Chin. J . Chem. Eng., 15(1) 122-126 (2007)

Soluble Expression and Rapid Quantification of GFP-hepA Fusion Protein in Recombinant Escherichia coZi*

CHEN Yin( %&)**, XING Xinhui(fl$k&)***, YE Fengchun(t'-t%&) and KUANG Ying(%g) Department of Chemical Engineering, Tsinghua University, Beijing 100084, China

Abstract To establish a rapid quantification method for heparinase I during its production in recombinant Es- cherichiu coli, a translational fusion vector was constructed by fusing the N terminus of heparinase I to the C ter- minus of a green fluorescent protein mutant (GFTmutl). As a result, not only was the functional recombinant ex- pression of heparinase I in E. coli accomplished, but also a linear correlation was obtained between the GFP fluores- cence intensity and heparinase I activity, allowing enzyme activity to be quantified rapidly during the fermentation. Keywords functional expression, fusion protein, green fluorescent protein (GFP), heparinase I, rapid quantification

1 INTRODUCTION Heparinase I (hepA) is an important polysaccha-

ride lyase that has important applications in the pro- duction of low molecular weight heparin (LMWH) as an anticoagulant drug. On account of the poor enzy- matic productivity by Flavobacterium heparinum, the original producer of hepA, and the complicated pro- cedures of separation and purification of hepA, the cost of the commercial enzyme is very high, which has hindered the application of heparinase I in the production of LMWH. The measurement of the intra- cellular activity of heparinase I when expressed in E. C O Z ~ is time-consuming. Therefore, it is desirable to es- tablish a rapid and simple quantification method of the enzymatic activity during the bacterial cultivation from the view point of bioprocess optimization. Furthermore, it is well known that heparinase I forms inclusion bod- ies when expressed in recombinant E. coli even by fu- sion to a cellulose binding domain (CBD)[l-31. Thus, it is also necessary to construct a soluble expression system of heparinase I in E. coli.

Since its first cloning and expression in E. coli as a reporter gene[4], green fluorescent protein (GFP) has been used extensively in many biological fields[5,6]. However, the application of GFP as a visible marker in bioprocess monitoring and process optimization is still a developing area. Poppenborg et al.[7] initially dem- onstrated the potential use of GFP by fusion of GFP to an affinity tag for process monitoring. GFP has also proved to be a useful tool in the quantification of high cell density cultivation[8], fermentation process opti- mization, and in the analysis of protein stability during immobilization[9,10]. Either translational fusion[ 11,121 or operon fusion[l3,14] between GFP and the target protein has been applied for the use of GFP in biopro- cess monitoring. Although the mechanism remains un- known, several reports showed that the GFP tag was capable of enhancing the solubility of the attached polypeptides[ 1 1,121. In addition, the fluorescence of the GFP fusion protein is also a reliable indicator of the solubility of the attached proteins fused to the GFP[l5].

The fluorescence of the GFP fusion protein is not de- tected if the attached protein does not fold properly[ 151. Therefore, for a new target protein, a trial-and-error approach for the fusion with GFP is always necessary to examine the fluorescence and the solubility of the GFP fusion protein during the expression.

Thus, the aim of this study is twofold: (1) To ex- amine the solubility enhancement of heparinase I, when the GFP tag is fused to its N terminus; (2) To study the relationship of GFP fluorescence and heparinase I ac- tivity to establish a real-time quantification method for the optimization of enzyme production and to monitor the enzyme stability during the application of GFP-hepA fusion protein in the production of LMWH. As a result, the first step was to demonstrate that the GFP tag was capable of increasing the solubility of heparinase I in recombinant E. coli. Second, a simple relationship between heparinase I activity and GFP fluorescence was realized during the bacterial growth, allowing the enzyme activity to be quantified rapidly.

2 EXPERIMENTAL 2.1 Construction of expression vector pGW-hepA for GFPmutl-hepA fusion protein

Plasmid pMAL-c2x was obtained from the New England Biolabs (NEB, USA). Plasmid pSG1729 containing the &mutl gene was a kind gift from the Bacillus Genetic Stock Center (BGSC, USA). The &mutl gene encodes a highly fluorescent red-shift GFP variant (excitation peak at 488nm and emission peak at 507nm)[16].

The expression vector pGFP-hepA was constructed as shown in Fig.l. The &mutl gene was cloned from pSG1729 with primers P1F-P1R and inserted between the NdeI and Sac1 sites of pMAL-c2x to generate pGFP-dx. HepA was amplified from pMHL[17] with primers P2F-P2R and inserted between the BamHI and HindIII sites of pMAL-c2x to generate pMHS. Then hepA was cut from pMHS by EcoRI and HindIII and inserted into pGFP-c2x to generate pGFP-hepA. The primer sequences are listed below.

Received 2005- 11-21, accepted 2006-06- 12. * Supported by the National Natural Science Foundation of China (No.20336010 and No.20176025).

** Present address: Department of Biological Sciences, the University of Warwick, Coventry, CV4 7AL, UK *** To whom correspondence should be addressed. E-mail: xhxing@tsinghua.edu.cn

Soluble Expression and Rapid Quantification of GFP-hepA Fusion Protein in Recombinant Escherichia coli 123

P1F 5'-3', AAAGGAGATTCGA CATATG GGTACC CTGCAT ATGAGTAAAGGA (Nde I ) P1 R 5'-3', CATCGGAGCTCGAGGTACCTTTGTATAGTTCATCCATGCCATGTG (Sac I ) P2F 5'-3' GCCTGGATCCCAGCAAAAAAAATCCGGTAAC (BamHI) P2R 5'-3' CTTAAAGCTT TTACTATCTGGCAGTTTCGCTGTAC (HindIII)

pMB 1

SacI

Hindlll IacZ,,

NdeIISacl

Pxv 1

amyE3

pMB 1

lacZc,

EcoRIIHind I I I

pMBl oriQ IacIq BP

pMHS MI3 ori

EcoRl Amp BamHl

terminator hepA lacZ,,

1 EcoRl hepA Hindlll

pMBl ori

M I 3 ori pGFP-hepA

sac I EcoRl Amp

Figure 1 Construction of expression vector pGFP-hepA

2.2 Bacterial cultivation and fluorescence detection E. coli BL21(DE3) was transformed with plasmid

pGR-hepA. Unless otherwise stated, the recombinant

E. coli BL21(DE3) [pGFP-hepA1 was grown in Luria Bertani (LB) medium with ampicillin 100~g.ml-' . After the cells were cultivated at 37°C for 2h

Chin. J. Ch. E. 15(1) 122 (2007)

124 Chin. J. Ch. E. (Vol. 15, No.1)

(OD600=0.25), IPTG was added to 0.3mmol.L-', and the cells were shifted to a lower temperature (32"C, 20°C or 15°C) for induction. At predetermined time intervals, lml of the culture was collected to measure cell density, heparinase I activity, and GFP fluores- cence (in RFU, relative fluorescent unit). GFP fluo- rescence of the cultures, with or without cell disrup- tion by sonication, was detected using a fluorescence spectrophotometer with excitation wavelength at 488nm and emission peak at 507nm (F-2500, Hitachi Co., Japan).

2.3 Effects of culture media and induction tem- peratures on GFP-hepA expression

The effects of LB medium and modified M9 me- dium (M9YGC) (containing yeast extract 12.5g.L-', glucose 12g.L-', and CaC12 0.5mmol-L-') on enzyme activity and fluorescence intensity of GFP-hepA were examined using E. coli BL21(DE3) [pGFP-hepA]. The effects of induction temperatures (15 "C, 20%, and 32%) on the expression of GFP-hepA in LB medium were examined using SDS-PAGE based on the procedure reported earlier[ 171.

2.4 Protein determination and heparinase I activ- ity assay

Protein analysis was performed using 12.5% SDS-PAGE, as described in MOLECULAR CLONING[ 181. Heparinase I activity was measured by the UV 232nm method[l9]. One international unit (IU) was defined as the amount of protein that could form lpmol of unsaturated uronic acid per minute at 30"C[ 191.

3 RESULTS AND DISCUSSION 3.1 Functional expression of heparinase I by GFP fusion tag

It was proved that the recombinant expression of heparinase I in E. coli formed inclusion bodies even

by fusion to CBD[3]. The previous results of the au- thors showed that the functional expression of hepari- nase I could be accomplished by the fusion to E. coli-derived maltose-binding protein (MBP) although a low induction temperature (15°C) was needed[ 171. When the expression of GFP-hepA in E. coli BL21(DE3) [pGFP-hepA] was examined at different induction temperatures (15 C , 20"C, and 32"C), the soluble form of GFP-hepA fusion protein was clearly observed even at 32°C (Fig.2), indicating that the GFP tag was helpful in achieving the functional expression of heparinase I in recombinant E. coli. However, the percentage of the soluble form became higher at 15°C (Fig.2). Thus, all the following experiments were car- ried out at the induction temperature of 15 "C . In addi- tion, a band at approximately 43kD, observed in Fig.2, was independent of the induction temperature. Al- though the mechanism related to the appearance of the band remained unknown, it was not likely to be attrib- uted to the degradation of GFP-hepA, as the same band was also observed in E. coli without induction (data not shown). Incidentally, the fraction of the in- soluble fusion protein in Fig.2 was lower than that in the fusion system of MBP-hepA at the same tempera- tures[l7]. The increased solubility of GFP on hepA made it possible for the application of GFP-hepA fu- sion protein in the production of LMWH. Potentially, the GFP tag could also be used as a visible maker for monitoring the enzyme stability during the de- heparinization process.

3.2 Cultivation characteristics of fluorescent E. coli BL21(DE3) [pGFP-hepA]

GFP fluorescence, heparinase I activity, and cell density (OD600) were measured during cell cultivation in LB and M9YGC media (Fig.3). GFP fluorescence was detected either directly or after cell disruption. The GFP fluorescence after cell disruption was much higher than that detected directly, indicating the

Figure 2 SDS-PAGE of GFP-hepA fusion protein (soluble versus insoluble fractions) at different induction temperatures in E. coli BL21(DE3) [pGFP-hepA] (IS: insoluble fraction; S: soluble fraction)

February, 2007

Soluble Expression and Rapid Quantification of GFP-hepA Fusion Protein in Recombinant Escherichia coli 125

influence of light scattering during the transmission of fluorescence through the cell wall. The M9YGC me- dium was chosen because a previous experimental result showed that this medium significantly enhanced both cell growth and expression of the MBP-fused heparinase I in recombinant E. coli (data not shown). As shown in Fig.3, the final cell density in the M9YGC medium was also enhanced, about three times higher than that in the LB medium after 25h cultivation. Accordingly, both the heparinase I activity and GFP fluorescence intensity in the former were much higher than those in the latter. In addition, deg- radation of the GFP-hepA fusion protein was observed after l l h of cultivation in the LB medium using SDS-PAGE (the band strength decreased after l l h , data not shown). This can also be seen from Fig.3(a) as the total enzyme activity and GFP fluorescent in- tensity began to decrease after about 1 lh. Presumably, the degradation of the GFP-hepA fusion protein was due to the stimulation of certain proteases by the overproduction of heterologous proteins in E. coli[20].

1400

I200

I000

800

600 a!

400

200

z

0 d l , I , , I I I I I , I 0 2 4 6 8 1 0 1 2 1 4 1 6 1 8 2 0 2 2 2 4 2 6

cultivation time, 11

(a) LB medium

4000 3500

3000 2500

2000 g 1500

1000 500 n -

I I I I I I 1 I I 1 I I I I

0 2 4 6 8 10 12 14 16 18 20 22 24 t

cultivation time, h (b) M9YGC medium

Figure 3 Time-course profiles of cell density, heparinase I activity, and fluorescence intensity before and after cell

disruption during the cell cultivation in LB (a), and M9YGC (b) media

0 enzymatic activity; n RFU (cells disrupted); A RFU (whole cells); O D G ~

3.3 Relationship between GFP fluorescence, cell density, and heparinase I activity

To establish the relationship between GFP fluo- rescence and heparinase I activity, GFP fluorescence was plotted versus heparinase I activity using the data obtained till the l l h cultivation in the LB medium

[Fig.3(a)] and all the data in the M9YGC medium [Fig.3(b)]. Relationships between heparinase I activity, OD600, and fluorescence intensity for either whole cells or cells after disruption are shown in Figs.4(a)- (d). In both the LB medium [Fig.4(a)] and the M9YGC medium [Fig.4(c)], a linear correlation ex- isted between the fluorescence intensity and hepari- nase I activity, indicating the feasibility of a transla- tional fusion of GFP with heparinase I for rapid detec- tion of the enzymatic activity. The GFP fluorescence also exhibited a good relationship with the cell density in both media [Fig.4(b) and Fig.4(d)].

1000 900 800 700

2 600 d 500

400 300 200 100

1-0.99873 M J-0.99437

-50 0 50 100 150200250300350 enzymatic activity, I U * L - '

(a)

1400 1200 1000 t 4A

J-0,98348

400 200

/- n l I I I I 1 " 1.0 1.5 2.0 2.5 3.0 3.5

OD,"" (b)

1-0.99776

& 2000 1500 1000 500

500 1000 1500 2000 2500 enzymatic activity, IU-L- '

(c)

3500

3 2500

I500 1000

2 2000

5 0 0 l c I I I I I I I 0 1 2 3 4 5 6 7 8 9 1 0 1 1

OD,", (4

Figure 4 Correlation between heparinase I activity and GFP fluorescence intensity (a, c), ODm, and GFP fluorescence in-

tensity @, d) in LB medium (a, b), and M9YGC medium (c, d) w RFU (original culture); A RFU (cells disrupted)

Chin. J. Ch. E. 15(1) 122 (2007)

126 Chin. J. Ch. E. (Vol. 15, No.1)

Although Li et al.[ 121 and Wu et al.[ 111 had also established a similar relationship between GFP and their target proteins by the translational fusion strategy, an attempt to apply a similar method to recombinant expression of human interleukin-2 (hIL-2) failed be- cause the recombinant expression of hIL-2 in E. coli resulted in inclusion bodies[2 11. Interestingly, a simi- lar correlation between GFP fluorescence intensity and the target enzyme activity was also reported by Albano et a1.[13] and Daabrowslu et a1.[14] by an operon fusion of GFP-CAT and GFP variants-human proinsulin. However, the linear correlation established by the operon fusion could be a coincidence as a bi- cistronic vector does not always express a certain proportion of the operon fusion proteins[22].

4 CONCLUTIONS In summary, construction of a translational fusion

system of GFP with heparinase I not only allowed the functional expression of heparinase I to be accom- plished in recombinant E. coli, but also enabled the enzyme production process to be rapidly quantified using GFP fluorescence.

ACKNOWLEDGEMENTS We are grateful to Mr. Minsheng Liu and Dr.

Zhongxuan Gou for their valuable discussions and technical help. We sincerely thank Professor Robert J. Linhardt at the Rensselaer Polytechnic Institute (USA) for his advice on heparinase 1 activity assay.

REFERENCES Emst, S., Venkataraman, G., Winkler, S., Godavarti, R., Langer, R., Cooney, C.L., Sasisekharan, R., “Expression in Escherichia coli, purification and characterization of heparinase I from Flavobacteriurn heparinurn”, Biochem. J., 315,589-597(1996). Sasisekharan, R., Bulmer, M., Moremen, K.W., Cooney, C.L., Langer, R., “Cloning and expression of heparinase I gene from Flavobacterium heparinurn”, Proc. Natl. Acad. Sci. USA., 90,366+3664( 1993). Shpigel, E., Goldlust, A,, Efroni, G, Avraham, A., Eshel, A,, Dekel, M., Shoseyov, O., “Immobilization of recom- binant heparinase I fused to cellulose-binding domain”, Biotechnol. Bioeng., 65, 17-23(1999). Chalfie, M., Tu, Y., Euskirchen, G, Ward, W.W., Prasher, D.C., “Green fluorescent protein as a marker for gene expression”, Science, 263, 802-805( 1994). March, J.C., Rao, G, Bentley, W.E., “Biotechnological applications of green fluorescent protein”, Appl. Micro- biol. Biotechnol., 62, 303-315(2003). Zimmer, M., “Green fluorescent protein (GFP): applica- tions, structure, and related photophysical behavior”, Chem. Rev., 102,759-781(2002).

7

8

9

10

11

12

13

14

15

16

17

18

19

20

21

22

Poppenborg, L., Friehs, K., Flaschel, E., “The green fluorescent protein is a versatile reporter for bioprocess monitoring”, J . Biotechnol., 58,79-88( 1997). Chae, H.J., Delisa, M.P., Cha, H.J., Weigand, W.A., Rao, G., Bentley, W.E., “Framework for online optimization of recombinant protein expression in high-cell-density Es- cherichia coli cultures using GFP-fusion monitoring”, Biotechnol. Bioeng., 69,275-285(2000). Hunt, L., Batard, P., Jordan, M., Wurm, EM., “Fluores- cent proteins in animal cells for process development: optimization of sodium butyrate treatment as an exam- ple”, Biotechnol. Bioeng., 77,528-537(2002). Wu, C.F., Cha, H. J., Valdes, J. J., Bentley, W. E., “GFP-visualized immobilized enzymes: degradation of paraoxon via organophosphorus hydrolase in a packed column”, Biotechnol. Bioeng., 77, 212-21 8(2002). Li, J., Xu, H., Herber, W.K., Bentley, W.E., Rao, G., “In- tegrated bioprocessing in Sacchuromyces cerevisiue us- ing green fluorescent protein as a fusion partner”, Bio- technol. Bioeng., 79, 682-693(2002). Wu, C.F., Cha, H.J., Rao, G , Valdes, J.J., Bentley, W.E., “A green fluorescent protein fusion strategy for monitor- ing the expression, cellular location, and separation of biologically active organophosphorus hydrolase”, Appl. Microbiol. Biotechnol., 54,78-83(2000). Albano, C.R., Randers-Eichhorn, L., Bentley, W.E., Rao, G, “Green fluorescent protein as a real time quantitative reporter of heterologous protein production”, Biotechnol. Prog., 14,351-354(1998). Daabrowski, S., Brillowska, A,, Kur, J., “Use of the green fluorescent protein variant (YFP) to monitor MetArg human proinsulin production in Escherichia coli“, Protein Expr. Purif., 16, 3 15-323(1999). Waldo, G.S., Standish, B.M., Berendzen, J., Terwilliger, T.C., “Rapid protein-folding assay using green fluores- cent protein”, Nut. Biotechnol., 17, 69 1-693 1999). Cormack, B.P., Valdivia, R.H., Falkow, S., “FACS-optimized mutants of the green fluorescent pro- tein (GFP)”, Gene, 173, 33-38(2000). Chen, Y., Xing, X.H., Lou, K., “Construction of recom- binant Escherichia coli for over-production of soluble heparinase I by fusion to maltose-binding protein”, Bio- chern. Eng. J., 23, 155--159(2005). Sambrook, J., Russell, D.W., Molecular Cloning (Third Edition), Cold Spring Harbor, New York (2001). Su, H., Blain, F., Musil, R.A., Zimmermann, J.J., Gu, K., Bennett, D.C., “Isolation and expression in Escherichia coli of hepB and hepC, genes coding for the glycosami- noglycan-degrading enzymes heparinase I1 and hepari- nase 111, respectively, from Flavobacteriurn heparinurn”, Appl. Environ. Microbiol., 62, 2723-2734( 1996). Goff, S.A., Goldberg, A.L., “Production of abnormal proteins in E. coli stimulates transcription of Ion and other heat shock genes”, Cell, 41,587-595(1985). Cha, H.J., Wu, C.F., Valdes, J.J., Rao, G, Bentley, W.E., “Observations of green fluorescent protein as a fusion partner in genetically engineered Escherichia coli: monitoring protein expression and solubility”, Biotechnol. Bioeng., 67,565-574(2000). Rucker, P., Torti, EM., Torti, S.V., “Recombinant femtin: modulation of subunit stoichiometry in bacterial expres- sion systems”, Protein Eng., 10,967-973( 1997).

February, 2007