some major episodes in the history of life.. trends in ecology & evolution feb. 2003. vol. 18,...
TRANSCRIPT
![Page 1: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/1.jpg)
Some major episodes in the history of life.
![Page 2: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/2.jpg)
Trends in Ecology & EvolutionFeb. 2003. Vol. 18, Iss. 2
3 of these 5 are the most downloaded papers in TREE
1. Taxonomy: renaissance or Tower of Babel? Jim Mallet et al4. A plea for DNA taxonomy Tautz et al5. The encyclopedia of life Edward Wilson
![Page 3: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/3.jpg)
DNA barcodinga new diagnostic tool for rapid species recognition identification,
and discovery
James Hanken, Museum of Comparative Zoology, Harvard University, USA
New Scientist, 26 June, 2004
![Page 4: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/4.jpg)
BARCODING LIFE
Mark Stoeckle, The Rockefeller University; Paul E. Waggoner, Connecticut Agricultural Experiment Station; Jesse H. Ausubel, Alfred P. Sloan Foundation
Barcoding is a standardized approach to identifying plants and animals by minimal sequences of DNA, called DNA barcodes.
DNA Barcode: A short DNA sequence, from a uniform locality on the genome, used for identifying species.
![Page 5: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/5.jpg)
By harnessing advances in electronics and genetics, barcoding will • help many people quickly and cheaply recognize known species
and retrieve information about them• speed discovery of the millions of species yet to be named • provide vital new tools for appreciating and managing the
Earth’s immense and changing biodiversity.
Standardization• accelerate construction of a comprehensive, consistent
reference library of DNA sequences• speedy development of economical technologies for species
identification.
The goal is that anyone, anywhere, anytime be able to identify quickly and accurately the species of a specimen whatever its condition.
• Results so far suggest that a mitochondrial gene will enable identification of most animal species.
• For plants, mitochondrial genes do not differ sufficiently to distinguish among closely related species. Promising approaches to standardize plant identification use one or possibly more barcode regions are under development.
![Page 6: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/6.jpg)
An Internal ID System for All Animals
Typical Animal Cell
Mitochondrion
DNA
mtDNA
D-Loop
ND5
H-strand
ND4
ND4L
ND3COIII
L-strand
ND6
ND2
ND1
COII
Small ribosomal RNA
ATPase subunit 8
ATPase subunit 6
Cytochrome b
COICOI
The Mitochondrial Genome
![Page 7: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/7.jpg)
• Copy number. There are 100-10,000 more copies ofmitochondrial than nuclear DNA per cell, making recovery,especially from small or partially degraded samples, easierand cheaper.
• Relatively few differences within species in most cases. Small intraspecific and large interspecific differences signal distinct genetic boundaries between most species, enabling precise identification with a barcode.
• Introns, which are non-coding regions interspersed between coding regions of a gene, are absent from mitochondrial DNA of most animal species, making amplification straightforward. Nuclear genes are often interrupted by introns, making amplification difficult or unpredictable.
Why barcode animals with mitochondrial DNA?
Mitochondria, energy-producing organelles in plant and animal cells, have their own genome. Twenty years of research have established the utility of mitochondrial DNA sequences in differentiating among closely-related animal species.
Four properties make mitochondrial genomes especially suitable for identifying species
* Greater differences among species
![Page 8: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/8.jpg)
How Barcoding is Done
From specimen to sequence to species
Voucher Specimen
DNA extraction CO1 gene DNA sequencing Trace file
Database of Barcode Records
Collecting
ND3
COIII
ND2
ND1
![Page 9: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/9.jpg)
What are the main limits to barcoding encountered so
far? • Groups with little sequence
diversity• Resolution of recently
diverged species • Hybrids• Nuclear pseudogenes
![Page 10: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/10.jpg)
What do barcode differences among and within animal species studied so far suggest? • Barcodes identify most animal species unambiguously. • Approximately 2-5% of recognized species have shared or
overlapping barcodes with closely-related species. Many of the species with overlapping barcodes hybridize regularly.
• In all groups studied so far, distinct barcode clusters with biologic co-variation suggest cryptic species.
![Page 11: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/11.jpg)
Barcoding North American birds highlights probable cryptic species
![Page 12: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/12.jpg)
Barcodes affirm the unity of the species Homo sapiens.
Comparisons show we differ from one another by only 1 or 2 nucleotides out of 648, while we differ from chimpanzees at 60 locations and gorillas at 70 locations.
![Page 13: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/13.jpg)
Can barcodes aid understanding history of animal and plant species?
![Page 14: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/14.jpg)
What isn’t DNA barcoding?• It is not intended to, in any way, supplant
or invalidate existing taxonomic practice.• It is not DNA-taxonomy; it does not
equate species identity, formally or informally, with a particular DNA sequence.
• It is not intended to duplicate or compete with efforts to resolve deep phylogeny, e.g., Assembling the Tree of Life (ATOL).
![Page 15: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/15.jpg)
“the role of any molecular diagnostic is to aid research, not to serve as an end in itself. Barcoding … is independent of questions as to whether individual taxa are species, what species are (or should be), and where they fit in a unified tree of life…. Barcoding is not an end in itself, but will boost the rate of discovery. The unique contribution of DNA barcoding to … taxonomy and systematics is a compressed timeline for the exploration and analysis of biodiversity.”
![Page 16: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/16.jpg)
Sequence data
Barcoding must adhere to standards for specimen and data management
Voucher specimens and electronic databases
Digital images
![Page 17: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/17.jpg)
Strengths• Offers alternative taxonomic identification
tool for situations in which morphology is inconclusive.
• Focus on one or a small number of genes provides greater efficiency of effort.
• Cost of DNA sequencing is dropping rapidly due to technical advances.
• Potential capacity for high throughput and processing large numbers of samples.
• Once reference database is established, can be applied by non-specialist.
![Page 18: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/18.jpg)
Weaknesses• Assumes intraspecific variation is negligible, or at
least lower than interspecific values.
• No single gene will work for all taxa (e.g., COI is not appropriate for vascular plants, or even for some animals).
• Single-gene approach is less precise than using multiple genes; may introduce unacceptable error.
• Some of the most attractive aspects rely on future technology, e.g., handheld sequencer
![Page 19: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/19.jpg)
Simple & Ambitious!Advocates Opposition
ID all species
Discover new species
Speed up ID’s
Revitalize biological collections
Won’t work
Destroy traditional systematics
Service industry
Pseudo taxonomy
![Page 20: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/20.jpg)
A global science project
► 5 years
► 5M specimens
► 500K species
Making Every Species Count
![Page 21: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/21.jpg)
Official launch of iBOL – CN Tower, Toronto, September 25, 2010
![Page 22: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/22.jpg)
iBOL launches with 1M records, 100K species
![Page 23: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/23.jpg)
iBOL structure: participating nations
Central Nodes ($25M) Regional Nodes ($5M) National Nodes ($1M)
![Page 24: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/24.jpg)
Collection andDatabasing
Central Nodes
Developing Nodes
Regional Nodes
Curation andIdentification
Sequencing MirroredDatabases
Data Analysisand Access
ICI is an alliance of researchers and biodiversity organisations in 21 nations. All nations active in specimen assembly, curation and data analysis.Sequencing and informatics support by regional and central nodes.
![Page 25: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/25.jpg)
Theme 1:
DNA Barcode Library
WG1.1 VertebratesWG1.2 Land PlantsWG1.3 FungiWG1.4 Animal Parasites, Pathogens & VectorsWG1.5 Agricultural & Forestry Pests & ParasitoidsWG1.6 PollinatorsWG1.7 Freshwater Bio-SurveillanceWG1.8 Marine Bio-SurveillanceWG1.9 Terrestrial Bio-SurveillanceWG1.10 Polar Life
![Page 26: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/26.jpg)
iBOL WG 1.5
• Bringing genomics to the fight against plant pests and invasive species
• Assembling a DNA barcode reference library of pests and their parasitoids
• 2015 target: 25,000 of the most important pest species
![Page 27: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/27.jpg)
BENEFITS OF DNA BARCODING BENEFITS OF DNA BARCODING
•DNA barcoding can speed up identification of new species.
•DNA barcodes can be linked to readily observable morphological characters.
•DNA barcoding can provide an avenue to encourage new participants into taxonomy.
•Applied taxonomic research areas will benefit from barcoding.
•Food adulteration
![Page 28: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/28.jpg)
![Page 29: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/29.jpg)
• Promote barcoding as a global standard
• Build participation
• Working Groups
• BARCODE standard
• International Conferences
• Increase production of public BARCODE records
Networks, Projects, Organizations
Barcode of Life Community
![Page 30: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/30.jpg)
CBOL Member Organizations: 2009
• 200+ Member organizations, 50 countries
• 35+ Member organizations from 20+ developing countries
![Page 31: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/31.jpg)
NBII, 25 February 2009
GenBank, EMBL, and DDBJGlobal, Open Access to Barcode Data
http://www.insdc.org/
![Page 32: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/32.jpg)
Barcode Sequence
Voucher Specimen
Species Name
Specimen Metadata
Literature(link to content or
citation)
BARCODE Records in INSDC
Indices - Catalogue of Life - GBIF/ECAT
Nomenclators - Zoo Record - IPNI - NameBank
Publication links - New species
Geo referenceHabitat
Character setsImages
BehaviorOther genes
Trace files
Other Databases
PhylogeneticPop’n
GeneticsEcological
Primers
Databases - Provisional sp.
![Page 33: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/33.jpg)
NBII, 25 February 2009
Linkout from GenBank to BOLD
![Page 34: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/34.jpg)
NBII, 25 February 2009
Linkout from GenBank to Taxonomy
![Page 35: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/35.jpg)
NBII, 25 February 2009
Link from GenBank to Museums
![Page 36: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/36.jpg)
Current Norm: High throughputLarge labs, hundreds of samples per day
ABI 3100 capillary
automated sequencer
Large capacity PCR and
sequencing reactions
![Page 37: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/37.jpg)
Emerging Norm: Table-top Labs Faster, more portable: Hundreds of samples per hour
Integrated DNA microchips
Table-top microfluidic systems
![Page 38: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/38.jpg)
Producing Barcode Data: 201?Barcode data anywhere, instantly
• Data in seconds to minutes
• Pennies per sample• Link to reference
database• A taxonomic GPS• Usable by non-
specialists
![Page 39: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/39.jpg)
Adoption by Regulators• Food and Drug Administration
– Reference barcodes for commercial fish• NOAA/NMFS
– $100K for Gulf of Maine pilot project– FISH-BOL workshop with agencies, Taipei, Sept 2007
• Federal Aviation Administration – $500K for birds• Environmental Protection Agency
– $250K pilot test, water quality bioassessment• FAO International Plant Protection Commission
– Proposal for Diagnostic Protocols for fruit flies • CITES, National Agencies, Conservation NGOs
– International Steering Committee, identifying pilot projects
![Page 40: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/40.jpg)
Establishing a DNA Barcode for Land plants
Santiago Madriñán Restrepo
Universidad de los Andes, Bogotá, Colombia
![Page 41: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/41.jpg)
COI or cox1 in Plants
• Low sequence divergence
• Other mitochondrial genes– Exhibit incorporation of foreign genes– Frequent transfer of some genes to the nuclear
genome
![Page 42: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/42.jpg)
Barcode representation of DNA fingerprints of Indian CASHEW varieties (Archak et al 2003
![Page 43: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/43.jpg)
Project PartnersPartner Organizations Scientists Target groups
Royal Botanic Gardens, Kew, UK Robyn Cowan Mark Chase
Conostylis, Pinus, Equisetum, Dactylorhiza maculata/incarnata
complex
Natural History Museum (London), UK Mark Carine Tortella, Ptychomniaceae, Asplenium,
Natural History Museum, Denmark Gitte Petersen Hordeum, Scalesia, Crocus
New York Botanical Garden, USA Kenneth Cameron Elaphoglossum, Cupressus, Labordia
Royal Botanic Garden Edinburgh, UK Peter Hollingsworth Podocarpus, Araucaria, Asterella,
Anastrophyllum
South African National Biodiversity Institute, (Cape Town), South Africa Ferozah Conrad Encephalartos, Mimetes
Universidad de los Andes, Colombia Santiago Madriñán Lauraceae
Instituto de Biologia UNAM, Mexico Gerardo A. Salazar Agave
Universidade Estadual de Feira de Santana, Brasil
Cássio van den Berg Laelia, Cattleya
University of Cape Town, South Africa Ter ry Hedderson Anastrophyllum- Barbilophozia,
Bryum
Imperial College, UK (& RBG Kew) Timothy Barraclough (Data analysis)
![Page 44: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/44.jpg)
Plant Barcode Proposals
![Page 45: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/45.jpg)
04/19/23 45
Molecules and their useful rangesin phylogenetic relationships
Species Genera Family Order Class Divisions
Spacers[ITS]
mt DNA
Nu rDNA
Taylor, et al., 1991
; more sufficient statistically significant results
; sufficient statistically significant results
![Page 46: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/46.jpg)
Other Regions• Internal transcribed spacer regions of nuclear
ribosomal DNA (ITS)– often highly variable in angiosperms at the generic and
species level– divergent copies are often present within single
individuals
• Non-coding plastid regions– Highly length variable
• rbcL (– Not variable enough at species level for many plant
groupsPlastid DNA• Monomorphic
• High copy number
• Highly diagnostic
![Page 47: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/47.jpg)
Regions and PrimersGene Primer Direction Sequence 5'- 3'
matK 2.1 f CCTATCCATCTGGAAATCTTAG 2.1a f ATCCATCTGGAAATCTTAGTTC 5 r GTTCTAGCACAAGAAAGTCG 3.2 r CTTCCTCTGTAAAGAATTC rpoC 1 1 f GTGGATACACTTCTTGATAATGG 2 f GGCAAAGAGGGAAGATTTCG 3 r TGAGAAAACATAAGTAAACGGGC 4 r CCATAAGCATATCTTGAGTTGG rpoB 1 f AAGTGCATTGTTGGAACTGG 2 f ATGCAACGTCAAGCAGTTCC 3 r CCGTATGTGAAAAGAAGTATA 4 r GATCCCAGCATCACAATTCC accD 1 f AGTATGGGATCCGTAGTAGG 2 f GGRGCACGTATGCAAGAAGG 3 r TTTAAAGGATTACGTGGTAC 4 r TCTTTTACCCGCAAATGCAAT YCF5 1 f GGATTATTAGTCACTCGTTGG 2 f ACTTTAGAGCATATATTAACTC 3 r ACTTACGTGCATCATTAACCA 4 r CCCAATACCATCATACTTAC ndhJ 1 f CATAGATCTTTGGGCTTYGA 2 f TTGGGCTTCGATTACCAAGG 3 r ATAATCCTTACGTAAGGGCC 4 r TCAATGAGCATCTTGTATTTC
![Page 48: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/48.jpg)
Sister taxa: Cattleya and Sophronitis“Corsage orchids”
Unifoliate species = 18 species, allopatric species “complex” Bifoliate species = 25 well-defined species, 6 species pairs
Sophronitis: 63 spp. in 3 subgenera (as “sections”)Sect. Cattleyodes+Hadrolaelia – 17 well-defined speciesSect. Parviflorae – 40 spp. messy complex, genetic data indicate ca. 15 spp.Sect. Sophronitis – 6 allopatric closely related species
Cattleya: 43 spp. in 2 subgenera
C.labiata C. aclandiae S. perrinii S. sp. nov.
Cássio van den BergUniversidade Estadual de Feira de Santana, Brasil
![Page 49: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/49.jpg)
% species discriminated
• ITS: 90.5%• psbA-trnH: 60%• matK: 33.3%• ndhJ: 37.1%• rpoB: 9.9%• rpoC1:9.9%• accD: 6.05 %
Nuclear non-coding
Plastid non-coding
Plastid coding
• accD, rpoB, rpoC1: variation too low for use as a single barcode
• matK and ndhF: more variable but with great variation of rate among subgenera
• Non-coding regions (ITS and psbA-trnH spacer) performed better, but required great manual effort for indel alignment
![Page 50: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/50.jpg)
Lauraceae• Big family
• Largely unstudied
• VERY difficult to id.
• Economically important
![Page 51: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/51.jpg)
Lauraceae
accD matK ndhJ rpoB rpoC1Actinodaphne glabra K-8202Actinodaphne pruinosa K-8203Aiouea dubia AN-417Beilschmiedia pendula BCI-065681Beilschmiedia pendula BCI-170421Beilschmiedia pendula BCI-257596Beilschmiedia tawa K-5519Caryodaphnopsis cogolloy JAUM-s.n.Cinnamomum camphora K-6469Cinnamomum dictyoneuron K-8201Cinnamomum obtusifolium K-8303Cinnamomum triplinerve BCI-206711Cinnamomum triplinerve BCI-240764Cinnamomum triplinerve SM-Ama-005Cinnamomum zeylanicum K-8306Cryptocarya triplinervis K-5522Dodecadenia grandiflora K-5520Endlicheria sp. 1 SM-Ama-006Endlicheria sp. 2 SM-Ama-003Lauraceae sp. 1 A-1535Lauraceae sp. 2 NN-BCI?Laurus azorica K-21989Laurus nobilis SM-s.n.Lindera benzoin K-16947Litsea cubeba K-15475Nectandra cissiflora BCI-216314Nectandra cissiflora BCI-233922Nectandra cissiflora BCI-244145Nectandra cissiflora BCI-269005Nectandra cuspidata FC-1579Nectandra cuspidata Gamboa-s.n.Nectandra 'fuzzy' BCI-036152Nectandra 'fuzzy' BCI-105750Nectandra lineata BCI-065446Nectandra lineata BCI-220065Nectandra purpurea BCI-151022Nectandra purpurea BCI-277412Nectandra purpurea BCI-415163Nectandra sp. 1 AN-410Nectandra sp. 1 AN-411Neolitsea aciculata K-17739Ocotea callophyla SM-s.n.Ocotea cernua BCI-206437Ocotea cernua BCI-215988Ocotea cernua BCI-412951Ocotea floribunda HD-1166Ocotea guianensis A-818Ocotea oblonga BCI-309078Ocotea oblonga BCI-403510Ocotea puberula BCI-146684Ocotea puberula BCI-272219Ocotea puberula BCI-716317Ocotea sp. 1 HD-1167Ocotea whitei BCI-008086Ocotea whitei BCI-306277Persea americana SM-s.n.Persea caerulea Sánchez-4911Persea rimosa K-8204Rhodostemonodaphne frontinoensis Brant-1387Rhodostemonodaphne kunthiana HD-1175Rhodostemonodaphne kunthiana Madriñán-717Rhodostemonodaphne penduliflora SM-s.n.Sassafras albidum K-16948
accD matK ndhJ rpoB rpoC1
Genera 17 17 16 17 17
Species 42 40 36 42 43
Specimens 47 58 42 48 49
Sp. w/ >1 specimen
5 11 6 6 6
![Page 52: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/52.jpg)
matK
974 bp
![Page 53: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/53.jpg)
ndhJ
428 bp
![Page 54: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/54.jpg)
Cryptocarya triplinervis K-5522
![Page 55: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/55.jpg)
Laurus nobilis SM-s.n.
![Page 56: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/56.jpg)
A comparative study of different DNA barcoding markers for the identification of
some members of LamiacaeaFabrizio De Mattia, Ilaria Bruni, Andrea Galimberti, Francesca Cattaneo, Maurizio Casiraghi, Massimo Labra
Università degli Studi di Milano Bicocca, ZooPlantLab, Dipartimento di Biotecnologie e Bioscienze, Piazza della Scienza 2, 20126 Milano, Italy
Food Research International 44 (2011) 693–702
The objective is to evaluate the efficacy of a DNA barcoding approach as a tool for the recognition of commercial kitchen spices belonging to the Lamiaceae family that are usually sold as enhancers of food flavor. A total of 64 spices samples, encompassing six different genera (i.e. Mentha, Ocimum, Origanum, Salvia, Thymus and Rosmarinus) were processed with a classical DNA barcoding approach by amplifying and sequencing four candidate barcode regions (rpoB, rbcL, matK and trnH-psbA) with universal primers. Results suggest that the non-coding trnH-psbA intergenic spacer is the most suitable marker for molecular spices identification followed by matK, with interspecific genetic distance values ranging between about 0% to 7% and 0% to 5%, respectively. Both markers were almost invariably able to distinguish spices species from closest taxa with the exclusion of samples belonging to the genus Oregano. Moreover, in a context of food traceability the two markers are useful to identify commercial processed spice species (sold as dried plant material). We also evaluated the potential benefits of a multilocus barcode approach over a single marker and although the most suitable combination was the matK+trhH-psbA, the observed genetic distances values were very similar to the discriminatory performance of the trnH-psbA. Finally, this preliminary work provide clear evidences that the efficacy of a DNA barcoding approach to the recognition of commercial spices is biased by the occurrence of taxonomic criticisms as well as traces of hybridization events within the family amiaceae. For this reason, to better define a more practical and standardized DNA barcoding tool for spices traceability, the building of a dedicated aromatic plants database in which all species and cultivars are described (both morphologically and molecularly) is strongly required.
![Page 57: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/57.jpg)
Fig. 1. Neighbor-joining reconstructions obtained with MEGA 4.0 for three out of the four molecular datasets produced in this study. Each tree encompasses all the samples analysed for the six taxonomical group considered: a) trnH-psbA, b) matK, c) rbcL. Bootstrap values lower than 70% not showed. Details on samples, species, cultivar, provenance and accession numbers for each marker can be retrieved from Table 1. Each taxonomic group has been shown
on the tree with squared brackets.
![Page 58: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/58.jpg)
Overall Results
• Standardized universal primers• Different levels of variation in different
groups at different taxonomic levels• Variable ID success with a single region
• Score on basis of– Amplification success– Sequence variation
![Page 59: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/59.jpg)
Non-COI regions for other taxa
• Land plants:– Chloroplast matK and rbcL approved Nov 09– Non-coding plastid and nuclear regions being
explored
![Page 60: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/60.jpg)
www.kew.org/barcoding
![Page 61: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/61.jpg)
What barcode providers want
• High PCR and sequencing success rates
• Bigger window into older, compromised samples
• Better software integration to eliminate bottlenecks
• Smaller labs/developing countries:– Lower equipment and maintenance costs
– Simplification for techs with less training
– Install anywhere without lab renovations
– Willing to accept slower throughput
![Page 62: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/62.jpg)
What barcode users want
• Answers to specific questions:
– Is this thing on this list of species or not?
– Is this thing a member of this genus/family?
– Which of the species on this list is this thing?
– What species is this thing?
• Production-scale capabilities:
– Hundreds to thousands of installations
– Lower but constant throughput
– Rapid turnaround
– The right price-point and limited life cycle costs
![Page 63: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/63.jpg)
What barcode users would do with the reference libraries
• Inspection stations at every port and international airport for:
– Agricultural pest control
– Illegal trade in endangered species
– Violations of trade quotas
• Regular Federal and State water quality surveys
• Federal, State and local food inspection
• Public health monitoring and diagnoses
![Page 64: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/64.jpg)
IISR
Barcoding of insect pests of Spices (IIHR, IISR initiative (TK Jacob) - COI
Barcoding for checking adulterants in traded spices (Sasikumar B) – ITS, rbcL, Mat K etc
![Page 65: Some major episodes in the history of life.. Trends in Ecology & Evolution Feb. 2003. Vol. 18, Iss. 2 3 of these 5 are the most downloaded papers in TREE](https://reader038.vdocuments.net/reader038/viewer/2022110401/56649dea5503460f94ae565d/html5/thumbnails/65.jpg)