Annals of Oncology 8 (Suppl. 2): S119-S122, 1997.© 1997 Kluwer Academic Publishers. Printed in the Netherlands.

Original article

Somatic mutations of the translocated bcl-2 gene are associated withmorphologic transformation of follicular lymphoma to diffuselarge-cell lymphoma

A. Matolcsy,1 R. A. Warnke,2 & D. M. Knowles3

^Department of Pathology, University Medical School of Pecs, Pecs, Hungary; 2 Department of Pathology, Stanford University Medical Center,Stanford, CA, USA; 3Department of Pathology, The New York Hospital- Cornell Medical Center, New York, NY, USA

Summary

Background: Ninety percent of low-grade follicular lymphomas(FLs) carry the t(14;18) translocation. This event juxtaposes thebcl-2 oncogene to the immunoglobulin (Ig) heavy-chain geneand leads to bcl-2 gene overexpression. Morphologic transfor-mation of FL to high-grade lymphoma is associated with multi-ple secondary chromosomal abnormalities of the neoplasticcells.

Design: To analyze whether additional structural alterationsof the translocated bcl-2 gene are associated with morphologictransformation of FL, we PCR-amplified, cloned, and sequencedthe major breakpoint region (MBR) and the open readingframes (ORF) of the translocated bcl-2 oncogene in six pairedsamples of FL and subsequent diffuse large-cell lymphoma(DLL).

Results: In five cases, FL and DLL cells were clonally related,

as suggested by the identical MBR sequences, but in one casethey were different. PCR single-strand conformation polymor-phism (SSCP) and sequence analyses were performed for iden-tification of structural alterations of the bcl-2 gene in the OFRregion corresponding to the 239 amino acid p26-bcl-2a protein.In three of the six patients, a total of 11 point mutations of theORF were detected in the DLL cells. Four of them, at positions29,46, 59, and 106, yielded amino acid replacements.

Conclusions: These findings demonstrate that FL and DLLcells may be clonally related or unrelated. They also show thattransformation of FL cells can be associated with somatic pointmutations of the bcl-2 oncogene ORF sequence resulting inalteration of the p26-Z>c/-2a gene product.

Key words: bcl-2 oncogene, diffuse large-cell lymphoma, follic-ular lymphoma, lymphoma transformation, somatic mutation

Introduction

Morphologic transformation of low-grade B-cell follicu-lar lymphoma (FL) to diffuse aggressive intermediate- orhigh-grade non-Hodgkin's lymphoma (NHL) occurs inabout 25% to 30% of patients during their clinical course[1]. This morphologic transformation is usually associatedwith acceleration of the clinical course and shortenedsurvival.

Approximately 90% of FLs are associated with thet(14;18) translocation that places the bcl-2 oncogene intojuxtaposition with the joining (JH) segment of the immu-noglobulin (Ig) heavy-chain (H) gene. In most cases, thebreakpoints on chromosome 18 are clustered either in the3' end of the last bcl-2 exon or within the 3'-untranslatedregion of the gene, leaving the open reading frame (ORF)intact [2, 3]. The t(14;18) translocation deregulates expres-sion of the bcl-2 gene product, which contributes to pro-longed cell survival by blocking programmed cell death(apoptosis) [4]. In general, FL cells undergoing trans-formation to a higher grade NHL retain their t(14;18)translocation and acquire secondary genetic abnormal-ities, including nonrandom chromosomal changes, c-myc

gene rearrangement, or p53 tumor-suppressor gene muta-tions, suggesting that heterogeneous genetic lesions anddifferent molecular mechanisms underlie this neoplasticevolution [5-7].

To analyze whether secondary alterations of the trans-located bcl-2 gene are associated with the morphologictransformation of FL, we analyzed the nucleotide se-quence of the breakpoint and ORF regions of the bcl-2oncogene in six cases of FL that underwent morphologictransformation to diffuse large-cell lymphoma (DLL).

Materials and methods

Tumor biopsies and criteria for morphologic transformation

Six histologically transformed FLs occurring in patients observed atStanford University Medical Center were selected for this study. Thematched pre-transformed FL was also available in all six cases. Thehistology of the six pre-transformed tumor samples were follicular cen-ter-cell lymphoma (FL), provisional cytologic grade I; the transformedhigh-grade NHLs were classified as DLL (Table 1).

Downloaded from https://academic.oup.com/annonc/article-abstract/8/suppl_2/S119/167900by gueston 11 April 2018

120

Table 1. Summary of bcl-2 gene breakpoint and ORF sequence analysis in six cases of FL and supervening DLL.

Patients

1

2

3

4

5

6

Sample

AB

AB

AB

AB

AB

AB

Date ofbiopsy

08-31-8303-27-85

03-26-8704-20-90

08-09-8410-09-86

10-05-8908-17-90

05-12-8603-17-87

05-07-8712-29-88

Histology

FL-IDLL

FL-IDLL

FL-IDLL

FL-IDLL

FL-IDLL

FL-IDLL

Bcl-2 breakpoint sequences

mbr mcr D(position) (position)

+(147)+(147)

+(62) - D21-9+(121)

+(118)+(118)

+(167)+(167)

+(61)+(61)

+(60)+(60)

JH(position)

JH6b(25)JH6b(25)

JH4b(6)JH4b(10)

JH6c(32)JH6c(32)

JH6b(23)JH6b(23)

JH6c(ll)JH6c(U)

JH6c(25)JH6c(25)

Bcl-2 OFR sequences (-40-741)

21 A/Gpoly-mor-phism

A/GA/G

AA

A/GA/G

GG

A/GA/G

A/GA/G

Numberof muta-tions

:

2

-

4

-

5(G)*

Type of mutations(position)

:

C>T(-11) ;G > A(66)

-

G > A(24, 66, 85);C > T(137)

-

C > T(33, 175, 176);G > A(317,354)

Missensemutation(position)

-

:

-

E > K(29);P > L(46)

-

P > L(59);R > H(106)

Abbreviations: DLL - diffuse large B-cell lymphoma; FL-I - follicular lymphoma, grade I, predominantly small cleaved; mbr (position) - majorbreakpoint region (bp distance of the breakpoint from the mbr primer); mcr - minor cluster region; D - Ig heavy-chain diversity region gene; JH(position) - Ig heavy-chain joining region gene (bp distance of the breakpoint from the JH primer); ORF - open reading frame; * - mutationdetected in only G polymorphic sequences.

Polymerase chain reaction (PCR) and sequence analysis of t( 14; 18)breakpoints.

PCR and sequence analysis of genomic DNAs was used to characterizethe t(14;18) translocation in six paired samples of FL and DLL. Majorbreakpoint region (mbr) or minor cluster region (mcr) specific bcl-2sense primers in conjunction with an JH antisense primer were used inPCR, as previously described [8], The PCR products were cloned andsequenced.

PCR single-strand conformation polymorphism (SSCP) and sequenceanalysis oibcl-2 proto-oncogene ORF

PCRs were performed to amplify DNA segments of the bcl-2 ORFcorresponding to the p26-6c/-2a protein. Three pairs of amplificationprimers were designed and used in separate reactions to achieve thePCR amplification of the first 717 bp corresponding to amino acids 1to 239 of the ORF. The pairs of sense and antisense primers were (-40)AGAGGTGCCGTTGGCCCCCGTTGC / (221) GTCTGCAGCGGC-GAGGTCCT; (202) AGGACCTCGCCGCTGCAGAC / (478) TGAC-GCTCTCCACACACATGAC AND (448)TTGAGTTCGGTGGGGT-CATG / (741) TTTGGGGCAGGCATGTTGAC. PCR reactions wereperformed with 100 ng of DNA, 10 pmol of each primer, 2.5 nmoldNTPs, 1 uCi of [a-32P]dCTP (NEN; specific activity, 3000 Ci/mmol),10 mmol Tris (pH 8.8), 50 mmol KC1, 1.5 mmol MgCl2, 0.5 U of AmpliTaq DNA polymerase (Boehringer Mannheim Corp, Indianapolis, IN)in a final volume of 10 uL. Amplifications were performed for 30 cycles(denaturing: 95 °C for 1 min; annealing: 58 °C for 2 min; extension: 72 °Cfor 2 min). The SSCP analysis of the PCR products was performed asdescribed previously [7],

Results

Molecular characterization oft(14;18) chromosomaltranslocations

A fusion was demonstrated between the bcl-2 gene andmembers of the Ig JH exons in all six FL and DLLsamples, confirming the presence of t(14;18) transloca-tions in these tumors (Figure 1, Table 1). In five patients(cases 1 and 3-6), the FL and DLL cells showed identicalbcl-2 and JH breakpoints and intervening junctionalsequences, suggesting a common clonal origin for thetwo tumor cell populations. In the FL cells from onepatient (case 2), the bcl-2 breakpoint was 62 bp and theJH breakpoint was 6 bp distant from the annealing site ofthe sense and antisense primers, respectively. The junc-tional sequence of the hybrid gene was found to containa D21-9 gene. In the DLL cells from the same patient,the bcl-2 breakpoint was 121 bp and the JH breakpointwas 10 bp distant from the annealing site of the sense orantisense primers, respectively. The junctional sequenceof the hybrid gene was 8 bp long and showed no homol-ogy to the junctional sequence of the FL cells. The factthat the bcl-2/igH gene hybrid of the DLL cells in patient2 incorporated longer bcl-2 and JH fragments than thepreexisting FL cells suggests that the DLL cells developedthrough an additional independent t(14;18) translocationrather than by deletion of diversity (D) genes from thebcl-2/lgH gene hybrid of the FL cells.

Downloaded from https://academic.oup.com/annonc/article-abstract/8/suppl_2/S119/167900by gueston 11 April 2018

[Ai GAAAGCAGGAAACCTGTGGT (147)-(B) GAAAGCAGGAAACCTGTGGT 1147)*

IA) CCCTCCTGCCCTCCTTCCGC 162)-(B) ATGCAGTGGTGCTTACGCTC (121)-

{AI GAAATGCAGTGGTGCTTACG (119) •IBI GAAATGCAGTGGTGCTTACG dial*

(A) AVGAAGCCAGACCTCCCCGG (1671*(E) ATGAAGCCAGACCTCCCCGG (167)-

(A) GCCCTCCTGCCCTCCTTCCG 161)-(B) GCCCTCCTGCCCTCCTTCCG (61)-

(A) AGCCCTCCTGCCCTCCTTCC (60!-(B) AGCCCTCCTGCCCTCCTTCC (601-

TCAGTATTTGTTCCTCAGTATTTGTTCC

TCTTCTACTTAGGTGGCACCGAGGGA -GTATTACTATGATAG (D21-9)- ATATCGTGCT

GTTTCGGGGTTTTGGTTTCGGGGTTTTG

TTTTGTGCATAAGCCCCCAATTTTGTGCATAAGCCCCCAA

TTTTCGGGGATTCTATTTTCGGGGATTCTA

(2 5) i CTACGGTATGGACGTCTGGGGCCAAGGGGCCACG(25) » CTACGGTATGGACGTCTGGGGCCAAGGGGCCACG

(611 GGCCAGGGAACCCTG[10)1 CTGGGGCCAGGGAACCCTG

(3211 ACTACTACTACTACATGGACGTCTGGGGNAAAGGGACCACG132)1 ACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACG

(23)1 ACGGTATGGACGTCTGGGGCCAAGGGACCACG(2 3) # ACGGTATGGACGTCTGGGGCCAAGGGACCACG

111)* TCTGGGGCAAAGGGACCACG111) # TCTGGGGCAAAGGGACCACG

E 2 5) I CTACTACATGGACGTCTGGGGCAAAGGGACCACG(2 5) • CTACTACATGGACGTCTGGGGCAAAGGGACCACG

121

U H6b)(JH6bl

(JH4b)<JH4b]

(JH6c)IJH6c)

IJH6b)(J6b)

(JH6c)(JH6=I

(JK«<=>(Ju6c)

Figure 1. Bcl-2/JH junction sequences indentified in six FLs and subsequent DLLs by PCR-sequence analysis. DNA sequences flanking bcl-2 and JH

breakpoints and the intervening D- and N-regions of FL and respective DLL cells are clustered in each case. The distance of bcl-2 (mbr) breakpointsfrom the sense primers and the distance of JH breakpoints from the antisense primers are shown in parentheses, respectively.

Frequency, type, and position of mutations in the bcl-2ORF

Figure 2 shows the results of PCR-SSCP analysis gener-ated by the primers that span the region -40 to 741 bp ofthe ORF. PCR products from DLL samples of patients 2,4, and 6 showed altered electrophoretic mobility com-pared to their respective FL cell counterparts. Sequenceanalysis of the bcl-2 ORF in six FLs confirmed the resultsof SSCP analysis. None of the six FL samples showednucleic acid changes compared to germline bcl-2 genesequences. A total of 11 point mutations detected in thethree DLLs (cases 2, 4, and 6) showed altered electro-phoretic mobility by SSCP analysis, but these mutationswere absent in the preexisting FLs (Table 1). All 11 so-matic mutations were transitions (A > C or G > T) andfour of them predicted amino acid substitutions withinthe p26-6c/-2a protein at codons 29 (E > K), 46 and 59(P > L), and 106 (R > H).

Discussion

The present report confirms previous studies showingthat FL and transformed DLL may carry identicalt(14;18) translocations and junctional bcl-2/JH gene se-quences suggesting a common clonal origin for the twoneoplasms, and it extends them by providing evidencethat FL and DLL cells in the same patient can displaydifferent t(14;18) chromosome translocations and junc-tional bcl-2/JH gene sequences, thereby suggesting dis-crete clonal B-cell origins.

Somatic mutation of the ORF of the translocated bcl-2gene has been demonstrated in SU-DHL-6 lymphomacell lines carrying the t(14;18) translocation [10], and inFL cells of different histological types [11], but the bio-logical significance of these mutations is highly debated.The correlation of somatic mutations with transformedDLLs suggested in our recent study may be associatedwith the activated proliferating phenotype of high-gradeNHL cells.

Gene transfer studies in lymphokine-dependent hema-topoietic cells indicate interactions of the bcl-2 proteinwith itself and other members of the bcl-2 family mem-bers, including bax, bcl-x-l and bcl-x-s. Bax is envisioned

Case 1N N N(A) (G) (AA3) a b a b a

Case 2 Cas»3 Case 4 Cases Case 6

BCasei Caw 2 C—3 C—4 CntS Cases

Case 1 Case 2 Case 3 Case 4 Case 5 Case 6

Figure 2. PCR-SSCP analysis of bcl-2 gene corresponding to amino acid1 to 239 of the ORF in six cases of FL (a) and subsequent DLL (b)samples. (A) PCR-SSCP analysis generated by the primers that span theregion from -40 bp to 221 bp of the ORF. A/G hereditary polymor-phism of the bcl-2 gene located at 21 bp into the ORF has beendocumented [9]. Lanes labeled N(A), N(G), and N(A/G) represent themigration pattern of wild type A, G, and A/G hereditary polymorphicforms located at 21 bp position, respectively. (B) PCR-SSCP analysisgenerated by the primers that span the region from 202 bp to 487 bp ofthe ORF. (C) PCR-SSCP analysis generated by the primers that span theregion from 448 bp to 741 bp of the ORF. Arrows identify the abnor-mally migrating bands.

as a cell-death (apoptosis) effector whose activity is neu-tralized by binding of bcl-2 [12]. The binding of bcl-x-s tobcl-2 was hypothesized to prevent bcl-2 from interactingwith bax, thus leaving bax unopposed in its cell-deatheffector function [12]. Use of site-specific mutagenesis [13]and deletion mutants [12] of bcl-2 suggests that bcl-2homodimerization and heterodimerization with other

Downloaded from https://academic.oup.com/annonc/article-abstract/8/suppl_2/S119/167900by gueston 11 April 2018

122

bcl-2 family members involves interaction between dis-tinct regions within the bcl-2 protein. In our studies, wehave shown that somatic mutation in DLL cells resultedin replacements of the amino acid at positions 29, 46, 59,and 106 of the bcl-2 protein. These structural alterationsmay affect interaction of bcl-2 with other bcl-2 familymembers and/or other oncogenes and tumor-suppressorgenes. Since the precise amino acid residues of the bcl-2protein involved in homo- or hetrodimerization have notbeen determined, the mechanism(s) by which structurallyaltered bcl-2 protein changes to biological behavior of FLcells is highly speculative. The demonstration of alteredamino acid residues of the bcl-2 protein in morphologi-cally transformed of FL cells showed in the presentstudies provides a reasonable starting point for the fur-ther investigation of the molecular basis and pathways oflymphoma transformation.

Ackowledgements

This study was partially supported by NIH grantsEY-06337 to D. M. Knowles and CA-33119 and CA-34233 to R. A.Warnke.

References

10.

12.

13.

point cluster region in human follicular lymphomas. J Exp Med1986; 164: 315-20.Korsmeyer S J. Bcl-2 initiates a new category of oncogenes: Regu-lations of cell death. Blood 1992; 80: 879-86.Richardson ME, Quanguang C, Filippa DA et al. Intermediate- tohigh-grade histology of lymphomas carrying t(14; 18) is associatedwith additional nonrandom chromosome changes. Blood 1987; 70:444-7.

Yano T, Jaffe ES, Longo DL et al. MYC rearrangements in histo-logically progressed follicular lymphomas. Blood 1992; 80: 758-67.Lo Coco F, Gaidano G, Louie DC et al. P53 mutations areassociated with histologic transformation of follicular lymphoma.Blood 1993; 82: 2289-95.Crescenzi M, Seto M, Herzig GP et al. Thermostable DNA poly-merase chain amplification of t(14;18) chromosome breakpointsand detection of minimal residual disease. Proc Natl Acad SciUSA 1988; 85: 4869-73.Tanaka S, Kant J, Reed JC. G to A polymorphism in the secondexon of the6c/-2 gene. Nucleic Acid Res 1991; 19:1964-9.Seto M, Jaeger U, Hockett RD et al. Alternative promoters andexons, somatic mutation, and transcriptional deregulation of thebcl-2-Ig fusion gene in lymphoma. EMBO J 1988; 7:123-9.Tanaka S, Louie DC, Kant JA et al. Frequent incidence of somaticmutations in translocated bcl-2 oncogenes of non-Hodgkin's lym-phomas. Blood 1992; 79: 229-37.

Sato T, Hanada M, Bodrug S et al. Interactions among members ofthe bcl-2 protein family analyzed with a yeast two-hybrid system.Proc Natl Acad Sci USA 1994; 91: 9238^2.Yin X, Oltvai ZN, Korsmeyer SJ. HB1 and HB2 domains of bcl-2are required for inhibition of apoptosis and heterodimerizationwith box. Nature 1994; 369: 321-3.

Garvin AJ, Simon RM, Osborne CK et al. An autopsy study ofhistologic progresssion in non-Hodgkin's lymphomas: 192 casesfrom the National Cancer Institute. Cancer 1983; 52: 393-405.Cleary ML, Sklar J. Nucleotide sequence of a t(14;18) chromoso-mal breakpoint in follicular lymphoma and demonstration of abreakpoint cluster region near a transcriptionally active locus onchromosome 18. Proc Natl Acad Sci USA 1985; 82: 7439-43.Cleary ML, Galili N, Sklar J. Detection of a second t(14;18) break-

Correspondence to:Daniel M. Knowles, MDDepartment of PathologyThe New York Hospital - Cornell Medical Cancer525 East 68th StreetNew York, NY 10021USA

Downloaded from https://academic.oup.com/annonc/article-abstract/8/suppl_2/S119/167900by gueston 11 April 2018