SOX2–LIN28/let-7 pathway regulates proliferation andneurogenesis in neural precursorsFlavio Cimadamore, Alejandro Amador-Arjona, Connie Chen, Chun-Teng Huang, and Alexey V. Terskikh1

Center for Neuroscience, Aging, and Stem Cell Research, Sanford-Burnham Medical Research Institute, La Jolla, CA 92037

Edited by Konrad Hochedlinger, Massachusetts General Hospital, Boston, MA, and accepted by the Editorial Board June 18, 2013 (received for reviewNovember 20, 2012)

The transcription factor SRY (sex-determining region)-box 2(SOX2) is an important functional marker of neural precursor cells(NPCs) and plays a critical role in self-renewal and neuronal differ-entiation; however, the molecular mechanisms underlying its func-tions are poorly understood. Using human embryonic stem cell-derived NPCs to model neurogenesis, we found that SOX2 isrequired to maintain optimal levels of LIN28, a well-characterizedsuppressor of let-7 microRNA biogenesis. Exogenous LIN28 expres-sion rescued the NPC proliferation deficit, as well as the early butnot the late stages of the neurogenic deficit associated with theloss of SOX2. We found that SOX2 binds to a proximal site in theLIN28 promoter region and regulates LIN28 promoter acetylation,likely through interactions with the histone acetyltransferase com-plex. Misexpression of let-7 microRNAs in NPCs reduced prolifera-tion and inhibited neuronal differentiation, phenocopying the lossof SOX2. In particular, we identified let-7i as a novel and potentinhibitor of neuronal differentiation that targets MASH1 andNGN1, two well-characterized proneural genes. In conclusion, wediscovered the SOX2–LIN28/let-7 pathway as a unique molecularmechanism governing NPC proliferation and neurogenic potential.

neural stem cells | mechanisms of pluripotency

Self-renewing, multipotent neural precursor cells (NPCs) arecapable of terminally differentiating into neuronal and glial

lineages during development and in the adult nervous system (1,2). Disruption of the pathways controlling NPC biology has beenimplicated in various pathologies, including autism (3), TreacherCollins syndrome (4), and neural tube defects (5), emphasizingthe importance of gaining a better understanding of the un-derlying molecular events and how they may be manipulated totreat and prevent such pathologies. The HMG-box transcriptionfactor SOX2 is ubiquitously expressed in NPCs and supportstheir self-renewal (6). SOX2 is also required for neurogenesis inthe central nervous system (7–10). Recently, we used humanembryonic stem cells (hESCs) and mouse models to demonstratea critical requirement for SOX2 for sensory neurogenesis indorsal root ganglia (11). However, the mechanisms by whichSOX2 functions in self-renewal and neuronal differentiationremain poorly understood.Small, noncoding microRNAs (miRNAs) are transcribed as

long precursors (pri-miRNAs) that are sequentially processed bythe RNases Drosha/Pasha to form pri-miRNAs and by Dicer toform the mature miRNAs of ∼20–25 nucleotides. The miRNAsfunction through imperfect base-pairing with hundreds of targetmRNAs to trigger their degradation (or block their translation)by the RNA-induced silencing complex, RISC (12). In somecases, miRNA maturation is tightly controlled; for example, theRNA-binding protein LIN28 regulates the biogenesis of the let-7miRNA family by inhibiting their maturation at both the pri-miRNA (13, 14) and premiRNA (15, 16) processing steps. In-triguingly, LIN28 protein was found to be associated with SOX2protein in mouse ESC, but the functional consequences of theinteraction are unclear (17, 18). Beyond its role in let-7 bio-genesis, LIN28 was recently reported to regulate splicing of a

large proportion mRNAs and to bind numerous other mRNAs,many of which play roles in growth and survival (19, 20).MicroRNAs have been shown to control gene expression in

many important cellular functions such as stress signaling anddifferentiation, and in diseases such as cancer (21, 22). SeveralmiRNAs have been reported to regulate mammalian neuro-genesis by promoting neuronal differentiation (miR-124) (23) orby supporting NPC maintenance and opposing their differenti-ation (miR-184 and miR-137) (24, 25). The let-7 family has beenshown to attenuate proliferation by inhibiting cell cycle regu-lators such as RAS, high mobility group AT-hook 2 (HMGA2),Cyclin D, and CDC25 (26–28). In particular, the let-7b miR wasfound to inhibit self-renewal and promote neuronal differentia-tion of mouse NPCs by targeting the critical stem cell tran-scription factor TLX and the cell cycle regulator CCND1 (29).Here, we present evidence for an unsuspected link betweenSOX2 and the LIN28/let-7 pathway and provide a molecularmechanism for the dual role of SOX2 in maintaining NPC pro-liferation and neurogenic potential.

ResultsSOX2 Positively Regulates LIN28 Expression. Our previous micro-array gene expression analysis of hESC-derived multipotentNPCs (11, 30, 31) suggested that SOX2 regulates the expressionof LIN28, a well-studied repressor of let-7 family biosynthesis(13–16). Immunofluorescence analysis confirmed that SOX2 andLIN28 were coexpressed in all NPCs (Fig. 1A). We used NPCsderived from a hESC line carrying a doxycycline (dox)-inducibleSOX2 shRNA (11) to knock down SOX2 and monitor theexpression of LIN28 transcripts. Following dox treatment, weobserved loss of SOX2 expression with concomitant and pro-portional loss of LIN28, as measured by quantitative PCR

Significance

The transcription factor SOX2 plays a critical role in self--renewal and neuronal differentiation of neural precursors (NPCs);however, the molecular mechanisms underlying its functionsare poorly understood. We found that SOX2 regulates theexpression of LIN28, a suppressor of let-7 microRNA biogenesis.Exogenous LIN28 rescued the NPC proliferation and someneurogenic deficits in the absence of SOX2. We identified let-7ias a novel and potent inhibitor of neuronal differentiation thatrepresses proneural genes. The discovery of SOX2–LIN28/let-7pathway that maintains both NPC proliferation and neurogenicpotential will enhance our understanding and therapeutic de-velopment relevant to neurodegeneration and brain tumors.

Author contributions: F.C. and A.V.T. designed research; F.C., A.A.-A, C.C., and C.-T.H.performed research; C.-T.H. contributed new reagents/analytic tools; F.C., A.A.-A., andA.V.T. analyzed data; and F.C. and A.V.T. wrote the paper.

The authors declare no conflict of interest.

This article is a PNAS Direct Submission. K.H. is a guest editor invited by the EditorialBoard.1To whom correspondence should be addressed. E-mail: terskikh@burnham.org.

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1220176110/-/DCSupplemental.

www.pnas.org/cgi/doi/10.1073/pnas.1220176110 PNAS | Published online July 24, 2013 | E3017–E3026

NEU

ROSC

IENCE

PNASPL

US

Dow

nloa

ded

by g

uest

on

July

24,

202

1

(qPCR) analysis (Fig. 1B). Down-regulation of LIN28 (60–80%decrease) was confirmed at the protein level by Western blot andimmunocytochemistry (Fig. 1 C and D). The reintroduction ofexogenous SOX2 in SOX2 knockdown NPCs rescued LIN28expression (Fig. S1 A and B; note that the shRNA targets SOX23′ UTR and therefore does not affect the exogenous SOX2coding sequence). SOX2 knockdown also triggered a less pro-nounced decrease (∼45%) in expression of LIN28B, a LIN28homolog that also suppresses let-7 maturation (Fig. S1C). Ourconventional neuralization protocol (see Materials and Methodsfor details) resulted in neural precursors uniformly positive forPAX3 and SOX9, and up to 80% positive for SOX10 (Fig. S2 A–K). These neural precursors are biased toward a dorsal identityand are hereafter referred to as NPCs. To investigate whetherSOX2 regulation of LIN28 depends on the regional identity ofthe NPCs, we used ventralized NPCs (vNPCs) obtained by pat-terning hESC during neuralization with the Sonic Hedgehog(SHH) agonist purmorphamine. vNPCs expressed high levels ofthe ventral markers OLIG2 and FOXA2 and displayed markedlyreduced levels of the dorsal markers PAX3 and GDF7 (Fig. S2 I–K). Knockdown of SOX2 in vNPCs resulted in robust down-regulation of LIN28 (Fig. 1E), suggesting that SOX2 regulationof LIN28 expression is independent of the NPC regional identity.Next, we used mouse genetic models to investigate the de-

pendence of LIN28 expression on SOX2 in vivo. LIN28 washighly expressed in the developing neural tube (E11) of wild-typeanimals (Fig. 1F). In contrast, ablation of SOX2 expression in

Sox2flox::Wnt1-Cre mutant mice [Sox2flox allele (8) crossed withWnt1-Cre mice (32)] reduced LIN28 expression by 60% in thedorsal region, where the Wnt1-Cre transgene is most active (Fig.1 F and G). These results demonstrate that SOX2 is required forexpression of physiological levels of LIN28 in the developingneural tube. We also analyzed LIN28 expression in the sub-granular layer of the dentate gyrus, the area of adult hippo-campal neurogenesis (33). LIN28 was readily detected in NPCs(CFPnuc+ cells; Fig. 1H) of Nestin-CFPnuc transgenic mice(34). We engineered Sox2flox::mGFAP-Cre::Nestin-CFPnuc micein which SOX2 is ablated in adult NPCs (35) (Fig. S2 L and M).In these mice, levels of LIN28 were reduced by 65% in theneural precursors (CFPnuc+ cells) within the subgranular layerof dentate gyrus (Fig. 1 H and I and Fig. S2 N and O). Finally, weused the same transgenic mouse model to assess the effect ofSOX2 knockout on LIN28 expression in the adult NPCs of thesubventricular zone (SVZ), another region of the adult mousebrain displaying active neurogenesis. Similarly to that observedin the subgranular layer of dentate gyrus, we found significantreduction of LIN28 levels in the neural precursors (CFPnuc+cells) of SOX2 conditional knockout mice (Fig. 1 J and K andFig. S2 P and Q).Collectively, our in vitro data from human NPCs with different

regional identities, and the in vivo data in the developing spinalcord and neurogenic niches of the adult brain, indicate a generalrequirement of SOX2 for optimal levels of LIN28 expression inneural stem/precursor cells.

Fig. 1. SOX2 regulates the expression of LIN28. (A) Immunostaining for SOX2 and LIN28 in hESC-derived NPCs. (B) qPCR analysis of SOX2 (Left) and LIN28(Right) expression following SOX2 knockdown in hESC-derived NPCs. shRNA was induced by dox on day 0. Data are normalized to HPRT. shSOX2, SOX2shRNA; shCTRL, scrambled shRNA. (C) Western blot for SOX2 and LIN28 in SOX2 knockdown cells 3 d after dox induction. (D) Immunostaining for LIN28 inSOX2 knockdown and control NPCs 3 d after dox induction. (E) qPCR analysis of SOX2 and LIN28 expression in ventralized NPCs 3 d after dox induction. (F)Immunostaining for SOX2 and LIN28 in fetal neural tubes (E11) of wild-type (Sox2+/+) and SOX2 knockout (Sox2flox/flox) mice with conditional deletion in thedorsal neural tube (Wnt1-Cre::Sox2flox). (G) Quantification of LIN28 fluorescence shown in F. (H) Immunostaining for LIN28 in the subgranular layer of theadult hippocampal dentate gyrus in wild-type (Sox2+/+) and SOX2-deleted (Sox2flox/flox) mice. (I) Quantification of LIN28 fluorescence in CFP+ cells shown in H.(J) Immunostaining for LIN28 in the subventricular zone of wild-type (Sox2+/+) and SOX2-deleted (Sox2flox/flox) mice. (K) Quantification of LIN28 fluorescence inCFP+ cells shown in J. **P < 0.005. Nestin-CFPnuc transgene labels neuronal precursors in H and J. Nuclei are in blue (DAPI). (Scale bars: 50 μm.) Error bars ± SE.

E3018 | www.pnas.org/cgi/doi/10.1073/pnas.1220176110 Cimadamore et al.

Dow

nloa

ded

by g

uest

on

July

24,

202

1

SOX2 Modulates Histone Acetyltransferase Activity at the LIN28Promoter. A bioinformatic analysis of the LIN28 promoter inseveral species revealed the presence of putative SOX bindingsites, including a conserved site proximal to the transcriptioninitiation site (distance <150 bp; Fig. S3A). We assayed humanLIN28 2-kb proximal promoter (containing either a wild-type ora mutated SOX binding site) in wild-type or SOX2 knockdownNPCs (Fig. S3 B and C). The mutated promoter was significantlyless active compared with wild type in the presence Sox2; how-ever, no differences were observed in the absence of Sox2 (Fig.S3 B and C), suggesting that SOX2 directly modulate the activityof LIN28 promoter at least in part through the conserved prox-imal SOX binding site. We next directly assessed SOX2 bindingat the human LIN28 promoter in hESC-derived NPCs by ChIP-qPCR, and we found that SOX2 binds in proximity of the tran-scription start site (Fig. 2 A and B). Overall, these data suggestthat SOX2 directly interacts with LIN28 genomic regulatoryelements. In a previous study (11), we identified SOX2-inter-acting proteins in hESC-derived NPCs by immunoprecipitationfollowed by mass spectrometry (IP-MS). Intriguingly, we foundthat SOX2 interacts with several protein components of histoneacetyltransferase (HAT) complexes (Fig. 2C), and among thesewere DNMT1-associated protein 1 (DMAP1), TBP-associatedfactor (TAF), TAF5, TAF6, and the HAT adaptor proteinTRRAP (36), which was recently found to interact with SOX2in mouse NPCs (37). We confirmed that TRRAP is expressedand colocalized with SOX2 in the nuclei of NPCs (Fig. 2D),hinting at the possibility that SOX2 might be associated withaHAT adaptor complex that increasesHAT activity on the LIN28promoter. Indeed, ChIP experiments with a TRRAP-specificantibody demonstrated the presence of TRRAP-containing com-plexes associated with the LIN28 promoter in the proximity ofthe SOX2 binding site (Fig. 2E). Furthermore, down-regulationof SOX2 resulted in a significant reduction in TRRAP-containingcomplexes at the LIN28 promoter (Fig. 2F) and reduced the

binding of HATs known to interact with TRRAP [i.e., GCN5 (38)and PCAF (39); Fig. 2F]. These results suggest that the in-teraction of TRRAP and HATs with LIN28 regulatory elementsrequires SOX2.Consistent with the reduced binding of TRRAP and HATs at

the LIN28 promoter, SOX2 knockdown reduced the acetylationof histone H3 at lysine 9 (H3K9Ac) and lysine 18 (H3K18Ac),epigenetic markers for open, actively transcribed chromatin (Fig.2G). A 24-h treatment of NPCs with the HAT inhibitor MB3significantly reduced the levels of LIN28 mRNA (Fig. S3D),suggesting that histone acetylation is functionally required tomaintain high levels of LIN28 expression. To evaluate whetherthe reduced assembly of the HAT machinery at LIN28 promoterwas specific for LIN28 or due to a global loss of acetylation andHAT functional components, we quantified TRRAP, GCN5, andglobal H3K9/18ac in SOX2 knockdown NPCs. Loss of SOX2 didnot alter TRRAP expression (Fig. S4 A and B), and GCN5 wasslightly down-regulated (53% and 39% decrease by qPCR andWestern blot, respectively; Fig. S4 A and B). The global levelsof H3K9/18Ac were not altered in SOX2 knockdown NPCs(Fig. S4 C and D). These results suggest that SOX2 knockdowninduces a local reduction of H3K9/18 acetylation at the LIN28promoter. The loss of histone acetylation in SOX2 knockdowncells could also be explained if SOX2 inhibits histone deacety-lases (HDACs) at the LIN28 promoter; if so, we reasoned thatchemical inhibition of HDACs should mimic SOX2 functionand increase LIN28 expression, even in the absence of SOX2.However, we found that HDAC inhibition in shSOX2-treatedcells did not increase LIN28 expression (Fig. S3E), suggestingthat SOX2 regulation of LIN28 promoter acetylation is likelymediated only by HAT activity. Considering that TRRAP-con-taining complexes regulate different types of histone acetylation,it is possible that additional epigenetic mechanisms may be op-erating. Collectively, our results suggest that SOX2 regulatesthe epigenetic state (H2K9/18Ac) of LIN28 promoter and that in

Fig. 2. SOX2 affects the epigenetic state of human LIN28 promoter. (A) Schematic of the putative SOX2 binding sites on the human LIN28 promoter. (B) ChIP-qPCR showing SOX2 enrichment at the LIN28 promoter. (C) SOX2 was shown to interact with TRRAP and other proteins found in HAT complexes using a SOX2IP-MS approach. (D) NESTIN/TRRAP (Upper) and SOX2/TRRAP (Lower) costaining showing TRRAP expression in NPCs. (E) ChIP-qPCR analysis of TRRAP bindingto LIN28 promoter in proximity to the SOX2 binding site. (F) ChIP-qPCR analysis demonstrated reduced binding of TRRAP and HATs (GCN5 and PCAF) at theLIN28 promoter in SOX2 knockdown (shSOX2) vs. control (shCTRL) cells. (G) ChIP-qPCR with antibodies specific for H3K9Ac, H3K9/18Ac, and control IgGdemonstrated reduced levels of H3 acetylation at the LIN28 promoter in shSOX2 vs. shCTRL cells. Analyses were performed 3 d after dox-mediated shRNAinduction. *P < 0.05, **P < 0.005. Error bars ± SE. (Scale bars: 50 μm.)

Cimadamore et al. PNAS | Published online July 24, 2013 | E3019

NEU

ROSC

IENCE

PNASPL

US

Dow

nloa

ded

by g

uest

on

July

24,

202

1

the absence of SOX2, LIN28 promoter exhibits a decreasedH3K9/18 acetylation associated with a more closed chromatinconfiguration.

LIN28 Modulates NPC Proliferation and Neuronal Commitment.SOX2 knockdown in proliferating NPCs (i.e., cultured underself-renewal conditions) decreased the cell number comparedwith control cultures; however, immunostaining for activatedcaspase 3 (AC3) showed no change in apoptosis, suggestingthat the rate of cell death is unchanged under these conditions.Instead, SOX2 knockdown dramatically decreased NPC pro-liferation, as assessed by immunostaining of the cell cycle markerKi67 (52% reduction; Fig. 3 A and B) and BrdU incorporation(30.9 ± 1.9% BrdU+ cells in control NPCs vs. 16.9 ± 2.9%in SOX2 knockdown cells). Because LIN28 has been shownto promote proliferation in both let-7–dependent (28) and–independent (19) manners, we asked if exogenous LIN28 wouldrescue NPC proliferation in the absence of SOX2. Inducibleexpression of exogenous LIN28 in SOX2 knockdown NPCs re-stored LIN28 to 63% of its endogenous level (while SOX2 levelsremained low; Fig. 3H). Reexpression of LIN28 efficiently res-cued NPC proliferation, as assessed by Ki67 staining (89% ofcontrol; Fig. 3 A and B) and BrdU incorporation (16.9 ± 2.9%BrdU+ cells in SOX2 knockdown NPCs vs. 35.6 ± 1.2% inSOX2 knockdown cells expressing exogenous LIN28). Theseresults suggest that LIN28 can fully rescue the proliferativedeficits associated with SOX2 knockdown and therefore estab-

lish LIN28 as a major downstream mediator of SOX2-dependentproliferation in NPCs.We previously found that knocking down SOX2 precludes

NPC differentiation into neurons without affecting glial fates(11). Indeed, SOX2 knockdown in NPCs cultured under con-ditions favoring neuronal differentiation strongly reduced theappearance of young TUJ1+ neurons (Fig. 3 C and D) andcompletely inhibited the more mature MAP2+ cells (Fig. 3G).The loss of neurons was likely due to extensive apoptosis, asevaluated by immunostaining for AC3 (Fig. 3 E and F). Ex-pression of exogenous LIN28 on the background of SOX2knockdown rescued the early stages of neuronal differentiation(TUJ1 immunostaining; Fig. 3 C and D) and reduced apoptosisby 57% (AC3 immunostaining; Fig. 3 E and F), suggesting thatprevention of cell death might contribute to the observed LIN28-dependent rescue. However, LIN28 overexpression was unableto rescue neuronal maturation (MAP2 staining; Fig. 3G), sug-gesting that other functions of SOX2 are required to achieveneuronal maturation.Taken together, these results suggest that LIN28 plays a major

role in controlling SOX2-dependent NPC proliferation andcontributes to SOX2-dependent neurogenesis.

Role of let-7 in NPC Proliferation and Neuronal Differentiation.LIN28 is well known to be a suppressor of let-7 miR biogenesis.Therefore, we investigated the effect of SOX2 knockdown (andsubsequent LIN28 down-regulation) on expression of the let-7miR family in NPCs. Quantification of mature miRNA expression

Fig. 3. LIN28 rescues SOX2-dependent proliferation and an early but not late stage of neurogenesis. (A) Immunostaining for Ki67 in NPCs expressing dox-inducible scrambled shRNA (Left, shCTRL), inducible SOX2 shRNA (Center, shSOX2/RFP), and inducible SOX2 shRNA in conjunction with inducible LIN28 (Right,shSOX2/LIN28). We overexpressed red fluorescent protein (RFP) in shSOX2/RFP cells to control for LIN28 overexpression in shSOX2/LIN28 NPCs. In all of theassays described in this figure, the shSOX2/RFP line performed similarly to the shSOX2 line. (B) Quantification of the Ki67 staining shown in A. (C) Immu-nostaining for TUJ1 in shCTRL, shSOX2/RFP, and shSOX2/LIN28 lines cultured under neuronal differentiation conditions. (D) Quantification of the TUJ1staining shown in C. (E) Immunostaining for AC3 in shCTRL, shSOX2/RFP, and shSOX2/LIN28 lines cultured under neuronal differentiation conditions. (F)Quantification of AC3 staining shown in E. (G) MAP2 staining in shCTRL, shSOX2/RFP, and shSOX2/LIN28 lines cultured under neuronal differentiationconditions. (H) qPCR analysis of SOX2 and LIN28 expression in shSOX2/RFP, shSOX2/LIN28, and shCTRL NPC lines was performed to confirm exogenous ex-pression of LIN28 in the shSOX2/LIN28 line. Data are normalized to HPRT. *P < 0.05, **P < 0.005. Nuclei are in blue (DAPI). Error bars ± SE. (Scale bars: 50 μm.)

E3020 | www.pnas.org/cgi/doi/10.1073/pnas.1220176110 Cimadamore et al.

Dow

nloa

ded

by g

uest

on

July

24,

202

1

upon SOX2 knockdown using TaqMan miRNA arrays showedthat 50% of total let-7 family members were up-regulated, 25%were not affected, and 25% were down-regulated (Fig. S5A).Subsequent qPCR analysis confirmed the up-regulation of maturelet-7b miR (albeit at lower levels, suggesting that TaqMan arrayanalysis may overestimate the up-regulation of let-7 miRs) andidentified an increase in mature let-7i miR, which was notdetected on the TaqMan array (Fig. 4A). In agreement with theobserved up-regulation of let-7b, qPCR analysis of SOX2 knock-down NPCs revealed significant down-regulation of the reportedlet-7b targets TLX, CCND1 (29), CDC25A (28) (Fig. 4 B–D), andconfirmed targets of other let-7, such as E2F transcription factor 2(E2F2) (26) and Kirsten rat sarcoma viral oncogene homolog(KRAS) (27, 40, 41) (Fig. S5B). The let-7 targets were also down-regulated in vNPCs following SOX2 knockdown (Fig. S5C).Reexpression of LIN28 in SOX2 knockdown NPCs inhibited let-7b and let-7i maturation (Fig. 4E) and derepressed let-7 targetgenes (Fig. 4F), suggesting a canonical pathway for LIN28 regu-lation of let-7b and let-7i biogenesis.To monitor let-7 activity during neuronal differentiation, we

engineered lentiviral reporters encoding GFP with 3′ UTRcontaining five perfect let-7b or let-7i target sequences (let-7b/isensors; Fig. S6). Let-7 activity was not detected in NPCs, con-

sistent with the high levels of SOX2 and LIN28 expression inthese cells (Fig. 4 G and H). In contrast, let-7 miRNAs werehighly active in mature MAP2+ neurons (Fig. 4 I and J), sug-gesting that let-7 miRNA accumulates in these cells.To investigate the consequence of let-7 misexpression in

NPCs, we generated hESC lines expressing dox-inducible let-7bor let-7i and differentiated the lines into NPCs. Under self-renewal conditions, overexpression of let-7b reduced NPC pro-liferation (Fig. 5 A and B), but let-7i had no apparent effect (Fig.5 A and B). Under neurogenic conditions, let-7b overexpressionreduced the number of MAP2+ neurons by ∼35% (Fig. 5 C andD), whereas let-7i overexpression almost completely abolishedMAP2 expression and cells with neuronal morphologies (Fig. 5 Cand D). Furthermore, let-7i overexpression induced a dramaticincrease in apoptosis, similar to the effect of SOX2 knockdownunder neurogenic conditions (Fig. S7 A and B). These resultsindicate that different let-7 family members might have selec-tive effects on NPC proliferation and neurogenesis, although itis possible that the observed functional differences may be di-minished at higher expression levels (Fig. S6).Because the role of let-7 in regulating proliferation is well

established, we focused on their involvement in neurogenesis—in particular, let-7i, which showed the strongest antagonistic

Fig. 4. SOX2 regulates the LIN28/let-7 pathway in NPCs. (A) TaqMan qPCR analysis of mature let-7b and let-7i miRs 3 d after shSOX2 or shCTRL induction bydox, normalized to U6 small RNA. (B–D) qPCR analysis of known let-7b targets (normalized to HPRT) over 3 d following SOX2 knockdown in NPCs. Dox wasadded on day 0. (E) TaqMan qPCR analysis of mature let-7b and let-7i miRs in control NPCs (shCTRL), cells with inducible SOX2 shRNA (shSOX2/RFP), and cellswith inducible SOX2 shRNA and inducible LIN28 (shSOX2/LIN28). Inducible RFP expression in shSOX2/RFP served as a control for LIN28 expression. (F) qPCRanalysis of the let-7b target genes CCND1, TLX, and CDC25A in shCTRL, shSOX2/RFP, and shSOX2/LIN28 lines. Cells were analyzed 3 d after dox-mediatedinduction of shRNA and LIN28/RFP overexpression. (G–J) Monitoring of let-7 activity in NPCs and mature neurons with let-7 sensors. (G) No differences in GFPfluorescence were seen for control and let-7 sensors in nestin-positive NPCs, suggesting low let-7 activity (quantified in H). MAP2+ neurons (21 d of neuronaldifferentiation) transduced with let-7 sensors (I) uniformly lack GFP expression compared with control (quantified in J), suggesting high let-7 activity inmature neurons. *P < 0.05, **P < 0.005. Error bars ± SE. (Scale bar: 50 μm.)

Cimadamore et al. PNAS | Published online July 24, 2013 | E3021

NEU

ROSC

IENCE

PNASPL

US

Dow

nloa

ded

by g

uest

on

July

24,

202

1

activity (Fig. 5 C and D). Previously, we suggested that SOX2may be required in NPCs for expression of the proneural genesMASH1and NGN1 (11). Indeed, overexpression of let-7istrongly reduced expression of both MASH1 and NGN1, mim-icking the effects of SOX2 knockdown (Fig. 5E). A bioinformaticanalysis predicted the existence of two let-7 binding sites in thehuman MASH1 3′ UTR and one site in the human NGN1 3′UTR (Fig. S8). These binding sites were also conserved in themurine Mash1 and Ngn1 mRNAs (Fig. S8 A–C). To determinewhether MASH1 is a direct target of let-7i, we fused the GFPcoding sequence with a 200-bp sequence of the MASH1 3′ UTRcontaining the two predicted let-7 binding sites (Fig. 5F).Cotransfection of HEK293T cells with a let-7i expression vectorand the GFP-MASH1 3′ UTR reporter resulted in a significantreduction in GFP expression (Fig. 5G), which was reversed byintroducing mutations into both let-7 binding sites (Fig. 5H).These data suggest that the proneural gene MASH1 is a directtarget of let-7i.Collectively, these results demonstrate that individual mem-

bers of the let-7 miR family may preferentially affect NPCproliferation or neuronal differentiation and suggest that the

combined activity of let-7 miRs phenocopies the loss of SOX2 inNPCs with respect to proliferation and neurogenesis. We identifyLIN28 as a direct SOX2 effector that inhibits activation of thelet-7 family, thus enabling the proliferation and subsequentneuronal differentiation of NPCs (Fig. 5I). Our findings providea mechanism for the previously observed dual requirement forSOX2 in proliferation and neuronal differentiation of NPCs.

DiscussionThe molecular mechanisms underlying SOX2 function in NPCsare not well understood. Here, we discovered that SOX2 is re-quired to maintain endogenous levels of LIN28, a master regu-lator of let-7 miR biogenesis that was recently implicated inglobal modulation of mRNA splicing (20). The knockdownstudies in hESC-derived NPCs and genetic ablation of SOX2 inmouse models established that SOX2 is required for optimalLIN28 expression in cultures and in vivo. We found that thefunction of SOX2 in NPC proliferation is largely mediated byLIN28, because LIN28 overexpression is sufficient to rescue theproliferation deficits associated with the loss of SOX2. Underneurogenic conditions, LIN28 was able to rescue apoptosis and

Fig. 5. Let-7 miRs antagonize NPC self-renewal and neurogenesis. (A and B) Effect of let-7b and let-7i overexpression on NPC proliferation. Immunostainingfor Ki67 and pHH3 and quantification of Ki67+ and pHH3+ cells. (C and D) Effect of let-7b and let-7i overexpression on neuronal differentiation of NPCs.Immunostaining and quantification of MAP2 after 21 d. (E) qPCR analysis of proneural genes (MASH1, NGN1) in control (shCTRL), shSOX2, and let-7i–overexpressing NPCs. Data are normalized to HPRT expression. (F) Schematic of the GFP reporters for let-7 activity at MASH1 3′ UTR. Black boxes, wild-type;red crossed boxes, mutated let-7 binding sites from MASH1 3′ UTR. (G and H) GFP fluorescence of wild-type and mutant GFP-MASH1 3′ UTR reporters in thepresence of scrambled shRNA (shCTRL) or let-7i miR. (I) Schematic of the SOX2-LIN28/let-7 pathway activity regulating proliferation and neurogenesis in NPCs.*P < 0.05, **P < 0.005. Error bars ± SE. (Scale bars: 50 μm.)

E3022 | www.pnas.org/cgi/doi/10.1073/pnas.1220176110 Cimadamore et al.

Dow

nloa

ded

by g

uest

on

July

24,

202

1

the early (βIII-tubulin+ cells) but not late (MAP2+ cells) stagesof neurogenesis after SOX2 knockdown. Based on our in vitrofindings, we speculate that SOX2 regulates LIN28 expression inpart by recruiting HATs through the TRRAP adaptor to theLIN28 promoter to maintain a high level of H3K9/18 acetylationand an open chromatin state of LIN28 promoter in NPCs. It ispossible, however, that other mechanisms downstream of SOX2,such as a classical transcriptional transactivation (42) or a globalregulation of HATs levels (43), contribute to the regulation ofLIN28 expression in NPCs.Recently, LIN28 was shown to regulate the abundance of

splicing factors and to interact with numerous mRNAs (19, 20),several of which play roles in growth and survival (19, 20), thusproviding one potential mechanism by which LIN28 may pro-mote NPC proliferation independently of let-7. However, therole of LIN28 in the repression of let-7 miR family biosynthesisis better understood (13–16). The let-7 family plays well-estab-lished roles in controlling proliferation (26–28), such as the roleof let-7b in targeting TLX and CCND1 in neural stem cellsand in promoting neuronal differentiation (29). However, let-7miRNAs can act as inhibitors of neuronal differentiation (44);for example, let-7 regulates neuronal differentiation in zebrafishthrough targeting Mash1/Ascl1 (45). We found that let-7b overex-pression inhibited NPC proliferation, whereas let-7i overex-pression was significantly less active under the same conditions.Although both let-7b and let-7i inhibited NPC neurogenesis,let-7i overexpression produced a much stronger effect. Modelingthe mRNA degradation with the let-7 sensors suggest that theeffect of a specific let-7 miR on a particular target mRNAdepends on the degree of miR–mRNA complementarity and onthe ratio of particular let-7 miR and its mRNA target. Althoughthe let-7 family members are often considered to have redundantfunctions (21), studies in squamous cell carcinomas of the headsuggest that let-7b inhibits proliferation, let-7d represses epi-thelial to mesenchymal transition, and let-7i mainly inhibitsmesenchymal cell movement (46–48). Our observations supportthe possibility that the let-7 family members exhibit target se-lectivity and thus might promote different cell fates even whenexpressed in the same cell type.In conclusion, we identified LIN28 as a direct mediator of

SOX2-dependent proliferation in neural precursors. We showedthat LIN28 is required in NPCs, at least in part, to suppress theprecocious biogenesis of active let-7 family miRNAs. Indeed, let-7 activity was detected in mature MAP2+ neurons but not inNPCs. The let-7 activity would be deleterious for self-renewingmultipotent NPCs because it inhibits both proliferation (e.g.,TLX, CCND1, CDC25A) and neuronal commitment (e.g.,NGN1, MASH1). It is tempting to speculate that the down-regulation of SOX2 and LIN28 followed by the induction of let-7expression that occurs during the final stages of neurogenesisis required to orchestrate cell cycle exit and the extinction ofproneural gene transcripts that are only transiently requiredduring neurogenesis and are absent in mature neurons (49). Thishypothesis is consistent with the evidence that LIN28 negativelyregulates gliogenesis independently of let-7 miRs (44), as well asour previous observation that gliogenesis is not affected by theloss of SOX2 from neural precursors (11). In humans, SOX2haploinsufficiency results in abnormal development of the hip-pocampus, and epilepsy (50); anophthalmia (51); retardedgrowth and sensorineural deafness (52); and genital anomalies(53). Our findings suggest that some of these phenotypes couldbe mediated through the LIN28/let-7 pathway, thus identifyingpotential new targets for therapeutic intervention.

Materials and MethodsMaintenance of hESCs. H9 hESCs were maintained on a feeder layer of mouseembryonic fibroblasts and in Matrigel-coated plates [BD Biosciences; finalMatrigel dilution = 1:30 in PBS, 2-h coating at room temperature (RT)] in

Knockout DMEM (Gibco) containing 20% serum replacement (Gibco), 1×nonessential amino acids (Gibco), 2 mM L-glutamine (Gibco), 0.1 mMβ-mercaptoethanol (Gibco), 1× antibiotics/antimycotics (Omega), and 8 ng/mL bFGF (Sigma). hESCs were passaged every 5–7 d by manual removal ofmorphologically identifiable differentiated colonies followed by treatmentwith 1 mg/mL collagenase type IV (Gibco) diluted in knockout DMEM. Themedium was changed daily.

Derivation, Maintenance, and Differentiation of Human NPCs. Neurosphereswere generated from hESCs as previously described (30, 54). The protocolyields NPCs with a clear dorsal identity (Fig. S2 A–K). To ventralize the cells,NPCs at the rosette stage (5–7 d after neural induction) were treated withthe SHH agonist purmorphamine (0.5 μM) for 7 d. Monolayer cultures ofhESC-derived NPCs were propagated on Matrigel-coated plates in basemedium [1:1 ratio of DMEM/F12 GlutaMAX-neurobasal medium (Gibco), 2%B27 supplement without vitamin A (Gibco), 10% BIT 9500 (StemCell Tech-nologies), and 1 mM glutamine (Gibco)] supplemented with 20 ng/mL EGF(Chemicon), 20 ng/mL bFGF, 5 μg/mL insulin (Sigma), 10 ng/mL LIF (Millipore),and 5 mM nicotinamide (Sigma). hESC-derived NPCs were subcultured en-zymatically with Accutase (Chemicon) at a 1:2 or 1:3 ratio approximatelyonce a week. To induce neuronal differentiation, hESC-derived NPCs wereseeded onto fibronectin-coated plates (2 μg/mL, overnight coating) at highdensity (3 × 105 cells/cm2) and cultured for 3 wk with base medium sup-plemented with 40 ng/mL basic FGF and 40 ng/mL brain-derived neuro-trophic factor. Unless otherwise stated, all data were obtained by using thehESC-derived NPCs with a default dorsal identity.

Immunocytochemistry and Immunohistochemistry. Immunocytochemistry. Cellswere rinsed with PBS and fixed in 4% paraformaldehyde (PFA) in PBS for15 min at RT. Cells were blocked with 3% BSA and 0.5% Triton X-100 in PBS(PBSAT) for 1 h at RT and then incubated overnight at 4 °C with primaryantibodies (Table S1) diluted in PBSAT. The appropriate fluorochrome-con-jugated secondary antibodies were used at 1:1,000 dilution. Nuclei werestained with DAPI.Immunohistochemistry. PFA-fixed mouse sections (12-μm thickness) in low pHAntigen Unmasking Solution (Vector Laboratories) were heated in a micro-wave until boiling and then cooled to RT. This process was repeated 3–4times and sections were then washed with PBS and blocked with 5% BSA,5% goat serum, 0.5% Triton X-100 in PBS (PBSGT) for 1 h at RT. Sectionswere incubated with primary antibodies overnight at 4 °C, washed withPBSGT, and incubated for 1 h at RT with the appropriate fluorochrome-conjugated secondary antibody.

Quantitative PCR. Quantification of mRNA levels. Total RNA was extractedusing the RNeasy kit (Qiagen) and 1 μg was reverse-transcribed using theQuantiTect kit (Qiagen) according to the manufacturer’s instructions. Pu-rified cDNA (2 μL) diluted 1:8 was used as a template. qPCR was performedwith SYBR Green PCR Master Mix (Invitrogen) according to the manufacturer’srecommendations. Hypoxanthine phosphoribosyltransferase (HPRT) or GAPDHwas used for normalization. Data were analyzed using the Δ(ΔCT) method.Primers are listed in Table S2.Quantification of mature miRNA levels—TaqMan qPCR. The small RNA fractioncontaining the miRNA pool was purified with the NucleoSpin miRNA kit(Macherey-Nagel) according to the manufacturer’s instructions. miRNA-specific cDNA preparation and qPCR quantification was performed using theTaqMan small RNA assay (Applied Biosystems). An aliquot of 10 ng of pu-rified small RNA pool was used in the retrotranscription reactions. qPCR wasperformed with TaqMan universal PCR master mix according to the manu-facturer’s guidelines. Data were analyzed using the Δ(ΔCT) method andnormalized to U6 snRNA.Quantification of mature miRNA levels—TaqMan arrays. RNA was purified withthe mirVANA miRNA Isolation Kit (Ambion). The purity and integrity of thetotal RNA were analyzed on RNA NanoChip (Agilent Technologies) using theEukaryote Total RNA Nano Assay protocol. Total RNA samples with an RNAintegrity number of 10 were used for miRNA analysis. The miRNA profilingwas performed using TaqMan MicroRNA assays according to the manu-facturer’s protocol (Applied Biosystems). For each sample, two RT reactions(Megaplex Pool A and Pool B) and two TaqMan MicroRNA Arrays (A and BCards) were performed for a full miRNA profile. Briefly, 1 μg of total RNAwas used for each Megaplex reverse transcription reaction in a total reactionvolume of 7.5 μL using MicroRNA Reverse Transcription Kit (Applied Bio-systems). The cDNA synthesis was performed on ABI’s 96-well Thermal Cycler(Veriti) for 40 cycles of 16 °C for 2 min, 42 °C for 1 min, 50 °C for 1 s, and 85 °Cfor 5 min. Each RT product was mixed with 2× TaqMan Universal PCR MasterMix II, with no uracil-N-glycosylase (part no. 4440040; Applied Biosystems)

Cimadamore et al. PNAS | Published online July 24, 2013 | E3023

NEU

ROSC

IENCE

PNASPL

US

Dow

nloa

ded

by g

uest

on

July

24,

202

1

and loaded into the two (A and B) TaqMan low-density array (TLDA) humanmiRNA V3.0 384-well cards. PCR mix (100 μL) was dispensed into each port ofthe 384-well TLDA card. The cards were centrifuged twice for 1 min each at331 × g in a Sorvall centrifuge (Thermo Scientific) and sealed with a micro-fluidic card sealer. The TLDA cards were run on a 7900HT Fast Real-Time PCRsystem with robotics (Applied Biosystems) using Sequence Detection Systems(SDS) software V2.3. Conditions were 10 min at 95 °C followed by 40 cycles of95 °C for 15 s and 60 °C for 60 s. Raw Ct values were calculated using SDS RQManager V1.2 with automatic baseline threshold setting, and all sampleswere normalized using miRNA mammalian endogenous control gene, U6.The miRNA arrays were performed by the functional genomics core of theSanford–Burnham Medical Research Institute (Lake Nona, FL).Quantification of total miRNA levels. The small RNA fraction containing themiRNA pool was purified with the NucleoSpin miRNA kit (Macherey–Nagel)according to the manufacturer’s instructions. The miRNAs were poly-adenylated and reverse-transcribed with the Mir-X miRNA First-StrandSynthesis Kit (Clontech). qPCR quantification was performed with SYBRGreen PCR Master Mix (Invitrogen). The universal reverse primers included inthe Mir-X kit were used in conjunction with miRNA-specific forward primersconsisting of the full sequence of the mature miRNA being analyzed. Be-cause the mature miRNA sequence is also contained in pri- and premiRNAs,this technique quantifies the total level of a particular miRNA.

ChIP-qPCR. ChIP was performed using the EZ-ChIP kit (Millipore) accordingto the manufacturer’s recommendations with the following modifications:2 ×106 cell equivalents were used for each immunoprecipitation; cells weresonicated to obtain chromatin fragments of 200–500 bp; and 5–10 μg of theimmunoprecipitating antibodies were used in each ChIP. Antibodies in-cluded normal rabbit IgG (nonspecific control; Millipore, PP64), rabbit anti-SOX2 (Millipore; AB5603), rabbit anti-TRRAP (Santa Cruz; sc-1141), rabbitanti-PCAF (Santa Cruz; sc-8999), rabbit anti-GCN5 (Santa Cruz; sc-20698),mouse anti-H3K9Ac (Cell Signaling; 9671), and rabbit anti-H3K9/18Ac (Mil-lipore; 07-593). To evaluate factor-specific enrichment at different promotersites, qPCR was performed using the purified chromatin as a template.Amplification was performed with site-specific primers designed to flank thegenomic region of interest (i.e., the SOX binding site at position −32 on theLIN28 promoter). Primer sequences were as follows: forward, GGGTTGG-GTCATTGTCTTTTAG; reverse, AAAGGGTTGGTTCGGAGAAG. qPCR data werenormalized to the values obtained with normal rabbit IgG. To comparefactor-specific enrichment at particular sites across different cell lines [i.e.,control shRNA-expressing cells (shCTRL) vs. SOX2 knockdown (shSOX2)],qPCR data were normalized to 1% of the purified input DNA, which wasused as a measure of the total amount of chromatin present in the sample.

Identification of SOX2-Interacting Proteins. IP-MS was performed as previouslydescribed (11). Briefly, hESC-derived NPCs were cultured as described above,lysed, and subjected to IP using the Pierce Crosslink Immunoprecipitation Kitwith rabbit anti-SOX2 or normal rabbit IgG control antibodies. Samples werereduced, alkylated, and digested with sequencing grade modified trypsin(Promega) using standard procedures. The resulting peptides were desaltedwith a peptide microtrap (Michrom Bioresources), dried in a SpeedVac, andresuspended in 0.1% formic acid/5.0% (vol/vol) acetonitrile. Each sample wasrun in triplicate. LC-MS/MS analyses were performed using an HTC-PALAutosampler/Paradigm MS2 HPLC connected to a 0.2 × 150-mm Magic C18column/CaptiveSpray (Michrom) coupled to an LTQ Orbitrap Velos massspectrometer equipped with electron transfer dissociation (Thermo Fisher),using a decision tree (55) top-20 data-dependent method and a 15-min HPLCgradient. Spectra were searched against an ipi.v.3.73 human protein data-base using a Sorcerer-SEQUEST Enterprise (SageN Research), and resultswere filtered to a false discovery rate of 0.005–0.008 using ProteinProphet(Trans-Proteomic Pipeline).

3′ UTR Reporters and let-7 Sensor/Sponges. 3′ UTR reporters. To study the in-teraction between let-7i and MASH1 mRNA, a 200-bp fragment of MASH1 3′UTR containing two predicted let-7 binding sites was cloned downstream ofthe GFP coding sequence. Reporters containing mutated versions of thelet-7 binding sites were also engineered. In these constructs, the wild-typebinding site at position 2091 (AACATGTAATGCTATTACCTCT) was mutatedto AAGCAGTAATGTAGCATAGATG, whereas the binding site at position2197 (AGAGGCCACCAGTTGTACTTCA) was mutated to TTGCTGAACCTCA-ACTGCGGAA. The mutations were designed to completely disrupt thebinding of let-7 as predicted by the RNA22 algorithm (Fig. S8D). HEK293Tcells were transfected with the reporter and let-7i expressing plasmid.Cotransfection with a vector expressing nontargeting shRNA was used asa control. To compare fluorescence across different samples, pictures were

taken with the same exposure time and contrast/brightness parameters. Foreach experiment, a minimum of 75 cells was analyzed. GFP fluorescence wasquantified under the different experimental conditions using ImageJ soft-ware (http://rsb.info.nih.gov/ij/).Let-7 sensors/sponges. The GFP coding sequence was cloned downstream ofthe doxycycline-inducible promoter of the pTRIPZ vector (Open Biosystems).The resulting pTRIPZ-GFP vector was used as a control in all experimentsusing the sensors/sponges. The let-7b and let-7i sensors/sponges were con-structed by inserting five perfectly complementary let-7b or let-7i sites in the3′ UTR of GFP of the pTRIPZ-GFP vector. To monitor the activity of let-7 inNPCs, cells were transduced with lentiviruses packaged with the appropriateplasmids. GFP expression from the control construct and sensors was inducedwith 0.5 μg/mL doxycycline. Cells were fixed and analyzed by immunocyto-chemistry 4 d later. To monitor the activity of let-7 in mature (MAP2+)neurons, NPCs were differentiated into neurons for 17 d, and cells were thentransduced with control and sensor lentivectors. Doxycycline (0.5 μg/mL) wasadded to the neutralizing medium, and the cells were fixed and analyzed 4 dlater, for a total of 21 d under neuronal differentiation conditions.

Let-7 sensors/sponges were also used to block let-7 activity in SOX2knockdown NPCs; for this, shSOX2 NPCs were transduced with control andsponge lentivectors. SOX2 shRNA and GFP sponges were induced with 3 μg/mL doxycycline until cells were fixed and analyzed. To examine the spongeeffects on proliferation, the cells were cultured under self-renewal con-ditions for 4 d in doxycycline-containing media. To assess the sponge effectson neurogenic differentiation, NPCs were cultured in neuronal differentia-tion media containing doxycycline for 21 d. Note that GFP expression fromsponges could not be used to assess transduction efficiency because itdepends on the endogenous let-7 levels. The efficiency of transduction wastherefore tested with the control pTRIPZ-GFP vector under both cultureconditions. NPCs were transduced with nearly 100% efficiency under self-renewal conditions and ∼20% efficiency under neuronal differentiationconditions.

Electroporation and Luciferase Assay in hES-Derived NPCs. The 2-kb LIN28proximal promoter was cloned into a firefly-luciferase reporter along withthemutant LIN28 promoter containing amutated SOX binding site (wild-typesite: 5′ CTTTGAA 3′; mutant site: 5′ CTCCTCA 3′, position −32 from tran-scription start site human genomic sequence). The constructs were electro-porated into human NPC lines expressing either control or SOX2 doxycycline-inducible shRNAs. Electroporation was performed with the Neon system(Invitrogen) as follows: 105 cells were resuspended in NPC media (withoutantibiotics/antimycotics and with the addition of 0.5% FBS) in the presenceof 800 ng LIN28 reporters and 500 ng of control vector expressing Renillaluciferase. Cells were electroporated with three pulses of 10 ms at 1,400 Vand plated onto Matrigel-coated plates; the next day, media was changed tostandard NPC media with the addition of 1 μg/mL doxycycline, to induceshRNA expression. Luciferase activity was monitored 3 d after with theDual Glow Luciferase Assay System (Promega) according to manufacturerinstructions.

Mutant Mice. We achieved conditional SOX2 deletion in vivo by exploiting twodistinct genetic models. Mice carrying Sox2loxP alleles (8) were crossed withmice expressing Cre recombinase under the control of either the Wnt1 pro-moter (Wnt1-Cre) (32) or the mGFAP promoter (mGFAP-Cre) (35). Crossing ofSox2loxP::Wnt1-Cre mice resulted in conditional deletion of SOX2 in embryonicdorsal neural tubes and neural crest derivatives. This model was used to studySOX2-dependent LIN28 expression at embryonic stages (E11) in the mousespinal cord. Five consecutive sections at the level of the forelimb were ana-lyzed in both wild-type and knockout mice. Sox2loxP::mGFAP:Cre crossesresulted instead in conditional ablation of SOX2 in adult NPCs of the dentategyrus. Sox2loxP::mGFAP:Cre mice were crossed onto the background of Nestin-CFPnuc (34) to allow visualization of neural stem/precursor cells within theadult dentate gyrus. Two-month-old mice were used to study SOX2-dependentLIN28 expression in the context of adult hippocampal and subventricularneurogenesis. In bothmodels,micehomozygous for Sox2deletion (Sox2LoxP/LoxP)were compared with the wild-type littermates.

Generation of Stable hESC Lines Carrying Doxycycline-Inducible Lentivectors forshRNA and Overexpression. Inducible SOX2 shRNA-expressing hESCs. hESC lines sta-bly expressing shSOX2 and shCTRL were established as previously described (11).Inducible let-7 overexpression. Sequences corresponding to mature let-7b orlet-7i were cloned between the mir-30 regulatory regions of the induciblepTRIPZ lentivector (Open Biosystems), which makes exogenous let-7 pro-cessing independent of LIN28. Vectors were packaged into lentiviral par-ticles by the Viral Vectors Core at the Sanford–Burnham Medical Research

E3024 | www.pnas.org/cgi/doi/10.1073/pnas.1220176110 Cimadamore et al.

Dow

nloa

ded

by g

uest

on

July

24,

202

1

Institute (La Jolla, CA) and used to generate stable hESC lines. To eliminatenontransduced hESCs, the puromycin resistance gene present in the pTRIPZvector was exploited. Cells were cultured in the presence of 2.5 μg/mL puro-mycin for at least 10 d before being used in experiments. TaqMan qPCR wasused to confirm doxycycline-dependent let-7 expression in these lines.Inducible LIN28 overexpression and SOX2 shRNA. The red fluorescent protein(RFP) and shRNA coding sequences downstream of the doxycycline-induciblepromoter of the pTRIPZ vector were replaced with the LIN28 coding se-quence. The resulting vector encoding doxycycline-inducible LIN28 was stablyintegrated in the genome of the shSOX2 hESCs described above by means oflentiviral transduction. Selection of transduced cells was performed byexploiting the puromycin resistance gene present in the pTRIPZ vector. Theresulting hESC line expressed both SOX2 shRNA and LIN28 in a doxycycline-inducible fashion (shSOX2/LIN28 line). A cell line expressing inducible SOX2shRNA and inducible RFP was used as a control (shSOX2/RFP). qPCR was usedto confirm the concomitant SOX2 down-regulation and LIN28 expression inthe shSOX2/LIN28 line.

Digital Image Analysis. Pictures of cells cultured under different experimentalconditions were taken with the same exposure time and contrast/brightnessparameters. For quantification of nuclear markers (such as Ki67), positive cellswere counted and expressed as a percentage of total (DAPI+) cells. Mea-surements were further normalized to the values obtained under the ex-perimental condition that served as a control.

Quantification of cytoplasmic markers (such as TUJ1 and MAP2) was dif-ficult to perform manually due to the dense cultures required to induceneuronal differentiation. We therefore used a semiautomated approach toevaluate neuronal marker expression using immunocytochemistry. Pictureswere takenwith the same exposure time and contrast/brightness parameters.The total area showing immunoreactivity for a particular marker was de-termined using ImageJ and normalized to the total area positive for DAPI,which provides an estimate of the total number of cells present in a givenfield. A minimum of three random fields containing at least 100 cells wasanalyzed for each condition.

miRNA Target Prediction and Statistical Analysis. miRNA target sites werepredicted using the software RNA22, available online (https://cm.jefferson.edu/rna22v1.0/). All experiments were performed at least in triplicate. Sta-tistical significance was assessed using the Student t test. P < 0.05 wasconsidered significant. In all graphs, error bars represent SE values.

ACKNOWLEDGMENTS. We thank Dr. Sonia Albini and Prof. Lorenzo Puri forreagents and for sharing their expertise in chromatin immunoprecipitationtechniques. We are grateful to Prof. Ranjan Perera and SubramaniamShyamala Govindarajan for their help with TaqMan miRNA array analysis.We thank Dr. Laurence M. Brill for his technical support with the IP-MSexperiments. This work was supported by a California Institute for Re-generative Medicine fellowship (to F.C.).

1. Lui JH, Hansen DV, Kriegstein AR (2011) Development and evolution of the humanneocortex. Cell 146(1):18–36.

2. Zhao C, Deng W, Gage FH (2008) Mechanisms and functional implications of adultneurogenesis. Cell 132(4):645–660.

3. Li H, et al. (2008) Transcription factor MEF2C influences neural stem/progenitorcell differentiation and maturation in vivo. Proc Natl Acad Sci USA 105(27):9397–9402.

4. Dixon J, et al. (2006) Tcof1/Treacle is required for neural crest cell formation andproliferation deficiencies that cause craniofacial abnormalities. Proc Natl Acad SciUSA 103(36):13403–13408.

5. De Marco P, Merello E, Cama A, Kibar Z, Capra V (2011) Human neural tube defects:Genetic causes and prevention. Biofactors 37(4):261–268.

6. Graham V, Khudyakov J, Ellis P, Pevny L (2003) SOX2 functions to maintain neuralprogenitor identity. Neuron 39(5):749–765.

7. Cavallaro M, et al. (2008) Impaired generation of mature neurons by neural stem cellsfrom hypomorphic Sox2 mutants. Development 135(3):541–557.

8. Favaro R, et al. (2009) Hippocampal development and neural stem cell maintenancerequire Sox2-dependent regulation of Shh. Nat Neurosci 12(10):1248–1256.

9. Puligilla C, Dabdoub A, Brenowitz SD, Kelley MW (2010) Sox2 induces neuronalformation in the developing mammalian cochlea. J Neurosci 30(2):714–722.

10. Taranova OV, et al. (2006) SOX2 is a dose-dependent regulator of retinal neuralprogenitor competence. Genes Dev 20(9):1187–1202.

11. Cimadamore F, et al. (2011) Human ESC-derived neural crest model reveals a key rolefor SOX2 in sensory neurogenesis. Cell Stem Cell 8(5):538–551.

12. Krol J, Loedige I, Filipowicz W (2010) The widespread regulation of microRNAbiogenesis, function and decay. Nat Rev Genet 11(9):597–610.

13. Newman MA, Thomson JM, Hammond SM (2008) Lin-28 interaction with theLet-7 precursor loop mediates regulated microRNA processing. RNA 14(8):1539–1549.

14. Viswanathan SR, Daley GQ, Gregory RI (2008) Selective blockade of microRNAprocessing by Lin28. Science 320(5872):97–100.

15. Heo I, et al. (2008) Lin28 mediates the terminal uridylation of let-7 precursorMicroRNA. Mol Cell 32(2):276–284.

16. Rybak A, et al. (2008) A feedback loop comprising lin-28 and let-7 controls pre-let-7 maturation during neural stem-cell commitment. Nat Cell Biol 10(8):987–993.

17. Cox JL, Mallanna SK, Luo X, Rizzino A (2010) Sox2 uses multiple domains to associatewith proteins present in Sox2-protein complexes. PLoS ONE 5(11):e15486.

18. Mallanna SK, et al. (2010) Proteomic analysis of Sox2-associated proteins during earlystages of mouse embryonic stem cell differentiation identifies Sox21 as a novelregulator of stem cell fate. Stem Cells 28(10):1715–1727.

19. Peng S, et al. (2011) Genome-wide studies reveal that Lin28 enhances the translationof genes important for growth and survival of human embryonic stem cells. StemCells 29(3):496–504.

20. Wilbert ML, et al. (2012) LIN28 binds messenger RNAs at GGAGA motifs and regulatessplicing factor abundance. Mol Cell 48(2):195–206.

21. Boyerinas B, Park SM, Hau A, Murmann AE, Peter ME (2010) The role of let-7 in celldifferentiation and cancer. Endocr Relat Cancer 17(1):F19–F36.

22. Mendell JT, Olson EN (2012) MicroRNAs in stress signaling and human disease. Cell148(6):1172–1187.

23. Cheng LC, Pastrana E, Tavazoie M, Doetsch F (2009) miR-124 regulates adultneurogenesis in the subventricular zone stem cell niche. Nat Neurosci 12(4):399–408.

24. Liu C, et al. (2010) Epigenetic regulation of miR-184 by MBD1 governs neural stem cellproliferation and differentiation. Cell Stem Cell 6(5):433–444.

25. Szulwach KE, et al. (2010) Cross talk between microRNA and epigenetic regulation inadult neurogenesis. J Cell Biol 189(1):127–141.

26. Dong Q, et al. (2010) MicroRNA let-7a inhibits proliferation of human prostatecancer cells in vitro and in vivo by targeting E2F2 and CCND2. PLoS ONE 5(4):e10147.

27. Kumar MS, et al. (2008) Suppression of non-small cell lung tumor development by thelet-7 microRNA family. Proc Natl Acad Sci USA 105(10):3903–3908.

28. Johnson CD, et al. (2007) The let-7 microRNA represses cell proliferation pathways inhuman cells. Cancer Res 67(16):7713–7722.

29. Zhao C, et al. (2010) MicroRNA let-7b regulates neural stem cell proliferation anddifferentiation by targeting nuclear receptor TLX signaling. Proc Natl Acad Sci USA107(5):1876–1881.

30. Bajpai R, et al. (2009) Molecular stages of rapid and uniform neuralization of humanembryonic stem cells. Cell Death Differ 16(6):807–825.

31. Curchoe CL, et al. (2010) Early acquisition of neural crest competence during hESCsneuralization. PLoS ONE 5(11):e13890.

32. Danielian PS, Muccino D, Rowitch DH, Michael SK, McMahon AP (1998) Modificationof gene activity in mouse embryos in utero by a tamoxifen-inducible form of Crerecombinase. Curr Biol 8(24):1323–1326.

33. Suh H, et al. (2007) In vivo fate analysis reveals the multipotent and self-renewalcapacities of Sox2+ neural stem cells in the adult hippocampus. Cell Stem Cell 1(5):515–528.

34. Encinas JM, Vaahtokari A, Enikolopov G (2006) Fluoxetine targets early progenitorcells in the adult brain. Proc Natl Acad Sci USA 103(21):8233–8238.

35. Garcia AD, Doan NB, Imura T, Bush TG, Sofroniew MV (2004) GFAP-expressingprogenitors are the principal source of constitutive neurogenesis in adult mouseforebrain. Nat Neurosci 7(11):1233–1241.

36. Lee KK, Workman JL (2007) Histone acetyltransferase complexes: One size doesn’t fitall. Nat Rev Mol Cell Biol 8(4):284–295.

37. Engelen E, et al. (2011) Sox2 cooperates with Chd7 to regulate genes that aremutated in human syndromes. Nat Genet 43(6):607–611.

38. Martinez E, et al. (2001) Human STAGA complex is a chromatin-acetylatingtranscription coactivator that interacts with pre-mRNA splicing and DNA damage-binding factors in vivo. Mol Cell Biol 21(20):6782–6795.

39. Vassilev A, et al. (1998) The 400 kDa subunit of the PCAF histone acetylase complexbelongs to the ATM superfamily. Mol Cell 2(6):869–875.

40. Johnson SM, et al. (2005) RAS is regulated by the let-7 microRNA family. Cell 120(5):635–647.

41. Yu ML, et al. (2011) Vascular smooth muscle cell proliferation is influenced by let-7dmicroRNA and its interaction with KRAS. Circ J 75(3):703–709.

42. Tanaka S, et al. (2004) Interplay of SOX and POU factors in regulation of the Nestingene in neural primordial cells. Mol Cell Biol 24(20):8834–8846.

43. Ura H, et al. (2011) Eed/Sox2 regulatory loop controls ES cell self-renewal throughhistone methylation and acetylation. EMBO J 30(11):2190–2204.

44. Balzer E, Heine C, Jiang Q, Lee VM, Moss EG (2010) LIN28 alters cell fate successionand acts independently of the let-7 microRNA during neurogliogenesis in vitro.Development 137(6):891–900.

45. Ramachandran R, Fausett BV, Goldman D (2010) Ascl1a regulates Müller gliadedifferentiation and retinal regeneration through a Lin-28-dependent, let-7microRNA signalling pathway. Nat Cell Biol 12(11):1101–1107.

46. Jakymiw A, et al. (2010) Overexpression of dicer as a result of reduced let-7 microRNAlevels contributes to increased cell proliferation of oral cancer cells. Genes ChromosomesCancer 49(6):549–559.

47. Chang CJ, et al. (2011) Let-7d functions as novel regulator of epithelial-mesenchymaltransition and chemoresistant property in oral cancer. Oncol Rep 26(4):1003–1010.

Cimadamore et al. PNAS | Published online July 24, 2013 | E3025

NEU

ROSC

IENCE

PNASPL

US

Dow

nloa

ded

by g

uest

on

July

24,

202

1

48. Yang WH, et al. (2012) RAC1 activation mediates Twist1-induced cancer cellmigration. Nat Cell Biol 14(4):366–374.

49. Bertrand N, Castro DS, Guillemot F (2002) Proneural genes and the specification ofneural cell types. Nat Rev Neurosci 3(7):517–530.

50. Sisodiya SM, et al. (2006) Role of SOX2 mutations in human hippocampalmalformations and epilepsy. Epilepsia 47(3):534–542.

51. Fantes J, et al. (2003) Mutations in SOX2 cause anophthalmia. Nat Genet 33(4):461–463.

52. Hagstrom SA, et al. (2005) SOX2 mutation causes anophthalmia, hearing loss, andbrain anomalies. Am J Med Genet A 138A(2):95–98.

53. Williamson KA, et al. (2006) Mutations in SOX2 cause anophthalmia-esophageal-genital (AEG) syndrome. Hum Mol Genet 15(9):1413–1422.

54. Cimadamore F, et al. (2009) Nicotinamide rescues human embryonic stem cell-derivedneuroectoderm from parthanatic cell death. Stem Cells 27(8):1772–1781.

55. Swaney DL, McAlister GC, Coon JJ (2008) Decision tree-driven tandem mass spectrometryfor shotgun proteomics. Nat Methods 5(11):959–964.

E3026 | www.pnas.org/cgi/doi/10.1073/pnas.1220176110 Cimadamore et al.

Dow

nloa

ded

by g

uest

on

July

24,

202

1