller, H. F. (1980) Pmc. NatL Acad. Sci. U. S. Natl. Acad. Scr. U. S. A. 75, 480-4805

Rubtaov P. M. Musakhanov M. M., Zakh ev V. M., Krayev A. S., Sbzabin, K. 'G., and Baye;, A. A. (1980)?uccIkic Acids Res. 8: 5779-

A. 77,201-204

39. Veldman, G. M., Klootwijk, J., de Re& V. C. H. F., Planta, R. J., Branlant,

40. Ikemura, T. (1982) J. Mol. Bwl. 168,573-597 C., Krol, A., and Ebel, J.-P: (1981) Nucleic Acids Res. 9,6935-6952

41. Zalkin, H., and Yanofsky, C. (1982) J. BioL Chem. 267,1491-1500 42. Trotta. P. P.. Burt. M. E.. Haschemeyer, R. H.. and Merster, A. (1971)

.J ,a*

Proc: NatL Acad. Sci. U. S. A. 68,2599-2603 43. Trotta, P. P., Pinkus, L. M., Wellner, V. P. Estis, L. Hascheme er, R. H.,

and Meister, A. (1973) in The E mes bf Glutum'ine Met@ofism (PN- slner, S., and Stadtman, E. R., e% pp. 431-482, Academic Press. New

-,

44. Nagano, H., Zalkin, H., and Henderson, E. J . (1970) J. Biol. Chem. 2 4 6 ,

45. Frere, J.-M., Schroeder, D. D., and Buchanan, J. M. (1971) J. Biol. Chem.

46. Huang, M., and Gibson, F. (1970) J. Bacteriol. 102,767-773 47. Zalkm, H. (1973) Adu. Enrymol. Relnt. Areas Mol. Bwl. 38 , l -39 48. Messenger, L. J., and Zalkm, H. (1979) J. Biol. Chem. 254,3382-3392 49. Pinkus, L. M., and Meister, A. (1972) J. BioL Chem. 247,6119-6127 50. Dawid, I. B., French, T. C., and Buchanan, J. M. (1963) J. Biol. Chem.

51. Ohnoki, S., Hong, B.-S., and Buchanan, J. M. (1977) Biochemistry 16 ,

52. Tso. J. Y.. Hermodson. M. A., and Zalkin, H. (1982) J. BioL Chem 267.

York

3810-3820

246,4727-4730

238,2178-2185

1070-1076 . ~~

3532-3536

H. (1683) J. BioL Chem. 258,10582-10585

Res. 'commun. 115,106-1068

53. Vollmer S. J., Switzer, R. L., Hermodson, M. A., Bower, S. G., and Zalkin,

54. Li, H.-C., and Buchanan, J. M. (1971) J. BWL Chem. 246,4713-4719 55. George D. G., Yeh, L.-S. L., and Barker, W. C. (1983) Biochem. Biophys.

56. Hwang, L. H., and Zalkin, H. (1971) J. Biol. Chem. 246,2338-2345 57. Grieshaher M and Bauerle, R. (1972) Nat. New Biol. 236,232-235 58. Li S.-L. HaniAn J., and Yanofsky, C. (1974) Nature ( l and . ) 2 4 8 , 6 4 9

,60. Long. C. W., Levitzki, A., and Koshland, D. E., Jr. (1970) J. BwL Chem. 59. MLtaah, P., and Zalkin, H. (1976) J. Biol. Chem. 261,3294-3299

61. Truitt, C. D., Hermodson, M. A., and Zalkin, H. (1978) J. BWL Chem. 2 6 3 ,

62. Tso, J. Y., Z4kin H van Cleemput, M., Yanofsky, C., and Smith, J. M.

2&,80-87

8470-8473

(1982) J. BwL &e$. 257,3525-3531


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

H Nyunoya and C J Lustyidentification of its catalytic domain.

Sequence of the small subunit of yeast carbamyl phosphate synthetase and

1984, 259:9790-9798.J. Biol. Chem.

http://www.jbc.org/content/259/15/9790Access the most updated version of this article at

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here

http://www.jbc.org/content/259/15/9790.full.html#ref-list-1

This article cites 0 references, 0 of which can be accessed free at


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/content/259/15/9790

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;259/15/9790&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/259/15/9790

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=259/15/9790&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/259/15/9790

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/content/259/15/9790.full.html#ref-list-1

http://www.jbc.org/

sequence of the small subunit of yeast carbamyl phosphate

Documents