SLIT2/ROBO-1: NOVEL MODULATORS OF VASCULAR INJURY

by

Sajedabanu Patel

A thesis submitted in conformity with the requirements for the degree of MSc.

Institute of Medical Science University of Toronto

© Copyright by Sajedabanu Patel. 2011.

 

ii

Slit2/Robo-1: Novel Modulators Of Vascular Injury

Sajedabanu Patel

Master of Medical Science (MSc)

Institute of Medical Science University of Toronto

2011

ABSTRACT

In atherosclerosis, infiltrating leukocytes and vascular smooth muscle cells

(VSMCs) cause progressive vascular narrowing. Platelet-mediated thrombosis

ultimately causes complete vessel occlusion, resulting in heart attack or stroke. In

animal models and human patients, individually blocking these events is only partially

effective. Another therapeutic strategy would be to globally target these multiple cell

types. Slit proteins act as developmental neuronal repellents, and Slit2 via interaction

with its receptor, Robo-1, impairs inflammatory recruitment of leukocytes and VSMCs.

We detected Robo-1 expression in human and murine platelets. Using static and

shear assays, we demonstrate that Slit2 impaired platelet adhesion and spreading on

fibrinogen, fibronectin and collagen. Slit2 mediated these effects, in part, by

suppressing activation of Akt but not Rac1, Cdc42, Erk or p38 MAPK. Slit2 also

prevented ADP-mediated granular secretion. In mouse tail-bleeding experiments, Slit2

dose-dependently prolonged bleeding times in vivo. These data suggest a therapeutic

role of Slit2 in atherothrombosis.

 

iii

ACKNOWLEDGEMENTS

I would like to express my sincere gratitude to my supervisor and mentor, Dr. Lisa

Robinson, for her constant encouragement and guidance. Working with Lisa has been

a tremendously exciting experience where I enjoyed science like never before. Her

remarkable passion for science, and commitment to motivate young minds through the

Kids Science program is truly inspirational and infectious. I also owe my gratitude to

my program advisory committee, Dr. Walter Kahr and Dr. William Trimble for their

valuable input, encouragement, and constructive criticism. I am heartily thankful to all

the wonderful members of the Robinson lab, particularly Dr. Yi-wei Huang, Guang

Ying Liu, Dr. Swasti Chaturvedi, Ilya Mukovozov and Soumitra Tole for their constant

assistance, feedback and engaging discussions. I would also like to thank Dr. Fred

Pluthero for his technical expertise and suggestions in optimization of the platelet

assays. I also acknowledge the technical advice offered by Dr. Peter Gross and Ali

Akram to optimize the in vivo experiments. In addition, I would further acknowledge

the friendly and supportive individuals of the 4th floor whose zany antics made my

experience even more joyous and memorable. My appreciation and gratitude also

extends to all the volunteers who have donated blood for this study. Most importantly,

I would like to thank my parents, my sister and my brother for their unconditional love

and support throughout my life.

 

iv

DATA ATTRIBUTION The work presented here was performed in collaboration with a number of individuals.

The purification of Slit2 was conducted in the laboratory of Dr. Yves Durocher

(National Research Council Canada). Dr. Fred Pluthero performed experiments

presented in Figure 3.1 b, c, and d, while Ling Li performed the ones in Figure 3.1 a.

Dr. Yi-wei Huang and myself jointly conducted the experiments presented in Figures

3.8, 3.9 and 3.10. In addition, Dr. Swasti Chaturvedi and myself optimized and

conducted the microfluidic assays shown in Figure 3.7. Finally, the data presented in

Appendix 1 represents another on-going study that was commenced by me during the

course of this degree.

 

v

TABLE OF CONTENTS

LIST OF FIGURES.......................................................................................................vii LIST OF TABLES........................................................................................................ viii LIST OF ABBREVIATIONS...........................................................................................ix CHAPTER 1: INTRODUCTION .................................................................................... 1

1.1 Atherosclerosis and Inflammation ....................................................................... 1 1.2 Platelet: structure and function ............................................................................ 3

1.2.1 Platelet adhesion and spreading................................................................... 6 1.2.1.1 Glycoprotein IIb/IIIa ................................................................................ 7 1.2.1.2 Glycoprotein VI ....................................................................................... 9 1.2.1.3 Glycoprotein Ia/IIa .................................................................................. 9 1.2.1.4 Glycoprotein Ic/IIa ................................................................................ 10 1.2.1.5 Glycoprotein Ib-IX-V ............................................................................. 11 1.2.1.6 ADP receptors ...................................................................................... 11 1.2.1.7 Protease-activated receptors (PARs)................................................... 12 1.2.1.8 Thromboxane prostanoid receptor (TP) ............................................... 13

1.2.2 Platelet secretion ........................................................................................ 14 1.2.3 Intracellular platelet signaling...................................................................... 15 1.2.4 Current antiplatelet therapies and atherosclerosis...................................... 19

1.3 Rho GTPases: Rac and Cdc42 ......................................................................... 21 1.3.1 Structure and Regulation ............................................................................ 22 1.3.2 Biological functions of Rho GTPases.......................................................... 24

1.4 Slit proteins: Repulsive cue for migrating cells .................................................. 27 1.4.1 Expression .................................................................................................. 29 1.4.2 Slit and Robo structure ............................................................................... 30 1.4.3 Slit2/Robo-1 intracellular signal transduction.............................................. 35

1.5 Rationale, Hypothesis and Objectives............................................................... 36 1.5.1 Rationale..................................................................................................... 36 1.5.2 Hypothesis .................................................................................................. 37 1.5.3 Objectives ................................................................................................... 37

CHAPTER 2: MATERIALS AND METHODS .............................................................. 38

2.1 Reagents and antibodies................................................................................... 38 2.2 Isolation of primary human and murine platelets............................................... 39 2.3 Immunofluorescent labeling of platelets ............................................................ 40 2.4 Immunoblotting .................................................................................................. 40 2.5 Platelet spreading assays.................................................................................. 41 2.6 Platelet adhesion under flow conditions ............................................................ 42 2.7 Rac1 and Cdc42 activation assays ................................................................... 42 2.8 Platelet granular secretion................................................................................. 43 2.9 Murine tail bleeding assays ............................................................................... 44 2.10 Statistical analysis ........................................................................................... 44

CHAPTER 3: RESULTS ............................................................................................. 45

3.1 Platelets express Robo-1 on their surface......................................................... 45 3.2 Slit2 inhibits spreading of human platelets ........................................................ 45

 

vi

3.3 Slit2 inhibits platelet adhesion under physiologic flow conditions...................... 46 3.4 Slit2 does not affect Rac1 and Cdc42 activation during platelet spreading....... 47 3.5 Slit2 suppresses activation of Akt, but not Erk or p38 MAPK during platelet spreading................................................................................................................. 48 3.6 Slit2 inhibits ADP-mediated platelet activation .................................................. 48 3.7 Slit2 prolongs bleeding times in vivo ................................................................. 49

CHAPTER 4: DISCUSSION AND CONCLUSIONS.................................................... 72 REFERENCES............................................................................................................ 79 APPENDIX1: Regulation of srGAP1 during Slit/Robo signaling ............................... 105

A1.1 AIMS AND INTRODUCTION ........................................................................ 105 A1.2 METHODS .................................................................................................... 107 A1.3 RESULTS AND FUTURE DIRECTIONS ...................................................... 110 A1.4 TABLES AND FIGURES............................................................................... 114 A1.5 REFERENCES.............................................................................................. 121

 

vii

LIST OF FIGURES  Figure 1.1: Schematic overview of platelet responses during thrombus formation....... 5

Figure 1.2: Major intracellular signaling pathways in platelets .................................... 16

Figure 1.3: The domain organization of mammalian Slit and Robo proteins. ............ 34

Figure 3.1: Human and murine platelets express Robo-1 on the cell surface. .......... 51

Figure 3.2: Slit2 inhibits human platelet spreading on fibrinogen............................... 53

Figure 3.3: Time-lapse videomicroscopy of Slit2 treated platelets. ............................. 55

Figure 3.4: Slit2 inhibits human platelet spreading on fibronectin. .............................. 57

Figure 3.5: Slit2 inhibits human platelet spreading on collagen. ................................. 59

Figure 3.6: Slit2 does not inhibit human platelet spreading on glass. ........................ 61

Figure 3.7: Slit2 inhibits platelet adhesion to collagen under physiological shear flow

conditions. ............................................................................................................ 63

Figure 3.8: Slit2 does not inhibit activation of the Rho GTPases- Rac1 and Cdc42. 65

Figure 3.9: Slit2 inhibits activation of Akt but not Erk, or p38 MAPK.......................... 67

Figure 3.10: Slit2 suppresses ADP-mediated platelet activation response................ 68

Figure 3.11: Slit2 increases bleeding times in vivo. .................................................... 70

 

viii

LIST OF TABLES Table 1.1: Some important receptors involved in mediating platelet functions along

with their respective agonists ..............................................................................................................7 

 

ix

LIST OF ABBREVIATIONS  AA Arachidonic Acid AC Adenylyl Cyclase ACD Acid Citrate Dextrose ADP Adenosine diphosphate Akt/PKB Protein Kinase B C5a Complement component 5a CalDAG-GEF1 Calcium and DAG-regulated guanine nucleotide exchange factor-1 CD62P P-Selectin CNS Central Nervous System CXCL12 CXC Chemokine Ligand 12 DAG Diacylglycerol DH Dbl homology domain ECM Extracellular Matrix EGF Epidermal Growth Factor Ena Enabled Erk Extracellular-signal Regulated Kinase FITC Fluorescein isothiocyanate GAP GTPase Activating Protein GDNF Glial Cell Line-derived Neurotrophic Factor GEF Guanine Nucleotide Exchange Factor GFP Green Fluorescent Protein GP IIb/IIIa Glycoprotein IIb/IIIa GP VI Glycoprotein VI GP Ia/IIa Glycoprotein Ia/IIa GP Ic/IIa Glycoprotein Ic/IIa GP Ib-IX-V Glycoprotein Ib-IX-V GPCR G-Protein Coupled Receptor GTPase Guanosine Triphosphatase HRP Horseradish Peroxidase Ig Immunoglobulin IP3 Inositol -1,4,5-trisphosphate ITAM Immunoreceptor Tyrosine-based Activation Motif LRR Leucine-Rich Repeat MAPK Mitogen Activated Protein Kinase MCP-1 Monocyte Chemotactic Protein-1 Mena Mammalian Enabled MIP-2 Macrophage-inflammatory protein-2 OCS Open Canalicular System PAK p21-Activated Kinase PAR Protease-activated receptors PBD p21-Binding Domain PBS Phosphate Buffered Saline PCR Polymerase Chain Reaction PDGF Platelet-Derived Growth Factor PE Phycoerythrin PFA Paraformaldehyde

 

x

PH Pleckstrin Homology PI3K Phosphoinositide 3-kinase PIP2 Phosphatidylinositol 4,5 bisphosphate PKA Protein Kinase A PKC Protein Kinase C PLC Phospholipase C PRP Platelet Rich Plasma srGAP Slit-Robo GTPase activating protein TP Thromboxane prostanoid receptor TXA2 Thromboxane A2 VCAM Vascular Cell Adhesion Molecule VSMCs Vascular Smooth Muscle Cells vWF Von Willebrand factor

 

1

CHAPTER 1: INTRODUCTION 1.1 Atherosclerosis and Inflammation

Atherosclerosis is a complex disease of the arteries characterized by chronic

inflammation. The progression of atherosclerotic plaques results in numerous

cardiovascular complications, such as heart attack and stroke (Libby, 2002; Lusis,

2000). In Canada, cardiovascular disease remains the leading cause of mortality,

morbidity and disability, and costs the economy over $21 billion per year (Jackevicius

et al., 2009; Tarride et al., 2009).

Continuing research within the last few decades has ascertained that

atherosclerosis involves intricate physiological, biochemical and cellular processes

(Lusis, 2000; Ross, 1999). A primary initiating event in atherosclerosis is the

accumulation of lipids, most notably low-density lipoprotein (LDL), in the sub-

endothelial matrix (Libby, 2002; Ross, 1999). Lipid deposition usually begins at the

curvatures and branches on the luminal vascular sites (Lusis, 2000; Nakashima et al.,

1998). These sites are more prone to developing atherosclerosis, as they experience

a blood flow pattern that is substantially different from the rest of the arterial network

(Lusis, 2000; VanderLaan et al., 2004). The lipid accumulation stimulates the

endothelial cells lining the vessel wall to produce a number of pro-inflammatory

molecules, including adhesion molecules and chemotactic factors (Lusis, 2000; Ross,

1999). These, in turn mediate the adhesion and recruitment of immune cells, such as

monocytes/macrophages and lymphocytes to the arterial wall (Libby, 2002; Lusis,

2000). The monocytes can transmigrate across the endothelial monolayer into the

intima, where they proliferate and differentiate into macrophages. These macrophages

2

 

start accumulating at the damaged vascular sites, where they internalize and become

engorged with cholesterol, thus becoming foam cells (Libby, 2002; Lusis, 2000; Ross,

1999). The foam cells populate the injured sites to form initial lesions called fatty

streaks (Lusis, 2000; Ross, 1999). These fatty streaks are seeding grounds for the

formation of more advanced lesions called plaques (Lusis, 2000; Ross, 1999).

Plaques can lead to a considerable loss of arterial elasticity and narrowing of the

arterial lumen during the advanced stages of atherosclerosis (Lusis, 2000; van Popele

et al., 2006). Atherosclerotic lesions further recruit vascular smooth muscle cells

(VSMCs) into the vessel intima where they proliferate, and synthesize extracellular

matrix components (Libby, 2002; Lusis, 2000). This vascular proliferation releases

pro-inflammatory mediators such as monocyte chemoattractant protein-1 (MCP-1) and

vascular cell adhesion molecule (VCAM), which aids in the stabilization of the forming

plaque (Libby, 2002; Lusis, 2000). Interestingly, the activated monocytes/

macrophages may also act to weaken the plaque by secreting matrix

metalloproteinases, which enzymatically degrade collagen and extracellular matix

(Braganza and Bennett, 2001). This destabilization of the plaque can lead to plaque

rupture, causing complications such as myocardial infarctions and strokes (Braganza

and Bennett, 2001).

The progression of atherosclerosis is worsened by the interplay of the immune

cells with circulating platelets in the blood vessel. Platelets adhere to dysfunctional

endothelium, exposed collagen, macrophages and to each other (Gawaz et al., 2005;

Lusis, 2000; Ross, 1999; von Hundelshausen and Weber, 2007). Upon activation,

they release their granular contents, which contain cytokines, growth factors, as well

3

 

as thrombin. These released molecules further exacerbate the migration and

proliferation of VSMCs and monocytes to the damaged vessel (Lusis, 2000; Ross,

1999). Activation of platelets also leads to the formation and release of thromboxane

A2 (TXA2), which is a potent vasoconstrictor, platelet-aggregating substance, and a

VSMC mitogen (Lusis, 2000; Ross, 1999). Therefore, platelet aggregation and

activation amplify vascular inflammation responses, and precipitate formation of

occlusive vascular thrombi. Plaque rupture and thrombosis are the prominent

complications of advanced lesions that lead to unstable coronary syndromes,

myocardial infarction or stroke (Gawaz et al., 2005; Massberg et al., 2002; Meadows

and Bhatt, 2007; von Hundelshausen and Weber, 2007).

1.2 Platelet: structure and function

Platelets are small, anucleate blood cells, which are derived from precursor

cells called megakaryocytes that reside within the bone marrow (George, 2000).

Platelets are assembled by an intricate series of remodeling events along

pseudopodial extensions of the mature megakaryocyte, called proplatelets (Patel et

al., 2005). Platelets play a critical role in the recognition of vascular injury, and

prevention of excessive bleeding by formation of a hemostatic plug (George, 2000).

Each day, about 2.5 x 109 platelets are generated and circulate at a concentration of

150-450 x 109/ L (George, 2000). Resting platelets are approximately 2-5 µm in

diameter. They contain at least three different granules - dense granules, α-granules

and lysosomes (White et al., 2007). Dense granules store calcium, serotonin, ATP and

ADP among other substances (White et al., 2007). α-granules contain procoagulants

(fibrinogen, von Willebrand factor, platelet factor 4, fibronectin), chemokines, growth-

4

 

promoting factors (transforming growth factor β, vascular endothelial growth factor-A),

and mitogens (platelet-derived growth factor, thrombospondin). In addition, the α-

granules store adhesion receptors such as CD62P (P-selectin), GPIb-IX-V and GP

IIb/IIIa (Reed et al., 2007). The third type of platelet granules, lysosomes, contain

hydrolases and serves as an endosomal digestion compartment (Reed et al., 2007).

The platelet cytoskeleton primarily consists of a microtubule coil and a rigid network of

cross-linked actin filaments (White et al., 2007). In connection with the microtubule

system lies the open canalicular system (OCS), a membrane system which connects

the cytosol with the surrounding medium and is believed to be involved in

degranulation of platelets (White et al., 2007).

When platelets are activated following vascular injury, a series of morphological

changes occur that can be observed in vitro. These responses are initiated by platelet

adhesion onto the matrix surfaces via their cognate receptors (Hartwig et al., 2007).

Platelets then undergo an increase in surface area through spreading. Spreading is a

rapid process in which platelets change their shape, forming finger-like projections

called filopodia, later superceded by sheet-like lamellipodia. These morphological

changes allow platelets to flatten and adhere firmly on the surface with which they are

in contact (Hartwig et al., 2007). As a consequence of the shape change, the granules

inside the platelet become centralized and release their contents. This degranulation

and release of secondary platelet agonists such as ADP, which further exacerbates

plug formation by recruiting new platelets to the injured area (Zarbock et al., 2007).

This promotes platelet aggregation through homotypic adhesion of platelets. The

newly formed platelet plug is subsequently stabilized by a fibrin meshwork (Zarbock et

5

 

al., 2007). The net result is hemostasis and cessation of bleeding. The major steps

involved in thrombus formation are depicted in Figure 1.1. Overall, platelets are

essential for primary hemostasis. However, platelet hyperactivity can be deleterious in

atherosclerotic lesions, and contributes to atherothrombotic disorders (Gawaz et al.,

2005; Libby, 2002; von Hundelshausen and Weber, 2007).

Figure 1.1: Schematic overview of platelet responses during thrombus

formation. At sites of vascular injury, platelets become exposed to components of the

extracellular matrix (ECM). Platelet surface receptors interact with these ECM

proteins, particularly collagen and vWF, resulting in platelet adhesion to the sub-

endothelium. Activated platelets undergo a shape change, which causes the release

of secondary mediators such as ADP from granules. The released products attract

and activate more platelets at the damaged site. Aggregates are formed by platelet-

platelet interactions via fibrinogen and vWF, allowing for the formation of a stable

thrombus to prevent excessive bleeding.

 

6

 

1.2.1 Platelet adhesion and spreading  

Platelet adhesion occurs following vascular injury and is essential for effective

hemostasis (Ruggeri and Mendolicchio, 2007). Adhesion is generally viewed as the

first step of platelet activation, and involves complex interactions between platelet

membrane receptors and extracellular matrix constituents of the vessel wall (Ruggeri

and Mendolicchio, 2007).

Platelet receptors are of two main types: 1) G-protein coupled receptors

(GPCRs), receptors that consist of seven transmembrane domains that are linked to

and activate heterotrimeric (αβγ) G proteins upon agonist occupation, and 2) Adhesion

receptors linked to soluble protein tyrosine kinases. Platelet adhesion receptors are

further categorized into three sub-types: the leucine-rich glycoproteins, integrins, and

immunoglobulins (Clemetson et al., 2007). An overview of the major platelet receptors

is presented in Table 1.1 and then individually discussed.

7

 

Table 1.1: Some important receptors involved in mediating platelet functions

along with their respective agonists. Platelet receptors are broadly classified into

two main types - GPCRs (listed with their G proteins) and adhesion receptors.

1.2.1.1 Glycoprotein IIb/IIIa  

Glycoprotein IIb/IIIa (GP IIb/IIIa) also known as integrin αIIbβ3, is a

heterodimeric integrin receptor composed of an α and β subunit. It is the most

abundant platelet surface receptor and the best characterized amongst them (Plow et

al., 2007; Ruggeri, 2009). Between 40,000 to 80,000 GP IIb/IIIa receptors are

expressed on individual resting platelets, and additional pools are stored in α-granules

that are recruited to the surface upon activation (Woods et al., 1986). GP IIb/IIIa is the

major platelet adhesion receptor and plays pivotal roles in promoting platelet

adhesion, aggregation and thrombus formation (Clemetson et al., 2007; Plow et al.,

2007). When quiescent on resting platelets, GP IIb/IIIa exhibits minimal binding affinity

Receptor category G-proteins Receptors Agonist GPCR Gq, G12/13, Gi PAR1 Thrombin GPCR Gq, G12/13, Gi PAR2 Thrombin GPCR Gq P2Y1 ADP GPCR Gi P2Y12 ADP

GPCR Gq, G12/13 TP TXA2 Adhesion (Integrin) - GP Ic/IIa (α5β1) fibronectin Adhesion (Immunoglobulin)

- GP VI Collagen

Adhesion (Integrin) - GP Ia/IIa (α2β1) Collagen Adhesion (Integrin) - GP IIb/ IIIa

(αIIbβ3) Fibrinogen, vWF, fibronectin

Adhesion (LRR) - GP Ib-IX-V vWF, thrombin

8

 

for its main ligand, plasma fibrinogen (Plow et al., 2007; Ruggeri, 2009). Fibrinogen is

present in blood as a soluble protein, and a releasable pool is also stored in platelet α-

granules. Fibrinogen is also required for cross-linking platelets via activated GP

IIb/IIIa, thus contributing to platelet aggregation (Plow et al., 2007; Ruggeri, 2009). GP

IIb/IIIa recognizes and binds to the arginine-glycine-aspartic acid (RGD) sequence of

fibrinogen molecule (Plow et al., 2007; Ruggeri and Mendolicchio, 2007). In addition to

fibrinogen, GP IIb/IIIa has affinity for other ligands containing the RGD sequence, such

as vWF, fibronectin, vitronectin, and thrombospondin (Plow et al., 2007; Ruggeri and

Mendolicchio, 2007). In the “low-affinity” binding state of the integrin, the binding site

for the RGD sequence is hidden. Upon platelet activation, signaling events lead to a

conformational switch unmasking the RGD binding site, thus changing the receptor to

a “high-affinity” binding state (Plow et al., 2007; Ruggeri and Mendolicchio, 2007). This

active conformation of GP IIb/IIIa then mediates platelet adhesion, spreading, and

aggregation to form a stable platelet plug.

Dysfunction or mutations in GP IIb/IIIa gives rise to Glanzmann

thrombasthenia, a severe bleeding diathesis associated with impaired platelet

adhesion and aggregation in human patients (Plow et al., 2007; Ruggeri and

Mendolicchio, 2007). Accordingly, mice lacking β3 subunit resemble the phenotype of

Glanzmann thrombasthenia with minimal platelet aggregation (Nieswandt et al., 2005).

These mice have impaired hemostasis and thrombus formation, and exhibit

spontaneous hemorrhage in all developmental stages (Nieswandt et al., 2005).

9

 

1.2.1.2 Glycoprotein VI  

Glycoprotein VI (GP VI) belongs to the immunoglobulin superfamily of adhesion

receptors and is non-covalently associated with the immunoreceptor tyrosine-based

activating motif (ITAM)-bearing receptor, the FcR γ-chain (Ruggeri and Mendolicchio,

2007; Yip et al., 2005). GP VI plays a role in activation of platelets and is critical for

platelet attachment to collagen (Ruggeri and Mendolicchio, 2007; Yip et al., 2005).

Fibrillar collagens type I and III are among the most potent platelet activators and play

a key role in thrombus formation, especially in atherosclerotic lesions. The GP VI-

collagen interaction is involved in initiation of thrombus formation at both low and high

shear flow rates (Yip et al., 2005). Under conditions of high shear flow (> 650 s-1), it

supports platelet adhesion mediated by von Willebrand factor (vWF) and GP Ib-IX-V

(Yip et al., 2005). Defects in GP VI produce a mild bleeding diathesis in humans, and

immunodepletion of this receptor in murine platelets impaired occlusive thrombus

formation in vivo (Arthur et al., 2007; Nieswandt et al., 2001).

1.2.1.3 Glycoprotein Ia/IIa  

Glycoprotein Ia/IIa (GP Ia/IIa), also known as integrin α2β1 is present on

platelet surface with a copy number of approximately 2000 to 4000 per platelet, and

binds to collagen (Varga-Szabo et al., 2008). GP Ia/IIa plays a significant but non-

essential role in platelet activation (Varga-Szabo et al., 2008). Humans with heritable

reduced expression of this integrin display a mild bleeding tendency and impaired

platelet responses to collagen (Nieuwenhuis et al., 1985; Varga-Szabo et al., 2008).

Mice lacking α2 or β1 display normal bleeding times, and minor defects in platelet

10

 

adhesion and aggregation to collagen (Holtkotter et al., 2002; Rivera et al., 2009). It is

noteworthy that combined deficiency of the major collagen receptors, GP Ia/IIa and

GP VI, in mice completely inhibits thrombus formation (Ruggeri and Mendolicchio,

2007). It is widely recognized that the two major collagen receptors perform

independent functions in the interaction with collagen, and operate synergistically

(Ruggeri and Mendolicchio, 2007). Their respective contribution to the dynamics of

thrombus formation depends on the nature of the vascular lesion, flow rates, and other

unknown factors (Ruggeri and Mendolicchio, 2007).

1.2.1.4 Glycoprotein Ic/IIa  

Glycoprotein Ic/IIa (GP Ic/IIa), also known as integrin α5β1, serves as the

principal receptor for fibronectin. Besides GP Ic/IIa, the matrix protein fibronectin can

also bind to GP IIb/ IIIa (Kasirer-Friede et al., 2007). GP Ic/IIa supports platelet

adhesion and the generation of filopodia but is unable to generate lamellopodia

without the involvement of GP IIb/IIIa (McCarty et al., 2004). Upon blocking GP IIb/

IIIa with antagonists, platelets can form filopodia on fibronectin but not lamellopodia

(McCarty et al., 2004). Studies from β1 deficient mice have further suggested that GP

Ic/IIa is not critical for platelet adhesion and thrombus formation in vivo, owing to the

functional redundancy with GP IIb/ IIIa (Gruner et al., 2003; Varga-Szabo et al., 2008).

Thus, the specific role of GP Ic/IIa may be limited to initiating the interaction of

platelets with matrix fibronectin and augmenting platelet responses by promoting the

engagement of other receptors (Kasirer-Friede et al., 2007).

11

 

1.2.1.5 Glycoprotein Ib-IX-V  

Glycoprotein Ib-IX-V (GP Ib-IX-V) is a platelet adhesion receptor complex

belonging to the leucine-rich repeat family and is essential for platelet adhesion under

high shear conditions (Ruggeri, 2009). GP Ib-IX-V is the second most common

platelet receptor present on the cell surface with approximately 30,000-40,000 copies

per platelet (Yip et al., 2005). It consists of four different subunits- GP Ibα, GP Ibβ, GP

IX and GP V (Canobbio et al., 2004). GP Ibα is disulfide linked to GP Ibβ, and non-

covalently attached to GP IX and GP V (Canobbio et al., 2004). This complex

regulates platelet adhesion to its major ligand, von Willebrand factor (vWF), a

multimeric plasma glycoprotein (Yip et al., 2005). Binding of GP Ib-IX-V to vWF

triggers multiple signaling pathways that promote platelet aggregation and the

formation of a platelet plug (Moroi et al., 1997; Yip et al., 2005). The deficiency or

dysfunction of GP Ib-IX-V causes Bernard-Soulier syndrome in humans, which is

characterized by prolonged bleeding times (Clemetson et al., 2007). Genetic depletion

of GP Ibβ in mice also results in severe bleeding phenotype and increase in α-granule

size (Kato et al., 2004).

1.2.1.6 ADP receptors  

P2Y1 and P2Y12 are two purinergic GPCRs that bind to adenosine diphosphate

(ADP) (Cattaneo et al., 2007). ADP is stored in platelet dense granules and is also

released by red blood cells at the site of injury, allowing it to act in both an autocrine

and paracrine manner (Rivera et al., 2009). Although itself a weak agonist, ADP plays

a fundamental role in amplification of platelet responses (Cattaneo et al., 2007).

12

 

Platelet stimulation by ADP causes a full range of activation events including

intraplatelet calcium elevation, TXA2 synthesis, shape change, granule secretion, GP

IIb/IIIa activation, and aggregation (Rivera et al., 2009). The P2Y1 receptor causes

ADP-induced shape change with weak and transient aggregation of platelets by

triggering calcium mobilization from internal stores (Cattaneo et al., 2007). The P2Y12

receptor allows for the completion and amplification of response initiated by ADP and

other platelet agonists, such as TXA2, thrombin and collagen (Cattaneo et al., 2007).

P2Y1 deficient mice exhibit minor increase in bleeding times and no spontaneous

hemorrhage, and their platelets can aggregate in the presence of ADP (Cattaneo et

al., 2007; Rivera et al., 2009). However, P2Y12 deficient mice are protected against

thrombosis, and their platelets fail to aggregate upon ADP stimulation (Cattaneo et al.,

2007; Rivera et al., 2009). Along with results from in vitro studies using specific

inhibitors, P2Y12 is identified as the major receptor to amplify and sustain ADP-

mediated platelet activation (Cattaneo et al., 2007; Rivera et al., 2009). In addition,

human platelets also express a third purinergic receptor P2X1, which is an ATP-driven

calcium channel. ADP-P2X1 interaction is unable to trigger platelet aggregation

independently (Rivera et al., 2009). However, under high shear conditions, ADP

binding to P2X1 positively regulates platelet responses to collagen, thus playing a key

role in thrombus growth (Rivera et al., 2009). P2X1-deficient mice show normal

bleeding times but are resistant to thromboembolism (Rivera et al., 2009).

1.2.1.7 Protease-activated receptors (PARs)  

PARs are GPCRs that bind to thrombin, a serine protease that plays a key role

in thrombus formation by inducing fibrin deposition and platelet activation (Bahou et

13

 

al., 2007). To date, four PARs have been identified, of which murine platelets express

PAR3 and PAR4 (Bahou et al., 2007). In contrast, human platelets express PAR1 and

PAR4 receptors (Nieswandt et al., 2005). Thrombin is an essential enzyme in the

coagulation system, and also the strongest endogenous platelet agonist (Bahou et al.,

2007). Even though thrombin’s effect on platelets are mainly mediated by PAR1 and

PAR4, GP Ibα within the GP Ib-IX-V complex is also thought to contribute (Bahou et

al., 2007). PARs have a unique activation mechanism whereby thrombin binds to the

receptor, and cleaves the extracellular N-terminus of the receptor at a specific site.

The new truncated N-terminus acts as a tethered ligand leading to self-activation of

the receptor. PAR1 is the principal thrombin-activated receptor involved in platelet

aggregation. Blockade of PAR1 with specific antagonists arrested platelet activation

at low thrombin concentration (1 nM), whereas similar blockade of PAR4 has no

inhibitory effect (Bahou et al., 2007; Rivera et al., 2009). Consequently, PAR1 is

suggested to be the primary mediator of thrombin-induced platelet activation and

PAR4 functions as a back-up receptor (Bahou et al., 2007; Rivera et al., 2009).

Recent studies have indicated PAR4 to be important for clot elasticity (Bahou et al.,

2007; Vretenbrant et al., 2007). It has also been suggested that PAR4 activation is

needed for full spreading on a fibrinogen matrix (Mazharian et al., 2007; Vretenbrant

et al., 2007). PAR4 deficient mice display prolonged bleeding times, suggesting that

intact thrombin responses are critical for normal hemostasis (Nieswandt et al., 2005).

1.2.1.8 Thromboxane prostanoid receptor (TP)  

The thromboxane prostanoid receptor (TP) is a GPCR that binds to TXA2, a

short-lived lipid mediator synthesized by activated platelets (Grosser et al., 2007).

14

 

TXA2 is derived from arachidonic acid (AA) by the sequential action of cyclooxygenase

enzymes (Awtry et al., 2007; Grosser et al., 2007). TXA2 binding to TP elicits diverse

physiological/pathophysiological actions, including platelet aggregation and VSMC

contraction (Awtry et al., 2007; Grosser et al., 2007). TP receptor signaling facilitates

dense granule secretion and initiates activation of GP IIb/IIIa to amplify platelet

responses (Grosser et al., 2007).

1.2.2 Platelet secretion  

Platelet secretion or exocytosis releases molecules from their intracellular

granules at sites of vascular injury, and accelerates the progression of atherosclerotic

lesions (Reed et al., 2007). Amongst the platelet granules, the α-granules and dense

granules are specific for megakaryocytes and platelets, whereas the lysosomes are

present in numerous cell types (Reed et al., 2007). An average platelet contains an

average of 80 α-granules, and around 8-10 dense granules (Reed et al., 2007). Upon

interaction of a secreted platelet agonist with its membrane receptor,

phosphatidylinositol 4,5 bisphosphate (PIP2) from platelet membranes is cleaved to

diacylglycerol (DAG) and inositol-1,4,5-trisphosphate (IP3) (Gachet, 2001; Reed et al.,

2007). DAG activates different forms of protein kinase C (PKC), while IP3 causes an

increase in the intracellular Ca2+ (Gachet, 2001; Reed et al., 2007). This elevation in

Ca2+ concentration is sufficient to induce platelet secretion, though the specific

mechanism remains poorly understood in platelets. In addition, PKC is also believed

to act synergistically with Ca2+ to amplify secretion (Gachet, 2001; Reed et al., 2007).

The dense granules contain fewer proteins than the α-granules and mainly

15

 

contain ADP, serotonin, polyphosphate and calcium (Reed et al., 2007). ADP released

from the dense granules amplifies platelet aggregation (Gachet, 2001). The α-

granules release a repertoire of adhesive proteins (CD62P, vWF, fibronectin, GP

IIb/IIIa), procoagulant molecules, growth factors, chemokines, and mitogenic factors

that activate platelets and other vascular cells. For instance, P-selectin trafficking to

the platelet surface, allows for platelet binding to neutrophils and monocytes, and

facilitates leukocyte rolling on platelets during vascular injury (Furie et al., 2001).

Patients with diminished or absent α-granules exhibit variable bleeding diathesis

(Weiss et al., 1979).

1.2.3 Intracellular platelet signaling In general, the main platelet stimuli can be broadly categorized into adhesion

and GPCR dependent activation. The major signaling pathways in platelets are

summarized in Figure 1.2.

16

 

Figure 1.2: Major intracellular signaling pathways in platelets. Ligation of agonists

to GPCRs and/or adhesion receptors on the platelet surface activates multiple

redundant pathways that regulate platelet functions.

17

 

The adhesion receptors linked to tyrosine kinases, such as GP VI, GP Ib-IX-V

and GP IIb/IIIa play critical roles in assembly of a downstream signaling complex,

whose end result is the activation of phospholipase Cγ (PLCγ) (Canobbio et al., 2004;

Gratacap et al., 1998; Vorland et al., 2008). PLCγ can then hydrolyze PIP2 to form

DAG and IP3, which both act as second messengers. IP3 mobilizes Ca2+ into the

cytoplasm, which is critical in accelerating platelet activation, while DAG activates

protein kinase C (PKC) (Woulfe, 2005; Yang et al., 2002). Several PKC isoforms are

expressed in platelets. Recent evidence indicates that PKC signaling contributes to

granular secretion, GPIIb/IIIa activation and actin cytoskeleton organization (Harper

and Poole, 2007; Vorland et al., 2008). Additionally, integrin-dependent activation,

particularly through GP IIb/IIIa also utilizes conformational switch mechanism (affinity

modulation) and receptor clustering (avidity modulation) (Kasirer-Friede et al., 2007;

Shattil et al., 1998; Shattil and Newman, 2004). Integrin signaling also results in the

activation of PLCγ (Nieswandt and Watson, 2003; Prevost et al., 2007).

The main platelet agonists that cause activation via GPCRs are thrombin, ADP

and TXA2. The GPCRs are associated with heterotrimeric G-proteins. The G-proteins

of the GPCRs are composed of α,β, and γ subunits. The β and γ G-protein subunits

remain tightly associated with each other, and dissociate from the α subunit upon

agonist stimulation (Wettschureck et al., 2004). The interactions of the βγ family with

specific α subunits or with particular receptors remain unexplored in platelets (Woulfe,

2005). Studies of GPCR signaling in platelets have so far focused on G-protein

mediated pathways initiated by the Gs, Gi, Gq, and G12/13 subfamilies of the α family.

The PAR receptors are coupled to Gi, Gq, and G12/13; P2Y1 is coupled to Gq and P2Y12

18

 

to Gi, and TP receptor activates Gq and G12/13 pathways (Woulfe, 2005; Yang et al.,

2002).

Agonists for receptors coupled to Gs stimulate adenylyl cyclase (AC), which in

turn elevates cAMP production (Woulfe, 2005; Yang et al., 2002). This increase in

cytosolic cAMP negatively regulates platelet functions by activating protein kinase A

(PKA), which phosphorylates several substrates that lead to sequestration of cytosolic

Ca2+ (Woulfe, 2005; Yang et al., 2002). Conversely, Gi signaling inhibits AC, thereby

reducing cAMP concentrations, and allowing platelet activation (Woulfe, 2005; Yang et

al., 2002). Gq activation stimulates the activity of phospholipase Cβ (PLCβ) (Woulfe,

2005; Yang et al., 2002). Like PLCγ, PLCβ can also hydrolyze PIP2 to form DAG and

IP3, both then acting as second messengers. IP3 mobilizes Ca2+ into the cytoplasm,

ultimately enhancing platelet adhesion, shape change and aggregation (Harper and

Poole, 2007; Vorland et al., 2008). GPCR activation of G12/13 pathway in platelets

mediates a calcium-independent shape change that involves Rho-kinases (Woulfe,

2005; Yang et al., 2002).

Recently another downstream target of Ca2+ and DAG, calcium and DAG-

regulated guanine nucleotide exchange factor 1 (CalDAG-GEF1), was found to

activate platelets following exposure to multiple agonists (Crittenden et al., 2004;

Vorland et al., 2008). CalDAG-GEF1 is a GEF for small GTPase Rap1b, which is an

important regulator of platelet adhesion and spreading (de Bruyn et al., 2003; Jackson

et al., 2004). CalDAG-GEF1 can also be activated in a calcium-independent manner

via the phosphatidylinositol 3-kinases (PI3K) pathway (Lova et al., 2003; Woulfe et al.,

19

 

2002). Several isoforms of PI3K are present in platelets and they can be differentially

activated by GPCRs and adhesion receptors (Jackson et al., 2004; Vorland et al.,

2008). PI3K mediates platelet adhesion, spreading and aggregation, by activating

several other downstream molecules, most notably protein kinase B (PKB, also known

as Akt) (Barry and Gibbins, 2002; Woulfe et al., 2004; Yin et al., 2008). Studies have

also shown that Mitogen Activated Protein Kinases (MAPK) promote platelet

aggregation and platelet spreading after exposure to low-dose agonists, although the

mechanisms downstream of extracellular-signal-regulated kinases (Erk) or p38 MAPK

are unclear (Flevaris et al., 2009; Garcia et al., 2007; Li et al., 2006; Mazharian et al.,

2007). Additionally, the Erk and p38 MAPK pathways are also activated via the PKC

pathway (Yacoub et al., 2006). As platelet activation involves several common critical

steps, a major challenge to studying platelet signaling mechanisms is discerning

whether events are a direct result of primary agonist-receptor interactions, or are due

to the activation of amplification loops and/or integrin-mediated downstream signaling.

1.2.4 Current antiplatelet therapies and atherosclerosis  

The development and progression of atherosclerosis is a multifactorial process,

with varied clinical sequelae. Therapeutic strategies targeting atherosclerosis aim to

attenuate the initial vascular insult and/or the vessel’s pathologic response to that

injury (Selzman et al., 2001). Strategies that block recruitment to the intima of immune

cells, namely, monocytes/ macrophages, lymphocytes, and of VSMC are partially

protective against vascular injury. Indeed, in both animal models and human patients,

inhibiting monocyte and VSMC recruitment to selected chemoattractants partially

prevents atherosclerosis and its clinical manifestations (Boring et al., 1997; Boring et

20

 

al., 1998; Gosling et al., 1999; Lesnik et al., 2003; Libby, 2002; McDermott et al.,

2003; McDermott et al., 2001; Ortlepp et al., 2003; Teupser et al., 2004).

Simultaneous blockade of multiple chemo-attractive pathways confers additional, but

not complete, benefit (Combadiere et al., 2003; Saederup et al., 2008; Tacke et al.,

2007). However, the chemotactic pathways are characterized by redundancy and

pleiotropy, and hence strategies targeting such specific agents are likely to have

limited clinical utility (Preiss and Sattar, 2007; Selzman et al., 2001; von der Thusen et

al., 2003). Moreover, an involvement of numerous cell types, most notably platelets, in

atherosclerosis further limits the clinical benefits of existing strategies.

Currently, medical therapies that prevent platelet activation have become

important treatment modality for patients at risk for cardiovascular events. Indeed,

anti-platelet agents are the most prescribed drugs worldwide (Meadows and Bhatt,

2007). Over the past two decades, a number of antiplatelet drugs have emerged as

our understanding of platelet activation and pathophysiology expanded. Aspirin is the

foundation of antiplatelet therapy, and acts by inactivating cyclooxygenase enzymes

(Nappi, 2008). This in turn prevents the synthesis of TXA2 by activated platelets,

resulting in inhibition of platelet aggregation and thrombus growth (Badimon and

Vilahur, 2008; Nappi, 2008). Another widely prescribed drug is clopidogrel which acts

as an ADP receptor antagonist (Bhatt, 2009). Clopidogrel and its predecessor

ticlopidine bind to P2Y12 platelet receptor irreversibly, inhibiting its association with

ADP, thus preventing platelet activation and aggregation (Badimon and Vilahur, 2008;

Bhatt, 2009). The receptor GP IIb/IIIa, which mediates platelet adhesion and signaling,

is also an attractive target for antiplatelet therapy. The intravenous GP IIb/IIIa inhibitor

21

 

abciximab, the Fab fragment of a monoclonal antibody, was the first in this class of

these agents (Badimon and Vilahur, 2008; Bhatt, 2009; Nappi, 2008). Abciximab

irreversibly binds to GPIIb/IIIa to block the binding of fibrinogen and other adhesion

molecules, thus preventing platelet aggregation. Abciximab was followed by two

synthetic molecules, eptifibatide and tirofiban, that reversibly and competitively bind to

fibrinogen receptor (Badimon and Vilahur, 2008). Eptifibatide is a cyclic heptapeptide

with the RGD sequence, and tirofiban is a non-peptide tyrosine derivative that mimics

the RGD sequence (Badimon and Vilahur, 2008). Although these antiplatelet agents

could potentially reduce the complications of atherosclerosis, their clinical utility is

questionable given the adverse haemorrhagic and immune events associated with

their use (Angiolillo et al., 2009; Bhatt, 2009; Nappi, 2008). A number of invasive

procedures, such as percutaneous coronary intervention, cardiopulmonary bypass

surgery, angioplasty, and stenting are routinely performed to treat complications of

atherosclerosis. Nevertheless, patients undergoing such procedures must remain on

long-term antiplatelet therapy afterwards (Angiolillo et al., 2009). Thus, development of

new anti-atherosclerotic agents with improved safety and efficacy remains a medical

priority.

1.3 Rho GTPases: Rac and Cdc42

Rho family GTPases constitute a distinct family of guanine nucleotide-binding

proteins that belong to the Ras superfamily of small GTP-binding proteins. To date,

more than 20 mammalian members of Rho family GTPases have been described,

including several subfamilies such as Rho (RhoA, RhoB, RhoC), Rac (Rac1, Rac2,

Rac3, RhoG), Cdc42 (Cdc42, TC10/RhoQ, TCL/RhoJ, Wrch1/RhoU,

22

 

Chp/Wrch2/RhoV), Rnd (Rnd1, Rnd2, Rnd3/RhoE), Rho-BTB (Rho-BTB1, RhoBTB2),

RhoD, and RhoH/TTF (Aspenstrom, 1999; Heasman and Ridley, 2008; Kjoller and

Hall, 1999). Rho GTPases are key regulators of actin cytoskeletal dynamics and play

critical roles in regulating biological activities such as cell migration, cell morphology,

vesicle trafficking and cytokinesis (Aspenstrom, 1999; Heasman and Ridley, 2008;

Kjoller and Hall, 1999).

1.3.1 Structure and Regulation  

All Rho GTPases contain two main structural domains, a catalytic GTP domain

and the C-terminal 'CAAX' motif (cysteine (C) followed by two aliphatic amino acids

(AA) and a terminal amino acid (X)). The GTPases undergo post-translational

modifications at the C-terminal 'CAAX' motif, involving covalent addition of isoprenoid

moieties to the cysteine residue, carboxy-terminal proteolysis of the AAX residues

followed by carboxyl-methylation. The modified C-terminal domain would then allow

the protein to associate with membrane lipids (Casey et al., 1989; Fujiyama and

Tamanoi, 1990; Gutierrez et al., 1989). The N-terminal catalytic domain of the

GTPases allows for conformational changes, via binding to GDP or GTP. Rho

GTPases function as bi-molecular switches by cycling between inactive GDP-bound

state and active GTP-bound forms. The Rho GTPases remain inactive in the cytosol

until triggered by upstream signaling events and extracellular factors to exchange

GDP for GTP, thereby activating the protein. In their GTP-bound form, Rho GTPases

are able to bind to various effectors to regulate numerous cellular responses

(Aspenstrom, 1999; Heasman and Ridley, 2008; Kjoller and Hall, 1999).

23

 

Activity of Rho GTPases is tightly controlled by the coordinated action of three

classes of regulatory proteins: guanine nucleotide exchange factors (GEFs), GTPase

activating proteins (GAPs), and guanine nucleotide dissociation inhibitors (GDIs).

GEFs activate Rho GTPases by catalyzing the exchange of bound GDP for GTP,

enabling them to recognize and activate downstream effectors. Rho GEFs are

characterized by the presence of a DH (Dbl homology) domain followed by a PH

(Pleckstrin homology) domain. Briefly, the DH domain of the Rho GTPases is critical

for the recognition of GEFs by their specific targets. GEFs disrupt binding of the

GTPases with GDP, and promote preferential binding to GTP (Rossman et al., 2005;

Snyder et al., 2002). The PH domain targets GEFs to specific subcellular membranes

through interaction with lipids (Rossman et al., 2005).

In contrast to GEFs, GAPs suppress activity of Rho GTPases by enhancing the

intrinsic rate of GTP hydrolysis to GDP. To date, more than 70 eukaryotic Rho GAPs

have been identified (Tcherkezian and Lamarche-Vane, 2007). Although GTPases

posses intrinsic GTPase activity, the actual rate of GTP hydrolysis is relatively very

low, but can be accelerated by orders of magnitude upon interaction with the Rho

GAPs (Vetter and Wittinghofer, 2001). There exists a large diversity in the primary

sequences of the various GAPs, but their tertiary structure as well as the basic

GTPase-activating mechanism is similar. Rho GAPs bind to the nucleotide-contacting

core of Rho GTPases, thus leading to conformational structural change.

Consequently, an essential arginine residue of GAPs together with a glutamine

residue of the GTPases is responsible for positioning a water molecule in the vicinity

of GTP, thereby triggering hydrolysis to inactivate the GTPases (Bos et al., 2007;

24

 

Moon and Zheng, 2003). The specificity of individual GAPs for different Rho GTPases

is thought to be determined by residues outside of the nucleotide-binding core of the

GTPases (Li et al., 1997).

The third class of regulatory proteins, GDIs, sequesters the Rho GTPases in

the cytosol and prevents the dissociation of the guanine nucleotide from the GTPases.

GDIs inhibit the activity of Rho GTPases in several ways. First, GDIs maintain the

GTPases in an inactive form by preventing the dissociation of GDP from the GTPases.

Second, GDIs can bind to isoprenyl moieties on the C-terminus of GTPases in order to

sequester them in the cytosol (Olofsson, 1999). Moreover, although Rho GDIs usually

bind to GDP-bound GTPases with high affinity, they can also interact with the GTP-

bound forms and inhibit their GTPase activity by preventing subsequent binding of

their effectors (DerMardirossian and Bokoch, 2005; Olofsson, 1999). Overall, the

function of GDIs is to prevent the activation of Rho GTPases, as well as their

interaction with membranes, and to inhibit downstream signaling networks.

1.3.2 Biological functions of Rho GTPases  

Most of our understanding on the biological functions of Rho GTPases has

been obtained from studies of RhoA, Rac1 and Cdc42, the three most extensively

characterized family members of Rho GTPases. Rho GTPases are pivotal regulators

of signaling networks that result in the mobilization of the actin cytoskeleton

(Machesky and Hall, 1997). Activation of RhoA, Rac1 and Cdc42 in fibroblasts was

observed to lead to the formation of distinctive cytoskeletal structures. RhoA induces

stress fibers and focal adhesions, while activation of Cdc42 induces formation of

25

 

filopodial microspikes (Hall, 1998; Nobes and Hall, 1995; Raftopoulou and Hall,

2004). Rac1 GTPase stimulates the formation of sheet-like lamellipodia (Hall, 1998;

Nobes and Hall, 1995; Raftopoulou and Hall, 2004). By altering the actin cytoskeleton,

Rho GTPases regulate a large variety of biological activities including morphogenesis,

cell migration, vesicle trafficking and integrin-mediated cell adhesion (Calderwood et

al., 2000; DeMali et al., 2003; Heasman and Ridley, 2008; Machesky and Hall, 1997).

Because they regulate cytoskeletal reorganization and cell morphology, Rho

GTPases are suggested to be crucial regulators of several platelet functions. Cdc42

has been implicated in filopodia formation and exocytosis in various cell types, but its

exact function in platelets is not well established. A role for Cdc42 in platelet filopodial

formation has been reported based on in vitro studies using pharmacological inhibitors

(Chang et al., 2005; Vidal et al., 2002). Surprisingly, Cdc42-deficient murine platelets

form normally shaped filopodia and spread fully on fibrinogen upon activation. Upon

selective induction of GPIb signaling by immobilized vWF, Cdc42-deficient platelets

exhibited reduced filopodia formation (Pleines et al., 2010). In the same study, Cdc42-

deficient platelets showed enhanced secretion from alpha granules, increased

aggregation at low agonist concentrations, and enhanced aggregation on collagen

under shear flow conditions. These data point to regulatory roles of Cdc42 in platelet

activation, granule organization, and specifically in GPIb signaling (Pleines et al.,

2010). Rac1 GTPase, is the major Rac isoform present in platelets and has been

shown to be crucial for platelet granular secretion, adhesion, spreading and

aggregation (Akbar et al., 2007; McCarty et al., 2005; Suzuki-Inoue et al., 2001).

Studies using Rac1-deficient platelets have established that Rac1 is essential for

26

 

platelet lamellipodia formation (McCarty et al., 2005). In addition, Rac1 is also

required for aggregate stability of platelets under physiologic shear conditions both in

vitro and in vivo (McCarty et al., 2005). Studies with RhoA inhibitors have reported a

decrease in adhesion of agonist-stimulated platelets on fibrinogen, as well as reduced

formation of focal adhesion complexes in cells spread on fibrinogen (Leng et al.,

1998). Also, it has been shown that RhoA regulates the stability of GP IIb/IIIa

adhesion contacts under high shear conditions, but has no effect on GP IIb/IIIa

activation induced by soluble agonists or adhesive substrates, such as vWF

(Schoenwaelder et al., 2002).

27

 

1.4 Slit proteins: Repulsive cue for migrating cells

Axons and neurons undergo significant transformations commencing as

unspecialized cells, and becoming complex structures that make highly specific

contacts with their target cells. The development of the central nervous system

(CNS), axon extensions and neuronal migration is co-ordinated by a combination of

long/short-range attractive or repulsive cues (Tessier-Lavigne and Goodman, 1996).

Large-scale mutant screens for CNS midline crossing defects in Drosophila

melanogaster led to the identification of the Slit family of secreted proteins and their

cell-surface receptor, Roundabout (Robo) (Rothberg et al., 1988; Seeger et al., 1993).

Most axons normally cross the midline once before projecting towards their synaptic

targets. However, Drosophila robo mutants exhibit repeated and random midline

crossing of axons, while slit mutants show a complete collapse of the axon scaffold

onto the ventral midline (Kidd et al., 1999; Kidd et al., 1998; Rothberg et al., 1990). Slit

expressed by midline glial cells, serves as a neuronal repellent for Robo expressing

axons and is required to prevent their re-crossing of the midline (Brose et al., 1999;

Kidd et al., 1999; Kidd et al., 1998; Rothberg et al., 1990). There are three known

members in the mammalian Slit family (Slit1, Slit2, and Slit3), and four members in the

Robo receptor family (Robo-1, Robo-2, Robo-3 and Robo-4) (Chedotal, 2007;

Dickinson and Duncan, 2010; Legg et al., 2008).

In addition to their roles as axonal guidance cues, the Robo receptors and their

Slit ligands play crucial roles in a variety of developmental processes outside of the

the CNS. For example, Slit/Robo proteins contribute significantly to Drosophila heart

morphogenesis and nephrogenesis. In Drosophila slit and robo mutants, the dorsal

28

 

migration of myocardial progenitor cells and their alignment is perturbed during

cardiac development (Qian et al., 2005; Santiago-Martinez et al., 2006). The

myocardial precursor cells in the mutants fuse at the dorsal midline, and fail to

establish cardiac cell polarity, leading to misalignment of the myocardium.

Interestingly, these defects can be rescued by expressing Slit and Robo at the dorsal

midline (Qian et al., 2005; Santiago-Martinez et al., 2006).

Slit/Robo signaling is also crucial for kidney development. The proper

positioning of the kidney is initiated following the formation of a structure called the

ureteric bud in response to glial cell line-derived neurotrophic factor (GDNF) secreted

by the adjacent nephrogenic mesenchyme. Embryos from Robo2-deficient and Slit2-

deficient mice exhibit abnormal patterns of GDNF secretion, supernumerary ureteric

bud development and improper insertion of the ureters into the bladder (Grieshammer

et al., 2004; Ray, 2004). Furthermore, recent studies have also associated variations

in the human Robo-2 and Slit2 genes with familial vesico-ureteral reflux, a condition

characterized by abnormal backwardflow of urine from the bladder to the kidney

(Bertoli-Avella et al., 2008; Zu et al., 2009). Therefore, Slit/Robo appear to have key

functions in the formation of the ureteric bud during nephrogenesis.

Slit/Robo also play pivotal roles in modulating migration of cancer and

inflammatory cells. We previously had demonstrated that Slit2 prevents chemotactic

migration of primary human neutrophils to diverse chemoattractants, by suppressing

activation of Rho GTPases, Rac2 and Cdc42 (Tole et al., 2009). In addition,

Slit2/Robo-1 inhibits chemotaxis and transendothelial migration of Jurkat T-

29

 

lymphocytes towards the chemokine, CXCL12 (Prasad et al., 2007). Slit2 also

inhibited migration of VSMCs toward a gradient of platelet-derived growth factor

(PDGF) by suppressing the activation of small GTPase Rac1 (Liu et al., 2006).

Another study demonstrated the inhibition of cell migration and invasion by glioma

cells by Slit2/Robo-1 via the attenuation of Cdc42 activity (Yiin et al., 2009).

Furthermore, Slit2 inhibited the cell motility and chemoinvasion of breast cancer cells

towards a gradient of the chemokine, CXCL12 (Prasad et al., 2004). Several other

studies have shown Slit2 to inhibit colony formation in lung, colorectal and breast

cancer cell lines (Dallol et al., 2002; Dallol et al., 2003). The Slit2 promoter is often

hypermethylated in these cancerous cell lines, leading to the epigenetic silencing of

the Slit2 gene (Dallol et al., 2002; Dallol et al., 2003). Collectively, these studies imply

pivotal roles for Slit outside of developing CNS.

1.4.1 Expression  

Expression of Slit genes has been demonstrated in many organisms, including

Drosophila, Caenorhabditis elegans, Xenopus, chicken, mice, rats and humans

(Battye et al., 1999; Chen et al., 2000; Hao et al., 2001; Holmes and Niswander, 2001;

Holmes et al., 1998; Itoh et al., 1998; Marillat et al., 2002; Piper et al., 2000; Yuan et

al., 1999). While invertebrates have a single Slit protein; vertebrates have three

isoforms namely named Slit1, Slit2 and Slit3 that are all expressed at the midline of

the neural tube. Slit1 is predominantly expressed in the central nervous system, while

Slit2 and, to a lesser degree, Slit3 are also expressed in many other tissues,

especially heart, kidneys, and lungs (Wu et al., 2001). Importantly, Slit expression

persists in the adult organisms, suggesting a role for Slit beyond embryogenesis.

30

 

Robo genes are expressed in numerous organisms including Drosophila, C.

elegans, mice and humans (Hao et al., 2001; Kidd et al., 1998; Yuan et al., 1999). C.

elegans have a single Robo receptor wheres three isoforms of Robo receptors were

identified in Drosophila. However, four Robo receptors (Robo-1, Robo-2, Robo-3 and

Robo-4) have been identified in vertebrates (Dickinson and Duncan, 2010). Robo-1

and Robo-2 are detected in adult spleen, thymus, liver, lung and kidney; Robo-3 is

expressed during embryonic development in the central nervous system while Robo-4

is confined to endothelial cells and function in angiogenesis (Legg et al., 2008; Wu et

al., 2001; Yuan et al., 2002). Interestingly, the tissue expression of Slit and Robo is

relatively complementary, suggestive of a functional ligand-receptor relationship (Yuan

et al., 1999).

1.4.2 Slit and Robo structure  

Slits are secreted glycoproteins (~190-200 kilodaltons) with high degree of

conservation among isoforms. All Slit proteins possess the following general structure:

an N-terminal signal peptide, four domains (D1-D4) containing leucine-rich repeats

(LRRs), six epidermal growth factor (EGF)-like domains; a laminin G-like domain (LG);

a further one or three EGF-like domains in invertebrates and vertebrates respectively,

and a C-terminal cysteine knot domain (Brose et al., 1999; Rothberg et al., 1988;

Rothberg et al., 1990). Slit2 protein is detected in the human plasma proteome (Query

ID: NP_004778) (HIP2 website, 2011). There is a putative cleavage site in human

Slit2 after the fifth EGF-like repeat (Brose et al., 1999). This cleavage of full-length

Slit2 generates N-terminal (Slit-N) and C-terminal (Slit-C) Slit2 truncated proteins

(Brose et al., 1999). The identity of the proteases that cleave Slit2 and the biological

31

 

significance of this cleavage still remain elusive. The Slit-N fragment, which contains

the four LRRs and first five EGF repeats retains the repellent activity, while the C-

terminal fragment is inactive (Nguyen Ba-Charvet et al., 2001). The cleaved fragments

have different cell association properties, with the Slit-C being more diffusible, while

Slit-N and full-length protein are more tightly associated with cell membrane (Chen et

al., 2001; Nguyen Ba-Charvet et al., 2001). Surprisingly, studies in rat neural tissue

have also demonstrated that the Slit-C binds to heparan sulfate proteoglycan

glypican-1 with higher affinity than Slit-N, suggesting another possible regulatory

mechanism at which axonal migration could be controlled (Liang et al., 1999).

Robo receptors are single-pass transmembrane proteins belonging to the

immunoglobulin (Ig) superfamily of cell adhesion molecules (CAMs). An archetypical

Robo receptor comprises of Ig motifs and fibronectin (FN) type III domains in the

extracellular portion, and conserved cytoplasmic (CC) signaling motifs, containing

different permutations of proline rich regions and tyrosine phosphorylation sites (CC0-

CC3) (Chedotal, 2007; Dickinson and Duncan, 2010; Legg et al., 2008). The

schematics of Slit and Robo proteins are shown in Figure 1.3.

The extracellular region of human Robo-1 contains five Ig repeats, three

fibronectin type III domains, and the cytoplasmic region has four cytoplasmic motifs,

CC0, CC1, CC2 and CC3 (Dickinson and Duncan, 2010; Kidd et al., 1998). The

molecular weight of Robo-1 is ~ 190-200 kilodaltons, and recent studies reveal that it

is cleaved by metalloproteinases and γ-secretase (Seki et al., 2010). Biochemical and

structural studies have revealed that the second LRR of Slit binds to the first and

32

 

second Ig domains of Robo (Howitt et al., 2004; Morlot et al., 2007). Chimeric receptor

studies have shown that the cytoplasmic portion of Robo receptors dictates its

chemorepulsive activity (Bashaw and Goodman, 1999). Recent studies have further

demonstrated that efficient Slit signaling in Drosophila CNS requires co-expression of

Robo and syndecan, a membrane-spanning proteoglycan with covalently attached

heparan sulfate chains (Johnson et al., 2004; Steigemann et al., 2004). Slit/Robo

forms a ternary complex with syndecan, stabilizing the ligand-receptor interactions.

Whether sydecan contributes to intracellular signaling in response to Slit is not known

(Hussain et al., 2006).

33

 

34

Figure 1.3: The domain organization of mammalian Slit and Robo proteins.

All Slit proteins share a similar domain structure containing an N-terminal signal

peptide, four tandem leucine-rich repeats (LRRs), nine EGF-like repeats (EGF)

separated by a conserved laminin G-like domain (LG), and a C-terminal cysteine knot

(C) domain. A putative proteolytic cleavage site has been identified in Slit2 after

EGF5. The four mammalian Robo receptors possess a common extracellular domain

structure containing immunoglobulin-like (Ig) domains and fibronectin type III (FNIII)

repeats. The cytoplasmic domains of Robo-1 and Robo-2 share the same conserved

cytoplasmic motifs (CC0, CC1, CC2 and CC3), but Robo-3 lacks the CC1 motif. Robo-

4 is the smallest of the Robo proteins, and has the least similarity with the other

members of the family. It contains only two Ig and two FNIII domains along with one

intracellular CC motif, CC2. Slit proteins can bind to Robo1–3 receptors with similar

affinities, but the binding of Slit with Robo4 is disputable.

35

 

1.4.3 Slit2/Robo-1 intracellular signal transduction  

Much of what is known about the Slit/Robo intracellular signaling have been

characterized in the Drosophila nervous system. Studies in neuronal tissue have

demonstrated that Robo-1 can signal via the cytoplasmic CC motifs through two major

pathways: Enabled (Ena) protein and Rho GTPases. Ena and its mammalian

homologue (Mena) belongs to a family of proteins that modulate actin cytoskeletal

rearrangement by binding to profilin, an actin binding protein which regulates its

polymerization (Lanier et al., 1999; Wills et al., 1999). Ena was demonstrated to be a

substrate for Abelson (Abl) tyrosine kinase, and is implicated in normal axon guidance

(Gertler et al., 1989). Genetic and biochemical evidence support a role for Abl and

Ena in Slit/Robo signaling during axonal guidance at the Drosophila midline (Bashaw

et al., 2000). Ena and Abl can both bind to Robo, Ena via the CC1 Robo motif, and

Abl via the CC3 motif (Bashaw et al., 2000). Robo mutants impaired in Ena binding

reduced Robo activity while mutations in Abl resulted in Robo hyperactivity (Bashaw et

al., 2000).

The first evidence that Slit/Robo signaling regulates Rho GTPase activity was

established with the discovery of the family of slit-robo GTPase Activating Proteins

(srGAPs) in vertebrates (Wong et al., 2001). The srGAPs contain a Fer-CIP4

homology (FCH) domain, a Src-homology 3 (SH3) domain and a Rho GTPase-

activating protein (RhoGAP) domain. The FCH domain has unknown activity, the SH3

domain is required for binding to the CC3 motif of Robo, and the RhoGAP domain has

activity for the Rho GTPases Rac, Cdc42 and Rho (Wong et al., 2001). In in vitro

studies using Human Embryonic Kidney (HEK) cells, srGAP1 bound to and inactivated

36

 

Cdc42 and RhoA, but not Rac1. In the same study, a constitutively active Cdc42

blocked the repulsive effects of Slit in neurons (Wong et al., 2001). These data

suggest a model in which Slit2/Robo-1 complex induces recruitment of srGAP1, and

allows its association with Robo-1. This is followed by the inactivation of Rho

GTPases, with subsequent inhibition of actin remodeling and cell motility. The precise

mechanism through which srGAPs activation occurs remains elusive.

1.5 Rationale, Hypothesis and Objectives

1.5.1 Rationale  

During vascular injury associated with atherosclerosis, platelet-mediated acute

thrombosis completely occludes the vessel lumen, causing cardiac or cerebral

ischemia. Atherosclerotic lesions contain numerous cells, particularly VSMCs,

monocytes/macrophages, lymphocytes and platelets whose complex interactions

orchestrate the observed vessel injury. Hence, given the variety of infiltrating cell types

and molecular migration cues involved in atherogenesis, it is unlikely that targeting a

single agent or pathway will achieve widespread clinical success. Rather, a

generalized blockade of harmful cell migration cues and platelet activation within the

vasculature would be more beneficial.

The Slit family of secreted proteins and their transmembrane receptor, Robo,

repel neuronal and axonal migration in the developing central nervous system (Brose

et al., 1999; Kidd et al., 1999; Kidd et al., 1998). Multiple lines of evidence further

suggest that Slit2 binding to its receptor, Robo-1, impairs migration of numerous

inflammatory cell types that contribute to vascular injury, namely monocytes,

37

 

lymphocytes, and VSMCs (Liu et al., 2006; Prasad et al., 2004; Prasad et al., 2007;

Tole et al., 2009; Wu et al., 2001). However, thus far the role of Slit2 in modulating

platelet functions has not been explored. As cytoskeletal changes in platelets, such as

those needed for adhesion, spreading, and granule release, are reminiscent of those

involved in cell migration, we investigated the effects of Slit2 on platelet functions.

1.5.2 Hypothesis  (i) Slit2/Robo-1 signaling can inhibit platelet functions like adhesion, spreading and

secretion in vitro.

(ii) Also, administration of exogenous Slit2 in mice impairs platelet function in vivo.

1.5.3 Objectives  (i) To determine if human and murine platelets express Robo-1, the receptor for Slit2.

(ii) To investigate the effects of Slit2 on platelet adhesion and spreading under static

and shear flow conditions.

(iii) To discern the intracellular signaling cascades via which Slit2/Robo-1 mediates

observed effects on platelet adhesion and spreading.

(iv) To determine the effects of Slit2 on platelet granular secretion.

(v) To test effects of Slit2 on platelet functions in vivo using a murine tail-bleeding

model.

 

38

CHAPTER 2: MATERIALS AND METHODS

2.1 Reagents and antibodies

Horm collagen (Equine Type 1) was from Nycomed (Melville, NY) and hirudin

from Bayer Inc. (Toronto, ON). Human fibrinogen, fibronectin, and all other chemicals

were purchased from Sigma-Aldrich (St.Louis, MO, USA). The following primary

antibodies were used: anti-Robo-1 (Abcam, Cambridge, MA, and Santa Cruz

Biotechnology, Santa Cruz, CA, USA), phycoerythrin (PE)-conjugated anti-CD62P (BD

Biosciences, Mississauga, ON, Canada), and fluorescein isothiocyanate (FITC)-

conjugated anti-CD41 (BD BioSciences). Anti-Cdc42 , anti-Rac1, anti-Erk, anti-

phospho-Erk, anti-p38 MAPK, anti-phospho-p38 MAPK, anti-Akt, and anti-phospho-

Akt were all purchased from Cell Signaling (Danvers, MA, USA). Alexa Fluor 488-

conjugated phalloidin was from Invitrogen (Burlington, Ontario, Canada). The following

secondary antibodies were used: Alexa Fluor 568-conjugated anti-rabbit IgG

(Invitrogen), Alexa Fluor 488-conjugated anti-rabbit IgG (Invitrogen) and HRP-

conjugated anti-rabbit IgG and anti-mouse IgG (Jackson Immunoresearch

Laboratories, Bar Harbor, ME, USA).

Large-scale expression and purification of Slit2 was performed using HEK293-

EBNA1 cells, as previously described (Tole et al., 2009). Briefly, human Slit2 cDNA

cloned into the pTT28 was transfected into HEK293-EBNA1 cells grown in suspension

as described previously (Durocher et al., 2002). Culture medium was harvested by

centrifugation (4000 g for 15 min) after 120 h post-transfection. Slit2 secreted into the

medium was purified by immobilized metal-affinity chromatography using a Fractogel-

cobalt column equilibrated in PBS. Washing steps were performed with 5 CV Wash1

39

 

buffer (50 mM sodium phosphate, pH 7.0, 300 mM NaCl), followed by washes with 5

CV Wash2 buffer (50 mM sodium phosphate, pH 7.0, 300 mM NaCl, 25 mM

imidazole). Slit2 was then recovered from the column with elution buffer (50 mM

sodium phosphate, pH 7.0, 300 mMNaCl, 25 mM imidazole). The eluted protein was

desalted on Econo-Pac™ 10 columns (Bio-Rad Laboratories, Ontario, Canada) as per

the manufacturer’s specifications. Endotoxin levels in the purified protein were

measured using ToxinSensor Chromogenic Limulus amoebocyte lysate endotoxin

assay kit (GenScript Corp., Piscataway, NJ, USA), and purity was verified by Ponceau

staining and immunoblotting.

2.2 Isolation of primary human and murine platelets

Whole blood (6 vol) was collected from healthy donors into acid citrate dextrose

(ACD; 1 vol) and centrifuged at 160g for 15 min at 20oC to obtain platelet-rich plasma

(PRP). Washed platelets were isolated from PRP following centrifugation at 800g for

10 minutes, and washed twice with PBS adjusted to pH 6.3 with ACD. The final pellet

was resuspended in HEPES (10mM) modified Tyrode’s buffer (136 mM NaCI, 2.7 mM

KCl, 0.42 mM NaH2PO4, 19 mM NaHCO3, 0.35 Na2HPO4, 5.5 mM glucose, 1mM

CaCl2, 1mM MgCl2 pH 7.2) at the desired cell density.

Murine blood was collected by cardiac puncture in hirudin (20 µg/ml) and

centrifuged at 100g for 10 min to obtain PRP. Platelets were fixed using an equal

volume of 8% paraformaldehyde for 15 min, washed twice as above, and

resuspended in HEPES-Tyrode’s buffer for immunofluorescent labeling.

40

 

2.3 Immunofluorescent labeling of platelets

Immunofluorescent labeling of washed platelets was performed as previously

described (Licht et al, 2009). Briefly, platelets were fixed with 4% paraformaldehyde,

permeabilized with 0.5% Triton X-100, and incubated with antibody detecting Robo-1

or CD62P (P-Selectin).

2.4 Immunoblotting

Cell lysates were harvested from human megakaryocytes and from mature

platelets as described previously (Lo et al., 2005). Proteins were separated by SDS-

PAGE and transferred to nitrocellulose membranes. Immunoblotting was performed

using antibodies specifically detecting Robo-1, followed by HRP-conjugated

secondary antibodies. Blots were imaged using Western Lightning ECL (PerkinElmer

Health Sciences) onto X-ray film scanned at 600 dpi.

In other experiments, platelet suspensions (2x108/ml) were incubated with Slit2

(4.5 µg/ml) for 10 minutes at 37°C, and allowed to settle onto fibrinogen coated

surfaces for 30 minutes. Non-adherent cells were washed away and cell lysates were

harvested from adherent platelets using 0.2ml ice-cold lysis buffer (50mM Tris pH7.5,

10% glycerol, 1% NP-40, 100mM NaCl, 5mM MgCl2, 1mM PMSF, 1x protease

inhibitor cocktail, 0.2mM NaVO3, 1mM DTT). Proteins were separated onto a 12%

SDS-PAGE and immunoblotting performed using antibodies recognizing phospho-Akt,

phospho-Erk, or phospho-p38 MAPK. To control for protein loading, blots were

stripped and re-probed with antibodies detecting total Akt, total Erk, or total p38

MAPK, respectively. Densitometry analysis was performed using ImageJ software,

41

 

and signal intensity of bands detecting phospho-Akt, phospho-Erk, and phospho-p38

MAPK was normalized to bands detecting total Akt, Erk, and p38 MAPK, respectively.

2.5 Platelet spreading assays

Spreading assays were performed as previously described with minor

modifications (Mazharian et al., 2007; Suzuki-Inoue et al., 2001). Glass coverslips

were coated with fibrinogen (100 µg/ml) or fibronectin (50 µg/ml) for 1 hour at room

temperature, or collagen (100 µg/ml) for 1 hour at 37oC in 24-well plates. The

coverslips were then washed, and blocked with 2% BSA for 30 minutes at room

temperature. Washed platelets (107/ml) were pre-incubated with Slit2 (4.5 µg/ml) or

equal volumes of PBS for 10 minutes, and allowed to settle onto fibrinogen-,

fibronectin- or collagen-coated coverslips for various times (Tole et al., 2009). Non-

adherent cells were removed by washing with PBS thrice. The adherent cells were

then fixed and labeled with Alexa Fluor488-conjugated phalloidin for 30 min at room

temperature (Mazharian et al., 2007; Suzuki-Inoue et al., 2001). Cells were mounted

onto glass slides and visualized using a spinning disc DMIRE2 confocal microscope

(Leica Microsystems, Toronto, Canada). Fifteen images from random fields were

acquired using a 100x objective lens (1.4 numerical aperture) equipped with a

Hamamatsu back-thinned EM-CCD camera, a Leica focus drive and a 1.5x

magnification lens (Spectral Applied Research). The surface area was calculated

using VolocityTM analysis software.

For live real-time spreading assays, platelets (107/ml) were added to fibrinogen-

coated coverslips mounted in an Attafluor® cell chamber (Invitrogen), and placed on

42

 

the heated stage of the microscope. Time-lapse imaging and surface area calculation

was performed using VolocityTM software (Improvision, Lexington, MA).

2.6 Platelet adhesion under flow conditions

The Bioflux microfluidic system (Fluxion Biosciences, California, USA), a

platform to mimic physiologic shear flow conditions was used to assess platelet

adhesion onto collagen. The microfluidic channels were coated with collagen (100

µg/ml) for 1 hour at 37oC, then washed with PBS and blocked with 2% BSA for 30 min

at room temperature. Washed platelets (107/ml) were pre-labeled with calcein-AM

(4µM), incubated with Slit2 (4.5 µg/ml) or equal volumes of PBS for 10 minutes, and

flowed through the channels at constant shear rates of 1000 s-1 or 1900 s-1 for 4

minutes. The channels were then washed with HEPES-Tyrode’s buffer at the same

shear rates for 4 minutes, and imaged at 10x on a Leica DMIRE2 deconvolution

microscope (Siljander et al., 2004). The surface area covered by adherent platelets

was quantified using the BiofluxTM 200 analysis software (Fluxion Biosciences).

2.7 Rac1 and Cdc42 activation assays

The activity of Rac1 and Cdc42 were tested as previously described (Tole et

al., 2009). Briefly, the p21-binding domain (PBD; aa 67–150) of PAK1 was cloned into

the pGEX-4T3 vector, and expressed as a GST fusion protein in BL21 (DE3)

Escherichia coli cells. The GST-PBD fusion protein was bound onto glutathione

sepharose 4B beads (GE Healthcare Bio-Sciences, Piscataway, NJ, USA), aliquoted

and stored at - 80°C till use. Following incubation with Slit2 (4.5 µg/ml) or PBS, 0.5 ml

washed platelets (1.2x109/ml) were allowed to spread onto fibrinogen coated wells for

43

 

30 minutes. Non-adherent platelets were removed by washing twice with PBS and

lysates obtained from adherent platelets using ice-cold lysis buffer (50mM Tris pH7.5,

10% glycerol, 1% NP-40, 100mM NaCl, 5mM MgCl2, 1mM PMSF, 1x protease

inhibitor cocktail, 0.2mM NaVO3, 1mM DTT). Samples were centrifuged at 13000g for

5 minutes at 4°C, and supernatants were added to GST-PBD glutathione beads (20

µg GST PBD/sample). Samples were rotated at 4°C for 1 h and washed three times

with cold wash buffer (50 mM Tris, pH 7.5, 40 mM NaCl, 0.5% NP-40, 30 mM MgCl2).

Bound proteins were eluted with 2x Laemmli loading buffer. Proteins were separated

using SDS-PAGE, transferred to a 0.2µm PVDF (Millipore) membrane, and probed

using antibodies for Rac1 or Cdc42. Densitometry analysis was performed on the

blots using ImageJ software.

2.8 Platelet granular secretion

Cell surface CD62P mobilization, a marker of platelet activation, was measured

by flow cytometry as previously described (Hagberg and Lyberg, 2000). Briefly, PRP

was diluted with HEPES-Tyrode’s buffer to obtain a platelet concentration of 107/ml,

and activated with ADP (10 µM) for 1 min (Hagberg and Lyberg, 2000). In some

instances, platelets were incubated with Slit2 for 10 min prior to incubation with ADP.

The samples were then fixed with equal volume of 1% paraformaldehyde for 30

minutes. Samples were washed once with FACS buffer (PBS with 0.3% BSA, 10 mM

NaN3), and incubated with anti-CD62P-PE and anti-CD41-FITC antibody for 30 min.

Flow cytometry was performed using Becton-Dickinson LSR II (Becton-Dickinson) and

BD FACSDiva software. Subsequent analysis was performed using FlowJo software

(Tree Star, Inc., Ashland, OR, USA).

44

 

2.9 Murine tail bleeding assays

To test the effects of Slit2 on platelet function in vivo, murine tail bleeding

assays were performed as previously described (Cho et al., 2008). Animals were

cared for in accordance with the Guide for the Humane Use and Care of Laboratory

Animals, and all protocols were approved by The Hospital for Sick Children Research

Institute Animal Care Committee. Briefly, Slit2 (0-1.8 µg/mouse) was injected

intravenously by tail vein injection in CD1 mice (28-30 grams; Charles River

Laboratories, Wilmington, MA, USA). Two hours later, mice were anesthetized using

2.5-5% isoflourane and 1 L/min oxygen, and placed on a heating pad. Five mm of the

distal tail was amputated using surgical scissors, and the remaining tail was

immediately immersed in 10 ml of 0.9% NaCl pre-warmed to 37oC (Cho et al., 2008).

The time required for spontaneous bleeding to cease was recorded. The amount of

bleeding was quantified by measuring the hemoglobin content in the pre-warmed

saline. Samples were centrifuged at 250g for 15 minutes. The resultant pellet was

resuspended in 2 ml lysis buffer (155.2mM NH4Cl, 10mM KHCO3, and 0.13mM

EDTA), and the absorbance of the sample was measured at 575 nm.

2.10 Statistical analysis

Analysis of Variance (Combadiere et al.), followed by Bonferonni’s post-hoc

testing was performed using SPSS statistical software (Version 18.0) to compare

group means in multiple comparisons. For tail bleeding experiments, ANOVA followed

by Dunnett’s post-hoc testing was performed. In all other cases, the Student’s two-

tailed t-test was used. p< 0.05 was considered significant.

 

45

CHAPTER 3: RESULTS

3.1 Platelets express Robo-1 on their surface

Immunoblot analysis of cell lysates detected expression of the Slit2 receptor,

Robo-1, in human platelets and their precursor megakaryocytes (Fig. 3.1 a). Laser

confocal microscopy showed that in human and murine platelets, Robo-1

predominantly localized at the cell surface, with some expression inside the cells (Fig.

3.1 b,c,d). Localization of P-selectin (green) within the interior of platelets confirmed

the resting state of platelets (Fig 3.1 d).

3.2 Slit2 inhibits spreading of human platelets

The potential effects of Slit2 on platelet function were first examined by

assessing the effects of Slit2 on adhesion and spreading of human platelets on a

fibrinogen-coated surface. Untreated cells progressively spread on fibrinogen-coated

cover slips during a 30 min observation period (Fig. 3.2 a,b). In the presence of Slit2,

platelet spreading was markedly decreased, with cells exhibiting short, warped

filopodia and decreased formation of lamellar sheets (Fig. 3.2 a). After 30 min, the

mean platelet surface area was 20.9 ± 2.5 µm2 in the presence of Slit2, significantly

less than the 33.4 ± 0.6 µm2 mean surface area observed for untreated cells (Fig. 3.2

b; p < 0.05). In real-time visualization, Slit2-treated platelets exhibited rounding of the

cell body and development of dynamic and motile filopodial structures but limited

formation of lamellar sheets between the filopodia (Fig. 3.3). This was in sharp

contrast to the smooth, fluid formation of filopodia and lamellipodia seen when Slit2

was not present (Fig. 3.3).

46

 

Platelet spreading on fibrinogen is mediated by cell surface GP IIb/IIIa

receptors, while interaction with fibronectin also involves GP Ic/IIa and GP IIb/IIIa

receptors (Kuijpers et al., 2003; McCarty et al., 2004; Ruggeri, 2002). Platelet

spreading on collagen involves GP VI and GP Ia/IIa receptors (Kuijpers et al., 2003;

Moroi et al., 1996; Ruggeri, 2002). The effects of Slit2 on platelet spreading on

fibronectin and collagen were examined as described above. After 30 min, the mean

surface area of platelets on fibronectin-treated cover slips was 19.3 ± 2.6 µm2 in the

presence of Slit2, significantly less than untreated cells (31.7 ± 1.8 µm2; Fig. 3.4 a,b; p

< 0.05). On collagen-treated cover slips, the mean surface area was 13.5 ± 0.7 µm2 in

the presence of Slit2, significantly less than untreated cells (20.8 ± 1.9 µm2; Fig. 3.5

a,b; p < 0.05). Slit2, however, did not affect the spreading of platelets on uncoated

glass surfaces (Fig. 3.6 a,b).

3.3 Slit2 inhibits platelet adhesion under physiologic flow conditions

Collagen is the first potentially activating substrate that platelets typically

encounter within an injured blood vessel, and their response is sensitive to shear flow

conditions. We used Bioflux microfluidic channels coated with collagen to mimic

hydrodynamic flow conditions that would be encountered by platelets within the

arterial circulation (Kroll, 2001). For untreated cells, the average surface area covered

by platelets after 4 min was 8.3 ± 1.3 % at shear flow rates of 1000 sec-1 (Fig. 3.7

a,b); for cells treated with Slit2, this area markedly decreased to 1.3 ± 0.5% (Fig. 3.7

a,b; p<0.01). At shear flow rates of 1900 sec-1, comparable to hydrodynamic

conditions encountered within large arteries, the average platelet surface area

coverage decreased four-fold from 12.0 ± 2.4 % to 3.1 ± 0.9% with Slit2 treatment

47

 

(Fig. 3.7 a,b; p<0.05).

3.4 Slit2 does not affect Rac1 and Cdc42 activation during platelet spreading

Slit2 has been shown to prevent chemotactic migration of various cell types by

preventing activation of the Rho-family GTPases, Cdc42 and Rac (Kanellis et al.,

2004; Liu et al., 2006; Prasad et al., 2007; Tole et al., 2009). To determine whether

Slit2 inhibits platelet adhesion and spreading in a similar manner, we used GST beads

conjugated to the p21-binding domain (PBD) of PAK1 to detect the activated GTP-

bound species of Cdc42 and Rac (Tole et al., 2009). Since the predominant isoform

of Rac in human platelets is Rac1, we specifically studied the effects of Slit2 on Rac1

activation (McCarty et al., 2005). Unstimulated platelets exhibited low basal levels of

activated Rac1 and Cdc42 (Fig. 3.8 a,b), and as expected, platelet spreading on

fibrinogen increased levels of activated Rac1 five-fold and Cdc42 four-fold (Fig. 3.8

a,b; Rac1, basal 1.0 vs fibrinogen 4.9 ± 1.1 p < 0.05; Cdc42, basal 1.0 vs fibrinogen

4.1 ± 0.8; p < 0.01). Slit2 did not affect basal levels of activated Rac1 and Cdc42, nor

did it prevent activation of these Rho-family GTPases during platelet spreading (Fig.

3.8 a,b; Rac1, basal 1.0 vs fibrinogen 1.3 ± 0.3; Cdc42, basal 1.0 vs fibrinogen 1.7 ±

0.3; Rac1, control 4.9 ± 1.1 vs Slit2 4.6 ± 1.3; Cdc42, control 4.1 ± 0.8 vs Slit2 3.6 ±

0.8). These data suggest that Slit2 does not inhibit platelet spreading by preventing

activation of Rac1 or Cdc42.

48

 

3.5 Slit2 suppresses activation of Akt, but not Erk or p38 MAPK during platelet

spreading

Adhesion of platelets also involves activation of several major kinase pathways,

namely p38 MAPK, Erk and Akt (Chen et al., 2004; Lai et al., 2001; Li et al., 2006;

Mazharian et al., 2007; Woulfe et al., 2004). As expected, platelet spreading on

fibrinogen resulted in a significant increase in phosphorylation of p38 MAPK, Erk, and

Akt (Fig. 3.9 a-c; p38 MAPK, 4.0 ± 0.9 vs basal 1.0, p < 0.05; Erk, 4.6 ± 0.9 vs. basal

1.0, p < 0.01; Akt, 8.0 ± 0.6 vs basal 1.0, p < 0.0001). Slit2 treatment had no effect on

the basal level of kinase activation (Fig. 3.9 a-c; p38 MAPK, 1.1 ± 0.3 vs. basal 1.0;

Erk 1.6 ± 0.5 vs basal 1.0; Akt 1.1 ± 0.2 vs basal 1.0). Slit2 treatment had no effect on

phosphorylation of p38 MAPK or Erk (Fig. 3.9 a, b; p38 MAPK, control 4.0 ± 0.9 vs

Slit2 3.0 ± 1.0; Erk, control 4.6 ± 0.9 vs Slit2 3.5 ± 0.8). In contrast, Slit2 significantly

inhibited activation of Akt (Fig. 3.9 c, control 8.0 ± 0.6 vs Slit2 2.8 ± 0.7; p < 0.005).

Collectively, these data suggest that Slit2 inhibits platelet spreading, in part, by

suppressing activation of Akt.

3.6 Slit2 inhibits ADP-mediated platelet activation

When platelets adhere to injured blood vessels and become activated they

release several molecules, including ADP, that trigger vascular inflammation, platelet

activation and aggregation. We examined the ability of Slit2 to influence platelet

activation by using flow cytometry to monitor cell surface expression of CD62P, which

translocates from α-granules to the surface in activated platelets. In untreated cells,

ADP stimulation significantly increased the percentage of platelets expressing cell-

surface CD62P (Fig. 3.10 a,c,e; control 2.0 ± 0.5 vs ADP 25.0 ± 2.2; p < 0.0001), and

49

 

this response was significantly less for cells treated with Slit2 (Fig. 3.10 c-e; 13.2 ±

1.9; p < 0.01). These results indicate that in addition to inhibiting platelet responses to

adhesive substrates, Slit2 also modulates platelet responses to soluble agonists such

as ADP.

3.7 Slit2 prolongs bleeding times in vivo

We have observed that Slit2 inhibits platelet adhesion, spreading and activation

in vitro. To determine Slit2’s possible effects on platelet function in vivo we used the

well-described murine tail bleeding model. Following administration of control vehicle,

bleeding time was 24.3 ± 2.7 s (Fig. 3.11 a). Following intravenous administration of

Slit2 at doses of 1 µg/mouse and 1.8 µg/mouse the bleeding time was significantly

prolonged to 61.5 ± 9.5 s and 69.8 ± 8.9 s respectively (Fig. 3.11 a; Slit2 1 µg, p <

0.05 vs. vehicle; Slit2 1.8 µg, p < 0.01 vs. vehicle). To supplement these

observations, the hemoglobin content of the saline into which the amputated tails were

immersed was quantified by measuring absorbance at 575 nm. Following

administration of vehicle, the absorbance was 0.12 ± 0.01 (Fig. 3.11 b), which rose to

0.20 ± 0.01 (Fig. 3.11 b, p < 0.01 vs. vehicle) for Slit2 1.0 µg dose and 0.22 ± 0.02

(Fig. 3.11 b, p < 0.01 vs. vehicle) for Slit2 1.8 µg. Thus, Slit2 prolongs bleeding time

in mice in a dose-dependent manner, indicating that it inhibits platelet-mediated

hemostatic function in vivo.

130

230

Platele

ts

Megak

aryoc

ytesa b

Robo-1

Figure 3.1

c d

50

51

 

Figure 3.1: Human and murine platelets express Robo-1 on the cell surface. (a)

Cell lysates from human platelets and megakaryocytes were subjected to

immunoblotting and probed with anti-Robo-1 primary antibody and HRP-conjugated

anti-rabbit IgG. (b) Washed human platelets were fixed, permeabilized and labeled

with anti-Robo-1 antibody followed by Alexa Fluor 488-conjugated anti-rabbit antibody.

Image acquisition was performed using a Leica DMIRE2 spinning disc confocal

microscope at 100X magnification. Scale bar represents 4 µm. (c) Platelets were

isolated from mouse peripheral blood, fixed, permeabilized and incubated with anti-

Robo-1 antibody followed by Alexa Fluor 568-conjugated rabbit antibody. Image

acqusition was performed using a Leica DMIRE2 spinning disc confocal microscope at

63X magnification. Scale bar represents 4 µm. (d) Murine platelets were incubated

with anti-CD62P detected by Alexa Fluor 488-conjugated goat antibody and anti-

Robo-1 detected using Alexa Fluor 568-conjugated rabbit antibody. Scale bar

represents 2 µm. Right panel, image in the YZ plane (scale bar 1.2 µm).

'" #!" #'" $!" %!"

)*+#,(

!"

#!"

$!"

%!"

&!"

'" #!" #'" $!" %!"

$%&#%'(

ControlSlit2

10

20

30

40

Aver

age

surfa

ce a

rea

(μm

)

2

Time (min)

a

b

* *

* * *

5 min 10 min 15 min 20 min 30 min

Con

trol

Slit

2

05 10 15 20 30

Figure 3.2

52

53

 

Figure 3.2: Slit2 inhibits human platelet spreading on fibrinogen. Isolated

human platelets (107/ml) were pre-incubated with Slit2 (4.5 µg/ml) or equal volume of

PBS (control) for 10 min at 37oC, and dispensed onto coverslips pre-coated with

fibrinogen (100 µg/ml). (a) Platelets adherent to fibrinogen were fixed, permeabilized,

incubated with Alexa Fluor 488-conjugated phalloidin, and visualized using a Leica

DMIRE2 spinning disc confocal microscope. Scale bars represents 11 µm. (b)

Experiments were performed as in (a). Images were acquired from 15 random fields

and the surface area of platelets was quantified using VolocityTM software. Data are

expressed as mean ± SEM from 3 independent experiments. *, p<0.05.

Control Slit2

0 m

in4

min

6 m

in10

min

20 m

in30

min

Figure 3.3

54

55

 

Figure 3.3: Time-lapse videomicroscopy of Slit2 treated platelets. Isolated human

platelets (107/ml) were pre-incubated with Slit2 (4.5 µg/ml) or equal volume of PBS

(control) for 10 min at 37oC. The platelet suspension was dispensed onto fibrinogen-

coated glass coverslips in an Attafluor® cell chamber and placed on the heated stage

of a Leica DMIRE2 deconvolution microscope at 100X magnification. Images were

acquired every 10 s for up to 30 min using VolocityTM software interfaced with a

Hamamatsu C4242-95-12ERG camera.

)*+#,(

!"

'" #!" #'" $!" %!"

a

b

*

*

* *

*

5 min 10 min 15 min 20 min 30 min

Con

trol

Slit

2

#!"

$!"

%!"

&!"

10

20

30

40

Aver

age

surfa

ce a

rea

(μm

)

2

0'" #!" #'" $!" %!"

Time (min)5 10 15 20 30

$%&#%'(

ControlSlit2

Figure 3.4

56

57

 

Figure 3.4: Slit2 inhibits human platelet spreading on fibronectin. Isolated

human platelets (107/ml) were pre-incubated with Slit2 (4.5 µg/ml) or equal volume of

PBS (control) for 10 min at 37oC, and dispensed onto coverslips pre-coated with

fibronectin (50 µg/ml). (a) Platelets adherent to fibronectin were fixed, permeabilized,

incubated with Alexa Fluor 488-conjugated phalloidin, and visualized using a Leica

DMIRE2 spinning disc confocal microscope. Scale bars represents 11 µm. (b)

Experiments were performed as in (a). Images were acquired from 15 random fields

and the surface area of platelets was quantified using VolocityTM software. Data are

expressed as mean ± SEM from 3 independent experiments. *, p<0.05; **, p<0.01.

)*+#,(

a

b

*

*

10 min 30 minC

ontro

lS

lit2

10 30Time (min)

0

5

10

15

20

25

Aver

age

surfa

ce a

rea

(μm

) 2

$%&#%'(

ControlSlit2

Figure 3.5

58

59

 

Figure 3.5: Slit2 inhibits human platelet spreading on collagen. Isolated human

platelets (107/ml) were pre-incubated with Slit2 (4.5 µg/ml) or equal volume of PBS

(control) for 10 min at 37oC, and dispensed onto coverslips pre-coated with collagen

(100 µg/ml). (a) Platelets adherent to collagen were fixed, permeabilized, incubated

with Alexa Fluor 488-conjugated phalloidin, and visualized using confocal microscopy.

Scale bars represents 11 µm. (b) Experiments were performed as in (a). Images

were acquired from 15 random fields and the surface area of platelets was quantified

using VolocityTM software. Data are expressed as mean ± SEM from 4 independent

experiments. *, p<0.05.

)*+#,(

a

b

10 min 30 minC

ontro

lS

lit2

10 30Time (min)

0

10

20

30

40

Aver

age

surfa

ce a

rea

(μm

) 2

$%&#%'(

ControlSlit2

Figure 3.6

60

61

 

Figure 3.6: Slit2 does not inhibit human platelet spreading on glass. Isolated

human platelets (107/ml) were pre-incubated with Slit2 (4.5 µg/ml) or equal volume of

PBS (control) for 10 min at 37oC, and dispensed onto uncoated glass coverslips. (a)

Platelets adherent to glass were fixed, permeabilized, incubated with Alexa Fluor 488-

conjugated phalloidin, and visualized using a Leica DMIRE2 spinning disc confocal

microscope. Scale bars represents 11 µm. (b) Experiments were performed as in (a).

Images were acquired from 15 random fields and the surface area of platelets was

quantified using VolocityTM software. Data are expressed as mean ± SEM from 4

independent experiments.

Con

trol

Slit

2C

ontro

lS

lit2

a

b

1000 sec-1 1900sec-1

% s

urfa

ce a

rea

cove

rage

4

8

12

16 ControlSlit2

* *

*

1000

sec

-119

00se

c-1

DIC Calcein

Slit

2C

ontro

lS

lit2

Figure 3.762

63

 

Figure 3.7: Slit2 inhibits platelet adhesion to collagen under physiological shear

flow conditions. (a) Washed human platelets (107/ml) were incubated with calcein-

AM (4 µM) for 20 min and pre-incubated with Slit2 (4.5 µg/ml) or an equal volume of

PBS (control) for 10 min at 37oC. Platelets were perfused over collagen-coated

BiofluxTM micro-fluidic channels at constant shear rates of 1000 sec-1 or 1900 sec-1 for

4 min. Channels were washed with HEPES-Tyrode’s buffer for 4 min at the same

shear rates and images acquired by differential interface contrast and fluorescence

microscopy at 10x on a Leica DMIRE2 deconvolution microscope. The width of the

channel indicated by the dashed arrows is 350 µm. Images are representative of 3-5

independent experiments. (b) Platelet adhesion to collagen-coated micro-fluidic

channels was quantified using BiofluxTM 200 analysis software. Data are expressed

as mean ± SEM from 3-5 independent experiments. *, p<0.05; **, p<0.01.

1234

0

567

0 min 30 min

0 min 30 min

1234

0

56

a

b

* *

*

$%&#%'(

ControlSlit2

$%&#%'(

ControlSlit2

GTP-Rac1

total Rac1

GTP-Cdc42

total Cdc42

- + - +

- + - +

0 min 30 min

0 min 30 min

Norm

alize

d in

tens

ity

Norm

alize

d in

tens

ity

Figure 3.8

64

65

 

Figure 3.8: Slit2 does not inhibit activation of the Rho GTPases- Rac1 and

Cdc42. Washed human platelets were pre-incubated with Slit2 (4.5 µg/ml) or an

equal volume of PBS (control) for 10 min at 37oC, and allowed to spread on

fibrinogen-coated wells for 30 min. Wells were washed with PBS to remove non-

adherent platelets, and cell lysates harvested from adherent platelets. (a) Cell lysates

were incubated with GST-PBD glutathione beads to immunoprecipitate activated

Rac1, and immunoblotting performed using anti-Rac1 antibody. Lower panel, band

intensities of GTP-Rac1 normalized to total Rac1 expressed as mean ± SEM from 5

independent experiments. (b) Cell lysates were incubated with GST-PBD glutathione

beads to immunoprecipitate activated Cdc42, and immunoblotting performed using

anti-Cdc42 antibody. Lower panel, band intensities of GTP-Cdc42 normalized to total

Cdc42 expressed as mean ± SEM from 6 independent experiments. *, p<0.05; **,

p<0.01.

2

4

6

8

0

10

0 min 30 min

c

* * * * * * $%&#%'(

ControlSlit2

p-Akt

total Akt

- + - +0 min 30 min

*

Norm

alize

d in

tens

ity

1234

0

56

ControlSlit2

b

Norm

alize

d in

tens

ity

- + - +0 min 30 min

p-Erk

total Erk

* *

0 min 30 min

1234

0

56

0 min 30 min

a

*

$%&#%'(

ControlSlit2

p-p38 MAPK

total p38 MAPK

- + - +0 min 30 min

Norm

alize

d in

tens

ity

Figure 3.966

67

 

Figure 3.9: Slit2 inhibits activation of Akt but not Erk, or p38 MAPK. Washed

human platelets were pre-incubated with Slit2 (4.5 µg/ml) or an equal volume of PBS

(control) for 10 min at 37oC, and allowed to spread on fibrinogen-coated wells for 30

min. Wells were washed with PBS to remove non-adherent platelets, and cell lysates

harvested from adherent platelets. (a) Immunoblotting was performed using anti-

phospho-p38 MAPK antibody. Blots were stripped and re-probed with antibody

detecting total p38 MAPK. Lower panel, band intensities of p-p38 MAPK normalized

to total p38 MAPK expressed as mean ± SEM from 7 independent experiments. (b)

Immunoblotting was performed using anti-phospho-Erk antibody. Blots were stripped

and re-probed with antibody detecting total Erk. Lower panel, band intensities of p-Erk

normalized to total Erk expressed as mean ± SEM from 8 independent experiments.

Mean ± SEM from 8 independent experiments. (c) Immunoblotting was performed

using anti-Akt antibody. Blots were stripped and re-probed with antibody detecting

total Akt. Lower panel, band intensities of p-Akt normalized to total Akt expressed as

mean ± SEM from 4 independent experiments. *, p<0.05; **, p<0.01; ***, p<0.005;

****, p<0.0001.

2.35

28.8 10.5

2.3Control Slit2

ADP ADP+Slit2

15

5

10

20

2530

0

Unstimulated ADP

% C

D62

P po

sitiv

e ce

lls

a

ec

b

d

# of

CD

62P

-pos

itive

cel

ls

#of CD41-positive cells

# of

CD

62P

-pos

itive

cel

ls#

of C

D62

P-p

ositi

ve c

ells

#of CD41-positive cells

#of CD41-positive cells#of CD41-positive cells

# of

CD

62P

-pos

itive

cel

ls

*

102

103

104

105

0

0 102 103 104 105

102

103

104

105

0

102

103

104

105

0102

103

104

105

0

0 102 103 104 105

0 102 103 104 1050 102 103 104 105

* *

$%&#%'(

ControlSlit2

Figure 3.10

68

69

 

Figure 3.10: Slit2 suppresses ADP-mediated platelet activation response.

Platelet-rich plasma (PRP) was diluted with HEPES-Tyrode’s buffer to a cell density of

107/ml, and incubated with Slit2 (4.5 µg/ml) or an equal volume of PBS (control) for 10

min at 37oC. Platelets were stimulated with ADP (10 µM) for 1 min, fixed and

incubated with phycoerythrin-conjugated anti-CD62P antibody and fluorescein

isothiocyanate-conjugated anti-CD41 antibody. Flow cytometric analysis was

performed using a Becton-Dickinson LSR II and FlowJo software. (a) Resting

platelets (control). (b) Resting platelets incubated with Slit2. (c) Platelets stimulated

with ADP. (d) Platelets pre-incubated with Slit2 prior to ADP stimulation.

Representative images of one from three similar independent experiments are shown.

Numerical values indicate percentage of platelets positive for both surface CD62P and

CD41. (e) Graph depicting the percentage of CD62P-positive resting platelets

(control), resting platelets incubated with Slit2, platelets activated with ADP, and

platelets pre-treated with Slit2 prior to activation with ADP. Data are expressed as

mean ± SEM from 3 independent experiments. *, p<0.01; **, p<0.0001.

1020

50

70

60

4030

8090

0.05

0.10

0.15

0.20

0.25

0.30

Vehicle 1.8 μg

Slit2

1.0 μg 0.18 μg

Ble

edin

g tim

e (s

)

a

b

Abs

orba

nce

(A57

5nm

)

Vehicle 1.8 μg 1.0 μg 0.18 μg

* *

*

* *

* *

Slit2

Figure 3.11

70

71

 

Figure 3.11: Slit2 increases bleeding times in vivo. CD1 mice were intravenously

injected with the indicated dose of Slit2 or vehicle (0.9% NaCl). Two hours later, 5

mm of the distal tail was transected and immediately immersed in pre-warmed saline.

(a) Bleeding times for mice from vehicle control (n=7) and Slit2 treatment groups – 1.8

µg (n=12), 1 µg (n=15) and 0.18 µg (n=6). Data are expressed as mean ± SEM for

mice from each group. *,p<0.05; **,p<0.01. (b) The blood loss from each mouse was

quantified by measuring hemoglobin content of the saline in which the tails were

immersed. Hemoglobin content was determined by measuring absorbance at 575 nm.

Data are expressed as mean ± SEM. *, p < 0.05; **, p < 0.01.

 

72  

CHAPTER 4: DISCUSSION AND CONCLUSIONS

The soluble protein, Slit2, interacting with its transmembrane receptor, Robo1,

was first described in Drosophila as a neuronal and axonal repellent during

development of the central nervous system (Brose et al., 1999; Kidd et al., 1999; Kidd

et al., 1998). Since then, Slit2 has been shown to inhibit chemotaxis of leukocytes and

VSMC towards a number of attractant cues associated with critical events in the

progression of vascular lesions (Kanellis et al., 2004; Liu et al., 2006; Prasad et al.,

2007; Tole et al., 2009; Wu et al., 2001). However, the effect of Slit2 on platelet

functions has been previously unexplored. In this study we demonstrate the

unexpected ability of Slit2/Robo-1 interactions to inhibit several aspects of platelet

adhesion and activation in vitro and in vivo. The anti-adhesive properties of Slit2 point

to its use as an agent capable of simultaneously preventing the vascular inflammation,

neointimal proliferation and thrombus formation that collectively result in occlusion of

diseased vessels.

Although neuronal guidance cues, such as those belonging to the semaphorin

and ephrin families have been implicated in platelet function, their precise role is

unclear. While ephrin signaling stimulates adhesion and aggregation, semaphorins

have been shown to both promote thrombus formation and conversely, to inhibit

platelet adhesion (Kashiwagi et al., 2005; Prevost et al., 2002; Prevost et al., 2005;

Zhu et al., 2007; Zhu et al., 2009). The role of semaphorins and ephrins in modulating

immune responses is similarly controversial. Indeed, ephrins and semaphorins have

been reported to both enhance and inhibit immune cell trafficking,

73

  

to activate T lymphocytes, and to stimulate pro-inflammatory immune responses

(Aasheim et al., 2005; Delaire et al., 2001; Freywald et al., 2003; Hall et al., 1996;

Hjorthaug and Aasheim, 2007; Kashiwagi et al., 2005; Kitamura et al., 2008;

Kumanogoh et al., 2005; Sharfe et al., 2002; Takamatsu et al., 2010; Tordjman et al.,

2002; Yu et al., 2003).

Work from our group and others demonstrate that Slit2 inhibits inflammatory

cell and VSMC recruitment both in vitro and in vivo. (Kanellis et al., 2004; Liu et al.,

2006; Prasad et al., 2007; Tole et al., 2009; Wu et al., 2001). Although Slit2 inhibits

chemotactic migration of leukocytes and VSMC, the underlying mechanisms are not

well understood. We recently showed that Slit2 inhibits polarization of migrating cells

by preventing activation-induced generation of actin filament free barbed ends,

necessary for rapid actin polymerization at the leading edge of the cell (Sun et al.,

2007; Tole et al., 2009). These data are in keeping with observations from neuronal

cells connecting Robo-1 to cytoskeletal proteins, including slit-robo GTPase-activating

protein-1 (srGAP1) and Ena (Bashaw et al., 2000; Wong et al., 2001).

Platelet adhesion and spreading also involve cytoskeletal stabilization and

destabilization. Accordingly, we found that Slit2 inhibited platelet spreading on diverse

substrates, including fibrinogen, fibronectin and collagen. Platelet spreading on

fibrinogen engages the most abundant receptor on the platelet surface, GP IIb/IIIa,

whereas GP VI and GP Ia/IIa support spreading on collagen. Spreading on fibronectin

involves GP IIb/IIIa and GP Ic/IIa (Kuijpers et al., 2003; McCarty et al., 2004; Moroi et

al., 1996; Ruggeri, 2002). Our studies further demonstrated that during platelet

74

  

adhesion and spreading, activation of the small Rho-family GTPase, Cdc42, was not

affected by Slit2. These data differ from studies in human neutrophils and brain tumor

cells, in which Slit2 inhibited cell migration by preventing activation of Cdc42 (Tole et

al., 2009; Werbowetski-Ogilvie et al., 2006; Wong et al., 2001; Yiin et al., 2009). In

another report involving VSMC, Slit2 inhibited cell chemotaxis but did not prevent

Cdc42 activation (Liu et al., 2006; Prasad et al., 2007). We found that the formation of

dynamic, motile platelet filopodia was unaffected by Slit2. These results are entirely in

keeping with observations in platelets derived from Cdc42-deficient mice. In platelets

lacking Cdc42, spreading on fibrinogen and filopodial formation are completely intact

(Pleines et al., 2010).

Using time-lapse videomicroscopy, we observed that Slit2 inhibited formation of

lamellipodia during platelet adhesion and spreading. These effects are reminiscent of

Rac1 deficiency. Indeed, platelets from Rac1-deficient mice display impaired

lamellipodia formation and spreading on collagen, but retain the ability to form

filopodia (McCarty et al., 2005). Surprisingly, we did not find that Slit2 inhibited

activation of Rac1 during platelet spreading. This could be due to activation of the

Rac pathway via secondary platelet agonist receptors, such as the P2Y12 and TXA2

receptors, or may reflect the fact that in platelet adhesion and spreading activation of

Rac1 is acute, transient and limited to early stages of activation. To confirm this, our

future studies will test the effects of Slit2 on earlier stages of platelet adhesion and

spreading. In addition, we will also investigate platelet adhesion process on

immobilized Slit2, rather than providing it in solution. This will assist in understanding if

Slit2 has localized effects on platelet adhesion, and the data would particularly be

75

  

beneficial if Slit2 needs to be immobilized on medical devices such as stents.

Thus far, studies on the role of Rho GTPases in platelet function have been

focused primarily on Rac1, Cdc42 and RhoA, the classical Rho GTPases. While there

are apparent defects in platelet function when devoid of these GTPases, it is vital to

note that the human Rho GTPase family is comprised of 22 members (Rossman et al.,

2005). Importantly, very little is known about the role of these non-classical Rho

GTPases in the context of platelet function. Nevertheless, it is possible that Slit2 might

also potentially mediate its effects on platelet adhesion by targeting the non-classical

Rho GTPases. Besides the Rho GTPases, there are proteins from the Ras family of

GTPases, notably Rap1b, that are implicated in platelet adhesion and spreading.

Mounting evidence points to Rap1b as an important upstream regulator of integrin-

mediated platelet adhesion (de Bruyn et al., 2003; Jackson et al., 2004). Because we

found that Slit2 inhibited platelet spreading not just on one, but rather diverse matrix

substrates, it is possible that Slit2, in part, may mediate its adhesion-specific effect via

inactivation of Rap1b. In addition, platelet adhesion and spreading by Slit2 may be

regulated at several other levels. For instance, Slit2 could also potentially modulate

integrin-ligand-binding affinity, or alter the avidity of receptors via effects on integrin

lateral mobility and clustering.

Platelet adhesion and spreading depend on rapid phospholipid metabolism and

activation of major kinase pathways, especially Akt, Erk and p38 MAPK. We found

that Slit2 did not inhibit activation of Erk or p38 MAPK during platelet spreading. Our

results are supported by observations of human neutrophils, human granulocytic cells

76

  

and Jurkat T-lymphocytes, where Slit2 did not affect chemoattractant-induced

activation of Erk or p38 MAPK (Tole et al., 2009; Wu et al., 2001). In yet another

study, Slit2 suppressed Erk activation in chemokine-stimulated breast cancer cells

(Prasad et al., 2004).

Akt is a well-recognized downstream effector of phosphatidylinositol 3-kinase

(PI3K) and has been shown to phosphorylate and activate GPIIb/IIIa, thereby

regulating actin assembly and promoting platelet shape change and stable

aggregation (Chen et al., 2004; Hartwig et al., 1996; Jackson et al., 2004; Kandel and

Hay, 1999; Kirk et al., 2000; Kovacsovics et al., 1995; Stojanovic et al., 2006; Trumel

et al., 1999; Woulfe et al., 2004; Yin et al., 2008). Accordingly, we found that Slit2

inhibited Akt activation during platelet adhesion and spreading. These results are in

concordance with those of others, demonstrating that Slit2 suppressed activation of

Akt in Jurkat T-lymphocytes following chemokine stimulation (Prasad et al., 2007).

Interestingly, Akt-deficient platelets have a defect in secretion that results in reduced

fibrinogen binding and consequently impaired aggregation (Woulfe et al., 2004). The

differential effects of Slit2 on inducible kinase activity can be attributed to the different

cell types used. Previous reports have involved stimulating cells using

chemoattractants in solution, whereas our study focused on deciphering how Slit2

modulates signaling pathways during platelet adhesion and spreading on immobilized

ligands. Our studies indicate that Slit2 may suppress platelet spreading, in part, by

down-regulating Akt activation by limiting integrin function.

77

  

We found that during ADP-mediated activation, Slit2 inhibited CD62P

translocation to the platelet surface. These results are in keeping with work from other

groups identifying a central role for Akt in platelet granular secretion (Chen et al.,

2004; Woulfe et al., 2004; Yin et al., 2008). Our findings are also in agreement with a

recent study showing that Cdc42 is not required for α-granule secretion (Pleines et al.,

2010).

There has been a dearth of studies testing Slit2 in in vivo models of

inflammation. A study that tested Slit2 in a rat model of glomerulonephritis reported

that Slit2 treatment alleviated the disease histologically as well as improved renal

functions when given early in the disease course (Kanellis et al., 2004). In another

study, Slit2 inhibited the migration of dendritic cells in mice resulting in a suppression

of contact hypersensitivity responses (Guan et al., 2003). We have previously shown

that Slit2 reduced neutrophil infiltration in a murine model of peritoneal inflammation

induced by sodium periodate, macrophage-inflammatory protein-2 (MIP-2) and

complement component 5a (C5a) (Tole et al., 2009). In this study, we have

demonstrated that Slit2 negatively regulates platelet function in vivo using the mouse

tail-bleeding model. To understand the effects of Slit2 on the pathophysiology of

thrombotic events, our future studies will be centered on testing Slit2 in murine models

of acute as well as chronic thrombosis.

Local and systemic inflammation plays critical roles in vascular injury and

atherosclerosis via pathological processes involving leukocytes, VSMC and platelets.

The latter cause formation of thrombi that ultimately occlude vessels to cause

78

  

myocardial or cerebral ischemia and infarction (Gawaz, 2008; Libby, 2002; Meadows

and Bhatt, 2007). Given the variety of cells, responses and molecular cues involved

in atherothrombosis it is unlikely that targeting a single pathologic pathway – such as

leukocyte infiltration or platelet activation - will provide comprehensive clinical benefit.

Up until now, the search for a single therapy that simultaneously blocks the different

pathologic processes that cause vascular injury has proven elusive. We report here

that Slit2 inhibits platelet adhesion and spreading, and previous reports have

demonstrated that the same protein inhibits leukocyte recruitment and chemotactic

VSMC migration (Kanellis et al., 2004; Liu et al., 2006; Prasad et al., 2007; Tole et al.,

2009; Wu et al., 2001). These observations make Slit2 an exciting therapeutic

candidate for the prevention and/or treatment of atherothrombosis.

     

79  

REFERENCES

Aasheim, H.-C., J. Delabie, and E.F. Finne. 2005. Ephrin-A1 binding to CD4+ T

lymphocytes stimulates migration and induces tyrosine phosphorylation of

PYK2. Blood 105:2869-2876.

Akbar, H., J. Kim, K. Funk, J.A. Cancelas, X. Shang, L. Chen, J.F. Johnson, D.A.

Williams, and Y. Zheng. 2007. Genetic and pharmacologic evidence that Rac1

GTPase is involved in regulation of platelet secretion and aggregation. J

Thromb Haemost 5:1747-1755.

Angiolillo, D.J., D.L. Bhatt, P.A. Gurbel, and L.K. Jennings. 2009. Advances in

antiplatelet therapy: agents in clinical development. Am J Cardiol 103:40A-51A.

Arthur, J.F., S. Dunkley, and R.K. Andrews. 2007. Platelet glycoprotein VI-related

clinical defects. Br J Haematol 139:363-372.

Aspenstrom, P. 1999. Effectors for the Rho GTPases. Curr Opin Cell Biol 11:95-102.

Awtry, E.H., J. Loscalzo, M.D.A.D. Michelson, and S.C. Barry. 2007. Aspirin. In

Platelets (Second Edition). Academic Press, Burlington. 1099-1125.

Badimon, L., and G. Vilahur. 2008. Coronary atherothrombotic disease: progress in

antiplatelet therapy. Rev Esp Cardiol 61:501-513.

Bahou, W.F., M.D.A.D. Michelson, and S.C. Barry. 2007. Thrombin receptors. In

Platelets (Second Edition). Academic Press, Burlington. 179-200.

Barry, F.A., and J.M. Gibbins. 2002. Protein kinase B is regulated in platelets by the

collagen receptor glycoprotein VI. J Biol Chem 277:12874-1287

        80

 

Bashaw, G.J., and C.S. Goodman. 1999. Chimeric axon guidance receptors: the

cytoplasmic domains of slit and netrin receptors specify attraction versus

repulsion. Cell 97:917-926.

Bashaw, G.J., T. Kidd, D. Murray, T. Pawson, and C.S. Goodman. 2000. Repulsive

axon guidance: Abelson and Enabled play opposing roles downstream of the

roundabout receptor. Cell 101:703-715.

Battye, R., A. Stevens, and J.R. Jacobs. 1999. Axon repulsion from the midline of the

Drosophila CNS requires slit function. Development 126:2475-2481.

Bertoli-Avella, A.M., M.L. Conte, F. Punzo, B.M. de Graaf, G. Lama, A. La Manna, C.

Polito, C. Grassia, B. Nobili, P.F. Rambaldi, B.A. Oostra, and S. Perrotta. 2008.

ROBO2 gene variants are associated with familial vesicoureteral reflux. J Am

Soc Nephrol 19:825-831.

Bhatt, D.L. 2009. Role of antiplatelet therapy across the spectrum of patients with

coronary artery disease. Am J Cardiol 103:11A-19A.

Boring, L., J. Gosling, S.W. Chensue, S.L. Kunkel, R.V. Farese, Jr., H.E. Broxmeyer,

and I.F. Charo. 1997. Impaired monocyte migration and reduced type 1 (Th1)

cytokine responses in C-C chemokine receptor 2 knockout mice. J Clin Invest

100:2552-2561.

Boring, L., J. Gosling, M. Cleary, and I.F. Charo. 1998. Decreased lesion formation in

CCR2-/- mice reveals a role for chemokines in the initiation of atherosclerosis.

Nature 394:894-897.

Bos, J.L., H. Rehmann, and A. Wittinghofer. 2007. GEFs and GAPs: critical elements

in the control of small G proteins. Cell 129:865-877.

        81

 

Braganza, D.M., and M.R. Bennett. 2001. New insights into atherosclerotic plaque

rupture. Postgrad Med J 77:94-98.

Brose, K., K.S. Bland, K.H. Wang, D. Arnott, W. Henzel, C.S. Goodman, M. Tessier-

Lavigne, and T. Kidd. 1999. Slit proteins bind Robo receptors and have an

evolutionarily conserved role in repulsive axon guidance. Cell 96:795-806.

Calderwood, D.A., S.J. Shattil, and M.H. Ginsberg. 2000. Integrins and actin filaments:

reciprocal regulation of cell adhesion and signaling. J Biol Chem 275:22607-

22610.

Canobbio, I., C. Balduini, and M. Torti. 2004. Signalling through the platelet

glycoprotein Ib-V-IX complex. Cell Signal 16:1329-1344.

Casey, P.J., P.A. Solski, C.J. Der, and J.E. Buss. 1989. p21ras is modified by a

farnesyl isoprenoid. Proc Natl Acad Sci U S A 86:8323-8327.

Cattaneo, M., M.D.A.D. Michelson, and S.C. Barry. 2007. The platelet P2 receptors. In

Platelets (Second Edition). Academic Press, Burlington. 201-220.

Chang, J.C., H.H. Chang, C.T. Lin, and S.J. Lo. 2005. The integrin alpha6beta1

modulation of PI3K and Cdc42 activities induces dynamic filopodium formation

in human platelets. J Biomed Sci 12:881-898.

Chedotal, A. 2007. Slits and their receptors. Adv Exp Med Biol 621:65-80.

Chen, J., S. De, D.S. Damron, W.S. Chen, N. Hay, and T.V. Byzova. 2004. Impaired

platelet responses to thrombin and collagen in AKT-1-deficient mice. Blood

104:1703-1710.

Chen, J.H., L. Wen, S. Dupuis, J.Y. Wu, and Y. Rao. 2001. The N-terminal leucine-

rich regions in Slit are sufficient to repel olfactory bulb axons and subventricular

zone neurons. J Neurosci 21:1548-1556.

        82

 

Chen, J.H., W. Wu, H.S. Li, T. Fagaly, L. Zhou, J.Y. Wu, and Y. Rao. 2000. Embryonic

expression and extracellular secretion of Xenopus slit. Neuroscience 96:231-

236.

Cho, J., B.C. Furie, S.R. Coughlin, and B. Furie. 2008. A critical role for extracellular

protein disulfide isomerase during thrombus formation in mice. J Clin Invest

118:1123-1131.

Clemetson, K.J., J.M. Clemetson, M.D.A.D. Michelson, and S.C. Barry. 2007. Platelet

receptors. In Platelets (Second Edition). Academic Press, Burlington. 117-143.

Combadiere, C., S. Potteaux, J.L. Gao, B. Esposito, S. Casanova, E.J. Lee, P. Debre,

A. Tedgui, P.M. Murphy, and Z. Mallat. 2003. Decreased atherosclerotic lesion

formation in CX3CR1/apolipoprotein E double knockout mice. Circulation

107:1009-1016.

Crittenden, J.R., W. Bergmeier, Y. Zhang, C.L. Piffath, Y. Liang, D.D. Wagner, D.E.

Housman, and A.M. Graybiel. 2004. CalDAG-GEFI integrates signaling for

platelet aggregation and thrombus formation. Nature medicine 10:982-986.

Dallol, A., N.F. Da Silva, P. Viacava, J.D. Minna, I. Bieche, E.R. Maher, and F. Latif.

2002. SLIT2, a human homologue of the Drosophila Slit2 gene, has tumor

suppressor activity and is frequently inactivated in lung and breast cancers.

Cancer Res 62:5874-5880.

Dallol, A., D. Morton, E.R. Maher, and F. Latif. 2003. SLIT2 axon guidance molecule is

frequently inactivated in colorectal cancer and suppresses growth of colorectal

carcinoma cells. Cancer Res 63:1054-1058.

de Bruyn, K.M., F.J. Zwartkruis, J. de Rooij, J.W. Akkerman, and J.L. Bos. 2003. The

small GTPase Rap1 is activated by turbulence and is involved in integrin

        83

 

[alpha]IIb[beta]3-mediated cell adhesion in human megakaryocytes. J Biol

Chem 278:22412-22417.

Delaire, S., C. Billard, R. Tordjman, A. Chedotal, A. Elhabazi, A. Bensussan, and L.

Boumsell. 2001. Biological Activity of Soluble CD100. II. Soluble CD100,

Similarly to H-SemaIII, Inhibits Immune Cell Migration. J Immunol 166:4348-

4354.

DeMali, K.A., K. Wennerberg, and K. Burridge. 2003. Integrin signaling to the actin

cytoskeleton. Curr Opin Cell Biol 15:572-582.

DerMardirossian, C., and G.M. Bokoch. 2005. GDIs: central regulatory molecules in

Rho GTPase activation. Trends Cell Biol 15:356-363.

Dickinson, R.E., and W.C. Duncan. 2010. The SLIT-ROBO pathway: a regulator of cell

function with implications for the reproductive system. Reproduction 139:697-

704.

Durocher, Y., S. Perret, and A. Kamen. 2002. High-level and high-throughput

recombinant protein production by transient transfection of suspension-growing

human 293-EBNA1 cells. Nucleic Acids Res 30:E9.

Flevaris, P., Z. Li, G. Zhang, Y. Zheng, J. Liu, and X. Du. 2009. Two distinct roles of

mitogen-activated protein kinases in platelets and a novel Rac1-MAPK-

dependent integrin outside-in retractile signaling pathway. Blood 113:893-901.

Freywald, A., N. Sharfe, C. Rashotte, T. Grunberger, and C.M. Roifman. 2003. The

EphB6 receptor inhibits JNK activation in T lymphocytes and modulates T cell

receptor-mediated responses. J Biol Chem 278:10150-10156.

        84

 

Fujiyama, A., and F. Tamanoi. 1990. RAS2 protein of Saccharomyces cerevisiae

undergoes removal of methionine at N terminus and removal of three amino

acids at C terminus. J Biol Chem 265:3362-3368.

Furie, B., B.C. Furie, and R. Flaumenhaft. 2001. A journey with platelet P-selectin: the

molecular basis of granule secretion, signalling and cell adhesion. Thromb

Haemost 86:214-221.

Gachet, C. 2001. Identification, Characterization, and Inhibition of the Platelet ADP

Receptors. Int J Hematol 74:375-381.

Garcia, A., H. Shankar, S. Murugappan, S. Kim, and S.P. Kunapuli. 2007. Regulation

and functional consequences of ADP receptor-mediated ERK2 activation in

platelets. Biochem J 404:299-308.

Gawaz, M. 2008. The evolving science of atherothrombotic disease. European Heart

Journal Supplements 10:I4.

Gawaz, M., H. Langer, and A.E. May. 2005. Platelets in inflammation and

atherogenesis. J Clin Invest 115:3378-3384.

George, J.N. 2000. Platelets. Lancet 355:1531-1539.

Gertler, F.B., R.L. Bennett, M.J. Clark, and F.M. Hoffmann. 1989. Drosophila abl

tyrosine kinase in embryonic CNS axons: a role in axonogenesis is revealed

through dosage-sensitive interactions with disabled. Cell 58:103-113.

Gosling, J., S. Slaymaker, L. Gu, S. Tseng, C.H. Zlot, S.G. Young, B.J. Rollins, and

I.F. Charo. 1999. MCP-1 deficiency reduces susceptibility to atherosclerosis in

mice that overexpress human apolipoprotein B. J Clin Invest 103:773-778.

Gratacap, M.P., B. Payrastre, C. Viala, G. Mauco, M. Plantavid, and H. Chap. 1998.

Phosphatidylinositol 3,4,5-trisphosphate-dependent stimulation of

        85

 

phospholipase C-gamma2 is an early key event in FcgammaRIIA-mediated

activation of human platelets. J Biol Chem 273:24314-24321.

Grieshammer, U., M. Le, A.S. Plump, F. Wang, M. Tessier-Lavigne, and G.R. Martin.

2004. SLIT2-mediated ROBO2 signaling restricts kidney induction to a single

site. Dev Cell 6:709-717.

Grosser, T., S. Fries, G.A. Fitz Gerald, M.D.A.D. Michelson, and S.C. Barry. 2007.

Thromboxane generation. In Platelets (Second Edition). Academic Press,

Burlington. 565-574.

Gruner, S., M. Prostredna, V. Schulte, T. Krieg, B. Eckes, C. Brakebusch, and B.

Nieswandt. 2003. Multiple integrin-ligand interactions synergize in shear-

resistant platelet adhesion at sites of arterial injury in vivo. Blood 102:4021-

4027.

Guan, H., G. Zu, Y. Xie, H. Tang, M. Johnson, X. Xu, C. Kevil, W.C. Xiong, C. Elmets,

Y. Rao, J.Y. Wu, and H. Xu. 2003. Neuronal repellent Slit2 inhibits dendritic cell

migration and the development of immune responses. J Immunol 171:6519-

6526.

Gutierrez, L., A.I. Magee, C.J. Marshall, and J.F. Hancock. 1989. Post-translational

processing of p21ras is two-step and involves carboxyl-methylation and

carboxy-terminal proteolysis. EMBO J 8:1093-1098.

Hagberg, I.A., and T. Lyberg. 2000. Blood platelet activation evaluated by flow

cytometry: optimised methods for clinical studies. Platelets 11:137-150.

Hall, A. 1998. Rho GTPases and the Actin Cytoskeleton. Science 279:509-514.

Hall, K.T., L. Boumsell, J.L. Schultze, V.A. Boussiotis, D.M. Dorfman, A.A. Cardoso, A.

Bensussan, L.M. Nadler, and G.J. Freeman. 1996. Human CD100, a novel

        86

 

leukocyte semaphorin that promotes B-cell aggregation and differentiation.

Proc Natl Acad Sci U S A 93:11780-11785.

Hao, J.C., T.W. Yu, K. Fujisawa, J.G. Culotti, K. Gengyo-Ando, S. Mitani, G. Moulder,

R. Barstead, M. Tessier-Lavigne, and C.I. Bargmann. 2001. C. elegans slit acts

in midline, dorsal-ventral, and anterior-posterior guidance via the SAX-3/Robo

receptor. Neuron 32:25-38.

Harper, M.T., and A.W. Poole. 2007. Isoform-specific functions of protein kinase C:

the platelet paradigm. Biochem Soc Trans 35:1005-1008.

Hartwig, J.H., S. Kung, T. Kovacsovics, P.A. Janmey, L.C. Cantley, T.P. Stossel, and

A. Toker. 1996. D3 phosphoinositides and outside-in integrin signaling by

glycoprotein IIb-IIIa mediate platelet actin assembly and filopodial extension

induced by phorbol 12-myristate 13-acetate. J Biol Chem 271:32986-32993.

Hartwig, J.H., M.D.A.D. Michelson, and S.C. Barry. 2007. The platelet cytoskeleton. In

Platelets (Second Edition). Academic Press, Burlington. 75-97.

Heasman, S.J., and A.J. Ridley. 2008. Mammalian Rho GTPases: new insights into

their functions from in vivo studies. Nat Rev Mol Cell Biol 9:690-701.

HIP2 website. http://bio.informatics.iupui.edu/HIP2/. Retrieved 24 Jan 2011:

Hjorthaug, H.S., and H.C. Aasheim. 2007. Ephrin-A1 stimulates migration of

CD8+CCR7+ T lymphocytes. Eur J Immunol 37:2326-2336.

Holmes, G., and L. Niswander. 2001. Expression of slit-2 and slit-3 during chick

development. Dev Dyn 222:301-307.

Holmes, G.P., K. Negus, L. Burridge, S. Raman, E. Algar, T. Yamada, and M.H. Little.

1998. Distinct but overlapping expression patterns of two vertebrate slit

        87

 

homologs implies functional roles in CNS development and organogenesis.

Mech Dev 79:57-72.

Holtkotter, O., B. Nieswandt, N. Smyth, W. Muller, M. Hafner, V. Schulte, T. Krieg, and

B. Eckes. 2002. Integrin alpha 2-deficient mice develop normally, are fertile, but

display partially defective platelet interaction with collagen. J Biol Chem

277:10789-10794.

Howitt, J.A., N.J. Clout, and E. Hohenester. 2004. Binding site for Robo receptors

revealed by dissection of the leucine-rich repeat region of Slit. EMBO J

23:4406-4412.

Hussain, S.A., M. Piper, N. Fukuhara, L. Strochlic, G. Cho, J.A. Howitt, Y. Ahmed,

A.K. Powell, J.E. Turnbull, C.E. Holt, and E. Hohenester. 2006. A molecular

mechanism for the heparan sulfate dependence of slit-robo signaling. J Biol

Chem 281:39693-39698.

Itoh, A., T. Miyabayashi, M. Ohno, and S. Sakano. 1998. Cloning and expressions of

three mammalian homologues of Drosophila slit suggest possible roles for Slit

in the formation and maintenance of the nervous system. Brain Res Mol Brain

Res 62:175-186.

Jackevicius, C.A., J.L. Cox, D. Carreon, J.V. Tu, S. Rinfret, D. So, H. Johansen, D.

Kalavrouziotis, V. Demers, K. Humphries, L. Pilote, and for the Canadian

Cardiovascular Outcomes Research Team. 2009. Long-term trends in use of

and expenditures for cardiovascular medications in Canada. CMAJ 181:E19-

28.

Jackson, S.P., C.L. Yap, and K.E. Anderson. 2004. Phosphoinositide 3-kinases and

the regulation of platelet function. Biochem Soc Trans 32:387-392.

        88

 

Johnson, K.G., A. Ghose, E. Epstein, J. Lincecum, M.B. O'Connor, and D. Van Vactor.

2004. Axonal heparan sulfate proteoglycans regulate the distribution and

efficiency of the repellent slit during midline axon guidance. Curr Biol 14:499-

504.

Kandel, E.S., and N. Hay. 1999. The regulation and activities of the multifunctional

serine/threonine kinase Akt/PKB. Exp Cell Res 253:210-229.

Kanellis, J., G.E. Garcia, P. Li, G. Parra, C.B. Wilson, Y. Rao, S. Han, C.W. Smith,

R.J. Johnson, J.Y. Wu, and L. Feng. 2004. Modulation of inflammation by slit

protein in vivo in experimental crescentic glomerulonephritis. Am J Pathol

165:341-352.

Kashiwagi, H., M. Shiraga, H. Kato, T. Kamae, N. Yamamoto, S. Tadokoro, Y. Kurata,

Y. Tomiyama, and Y. Kanakura. 2005. Negative regulation of platelet function

by a secreted cell repulsive protein, semaphorin 3A. Blood 106:913-921.

Kasirer-Friede, A., M.L. Kahn, and S.J. Shattil. 2007. Platelet integrins and

immunoreceptors. Immunol Rev 218:247-264.

Kato, K., C. Martinez, S. Russell, P. Nurden, A. Nurden, S. Fiering, and J. Ware. 2004.

Genetic deletion of mouse platelet glycoprotein Ibbeta produces a Bernard-

Soulier phenotype with increased alpha-granule size. Blood 104:2339-2344.

Kidd, T., K.S. Bland, and C.S. Goodman. 1999. Slit is the midline repellent for the robo

receptor in Drosophila. Cell 96:785-794.

Kidd, T., K. Brose, K.J. Mitchell, R.D. Fetter, M. Tessier-Lavigne, C.S. Goodman, and

G. Tear. 1998. Roundabout controls axon crossing of the CNS midline and

defines a novel subfamily of evolutionarily conserved guidance receptors. Cell

92:205-215.

        89

 

Kirk, R.I., M.R. Sanderson, and K.M. Lerea. 2000. Threonine phosphorylation of the

beta 3 integrin cytoplasmic tail, at a site recognized by PDK1 and Akt/PKB in

vitro, regulates Shc binding. J Biol Chem 275:30901-30906.

Kitamura, T., Y. Kabuyama, A. Kamataki, M.K. Homma, H. Kobayashi, S. Aota, S.-i.

Kikuchi, and Y. Homma. 2008. Enhancement of lymphocyte migration and

cytokine production by ephrinB1 system in rheumatoid arthritis. Am J Physiol

Cell Physiol 294:C189-196.

Kjoller, L., and A. Hall. 1999. Signaling to Rho GTPases. Exp Cell Res 253:166-179.

Kovacsovics, T.J., C. Bachelot, A. Toker, C.J. Vlahos, B. Duckworth, L.C. Cantley,

and J.H. Hartwig. 1995. Phosphoinositide 3-kinase inhibition spares actin

assembly in activating platelets but reverses platelet aggregation. J Biol Chem

270:11358-11366.

Kroll, M. 2001. Mechanisms of Coagulation. In Manual of coagulation disorders. M.

Kroll, editor Wiley-Blackwell, Massachusetts. 1-8.

Kuijpers, M.J., V. Schulte, W. Bergmeier, T. Lindhout, C. Brakebusch, S. Offermanns,

R. Fassler, J.W. Heemskerk, and B. Nieswandt. 2003. Complementary roles of

glycoprotein VI and alpha2beta1 integrin in collagen-induced thrombus

formation in flowing whole blood ex vivo. FASEB J 17:685-687.

Kumanogoh, A., T. Shikina, K. Suzuki, S. Uematsu, K. Yukawa, S. Kashiwamura, H.

Tsutsui, M. Yamamoto, H. Takamatsu, E.P. Ko-Mitamura, N. Takegahara, S.

Marukawa, I. Ishida, H. Morishita, D.V. Prasad, M. Tamura, M. Mizui, T.

Toyofuku, S. Akira, K. Takeda, M. Okabe, and H. Kikutani. 2005. Nonredundant

roles of Sema4A in the immune system: defective T cell priming and Th1/Th2

regulation in Sema4A-deficient mice. Immunity 22:305-316.

        90

 

Lai, C.F., L. Chaudhary, A. Fausto, L.R. Halstead, D.S. Ory, L.V. Avioli, and S.L.

Cheng. 2001. Erk is essential for growth, differentiation, integrin expression,

and cell function in human osteoblastic cells. J Biol Chem 276:14443-14450.

Lanier, L.M., M.A. Gates, W. Witke, A.S. Menzies, A.M. Wehman, J.D. Macklis, D.

Kwiatkowski, P. Soriano, and F.B. Gertler. 1999. Mena is required for

neurulation and commissure formation. Neuron 22:313-325.

Legg, J.A., J.M. Herbert, P. Clissold, and R. Bicknell. 2008. Slits and Roundabouts in

cancer, tumour angiogenesis and endothelial cell migration. Angiogenesis

11:13-21.

Leng, L., H. Kashiwagi, X.D. Ren, and S.J. Shattil. 1998. RhoA and the function of

platelet integrin alphaIIbbeta3. Blood 91:4206-4215.

Lesnik, P., C.A. Haskell, and I.F. Charo. 2003. Decreased atherosclerosis in CX3CR1-

/- mice reveals a role for fractalkine in atherogenesis. J Clin Invest 111:333-

340.

Li, R., B. Zhang, and Y. Zheng. 1997. Structural determinants required for the

interaction between Rho GTPase and the GTPase-activating domain of p190. J

Biol Chem 272:32830-32835.

Li, Z., G. Zhang, R. Feil, J. Han, and X. Du. 2006. Sequential activation of p38 and

ERK pathways by cGMP-dependent protein kinase leading to activation of the

platelet integrin alphaIIb beta3. Blood 107:965-972.

Liang, Y., R.S. Annan, S.A. Carr, S. Popp, M. Mevissen, R.K. Margolis, and R.U.

Margolis. 1999. Mammalian homologues of the Drosophila slit protein are

ligands of the heparan sulfate proteoglycan glypican-1 in brain. J Biol Chem

274:17885-17892.

        91

 

Libby, P. 2002. Inflammation in atherosclerosis. Nature 420:868-874.

Liu, D., J. Hou, X. Hu, X. Wang, Y. Xiao, Y. Mou, and H. De Leon. 2006. Neuronal

chemorepellent Slit2 inhibits vascular smooth muscle cell migration by

suppressing small GTPase Rac1 activation. Circ Res 98:480-489.

Lo, B., L. Li, P. Gissen, H. Christensen, P.J. McKiernan, C. Ye, M. Abdelhaleem, J.A.

Hayes, M.D. Williams, D. Chitayat, and W.H. Kahr. 2005. Requirement of

VPS33B, a member of the Sec1/Munc18 protein family, in megakaryocyte and

platelet alpha-granule biogenesis. Blood 106:4159-4166.

Lova, P., S. Paganini, E. Hirsch, L. Barberis, M. Wymann, F. Sinigaglia, C. Balduini,

and M. Torti. 2003. A selective role for phosphatidylinositol 3,4,5-trisphosphate

in the Gi-dependent activation of platelet Rap1B. J Biol Chem 278:131-138.

Lusis, A.J. 2000. Atherosclerosis. Nature 407:233-241.

Machesky, L.M., and A. Hall. 1997. Role of actin polymerization and adhesion to

extracellular matrix in Rac- and Rho-induced cytoskeletal reorganization. J Cell

Biol 138:913-926.

Marillat, V., O. Cases, K.T. Nguyen-Ba-Charvet, M. Tessier-Lavigne, C. Sotelo, and A.

Chedotal. 2002. Spatiotemporal expression patterns of slit and robo genes in

the rat brain. J Comp Neurol 442:130-155.

Massberg, S., K. Brand, S. Gruner, S. Page, E. Muller, I. Muller, W. Bergmeier, T.

Richter, M. Lorenz, I. Konrad, B. Nieswandt, and M. Gawaz. 2002. A critical

role of platelet adhesion in the initiation of atherosclerotic lesion formation. J

Exp Med 196:887-896.

Mazharian, A., S. Roger, E. Berrou, F. Adam, A. Kauskot, P. Nurden, M. Jandrot-

Perrus, and M. Bryckaert. 2007. Protease-activating receptor-4 induces full

        92

 

platelet spreading on a fibrinogen matrix: involvement of ERK2 and p38 and

Ca2+ mobilization. J Biol Chem 282:5478-5487.

McCarty, O.J., M.K. Larson, J.M. Auger, N. Kalia, B.T. Atkinson, A.C. Pearce, S. Ruf,

R.B. Henderson, V.L. Tybulewicz, L.M. Machesky, and S.P. Watson. 2005.

Rac1 is essential for platelet lamellipodia formation and aggregate stability

under flow. J Biol Chem 280:39474-39484.

McCarty, O.J., Y. Zhao, N. Andrew, L.M. Machesky, D. Staunton, J. Frampton, and

S.P. Watson. 2004. Evaluation of the role of platelet integrins in fibronectin-

dependent spreading and adhesion. J Thromb Haemost 2:1823-1833.

McDermott, D.H., A.M. Fong, Q. Yang, J.M. Sechler, L.A. Cupples, M.N. Merrell, P.W.

Wilson, R.B. D'Agostino, C.J. O'Donnell, D.D. Patel, and P.M. Murphy. 2003.

Chemokine receptor mutant CX3CR1-M280 has impaired adhesive function

and correlates with protection from cardiovascular disease in humans. J Clin

Invest 111:1241-1250.

McDermott, D.H., J.P. Halcox, W.H. Schenke, M.A. Waclawiw, M.N. Merrell, N.

Epstein, A.A. Quyyumi, and P.M. Murphy. 2001. Association between

polymorphism in the chemokine receptor CX3CR1 and coronary vascular

endothelial dysfunction and atherosclerosis. Circ Res 89:401-407.

Meadows, T.A., and D.L. Bhatt. 2007. Clinical aspects of platelet inhibitors and

thrombus formation. Circ Res 100:1261-1275.

Moon, S.Y., and Y. Zheng. 2003. Rho GTPase-activating proteins in cell regulation.

Trends Cell Biol 13:13-22.

        93

 

Morlot, C., N.M. Thielens, R.B. Ravelli, W. Hemrika, R.A. Romijn, P. Gros, S. Cusack,

and A.A. McCarthy. 2007. Structural insights into the Slit-Robo complex. Proc

Natl Acad Sci U S A 104:14923-14928.

Moroi, M., S.M. Jung, S. Nomura, S. Sekiguchi, A. Ordinas, and M. Diaz-Ricart. 1997.

Analysis of the involvement of the von Willebrand factor-glycoprotein Ib

interaction in platelet adhesion to a collagen-coated surface under flow

conditions. Blood 90:4413-4424.

Moroi, M., S.M. Jung, K. Shinmyozu, Y. Tomiyama, A. Ordinas, and M. Diaz-Ricart.

1996. Analysis of platelet adhesion to a collagen-coated surface under flow

conditions: the involvement of glycoprotein VI in the platelet adhesion. Blood

88:2081-2092.

Nakashima, Y., E.W. Raines, A.S. Plump, J.L. Breslow, and R. Ross. 1998.

Upregulation of VCAM-1 and ICAM-1 at atherosclerosis-prone sites on the

endothelium in the ApoE-deficient mouse. Arterioscler Thromb Vasc Biol

18:842-851.

Nappi, J. 2008. Benefits and limitations of current antiplatelet therapies. Am J Health

Syst Pharm 65:S5-10; quiz S16-18.

Nguyen Ba-Charvet, K.T., K. Brose, L. Ma, K.H. Wang, V. Marillat, C. Sotelo, M.

Tessier-Lavigne, and A. Chedotal. 2001. Diversity and specificity of actions of

Slit2 proteolytic fragments in axon guidance. J Neurosci 21:4281-4289.

Nieswandt, B., B. Aktas, A. Moers, and U.J.H. Sachs. 2005. Platelets in

atherothrombosis: lessons from mouse models. J Thromb Haemost 3:1725-

1736.

        94

 

Nieswandt, B., V. Schulte, W. Bergmeier, R. Mokhtari-Nejad, K. Rackebrandt, J.P.

Cazenave, P. Ohlmann, C. Gachet, and H. Zirngibl. 2001. Long-term

antithrombotic protection by in vivo depletion of platelet glycoprotein VI in mice.

J Exp Med 193:459-469.

Nieswandt, B., and S.P. Watson. 2003. Platelet-collagen interaction: is GPVI the

central receptor? Blood 102:449-461.

Nieuwenhuis, H.K., J.W. Akkerman, W.P. Houdijk, and J.J. Sixma. 1985. Human

blood platelets showing no response to collagen fail to express surface

glycoprotein Ia. Nature 318:470-472.

Nobes, C.D., and A. Hall. 1995. Rho, rac, and cdc42 GTPases regulate the assembly

of multimolecular focal complexes associated with actin stress fibers,

lamellipodia, and filopodia. Cell 81:53-62.

Olofsson, B. 1999. Rho guanine dissociation inhibitors: pivotal molecules in cellular

signalling. Cell Signal 11:545-554.

Ortlepp, J.R., K. Vesper, V. Mevissen, F. Schmitz, U. Janssens, A. Franke, P.

Hanrath, C. Weber, K. Zerres, and R. Hoffmann. 2003. Chemokine receptor

(CCR2) genotype is associated with myocardial infarction and heart failure in

patients under 65 years of age. J Mol Med 81:363-367.

Patel, S.R., J.H. Hartwig, and J.E. Italiano, Jr. 2005. The biogenesis of platelets from

megakaryocyte proplatelets. J Clin Invest 115:3348-3354.

Piper, M., K. Georgas, T. Yamada, and M. Little. 2000. Expression of the vertebrate

Slit gene family and their putative receptors, the Robo genes, in the developing

murine kidney. Mech Dev 94:213-217.

        95

 

Pleines, I., A. Eckly, M. Elvers, I. Hagedorn, S. Eliautou, M. Bender, X. Wu, F. Lanza,

C. Gachet, C. Brakebusch, and B. Nieswandt. 2010. Multiple alterations of

platelet functions dominated by increased secretion in mice lacking Cdc42 in

platelets. Blood 115:3364-3373.

Plow, E.F., M.M. Pesho, Y.-Q. Ma, M.D.A.D. Michelson, and S.C. Barry. 2007. Integrin

[alpha]IIb[beta]3. In Platelets (Second Edition). Academic Press, Burlington.

165-178.

Prasad, A., A.Z. Fernandis, Y. Rao, and R.K. Ganju. 2004. Slit protein-mediated

inhibition of CXCR4-induced chemotactic and chemoinvasive signaling

pathways in breast cancer cells. J Biol Chem 279:9115-9124.

Prasad, A., Z. Qamri, J. Wu, and R.K. Ganju. 2007. Slit-2/Robo-1 modulates the

CXCL12/CXCR4-induced chemotaxis of T cells. J Leukoc Biol 82:465-476.

Preiss, D.J., and N. Sattar. 2007. Vascular cell adhesion molecule-1: a viable

therapeutic target for atherosclerosis? Int J Clin Pract 61:697-701.

Prevost, N., S.J. Shattil, M.D.A.D. Michelson, and S.C. Barry. 2007. Outside-in

signaling by integrin [alpha]IIb[beta]3. In Platelets (Second Edition). Academic

Press, Burlington. 347-357.

Prevost, N., D. Woulfe, T. Tanaka, and L.F. Brass. 2002. Interactions between Eph

kinases and ephrins provide a mechanism to support platelet aggregation once

cell-to-cell contact has occurred. Proc Natl Acad Sci U S A 99:9219-9224.

Prevost, N., D.S. Woulfe, H. Jiang, T.J. Stalker, P. Marchese, Z.M. Ruggeri, and L.F.

Brass. 2005. Eph kinases and ephrins support thrombus growth and stability by

regulating integrin outside-in signaling in platelets. Proc Natl Acad Sci U S A

102:9820-9825.

        96

 

Qian, L., J. Liu, and R. Bodmer. 2005. Slit and Robo control cardiac cell polarity and

morphogenesis. Curr Biol 15:2271-2278.

Raftopoulou, M., and A. Hall. 2004. Cell migration: Rho GTPases lead the way. Dev

Biol 265:23-32.

Ray, L.B. 2004. STKE: Slit and Robo in Kidney Formation. Science 304:1215c-.

Reed, G.L., M.D.A.D. Michelson, and S.C. Barry. 2007. Platelet secretion. In Platelets

(Second Edition). Academic Press, Burlington. 309-318.

Rivera, J., M.L. Lozano, L. Navarro-Nunez, and V. Vicente. 2009. Platelet receptors

and signaling in the dynamics of thrombus formation. Haematologica 94:700-

711.

Ross, R. 1999. Atherosclerosis--an inflammatory disease. N Engl J Med 340:115-126.

Rossman, K.L., C.J. Der, and J. Sondek. 2005. GEF means go: turning on RHO

GTPases with guanine nucleotide-exchange factors. Nat Rev Mol Cell Biol

6:167-180.

Rothberg, J.M., D.A. Hartley, Z. Walther, and S. Artavanis-Tsakonas. 1988. slit: an

EGF-homologous locus of D. melanogaster involved in the development of the

embryonic central nervous system. Cell 55:1047-1059.

Rothberg, J.M., J.R. Jacobs, C.S. Goodman, and S. Artavanis-Tsakonas. 1990. slit:

an extracellular protein necessary for development of midline glia and

commissural axon pathways contains both EGF and LRR domains. Genes Dev

4:2169-2187.

Ruggeri, Z.M. 2002. Platelets in atherothrombosis. Nat Med 8:1227-1234.

Ruggeri, Z.M. 2009. Platelet adhesion under flow. Microcirculation 16:58-83.

        97

 

Ruggeri, Z.M., and G.L. Mendolicchio. 2007. Adhesion mechanisms in platelet

function. Circ Res 100:1673-1685.

Saederup, N., L. Chan, S.A. Lira, and I.F. Charo. 2008. Fractalkine deficiency

markedly reduces macrophage accumulation and atherosclerotic lesion

formation in CCR2-/- mice: evidence for independent chemokine functions in

atherogenesis. Circulation 117:1642-1648.

Santiago-Martinez, E., N.H. Soplop, and S.G. Kramer. 2006. Lateral positioning at the

dorsal midline: Slit and Roundabout receptors guide Drosophila heart cell

migration. Proc Natl Acad Sci U S A 103:12441-12446.

Schoenwaelder, S.M., S.C. Hughan, K. Boniface, S. Fernando, M. Holdsworth, P.E.

Thompson, H.H. Salem, and S.P. Jackson. 2002. RhoA sustains integrin alpha

IIbbeta 3 adhesion contacts under high shear. J Biol Chem 277:14738-14746.

Seeger, M., G. Tear, D. Ferres-Marco, and C.S. Goodman. 1993. Mutations affecting

growth cone guidance in Drosophila: genes necessary for guidance toward or

away from the midline. Neuron 10:409-426.

Seki, M., A. Watanabe, S. Enomoto, T. Kawamura, H. Ito, T. Kodama, T. Hamakubo,

and H. Aburatani. 2010. Human ROBO1 is cleaved by metalloproteinases and

gamma-secretase and migrates to the nucleus in cancer cells. FEBS Lett

584:2909-2915.

Selzman, C.H., S.A. Miller, and A.H. Harken. 2001. Therapeutic implications of

inflammation in atherosclerotic cardiovascular disease. Ann Thorac Surg

71:2066-2074.

Sharfe, N., A. Freywald, A. Toro, H. Dadi, and C. Roifman. 2002. Ephrin stimulation

modulates T cell chemotaxis. Eur J Immunol 32:3745-3755.

        98

 

Shattil, S.J., H. Kashiwagi, and N. Pampori. 1998. Integrin signaling: the platelet

paradigm. Blood 91:2645-2657.

Shattil, S.J., and P.J. Newman. 2004. Integrins: dynamic scaffolds for adhesion and

signaling in platelets. Blood 104:1606-1615.

Siljander, P.R., I.C. Munnix, P.A. Smethurst, H. Deckmyn, T. Lindhout, W.H.

Ouwehand, R.W. Farndale, and J.W. Heemskerk. 2004. Platelet receptor

interplay regulates collagen-induced thrombus formation in flowing human

blood. Blood 103:1333-1341.

Snyder, J.T., D.K. Worthylake, K.L. Rossman, L. Betts, W.M. Pruitt, D.P. Siderovski,

C.J. Der, and J. Sondek. 2002. Structural basis for the selective activation of

Rho GTPases by Dbl exchange factors. Nat Struct Biol 9:468-475.

Steigemann, P., A. Molitor, S. Fellert, H. Jackle, and G. Vorbruggen. 2004. Heparan

sulfate proteoglycan syndecan promotes axonal and myotube guidance by

slit/robo signaling. Curr Biol 14:225-230.

Stojanovic, A., J.A. Marjanovic, V.M. Brovkovych, X. Peng, N. Hay, R.A. Skidgel, and

X. Du. 2006. A phosphoinositide 3-kinase-AKT-nitric oxide-cGMP signaling

pathway in stimulating platelet secretion and aggregation. J Biol Chem

281:16333-16339.

Sun, C.X., M.A. Magalhaes, and M. Glogauer. 2007. Rac1 and Rac2 differentially

regulate actin free barbed end formation downstream of the fMLP receptor. J

Cell Biol 179:239-245.

Suzuki-Inoue, K., Y. Yatomi, N. Asazuma, M. Kainoh, T. Tanaka, K. Satoh, and Y.

Ozaki. 2001. Rac, a small guanosine triphosphate-binding protein, and p21-

        99

 

activated kinase are activated during platelet spreading on collagen-coated

surfaces: roles of integrin alpha(2)beta(1). Blood 98:3708-3716.

Tacke, F., D. Alvarez, T.J. Kaplan, C. Jakubzick, R. Spanbroek, J. Llodra, A. Garin, J.

Liu, M. Mack, N. van Rooijen, S.A. Lira, A.J. Habenicht, and G.J. Randolph.

2007. Monocyte subsets differentially employ CCR2, CCR5, and CX3CR1 to

accumulate within atherosclerotic plaques. J Clin Invest 117:185-194.

Takamatsu, H., N. Takegahara, Y. Nakagawa, M. Tomura, M. Taniguchi, R.H. Friedel,

H. Rayburn, M. Tessier-Lavigne, Y. Yoshida, T. Okuno, M. Mizui, S. Kang, S.

Nojima, T. Tsujimura, Y. Nakatsuji, I. Katayama, T. Toyofuku, H. Kikutani, and

A. Kumanogoh. 2010. Semaphorins guide the entry of dendritic cells into the

lymphatics by activating myosin II. Nat Immunol 11:594-600.

Tarride, J.E., M. Lim, M. DesMeules, W. Luo, N. Burke, D. O'Reilly, J. Bowen, and R.

Goeree. 2009. A review of the cost of cardiovascular disease. Can J Cardiol

25:e195-202.

Tcherkezian, J., and N. Lamarche-Vane. 2007. Current knowledge of the large

RhoGAP family of proteins. Biol Cell 99:67-86.

Tessier-Lavigne, M., and C.S. Goodman. 1996. The molecular biology of axon

guidance. Science 274:1123-1133.

Teupser, D., S. Pavlides, M. Tan, J.C. Gutierrez-Ramos, R. Kolbeck, and J.L.

Breslow. 2004. Major reduction of atherosclerosis in fractalkine (CX3CL1)-

deficient mice is at the brachiocephalic artery, not the aortic root. Proc Natl

Acad Sci U S A 101:17795-17800.

Tole, S., I.M. Mukovozov, Y.W. Huang, M.A. Magalhaes, M. Yan, M.R. Crow, G.Y. Liu,

C.X. Sun, Y. Durocher, M. Glogauer, and L.A. Robinson. 2009. The axonal

       100

 

repellent, Slit2, inhibits directional migration of circulating neutrophils. J Leukoc

Biol 86:1403-1415.

Tordjman, R., Y. Lepelletier, V. Lemarchandel, M. Cambot, P. Gaulard, O. Hermine,

and P.H. Romeo. 2002. A neuronal receptor, neuropilin-1, is essential for the

initiation of the primary immune response. Nat Immunol 3:477-482.

Trumel, C., B. Payrastre, M. Plantavid, B. Hechler, C. Viala, P. Presek, E.A.

Martinson, J.P. Cazenave, H. Chap, and C. Gachet. 1999. A key role of

adenosine diphosphate in the irreversible platelet aggregation induced by the

PAR1-activating peptide through the late activation of phosphoinositide 3-

kinase. Blood 94:4156-4165.

van Popele, N.M., F.U. Mattace-Raso, R. Vliegenthart, D.E. Grobbee, R. Asmar, D.A.

van der Kuip, A. Hofman, P.J. de Feijter, M. Oudkerk, and J.C. Witteman. 2006.

Aortic stiffness is associated with atherosclerosis of the coronary arteries in

older adults: the Rotterdam Study. J Hypertens 24:2371-2376.

VanderLaan, P.A., C.A. Reardon, and G.S. Getz. 2004. Site Specificity of

Atherosclerosis: Site-Selective Responses to Atherosclerotic Modulators.

Arterioscler Thromb Vasc Biol 24:12-22.

Varga-Szabo, D., I. Pleines, and B. Nieswandt. 2008. Cell adhesion mechanisms in

platelets. Arterioscler Thromb Vasc Biol 28:403-412.

Vetter, I.R., and A. Wittinghofer. 2001. The guanine nucleotide-binding switch in three

dimensions. Science 294:1299-1304.

Vidal, C., B. Geny, J. Melle, M. Jandrot-Perrus, and M. Fontenay-Roupie. 2002.

Cdc42/Rac1-dependent activation of the p21-activated kinase (PAK) regulates

       101

 

human platelet lamellipodia spreading: implication of the cortical-actin binding

protein cortactin. Blood 100:4462-4469.

von der Thusen, J.H., J. Kuiper, T.J. van Berkel, and E.A. Biessen. 2003. Interleukins

in atherosclerosis: molecular pathways and therapeutic potential. Pharmacol

Rev 55:133-166.

von Hundelshausen, P., and C. Weber. 2007. Platelets as Immune Cells: Bridging

Inflammation and Cardiovascular Disease. Circ Res 100:27-40.

Vorland, M., V.A. Thorsen, and H. Holmsen. 2008. Phospholipase D in platelets and

other cells. Platelets 19:582-594.

Vretenbrant, K., S. Ramstrom, M. Bjerke, and T.L. Lindahl. 2007. Platelet activation

via PAR4 is involved in the initiation of thrombin generation and in clot elasticity

development. Thromb Haemost 97:417-424.

Weiss, H.J., L.D. Witte, K.L. Kaplan, B.A. Lages, A. Chernoff, H.L. Nossel, D.S.

Goodman, and H.R. Baumgartner. 1979. Heterogeneity in storage pool

deficiency: studies on granule-bound substances in 18 patients including

variants deficient in alpha-granules, platelet factor 4, beta-thromboglobulin, and

platelet-derived growth factor. Blood 54:1296-1319.

Werbowetski-Ogilvie, T.E., M. Seyed Sadr, N. Jabado, A. Angers-Loustau, N.Y. Agar,

J. Wu, R. Bjerkvig, J.P. Antel, D. Faury, Y. Rao, and R.F. Del Maestro. 2006.

Inhibition of medulloblastoma cell invasion by Slit. Oncogene 25:5103-5112.

Wettschureck, N., A. Moers, and S. Offermanns. 2004. Mouse models to study G-

protein-mediated signaling. Pharmacol Ther 101:75-89.

White, J.G., M.D.A.D. Michelson, and S.C. Barry. 2007. Platelet structure. In Platelets

(Second Edition). Academic Press, Burlington. 45-73.

       102

 

Wills, Z., L. Marr, K. Zinn, C.S. Goodman, and D. Van Vactor. 1999. Profilin and the

Abl tyrosine kinase are required for motor axon outgrowth in the Drosophila

embryo. Neuron 22:291-299.

Wong, K., X.R. Ren, Y.Z. Huang, Y. Xie, G. Liu, H. Saito, H. Tang, L. Wen, S.M.

Brady-Kalnay, L. Mei, J.Y. Wu, W.C. Xiong, and Y. Rao. 2001. Signal

transduction in neuronal migration: roles of GTPase activating proteins and the

small GTPase Cdc42 in the Slit-Robo pathway. Cell 107:209-221.

Woods, V.L., Jr., L.E. Wolff, and D.M. Keller. 1986. Resting platelets contain a

substantial centrally located pool of glycoprotein IIb-IIIa complex which may be

accessible to some but not other extracellular proteins. J Biol Chem 261:15242-

15251.

Woulfe, D., H. Jiang, A. Morgans, R. Monks, M. Birnbaum, and L.F. Brass. 2004.

Defects in secretion, aggregation, and thrombus formation in platelets from

mice lacking Akt2. J Clin Invest 113:441-450.

Woulfe, D., H. Jiang, R. Mortensen, J. Yang, and L.F. Brass. 2002. Activation of

Rap1B by G(i) family members in platelets. J Biol Chem 277:23382-23390.

Woulfe, D.S. 2005. Platelet G protein-coupled receptors in hemostasis and

thrombosis. J Thromb Haemost 3:2193-2200.

Wu, J.Y., L. Feng, H.T. Park, N. Havlioglu, L. Wen, H. Tang, K.B. Bacon, Z. Jiang, X.

Zhang, and Y. Rao. 2001. The neuronal repellent Slit inhibits leukocyte

chemotaxis induced by chemotactic factors. Nature 410:948-952.

Yacoub, D., J.F. Theoret, L. Villeneuve, H. Abou-Saleh, W. Mourad, B.G. Allen, and Y.

Merhi. 2006. Essential role of protein kinase C delta in platelet signaling, alpha

       103

 

IIb beta 3 activation, and thromboxane A2 release. J Biol Chem 281:30024-

30035.

Yang, J., J. Wu, H. Jiang, R. Mortensen, S. Austin, D.R. Manning, D. Woulfe, and L.F.

Brass. 2002. Signaling through Gi family members in platelets. Redundancy

and specificity in the regulation of adenylyl cyclase and other effectors. J Biol

Chem 277:46035-46042.

Yiin, J.J., B. Hu, M.J. Jarzynka, H. Feng, K.W. Liu, J.Y. Wu, H.I. Ma, and S.Y. Cheng.

2009. Slit2 inhibits glioma cell invasion in the brain by suppression of Cdc42

activity. Neuro Oncol 11:779-789

Yin, H., A. Stojanovic, N. Hay, and X. Du. 2008. The role of Akt in the signaling

pathway of the glycoprotein Ib-IX induced platelet activation. Blood 111:658-

665.

Yip, J., Y. Shen, M.C. Berndt, and R.K. Andrews. 2005. Primary Platelet Adhesion

Receptors. IUBMB Life 57:103-108.

Yu, G., H. Luo, Y. Wu, and J. Wu. 2003. Ephrin B2 Induces T Cell Costimulation. J

Immunol 171:106-114.

Yuan, S.S., Y.T. Yeh, and E.Y. Lee. 2002. Pax-2 interacts with RB and reverses its

repression on the promoter of Rig-1, a Robo member. Biochem Biophys Res

Commun 296:1019-1025.

Yuan, W., L. Zhou, J.H. Chen, J.Y. Wu, Y. Rao, and D.M. Ornitz. 1999. The mouse

SLIT family: secreted ligands for ROBO expressed in patterns that suggest a

role in morphogenesis and axon guidance. Dev Biol 212:290-306.

Zarbock, A., R.K. Polanowska-Grabowska, and K. Ley. 2007. Platelet-neutrophil-

interactions: linking hemostasis and inflammation. Blood Rev 21:99-111.

       104

 

Zhu, L., W. Bergmeier, J. Wu, H. Jiang, T.J. Stalker, M. Cieslak, R. Fan, L. Boumsell,

A. Kumanogoh, H. Kikutani, L. Tamagnone, D.D. Wagner, M.E. Milla, and L.F.

Brass. 2007. Regulated surface expression and shedding support a dual role

for semaphorin 4D in platelet responses to vascular injury. Proc Natl Acad Sci

U S A 104:1621-1626.

Zhu, L., T.J. Stalker, K.P. Fong, H. Jiang, A. Tran, I. Crichton, E.K. Lee, K.B. Neeves,

S.F. Maloney, H. Kikutani, A. Kumanogoh, E. Pure, S.L. Diamond, and L.F.

Brass. 2009. Disruption of SEMA4D ameliorates platelet hypersensitivity in

dyslipidemia and confers protection against the development of atherosclerosis.

Arterioscler Thromb Vasc Biol 29:1039-1045.

Zu, S., Z. Bartik, S. Zhao, U. Sillen, and A. Nordenskjold. 2009. Mutations in the

ROBO2 and SLIT2 genes are rare causes of familial vesico-ureteral reflux.

Pediatr Nephrol 24:1501-1508.

     

105

APPENDIX1: Regulation of srGAP1 during Slit/Robo signaling

A1.1 AIMS AND INTRODUCTION

The formation of the neuronal network during the development of the central

nervous system (CNS) is dependent on multiple extracellular guidance cues. These

guidance cues direct the navigation of axons and neurons towards their synaptic

targets. Among these guidance cues, Slit is one of the important neuronal repulsive

cues. Slits are large glycoproteins secreted by the midline glial cells and they prevent

neurons and axons from crossing and re-crossing the midline (Bashaw and Goodman,

1999; Brose et al., 1999; Kidd et al., 1999; Kramer et al., 2001). Three Slit genes, Slit-

1,-2,-3, have been identified in mammals, and contain several motifs including leucine-

rich repeats (LRRs), epidermal growth factor (EGF ) repeats and a laminin G-domain

(Chedotal, 2007; Dickinson and Duncan, 2010; Legg et al., 2008; Ypsilanti et al.,

2010). Slit proteins are recognized by their single-pass transmembrane Roundabout

(Robo) receptors, Robo-1, -2, -3, and -4 (Brose et al., 1999; Kidd et al., 1998). Robo

proteins are evolutionarily conserved. They contain immunoglobulin (Ig) and

fibronectin (FN) type III domains in the extracellular region and conserved cytoplasmic

(CC) signaling motifs which contain different permutations of conserved amino acid

stretches (CC0,CC1,CC2 and CC3) (Chedotal, 2007; Dickinson and Duncan, 2010;

Legg et al., 2008). Slit/Robo signaling is also known to inhibit migration of numerous

cells such as leukocytes, dendritic cells and VSMCs towards diverse chemoattractants

(Guan et al., 2003; Liu et al., 2006; Prasad et al., 2004; Tole et al., 2009; Wu et al.,

2001). Therefore, the Slit/Robo pathway influences important processes outside of the

CNS

       106

 

An understanding of the intracellular pathways regulated by Slit/Robo is only

beginning to emerge. A novel family of slit-robo GTPase activating proteins (srGAPs)

was identified in a yeast two-hybrid screen. srGAPs strongly interacted with the

cytoplasmic domain of rat Robo1 (Wong et al., 2001). The srGAP family consists of

three known highly conserved members, srGAP1, srGAP2, and srGAP3. Structurally,

srGAPs contain a Rho GAP domain, a Src-homology 3 (SH3) domain, and a Fes/CIP4

homology (FCH) domain (Wong et al., 2001). The SH3 domain is the region that binds

to the intracellular CC3 motif of Robo1 (Wong et al., 2001). The Rho GAP domain can

regulate the activities of Rho family GTPases, thus linking Slit/Robo to the actin

cytoskeleton (Wong et al., 2001). In vitro studies indicate that srGAP1 preferentially

downregulates Cdc42 Rho GTPase, while srGAP3 has been shown to predominantly

regulate Rac GTPase (Soderling et al., 2002; Wong et al., 2001). The specificity of

srGAP2 GAP activity is currently uncertain.

The intracellular localization and the developmental changes of srGAP proteins

have so far been studied in wild-type rat brains at various developmental stages (Yao

et al., 2008). Immunohistochemical studies have revealed that the three srGAPs were

mainly expressed in neurons throughout the brain (Yao et al., 2008). The srGAP

proteins translocated during development between the nucleus and the cytoplasm of

neurons and their expression patterns were not overlapping (Yao et al., 2008).

srGAP1 is localized in the nucleus during early neonatal stages but translocates to the

cytoplasm by the adult stage (Yao et al., 2008). On the other hand, srGAP3 is mainly

present in the cytoplasm at neonatal stages and confined to the nuclei in adult (Yao et

       107

 

al., 2008). srGAP2 is expressed in both the cytoplasm and the nuclei at all neonatal

stages, but disappears during the adult stage (Yao et al., 2008). The functional

significance of these intracellular differences remains unclear. Thus far, very little is

also known about the mechanisms that activate srGAPs, particularly in non-neuronal

cells.

In this study, we aim to understand the possible mechanisms that may regulate

srGAP1. As is the case for other GAPs, it is possible that srGAP1 activity is

determined by its subcellular location (Caloca et al., 2003; Dusi et al., 1996; Peck et

al., 2002). Preliminary studies in our lab have shown that in unstimulated neutrophils

and THP-1 monocytes, srGAP1 is expressed in the cytoplasm as well as at the

plasma membrane. Consequently, we first wanted to test if SIit2 induces translocation

of srGAP1 to the plasma membrane. Secondly, we wanted to determine whether

recruitment of srGAP1 to the plasma membrane is sufficient to cause its activation and

to prevent chemotactic cell migration in the absence of Slit. Results from this study

would be critical in understanding of the functional roles of srGAPs.

A1.2 METHODS

A1.2.1 Cloning of srGAP1 into pEGFP-C1 expression vector

1.2 µg of pEGFP-C1 (obtained from Dr. William Trimble, The Hospital for Sick

Children) and 1.5 µg Venus tagged srGAP1 cloned into pCS2 vector (obtained from

Dr. Jane Wu, Northwestern University), was digested with EcoRI and XhoI restriction

endonucleases (New England Biolabs). srGAP1 in pCS2 is flanked by EcoRI and XhoI

restriction sites. The digest was carried out in 1X BSA, 1X NE Buffer 2 with 0.25 Units

       108

 

of EcoRI and XhoI endonucleases, at 37oC for 2.5 hours in 40 µl reaction volume. The

restriction digests were analyzed on a 1% agarose gel and bands corresponding to

pEGFP-C1 and srGAP1 were isolated and further purified with QIA quick gel

extraction kit (QIAGEN) according to the manufacturer’s specifications. An overnight

ligation was set up at 14oC with 1 Weiss unit of T4 ligase enzyme, 1XT4 ligase buffer

(Fermentas®) and a 6:1 ratio of insert: vector (i.e srGAP1: pEGFP-C1). A control

ligation was also carried out without any insert DNA. E. coli XL10 competent cells

were mixed with one-tenth of the ligation volume, and transformed by heat-shock

method. Following transformation, the cells were recovered at 37°C for 1 hour in 1X

SOC media and transformants selected on LB/Kanamycin plates. The plates were

incubated for 16 hours at 37°C.

To verify the presence of the insert, plasmids were isolated from 10

independent recombinant colonies and subjected to restriction analysis using EcoRI

and XhoI. To further confirm the cloning of in-frame and mutation-free insert,

sequencing analysis was also done (ACGT DNA Technologies Corporation, Toronto,

Ontario).

A1.2.2 Cloning of srGAP1 with C-terminal CAAX sequence

The synthetic oligonucleotides EcoRI-srGAP1-Fwd

(AAAgaattcATGTCCACCCCGAGCCGATTC) and XhoI-srGAP1-CAAX-Rev

(GCGctcgagTTACATGATGACGCACTTAGTCTTGGACTTCTTCTTCTTCTTCTTACC

GTCCTTGGACAT CATTGTGCATGACTTGTCTGTTGGACC) purchased from Sigma

Genosys were used to amplify srGAP1 by Polymerase Chain Reaction (PCR). For the

reaction, 290 ng of the Venus-srGAP1/pCS2 plasmid template, 0.5 µM of the primers,

       109

 

1 unit of Phusion DNA Polymerase (New England Biolabs), 1X HF Phusion buffer, 4

mM Magnesium Chloride (MgCl2) and 0.6 mM of dNTP mix were used. The PCR

reaction consisted of an initial denaturation at 98oC for 30 seconds followed by 25

repetitive cycles: denaturation at 98oC for 10 seconds, annealing at 55oC for 15

seconds and extension at 72oC for 2 minutes. Subsequently, final extension was

carried out at 72oC for 2 minutes. The result of the reaction was verified on a 1%

agarose gel followed by ethidium bromide staining.

Following srGAP1-CAAX amplification, the PCR product was purified using

QIAGEN PCR purification kit, according to the specifications of the manufacturer.

Then, 1.5 µg of the purified srGAP1-CAAX PCR product, 4.5 µg of empty pEGFP-C1

plasmid and 4.5 µg of Venus-srGAP1/pCS2 plasmid were digested with 0.04 unit of

EcoRI and XhoI restriction endonucleases overnight at 37oC. The restriction digests

were examined on a 1% agarose gel, and bands corresponding to srGAP1-CAAX,

pEGFP-C1 and Venus/pCS2 were isolated and further purified with QIA quick gel

extraction kit as per the manufacturer’s specifications. Overnight ligations were then

set up at 14oC, each with 1 Weiss unit of T4 ligase enzyme, 1XT4 ligase buffer and a

6:1 ratio of insert: vector (i.e srGAP1-CAAX: pEGFP-C1; srGAP1-CAAX:

Venus/pCS2). Control ligations were also carried out without any insert DNA. The

ligation mix was then transformed into E. coli XL10 competent cells as mentioned in

section A1.2.1. Transformants for Venus-srGAP1-CAAX/pCS2 were selected on

LB/Ampicillin plates, and those of GFP-srGAP1-CAAX/pEGP-C1 were selected on

LB/Kanamycin plates. The positive colonies were screened and sequenced as in

section A1.2.1.

       110

 

A1.2.3 Cloning of srGAP1 constructs into lentiviral expression vector

To generate constructs for lentiviral transfections, eGFP from pEGFP-C1

vector, GFP-srGAP1-CAAX insert from GFP-srGAP1-CAAX/pEGP-C1, and GFP-

srGAP1 insert from GFP-srGAP1/ pEGFP-C1 were sub-cloned into pLenti III-HA

vector using NheI and XhoI endonucleases. Approximately, 3 µg of the GFP-srGAP1-

CAAX/pEGP-C1, GFP-srGAP1/ pEGFP-C1, pEGFP-C1 and pLenti III-HA plasmids

were digested with 0.2 Units of NheI and XhoI enzymes. The rest of the procedure is

as mentioned in section A1.2.1. The GFP-srGAP1-CAAX/ pLenti III-HA and GFP-

srGAP1/ pLenti III-HA transformants were selected on LB/Kanamycin.

A1.2.4 Transfection of srGAP1 constructs

The srGAP1 constructs were transfected into Human Embryonic Kidney 293

(HEK293) or COS7 cells to confirm their expression using LipoD293TM DNA in vitro

transfection reagent (SignaGen Laboratories, Ijamsville, MD). Briefly, the cells were

grown to 85-90% confluence in 12-well plates. The transfection was carried out for 16

hours in serum-free DMEM medium using 2 µg DNA: 6 µl LipoD293 transfection

reagent as per the specifications of the manufacturer.

A1.3 RESULTS AND FUTURE DIRECTIONS

A summary of the srGAP1 constructs generated for the study is summarized in

Table A1. In our study, we generated srGAP1 fluorescently tagged to GFP or Venus.

The Venus tagged constructs were cloned into the pCS2, a vector optimal for transient

transfections. The GFP-srGAP1 constructs were generated in pEGFP-C1 expression

       111

 

vector to generate stable cell lines if required. To constitutively target the srGAP1

protein to the plasma membrane, a CAAX consensus sequence was added to the C-

terminus of srGAP1. The expression of unmodified and CAAX-containing constructs

was confirmed following transfections in COS7 cells (Figures A1 and A2).

Because the srGAP1 DNA expression plasmids were to be used for functional

assays, specifically transmigration and chemotaxis assays, a cell line that migrates is

more suitable. Consequently, the srGAP1 expression plasmids were also transfected

into THP-1 monocytic cell line and Jurkat T-lymphocytes. These transfections were

carried by FuGENE HD and LipoD293 transfection reagents as well as

electroporation. However, the transfection efficiency with these classical methods in

desired cell lines have been low (<5%). As a result, the srGAP1 constructs were then

sub-cloned into a lentiviral expression vector and their expression confirmed in

HEK293 cells (Figure A3). Hence, our future experiments will include transfecting the

THP-1 cells and Jurkat T-cells using the lentiviral transfection system.

To discern if srGAP1 is recruited to the plasma membrane, co-localization

studies with a membrane marker in the presence and absence of Slit2 will be

conducted. Also, for certain Rac- or Cdc42- GAP proteins, recruitment to the plasma

membrane is sufficient to activate the protein (Caloca et al., 2003; Dusi et al., 1996;

Peck et al., 2002). To further test if srGAP1 recruitment to plasma membrane is

sufficient for its activation, srGAP1 constructs with the CAAX consensus sequence at

C-terminus will be used. The presence of CAAX motif promotes post-translational

modifications of srGAP1 including polyisoprenylation, endoproteolysis, and carboxyl

       112

 

methylation, allowing it to constitutively associate with the plasma membrane. To test

whether recruitment of srGAP1 to plasma membrane would suffice, transwell

chemotaxis assays with cells transiently expressing srGAP1-CAAX would be

performed in the absence of Slit2.

It is interesting to note that the srGAP1-CAAX DNA expression plasmids

transiently transfected in COS7 and HEK293 had a different cell morphology when

compared to srGAP1 or GFP transfected cells (Figures A1, A2 and A3). Cells

expressing the srGAP1-CAAX expression plasmids appear smaller and rounder. One

potential explanation is that constitutive targeting of srGAP1 to plasma membrane

may induce secondary changes. srGAP1 is known to bind to Rho GTPases such as

Cdc42 upon Slit2/Robo-1 binding, causing a decrease in the GTPase activity (Ghose

and Van Vactor, 2002; Wong et al., 2001). This decrease in Rho GTPase activity can

then adversely affect the intracellular actin polymerization (Ghose and Van Vactor,

2002; Wong et al., 2001). Thus, if indeed constitutive recruitment to plasma

membrane had activated srGAP1, then the observed morphological changes in

srGAP1-CAAX expressing cells may result from disruption of intracellular actin

cytoskeleton. To circumvent this problem, we will also inducibly recruit srGAP1 to the

plasma membrane using the rapamycin-inducible targeting system. Using this

strategy which involves heterodimerization of two chimeric proteins, srGAP1 can be

selectively targeted to the plasma membrane by rapamycin (Inoue et al., 2005). If our

assays demonstrate that srGAP1 recruitment to the plasma membrane is not the sole

requirement for its activation, then srGAP1 may require post-translational

modifications or other binding partners to activate it. We will verify whether Slit2

       113

 

binding to Robo-1 causes srGAP1 to become phosphorylated or to associate with

other proteins. This can be achieved by mass spectrometry studies. Preliminary work

from Dr. Tony Pawson’s lab has shown that in the basal state srGAP1 interacts with

14-3-3ε, an adaptor protein that brings together functionally diverse signaling proteins

(Blasutig, 2008). However, the significance of this interaction is not known (Blasutig,

2008).

If, however, our experiments demonstrate that recruitment of srGAP1 to the

plasma membrane is necessary and sufficient to mimic “Slit2-like” effects even in the

absence of Slit2, this would allow the creation of assays to rapidly screen compounds

for "Slit2-like" anti-chemotactic properties. Translocation of srGAP1 from the

cytoplasm to the plasma membrane could be used as the read-out to rapidly screen

and identify compounds that act as agonists of Slit2/Robo-1. More importantly, results

from this study would elucidate the mechanism by which Slit2 signals via Robo-1.

       114

 

A1.4 TABLES AND FIGURES

Table A1: A summary of the srGAP1 constructs along with the cell line used to verify

their expressions.

Constructs Cell line used to verify expression

Venus-srGAP1/pCS2 COS7

GFP-srGAP1/pEGFP-C1 COS7

Venus-srGAP1-CAAX/pCS2 COS7

GFP-srGAP1-CAAX/pEGFP-C1 COS7

GFP/pLenti III-HA HEK293

GFP-srGAP1/ pLenti III-HA Not verified yet

GFP-srGAP1-CAAX/ pLenti III-HA HEK293

GFP GFP-srGAP1 Venus-srGAP1

Figure A1

a b c

115

       116

 

Figure A1: COS7 cells transfected with srGAP1 constructs. (a) COS7 cells

transfected with pEGFP-C1. (b) COS7 cells transfected with GFP-srGAP1/pEGFP-C1.

(c) COS7 cells transfected with Venus-srGAP1/pCS2.

GFP-srGAP1-CAAX Venus-srGAP1-CAAX m

erge

d

WG

A

Figure A2

117

       118

 

Figure A2: COS7 cells transfected with srGAP1-CAAX constructs. GFP-srGAP1-

CAAX/pEGFP-C1 and Venus-srGAP-CAAX/ pCS2 plasmids were transfected in

COS7 cells using LipoD293 reagent. 16 hours post-transfection the cells were fixed

with 4% para-formaldehyde and stained with Alexa Fluor 594 wheat germ agglutinin

(WGA) marker for 30 minutes.

GFP-srGAP1-CAAX/pLenti III-HA GFP/pLenti III-HA

Figure A3

a b

119

       120

 

Figure A3: HEK293 cells transfected with srGAP1 constructs. (a) HEK293 cells

transfected with GFP/pLenti III-HA. (b) HEK293 cells transfected with GFP-srGAP1-

CAAX/ pLenti III-HA.

       121

 

A1.5 REFERENCES

Bashaw, G.J., and C.S. Goodman. 1999. Chimeric axon guidance receptors: the

cytoplasmic domains of slit and netrin receptors specify attraction versus

repulsion. Cell 97:917-926.

Blasutig, I. 2008. Phosphorylated motif recognition and mechanisms of cell signaling

in actin-cytoskeletal regulation. PhD Thesis Department of Medical Genetics,

University of Toronto.

Brose, K., K.S. Bland, K.H. Wang, D. Arnott, W. Henzel, C.S. Goodman, M. Tessier-

Lavigne, and T. Kidd. 1999. Slit proteins bind Robo receptors and have an

evolutionarily conserved role in repulsive axon guidance. Cell 96:795-806.

Caloca, M.J., H. Wang, and M.G. Kazanietz. 2003. Characterization of the Rac-GAP

(Rac-GTPase-activating protein) activity of beta2-chimaerin, a 'non-protein

kinase C' phorbol ester receptor. Biochem J 375:313-321.

Chedotal, A. 2007. Slits and their receptors. Adv Exp Med Biol 621:65-80.

Dickinson, R.E., and W.C. Duncan. 2010. The SLIT-ROBO pathway: a regulator of cell

function with implications for the reproductive system. Reproduction 139:697-

704.

Dusi, S., M. Donini, F. Wientjes, and F. Rossi. 1996. Translocation of p190rho

guanosine triphosphatase-activating protein from cytosol to the membrane in

human neutrophils stimulated with different agonists. Biochem Biophys Res

Commun 219:859-862.

Ghose, A., and D. Van Vactor. 2002. GAPs in Slit-Robo signaling. Bioessays 24:401-

404.

       122

 

Guan, H., G. Zu, Y. Xie, H. Tang, M. Johnson, X. Xu, C. Kevil, W.C. Xiong, C. Elmets,

Y. Rao, J.Y. Wu, and H. Xu. 2003. Neuronal repellent Slit2 inhibits dendritic cell

migration and the development of immune responses. J Immunol 171:6519-

6526.

Inoue, T., W.D. Heo, J.S. Grimley, T.J. Wandless, and T. Meyer. 2005. An inducible

translocation strategy to rapidly activate and inhibit small GTPase signaling

pathways. Nat Methods 2:415-418.

Kidd, T., K.S. Bland, and C.S. Goodman. 1999. Slit is the midline repellent for the robo

receptor in Drosophila. Cell 96:785-794.

Kidd, T., K. Brose, K.J. Mitchell, R.D. Fetter, M. Tessier-Lavigne, C.S. Goodman, and

G. Tear. 1998. Roundabout controls axon crossing of the CNS midline and

defines a novel subfamily of evolutionarily conserved guidance receptors. Cell

92:205-215.

Kramer, S.G., T. Kidd, J.H. Simpson, and C.S. Goodman. 2001. Switching repulsion to

attraction: changing responses to slit during transition in mesoderm migration.

Science 292:737-740.

Legg, J.A., J.M. Herbert, P. Clissold, and R. Bicknell. 2008. Slits and Roundabouts in

cancer, tumour angiogenesis and endothelial cell migration. Angiogenesis

11:13-21.

Liu, D., J. Hou, X. Hu, X. Wang, Y. Xiao, Y. Mou, and H. De Leon. 2006. Neuronal

chemorepellent Slit2 inhibits vascular smooth muscle cell migration by

suppressing small GTPase Rac1 activation. Circ Res 98:480-489.

       123

 

Peck, J., G.t. Douglas, C.H. Wu, and P.D. Burbelo. 2002. Human RhoGAP domain-

containing proteins: structure, function and evolutionary relationships. FEBS

Lett 528:27-34.

Prasad, A., A.Z. Fernandis, Y. Rao, and R.K. Ganju. 2004. Slit protein-mediated

inhibition of CXCR4-induced chemotactic and chemoinvasive signaling

pathways in breast cancer cells. J Biol Chem 279:9115-9124.

Soderling, S.H., K.L. Binns, G.A. Wayman, S.M. Davee, S.H. Ong, T. Pawson, and

J.D. Scott. 2002. The WRP component of the WAVE-1 complex attenuates

Rac-mediated signalling. Nat Cell Biol 4:970-975.

Tole, S., I.M. Mukovozov, Y.W. Huang, M.A. Magalhaes, M. Yan, M.R. Crow, G.Y. Liu,

C.X. Sun, Y. Durocher, M. Glogauer, and L.A. Robinson. 2009. The axonal

repellent, Slit2, inhibits directional migration of circulating neutrophils. J Leukoc

Biol 86:1403-1415.

Wong, K., X.R. Ren, Y.Z. Huang, Y. Xie, G. Liu, H. Saito, H. Tang, L. Wen, S.M.

Brady-Kalnay, L. Mei, J.Y. Wu, W.C. Xiong, and Y. Rao. 2001. Signal

transduction in neuronal migration: roles of GTPase activating proteins and the

small GTPase Cdc42 in the Slit-Robo pathway. Cell 107:209-221.

Wu, J.Y., L. Feng, H.T. Park, N. Havlioglu, L. Wen, H. Tang, K.B. Bacon, Z. Jiang, X.

Zhang, and Y. Rao. 2001. The neuronal repellent Slit inhibits leukocyte

chemotaxis induced by chemotactic factors. Nature 410:948-952.

Yao, Q., W.L. Jin, Y. Wang, and G. Ju. 2008. Regulated shuttling of Slit-Robo-GTPase

activating proteins between nucleus and cytoplasm during brain development.

Cell Mol Neurobiol 28:205-221.

       124

 

Ypsilanti, A.R., Y. Zagar, and A. Chedotal. 2010. Moving away from the midline: new

developments for Slit and Robo. Development 137:1939-1952.