Vitamin D attenuates rhinovirus-induced expression of intercellular adhesion

molecule-1 (ICAM-1) and platelet-activating factor receptor (PAFR) in

respiratory epithelial cells

Claire L. Greiller1

Reetika Suri1

David A. Jolliffe1

Tatiana Kebadze2

Aurica G. Hirsman2,4

Christopher J. Griffiths3

Sebastian L. Johnston2,3

Adrian R. Martineau1,3†

1. Centre for Immunobiology, Blizard Institute, Barts and The London School of

Medicine and Dentistry, Queen Mary University of London, London E1 2AB, UK

2. Airway Disease Section, National Heart and Lung Institute, MRC and Asthma UK

Centre in Allergic Mechanisms of Asthma, Imperial College London, London W2

1PG, UK

3. Asthma UK Centre for Applied Research, Barts Institute of Public Health, Queen

Mary University of London, London E1 2AB, UK

4. Department of Transfusion Medicine and Haemostaseology, Erlangen University

Hospital, 91054 Erlangen, Germany

† To whom correspondence should be addressed at Barts and The London School

of Medicine and Dentistry, Queen Mary University of London, 58 Turner St, London

E1 2AB, UK

1

Tel: +44 207 882 2551 │Fax: +44 207 882 2552 │Email: a.martineau@qmul.ac.uk

Keywords: Human rhinovirus; respiratory epithelial cells; 25-hydroxyvitamin D; 1,25-

dihydroxyvitamin D; ICAM1; PTAFR; IKBA; CAMP.

2

Abstract

Human rhinoviruses commonly cause upper respiratory infections, which may be

complicated by secondary bacterial infection. Vitamin D replacement reduces risk of

acute respiratory infections in vitamin D-deficient individuals, but the mechanisms by

which such protection is mediated are incompletely understood. We therefore

conducted experiments to characterise the influence of the major circulating

metabolite 25-hydroxyvitamin D (25[OH]D) and the active metabolite 1,25-

dihydroxyvitamin D (1,25[OH]2D) on responses of a respiratory epithelial cell line

(A549 cells) to infection with a major group human rhinovirus (RV-16). Pre-treatment

of A549 respiratory epithelial cells with a physiological concentration (10-7M) of

25(OH)D induced transient resistance to infection with RV-16 and attenuated RV-16-

induced expression of the genes encoding intercellular adhesion molecule 1 (ICAM-

1, a cell surface glycoprotein that acts as the cellular receptor for major group

rhinoviruses) and platelet-activating factor receptor (PAFR, a G-protein coupled

receptor implicated in adhesion of Streptococcus pneumoniae to respiratory

epithelial cells). These effects were associated with enhanced expression of the

genes encoding the NF-κB inhibitor IκBα and the antimicrobial peptide cathelicidin

LL-37. Our findings suggest possible mechanisms by which vitamin D may enhance

resistance to rhinovirus infection and reduce risk of secondary bacterial infection in

vitamin D-deficient individuals.

3

Highlights

Pre-treatment of A549 respiratory epithelial cells with physiological

concentrations of the major circulating vitamin D metabolite 25-hydroxyvitamin

D induced transient resistance to infection with RV-16 and attenuated RV-

induced expression of the genes encoding intercellular adhesion molecule 1

(ICAM-1, a cell surface glycoprotein that acts as the cellular receptor for major

group rhinoviruses) and platelet-activating factor receptor (PAFR, a G-protein

coupled receptor implicated in adhesion of Streptococcus pneumoniae to

respiratory epithelial cells).

These effects were associated with enhanced expression of the genes

encoding the NF-κB inhibitor IκBα and the antimicrobial peptide cathelicidin

LL-37.

Our findings suggest possible mechanisms by which vitamin D may enhance

resistance to rhinovirus infection and reduce risk of secondary bacterial

infection in vitamin D-deficient individuals.

4

Introduction

Human rhinoviruses are the most common aetiologic agents of the common cold,

which is the most frequent acute illness in the industrialised world (1, 2). They may

also precipitate secondary bacterial respiratory infections (3, 4) as well as

exacerbations of asthma and chronic obstructive pulmonary disease (COPD) (5, 6).

Currently there is no vaccine available, and treatments are limited to controlling

symptoms.

We and others have shown that vitamin D supplementation reduces the risk of acute

respiratory infections and exacerbations of asthma and COPD, with protective

effects being strongest in individuals with the lowest levels of the major circulating

metabolite 25-hydroxyvitamin D (25[OH]D) at baseline (7-11). Vitamin D metabolites

have been shown to decrease rhinovirus replication and release in respiratory

epithelial cells (12, 13), but the mechanisms by which such protection is mediated

are incompletely understood. Specifically, the influence of vitamin D metabolites on

expression of the NF-κB-regulated cell surface proteins intercellular adhesion

molecule 1 (ICAM-1, a cell surface glycoprotein that acts as the cellular receptor for

major group rhinoviruses) and platelet-activating factor receptor (PAFR, a G-protein

coupled receptor implicated in adhesion of Streptococcus pneumoniae to respiratory

epithelial cells) have not previously been investigated in the context of rhinovirus

infection, despite evidence that vitamin D signalling inhibits NF-κB activation (14)

and down-regulates ICAM-1 expression in other clinical contexts (15). We therefore

conducted experiments to characterise the influence of the major circulating

metabolite 25-hydroxyvitamin D (25[OH]D) and the active metabolite 1,25-

dihydroxyvitamin D (1,25[OH]2D) on responses of a respiratory epithelial cell line

5

(A549 cells) to infection with a major group human rhinovirus (RV-16), with a

particular focus on expression of the genes encoding these proteins.

6

Methods

A549 cell culture and stimulation

A549 cells (Sigma-Aldrich, USA) were cultured in complete Dulbecco’s Modified

Eagle Medium (DMEM), containing 10% FCS, 1% penicillin/streptomycin and 1% L-

glutamine (Lonza, Switzerland). Upon reaching confluence, cells were trypsinized

and resuspended in complete DMEM giving a concentration of 200,000 cells/ml.

Cells were incubated for 24 hours at 37oC with 5% CO2, and subsequently

supernatants were aspirated and cells were incubated for 48 hours with 25(OH)D or

1,25(OH)2D at final concentrations of 10-7M, or vehicle (0.1% ethanol). Following

this, supernatants were aspirated, and 200µl of incomplete media, RV-16 (MOI 1),

filtered virus, or UV-inactivated virus were added. After incubation at room

temperature on an orbital shaker for 1 hour, supernatants were aspirated, and

replaced with 200µl of incomplete DMEM, before a further 5- or 23-hour incubation at

37oC with 5% CO2. Supernatants were aspirated and either used immediately in the

cytotoxicity assay, or stored at -80oC for subsequent analysis, and 350µl Buffer RLT

(Qiagen, USA) was used for cell lysis, with the lysates stored at -80oC for

subsequent RNA extraction. A549 cells used in these experiments were passaged

no more than 20 times.

Vitamin D metabolite preparation

1α,25-dihydroxyvitamin D3 and 25-hydroxyvitamin D3 (Sigma-Aldrich) were dissolved

in anhydrous ethanol to stock concentrations of 10 -4M and were stored at -80oC

under a layer of argon to prevent oxidization. The final concentrations of 10 -7M were

obtained following dilution in incomplete DMEM containing 2% FCS.

7

Stimulant preparation

RV-16 stocks were provided by Professor Johnston’s lab at the National Heart and

Lung Institute, Imperial College London, with stocks generated following standard

procedures (16). Viral controls were obtained by filtering the virus using Amicon

Ultra centrifugal filters with a 30kDa molecular weight cut-off pore size (Sigma-

Aldrich), or by UV-inactivation for 30 minutes at 120,000µJ/cm2 using a UV

crosslinker.

Cytotoxicity assay

Cytotoxicity was measured in cell culture supernatants using a lactate

dehydrogenase (LDH)-based in vitro toxicology assay kit (Sigma-Aldrich), following

the manufacturer’s instructions. Absorbance was measured spectrophotometrically

at a background wavelength of 650nm, which was subtracted from the

measurements obtained at a wavelength of 450nm.

Cytopathic effect (CPE) assay

Cell culture supernatants were thawed and serial 1 in 10 dilutions were prepared

using complete DMEM. Five dilutions were prepared for each sample in total, and

50µl of each were plated in quadruplicate in a 96-well plate. A 150µl volume of HeLa

Ohio cells (1 x 105 cells/ml) was added to each well, before incubation at 37oC with

5% CO2 for 4 days. Cytopathic effect was observed by light microscopy, and

TCID/50 values were calculated using the Spearman-Kaerber method (17, 18).

RNA extraction and RT-PCR

8

RNA extraction was carried out using an RNeasy Mini Kit (Qiagen) according to the

manufacturer’s instructions. RNA was immediately reverse transcribed using

SuperScript VILO Mastermix (Invitrogen, Life Technologies), with each reaction

volume containing 9µl of RNA following the manufacturer’s instructions, and stored

at -80oC. In a 20µl reaction volume, 1µl of cDNA was used for quantitative RT-PCR,

using TaqMan gene expression master mix (Applied Biosystems, Life Technologies)

and pre-developed TaqMan gene expression assays for ICAM1, IKBA, CAMP and

PTAFR. Each assay was a 20x mix, with primers present at a concentration of 18µM

and probes at a concentration of 5µM. A gene expression assay for viral RNA was

custom-made (forward primer sequence GTGAAGAGCCSCRTGTGCT, reverse

primer sequence GCTSCAGGGTTAAGGTTAGCC, probe sequence

TGAGTCCTCCGGCCCCTGAATG), with final concentrations of 50nM forward

primer, 300nM reverse primer and 100nM probe used as described elsewhere (19).

All samples were run in triplicate. A 7500 Real Time PCR System (Applied

Biosystems) and 7500 software v2.0.6 were used with thermal cycling conditions set

according to the manufacturer’s instructions. Each reaction was normalised to the

GAPDH content, and the ΔΔCT method was used to give the fold induction over

unstimulated samples.

Multiplex ELISA

Cell culture supernatants underwent multiplex ELISA analysis for quantification of

concentrations of a panel of 30 cytokines and chemokines (IL-1β, IL-2, IL-4, IL-5, Il-

6, IL-7, IL-8 [CXCL8], IL-10, IL-12, IL-13, IL-15, IL-17, IL-1RA, IL-2R, IFN-α, IFN-γ,

TNF, MCP-1 [CCL2], MIP-1α [CCL3], MIP-1β [CCL4], RANTES [CCL5], eotaxin

[CCL11], MIG [CXCL9], IP-10 [CXCL10], EGF, FGF-basic, HGF, VEGF, G-CSF and

9

GM-CSF; Invitrogen Human Cytokine Magnetic 30-plex Panel, Invitrogen, Camarillo,

CA, USA). Assays were performed on the Magpix ® platform (powered by Luminex

xmap Technology) and data were analysed using Luminex xponent ® software.

Statistical analysis

Statistical analyses were carried out using GraphPad Prism version 6.04 (GraphPad

Software Inc, USA). Two-tailed Student’s T-tests were used to test for significant

differences in mean values between conditions, and statistical significance was

inferred where P values were less than 0.05.

10

Results

Pre-treatment of A549 cells with vitamin D metabolites for 48 hours pre-

infection reduces RV-16 RNA and release of lactate dehydrogenase

Following pre-treatment of A549 cells with vitamin D metabolites vs. vehicle and

inoculation with RV-16, RT-PCR was used to quantify viral RNA. At 6h post-infection,

RV-16 RNA increased an average of 1965-fold in cells infected with viable RV-16 vs.

control (UV-inactivated RV-16; P<0.001, Figure 1A). In cells pre-treated with 10-7M

25(OH)D or 10-7M 1,25(OH)2D for 48h prior to infection with RV-16, viral RNA was

significantly reduced compared to vehicle control at 6h post-infection (3.3-fold

reduction with 25(OH)D, P<0.001; 1.6-fold reduction with 1,25(OH)2D, P=0.008;

Figure 1A). These differences were not associated with any statistically significant

difference in viability of A549 cells treated with vitamin D metabolites vs. ethanol

vehicle at 6h post-infection, as measured using a LDH-based cytotoxicity assay (for

25[OH]D vs. vehicle, P=0.74; for 1,25[OH]2D vs. vehicle, P=0.52). No statistically

significant differences in cytopathic effect of supernatants harvested from cells

treated with vitamin D metabolites vs. ethanol vehicle at 6h post-infection were seen

(for 25[OH]D vs. vehicle, P=0.26; for 1,25[OH]2D vs. vehicle, P=0.07). At 24h post-

infection, pre-treatment with vitamin D metabolites did not influence levels of viral

RNA (for 25[OH]D vs. vehicle, P=0.54; for 1,25[OH]2D vs. vehicle, P=0.78) or

cytopathic effect of supernatants (for 25[OH]D vs. vehicle, P=0.42; for 1,25[OH]2D

vs. vehicle, P=0.08). Supernatant concentrations of LDH were decreased at 24h

post-infection (consistent with increased viability of RV-infected cells) in cells pre-

11

incubated with 25(OH)D (P=0.007 for comparison with vehicle control) and

1,25(OH)2D (P=0.04 for comparison with vehicle control, Figure 1B).

Vitamin D metabolites attenuate RV-induced expression of ICAM1 and enhance

IKBA expression

ICAM-1 is the main receptor for major serotypes of rhinovirus, such as RV-16 (20).

We therefore proceeded to determine whether the effects of 25(OH)D and

1,25(OH)2D on viral RNA in A549 cells were associated with differences in ICAM1

expression. Pre-treatment with vitamin D metabolites had no effect on constitutive

expression of ICAM1 (for 25[OH]D vs. vehicle, P=0.57; for 1,25[OH]2D vs. vehicle,

P=0.70). Infection with RV-16 induced ICAM1 expression at 6h (53-fold, P=0.005,

Fig 2A) and at 24h post-infection (3.5-fold, P<0.001, Figure 2B). Pre-treatment with

both 25(OH)D and 1,25(OH)2D attenuated RV-16-induced ICAM1 expression at both

time-points (for 25[OH]D, 3.6-fold reduction at 6 hours, P=0.005, and 1.4-fold

reduction at 24 hours, P=0.036; for 1,25(OH)2D, 1.4-fold reduction at 6 hours,

P=0.08, and 1.6-fold reduction at 24 hours, P=0.048; Figs 2A, B).

Since expression of ICAM1 is regulated by the transcription factor NF-κB (16), and

1,25(OH)2D has previously been shown to induce expression of the NF-κB inhibitor

IκBα in airway epithelial cells (21), we proceeded to investigate the influence of

25(OH)D and 1,25(OH)2D on expression of IKBA. Pre-treatment of A549 cells with

25(OH)D modestly induced constitutive expression of IKBA (1.4-fold increase vs.

vehicle control, P=0.005); a similar trend was seen for 1,25(OH)2D, although this did

not attain statistical significance (P=0.13; Figure 2C). In the presence of RV-16, both

12

25(OH)D and 1,25(OH)2D augmented IKBA expression at 6h post-infection with

borderline statistical significance (for 25[OH]D, 2.2-fold increase, P=0.054; for

1,25[OH]2D, 2.3-fold increase, P=0.061, Figure 2D). Similar trends for the effects of

vitamin D metabolites on IKBA expression were seen at 24h post-infection, but these

were not statistically significant (for 25[OH]D vs. vehicle, P=0.91; for 1,25[OH]2D vs.

vehicle, P=0.29).

Vitamin D-induced resistance to RV infection is associated with induction of

antimicrobial peptide expression

CAMP is a vitamin D-inducible gene that encodes the hCAP-18 protein from which

the antimicrobial peptide cathelicidin LL-37 is derived (22); this peptide has

previously been shown to possess antiviral activity (23). We were therefore

interested to investigate the influence of RV infection on CAMP expression by

respiratory epithelial cells in the absence and the presence of vitamin D metabolites.

As anticipated, both 25(OH)D and 1,25(OH)2D induced CAMP expression in the

absence of RV infection (3.9-fold and 5.4-fold respectively, P ≤0.04; Fig 3A). At 6h

post-infection, RV suppressed CAMP expression in the absence of vitamin D

metabolites (1.9-fold reduction, P=0.006), but this effect was attenuated by both

25(OH)D and 1,25(OH)2D (Fig 3B). The same pattern was observed at 24h post-

infection (Fig 3C).

13

Vitamin D metabolites attenuate RV-induced PAFR expression

PAFR mediates adhesion of virulent strains of Streptococcus pneumoniae to

respiratory epithelium (24). Human rhinoviruses induce PAFR expression (25),

representing a possible mechanism by which a primary viral infection may precipitate

a secondary bacterial infection or exacerbation of COPD. Vitamin D supplementation

has been shown to reduce risk of acute exacerbations of COPD in vivo in vitamin D-

deficient individuals (10, 11): we were therefore interested to determine whether

vitamin D metabolites might attenuate RV-induced PTAFR expression in respiratory

epithelial cells. We found that neither 25(OH)D nor 1,25(OH)2D modulated

constitutive expression of PTAFR in A549 cells (P ≥0.09, Fig 3D). However, both

metabolites attenuated RV-induced expression of PTAFR at 6h post-infection (5.1-

fold reduction for 25[OH]D, P=0.001; 4.9-fold reduction for 1,25[OH]2D, P=0.001; Fig

3E). At 24h post-infection, RV-16 reduced PTAFR expression (2.1-fold, P=0.001),

and this effect was not modulated by either vitamin D metabolite (Fig 3F).

Effect of RV-16 and vitamin D metabolites on secretion of inflammatory

mediators by A549 cells

Having demonstrated effects of RV-16 and vitamin D metabolites on the expression

of genes encoding key players in the host antiviral response, we next proceeded to

characterise their influence on concentrations of cytokines and chemokines in

supernatants harvested from A549 cells stimulated in the presence vs. the absence

of vitamin D metabolites, using multiplex ELISA. Full results for supernatants

14

harvested at 6h and 24h post-infection are presented in Tables 1 and 2, respectively.

RV-16 infection increased concentrations of 18/30 inflammatory mediators assayed

at 6h post-infection (IL-6, CXCL-8, IL-12, IFN-α A2, IFN-γ, RANTES, Eotaxin, MIP-

1α, MIP-1β, MCP-1, EGF, VEGF, FGF-β, GM-CSF, IL-4, HGF, IL-13 and IL-2R,

P≤0.04, Table 1) and 9/30 mediators assayed at 24h post-infection (IL-6, CXCL-8,

IFN-α A2, RANTES, MIP-1β, EGF, HGF, IL-2R and MCP-1, P ≤0.03, Table 2).

Vitamin D metabolites exerted relatively little influence on this inflammatory profile

however. Pre-treatment with 25(OH)D augmented concentrations of FGF-β, CXCL-8

and RANTES in the presence of RV-16 at 24h post-infection (P≤0.04, Table 2). Pre-

treatment with 1,25(OH)2D suppressed concentrations of EGF, HGF, IL-2R, IFN-γ,

MIP-1β, RANTES and VEGF at 6h post-infection (P ≤0.04, Table 1) but augmented

concentrations of FGF-β, IL-4, IL-6 and VEGF at 24h post-infection; the absolute

magnitude of these effects was small.

15

Discussion

We report that pre-treatment of the A549 respiratory epithelial cell line with

physiological concentrations of the major circulating vitamin D metabolite 25(OH)D

induces transient resistance to infection with RV-16 and attenuates RV-induced

expression of ICAM1 (the gene encoding the receptor for major group human

rhinoviruses) and PTAFR (the gene encoding a cell surface receptor implicated in

adhesion of virulent S. pneumoniae to respiratory epithelial cells). These effects

were associated with enhanced expression of IKBA and CAMP, which encode the

NF-κB inhibitor IκBα and the precursor for the antimicrobial peptide cathelicidin LL-

37, respectively.

Our finding that 25(OH)D and 1,25(OH)2D induced expression of IKBA and

decreased induction of NF-kB-driven genes by RV-16 echoes results of experiments

conducted by Hansdottir and colleagues who demonstrated similar effects in primary

airway epithelial cells cultured with vitamin D metabolites prior to infection with

respiratory syncytial virus (26). Our discovery that vitamin D metabolites attenuate

RV-induced expression of ICAM1 is novel, and suggests a mechanism by which

vitamin D could enhance resistance of respiratory epithelial cells to RV infection.

Furthermore, the observation that vitamin D attenuates RV-induced expression of

PTAFR suggests a mechanism by which vitamin D could reduce risk of adhesion of

pathogenic bacteria to respiratory epithelial cells following a primary infection with a

major group rhinovirus. Our findings raise the possibility that vitamin D metabolites

may protect against acute respiratory infections by inducing IKBA, with subsequent

down-regulation of NF-κB signalling and consequent attenuation of RV-induced

16

ICAM-1 and PAFR expression. This hypothesis could be tested by evaluating effects

of IKBA knock-down in RV-infected cells cultured with 25(OH)D.

Our observation that both 25(OH)D and 1,25(OH)2D induced constitutive expression

of CAMP in A549 cells is consistent with published data from primary human

respiratory epithelial cells (27), reflecting evolutionary conservation of the vitamin D

response element in the CAMP promoter of primates that is absent in the mouse, rat,

and canine genomes (28). Our finding that suppression of CAMP expression by RV

was attenuated by vitamin D metabolites echoes results of experiments that we have

previously conducted in mononuclear phagocytes infected with Mycobacterium

tuberculosis, where the same pattern was observed (29). The antimicrobial peptide

cathelicidin LL-37 (derived from the hCAP-18 protein encoded by CAMP) possesses

both antiviral and antimycobacterial activity (23, 30); suppression of CAMP

expression by RV and M. tuberculosis may therefore represent a mechanism by

which these pathogens subvert innate antimicrobial host responses.

A strength of our study is that we investigated immunomodulatory effects of the

major circulating vitamin D metabolite 25(OH)D at concentrations that are achievable

with vitamin D supplementation, and that associate with reduced susceptibility to

upper respiratory infection in vivo (31, 32). Our study also has several limitations. We

investigated a cell line rather than primary cells; specifically, there is some evidence

to suggest that A549 cells may exhibit aberrant responses to 1,25(OH)2D3 (33). Our

findings would have been more robust if they had been replicated in primary human

cells or another relevant cell line, such as BS2B cells. Moreover, we did not

investigate whether changes in the expression of genes encoding ICAM-1 and PAFR

17

were associated with changes in cell surface expression of these proteins. Our gene

expression findings should therefore be considered as being hypothesis-generating,

and further detailed work is needed to determine whether 25(OH)D attenuates

expression of ICAM-1 and PAFR proteins on the surface of primary epithelial cells,

and to evaluate whether this has functional consequences in terms of enhanced

resistance to RV infection and reduced pneumococcal adhesion if so.

In conclusion, our principal novel finding is that pre-treatment of A549 cells with

physiological concentrations of the major circulating vitamin D metabolite 25(OH)D

attenuates RV-induced expression of ICAM1 and PTAFR. This suggests possible

mechanisms by which vitamin D may enhance resistance to rhinovirus infection and

reduce risk of secondary bacterial infection in vitamin D-deficient individuals.

Acknowledgement: This research was funded by Medical Research Council PhD

Studentship at Barts and The London School of Medicine and Dentistry, awarded to

CLG.

18

References

1. Kirkpatrick G. The common cold. Prim Care. 1996;23(4):657 - 75.2. Monto A. Studies of the community and family: acute respiratory illness and infection. Epidemiol Rev. 1994;16(2):351 - 73.3. Hayden F. Rhinovirus and the lower respiratory tract. Rev Med Virol. 2004;14(1):17 - 31.4. Papadopoulos N. Do rhinoviruses cause pneumonia in children? Paediatr Respir Rev. 2004;5(Suppl A):S191 - 5.5. Potena A, Caramori G, Casolari P, Contoli M, Johnston S, Papi A. Pathophysiology of viral-induced exacerbations of COPD. Int J Chron Obstruct Pulmon Dis. 2007;2(4):477 - 83.6. Friedlander S, Busse W. The role of rhinovirus in asthma exacerbations. J Allergy Clin Imnmunol. 2005;116(2):267 - 73.7. Martineau AR, Jolliffe DA, Hooper RL, Greenberg L, Aloia JF, Bergman P, et al. Vitamin D supplementation to prevent acute respiratory tract infections: systematic review and meta-analysis of individual participant data. BMJ. 2017;356:i6583.8. Martineau AR, Cates CJ, Urashima M, Jensen M, Griffiths AP, Nurmatov U, et al. Vitamin D for the management of asthma. Cochrane Database Syst Rev. 2016;9:CD011511.9. Jolliffe DA, Greenberg L, Hooper RL, Griffiths CJ, Camargo CA, Jr., Kerley CP, et al. Vitamin D supplementation to prevent asthma exacerbations: a systematic review and meta-analysis of individual participant data. The lancet Respiratory medicine. 2017;5(11):881-90.10. Lehouck A, Mathieu C, Carremans C, Baeke F, Verhaegen J, Van Eldere J, et al. High doses of vitamin D to reduce exacerbations in chronic obstructive pulmonary disease: a randomized trial. Ann Intern Med. 2012;156(2):105-14.11. Martineau AR, James WY, Hooper RL, Barnes NC, Jolliffe DA, Greiller CL, et al. Vitamin D3 supplementation in patients with chronic obstructive pulmonary disease (ViDiCO): a multicentre, double-blind, randomised controlled trial. The Lancet Respiratory medicine. 2015;3(2):120-30.12. Brockman-Schneider RA, Pickles RJ, Gern JE. Effects of vitamin D on airway epithelial cell morphology and rhinovirus replication. PLoS ONE. 2014;9(1):e86755.13. Telcian AG, Zdrenghea MT, Edwards MR, Laza-Stanca V, Mallia P, Johnston SL, et al. Vitamin D increases the antiviral activity of bronchial epithelial cells in vitro. Antiviral Research. 2017;137:93-101.14. Chen Y, Zhang J, Ge X, Du J, Deb DK, Li YC. Vitamin D receptor inhibits nuclear factor kappaB activation by interacting with IkappaB kinase beta protein. J Biol Chem. 2013;288(27):19450-8.15. Martinesi M, Treves C, d'Albasio G, Bagnoli S, Bonanomi AG, Stio M. Vitamin D derivatives induce apoptosis and downregulate ICAM-1 levels in peripheral blood mononuclear cells of inflammatory bowel disease patients. Inflamm Bowel Dis. 2008;14(5):597-604.16. Papi A, Johnston S. Rhinovirus infection induces expression of its own receptor intercellular adhesion molecule 1 (ICAM-1) via increased NF-kappaB-mediated transcription. J Biol Chem. 1999;274(14):9707 - 20.17. Spearman C. The method of 'right and wrong cases' ('constant stimuli') without Gauss's formulae. Br J Psychol. 1908;2:227 - 42.18. Kärber G. Beitrag zur kollektiven behandlung pharmakologischer reihenversuche. Arch Exp Path Pharma. 1931;162:480 - 7.19. Gielen V, Johnston SL, Edwards MR. Azithromycin induces anti-viral responses in bronchial epithelial cells. Eur Respir J. 2010;36:646 - 54.20. Staunton D, Merluzzi V, Rothlein R, Barton R, Marlin S, Springer T. A cell adhesion molecule, ICAM-1, is the major surface receptor for rhinoviruses. Cell. 1989;56(5):849 - 53.21. Hansdottir S, Monick M, Lovan N, Powers L, Gerke A, Hunninghake G. Vitamin D decreases respiratory syncytial virus induction of NF-kappaB-linked chemokines and cytokines in airway epithelium while maintaining the antiviral state. J Immunol. 2010;184(2):965 - 74.

19

22. Gombart A, Borregaard N, Koeffler H. Human cathelicidin antimicrobial peptide (CAMP) gene is a direct target of the vitamin D receptor and is strongly up-regulated in myeloid cells by 1,25-dihydroxyvitamin D3. FASEB J. 2005;19(9):1067-77.23. Barlow PG, Svoboda P, Mackellar A, Nash AA, York IA, Pohl J, et al. Antiviral activity and increased host defense against influenza infection elicited by the human cathelicidin LL-37. PLoS One. 2011;6(10):e25333.24. Cundell DR, Gerard NP, Gerard C, Idanpaan-Heikkila I, Tuomanen EI. Streptococcus pneumoniae anchor to activated human cells by the receptor for platelet-activating factor. Nature. 1995;377(6548):435-8.25. Ishizuka S, Yamaya M, Suzuki T, Takahashi H, Ida S, Sasaki T, et al. Effects of rhinovirus infection on the adherence of Streptococcus pneumoniae to cultured human airway epithelial cells. J Infect Dis. 2003;188(12):1928-39.26. Hansdottir S, Monick MM, Lovan N, Powers L, Gerke A, Hunninghake GW. Vitamin D decreases respiratory syncytial virus induction of NF-kappaB-linked chemokines and cytokines in airway epithelium while maintaining the antiviral state. J Immunol. 2010;184(2):965-74.27. Hansdottir S, Monick MM, Hinde SL, Lovan N, Look DC, Hunninghake GW. Respiratory epithelial cells convert inactive vitamin D to its active form: potential effects on host defense. J Immunol. 2008;181(10):7090-9.28. Gombart AF, Borregaard N, Koeffler HP. Human cathelicidin antimicrobial peptide (CAMP) gene is a direct target of the vitamin D receptor and is strongly up-regulated in myeloid cells by 1,25-dihydroxyvitamin D3. FASEB J. 2005;19(9):1067-77.29. Martineau AR, Wilkinson KA, Newton SM, Floto RA, Norman AW, Skolimowska K, et al. IFN-g- and TNF-Independent Vitamin D-Inducible Human Suppression of Mycobacteria: The Role of Cathelicidin LL-37. J Immunol. 2007;178(11):7190-8.30. Martineau AR, Newton SM, Wilkinson KA, Kampmann B, Hall BM, Nawroly N, et al. Neutrophil-mediated innate immune resistance to mycobacteria. J Clin Invest. 2007;117(7):1988-94.31. Sabetta JR, DePetrillo P, Cipriani RJ, Smardin J, Burns LA, Landry ML. Serum 25-hydroxyvitamin D and the incidence of acute viral respiratory tract infections in healthy adults. PLoS ONE. 2010;5(6):e11088.32. Ginde AA, Mansbach JM, Camargo CA, Jr. Association between serum 25-hydroxyvitamin D level and upper respiratory tract infection in the Third National Health and Nutrition Examination Survey. Arch Intern Med. 2009;169(4):384-90.33. Zhang Q, Kanterewicz B, Shoemaker S, Hu Q, Liu S, Atwood K, et al. Differential response to 1alpha,25-dihydroxyvitamin D3 (1alpha,25(OH)2D3) in non-small cell lung cancer cells with distinct oncogene mutations. J Steroid Biochem Mol Biol. 2013;136:264-70.

20

Table 1: 6-hour concentrations of cytokines and chemokines in supernatants harvested from A549 cells treated with vitamin D metabolites or ethanol prior to infection with RV-16. Numbers are means (standard deviations). P values are from paired t-tests. Concentrations of the following inflammatory mediators were undetectable in all experimental conditions: IL-2, IL-15, IL-17, G-CSF, TNF.

  0.1% EtoH RV16 + 0.1% EtOH RV-16 + 10-7M 25(OH)D RV-16 + 10-7M 1,25(OH)2D P for RV-16 vs. EtoH P for RV-16+ 25(OH)D vs. RV-16 P for RV-16+1,25(OH)2D vs. RV-16

EGF, pg/ml 0.0 (0.0) 5.0 (3.7) 3.9 (3.4) 3.3 (3.5) 0.002 0.11 0.04

Eotaxin, pg/ml 0.3 (0.3) 0.5 (0.4) 0.6 (0.5) 0.5 (0.4) 0.01 0.50 0.99

FGF-β, pg/ml 3.7 (7.9) 24.5 (18.8) 33.4 (32.5) 23.0 (29.5) 0.01 0.18 0.81

GM-CSF, pg/ml 2.1 (1.3) 2.2 (1.3) 2.2 (1.3) 2.1 (1.3) <0.001 0.56 0.09

HGF, pg/ml 13.0 (10.4) 38.7 (19.2) 37.4 (17.8) 33.1 (17.2) <0.001 0.77 0.03

IFN-α A2, pg/ml 11.4 (5.2) 34.7 (13.2) 36.9 (17.8) 33.8 (15.1) <0.001 0.44 0.49

IL-10, pg/ml 1.2 (1.3) 1.3 (1.4) 1.3 (1.4) 1.3 (1.4) 0.17 >0.99 >0.99

IL-12, pg/ml 0.0 (0.0) 6.2 (4.2) 5.7 (4.3) 5.7 (3.6) 0.001 0.50 0.10

IL-13, pg/ml 5.7 (6.1) 7.1 (6.5) 8.1 (6.2) 7.0 (6.4) 0.04 0.20 0.95

IL-1β, pg/ml 0.0 (0.0) 1.9 (3.0) 1.1 (2.4) 0.6 (1.9) 0.08 0.24 0.13

IL-1RA, pg/ml 6.0 (6.4) 6.4 (6.7) 6.9 (7.4) 6.3 (6.6) 0.08 0.34 0.59

IL-2R, pg/ml 36.4 (6.4) 45.7 (8.7) 49.8 (8.8) 38.8 (12.1) 0.009 0.29 0.02

IL-4, pg/ml 3.7 (3.9) 5.4 (4.2) 5.3 (4.0) 5.1 (4.2) 0.001 0.86 0.18

IL-5, pg/ml 0.3 (0.3) 0.4 (0.4) 0.4 (0.4) 0.4 (0.4) 0.08 >0.99 0.80

IL-6, pg/ml 0.9 (1.0) 25.5 (15.7) 37.7 (32.4) 24.4 (14.0) <0.001 0.18 0.56

IL-7, pg/ml 0.0 (0.0) 2.3 (4.9) 1.1 (3.5) 0.0 (0.0) 0.17 0.29 0.17

CXCL-8, pg/ml350.7

(203.8) 2380.9 (2027.6) 2616.0 (2179.3) 1905.9 (1451.3) 0.007 0.70 0.08

IFN-γ, pg/ml 2.2 (0.9) 2.7 (0.9) 2.6 (0.9) 2.5 (1.0) <0.001 0.49 0.001

IP-10, pg/ml 1.3 (0.2) 1.4 (0.2) 1.5 (0.3) 1.5 (0.2) 0.40 0.08 0.31

MCP1, pg/ml 110.4 (59.8) 965.9 (703.6) 1170.4 (1045.2) 929.9 (747.0) 0.002 0.27 0.47

MIG, pg/ml 0.0 (0.0) 2.3 (3.7) 3.0 (3.9) 2.6 (4.3) 0.08 0.69 0.84

MIP-1α, pg/ml 5.2 (5.5) 8.3 (5.0) 8.2 (4.9) 8.7 (4.3) 0.01 0.91 0.55

MIP-1β, pg/ml 0.0 (0.0) 5.4 (5.0) 5.9 (5.9) 3.7 (4.2) 0.007 0.66 0.04

RANTES, pg/ml 0.0 (0.0) 23.0 (19.6) 21.0 (17.9) 15.9 (15.8) 0.005 0.71 0.001

VEGF, pg/ml 8.3 (7.7) 25.0 (8.1) 25.8 (10.8) 22.6 (7.6) <0.001 0.69 0.005

21

Table 2: 24-hour concentrations of cytokines and chemokines in supernatants harvested from A549 cells treated with vitamin D metabolites or ethanol prior to infection with RV-16. Numbers are means (standard deviations). P values are from paired t-tests. Concentrations of the following inflammatory mediators were undetectable in all experimental conditions: IL-2, IL-17, G-CSF, TNF.

  0.1% EtoHRV16 + 0.1% EtOH

RV-16 + 10-7M 25(OH)D

RV-16 + 10-7M 1,25(OH)2D

P for RV-16 vs. EtoH

P for RV-16+ 25(OH)D vs. RV-16

P for RV-16+1,25(OH)2D vs. RV-16

EGF, pg/ml 0.7 (2.2) 6.0 (3.3) 5.0 (3.5) 7.0 (1.3) 0.008 0.17 0.23

Eotaxin, pg/ml 0.3 (0.3) 0.3 (0.4) 0.3 (0.4) 0.4 (0.4) 0.75 0.45 0.28

FGF-β, pg/ml 13.7 (19.3) 11.8 (7.2) 25.6 (20.0) 26.5 (21.4) 0.76 0.04 0.04

GM-CSF, pg/ml 2.1 (1.3) 2.2 (1.4) 2.2 (1.3) 2.2 (1.3) 0.81 0.95 0.40

HGF, pg/ml 22.6 (16.3) 49.2 (17.3) 48.9 (15.3) 47.1 (15.3) 0.008 0.82 0.10IFN-α A2, pg/ml 21.8 (13.5) 48.0 (9.5) 49.8 (8.4) 49.5 (10.0) 0.002 0.20 0.23

IFN-γ, pg/ml 2.9 (1.2) 2.9 (1.2) 2.8 (1.1) 3.1 (1.2) 0.99 0.42 0.12

IL-10, pg/ml 1.4 (1.5) 1.4 (1.4) 1.4 (1.4) 1.4 (1.5) 0.97 0.80 0.17

IL-12, pg/ml 4.4 (5.2) 9.9 (5.0) 9.9 (4.7) 10.7 (4.6) 0.06 0.96 0.40

IL-13, pg/ml 6.5 (6.9) 9.3 (5.1) 9.5 (4.9) 9.3 (5.1) 0.26 0.88 0.96

IL-15, pg/ml 0.0 (0.0) 2.7 (8.4) 0.0 (0.0) 3.9 (12.4) 0.34 0.34 0.34

IL1-β, pg/ml 1.1 (2.3) 3.0 (3.2) 3.1 (3.3) 3.5 (3.7) 0.15 0.73 0.07

IL-1RA, pg/ml 6.3 (6.6) 6.4 (6.7) 6.6 (7.0) 6.6 (7.0) 0.96 0.34 0.17

IL-2R, pg/ml 35.0 (7.3) 42.9 (8.8) 39.4 (9.3) 57.1 (39.4) 0.03 0.23 0.28

IL-4, pg/ml 4.4 (4.2) 6.0 (4.1) 6.2 (3.9) 6.3 (4.0) 0.35 0.21 0.006

IL-5, pg/ml 0.4 (0.4) 0.4 (0.4) 0.4 (0.4) 0.4 (0.4) 0.94 0.50 0.76

IL-6, pg/ml 3.1 (2.2) 25.7 (11.1) 25.8 (11.1) 31.0 (12.5) <0.001 0.88 0.008

IL-7, pg/ml 4.2 (6.7) 5.9 (6.4) 2.5 (5.2) 6.5 (7.0) 0.58 0.06 0.16

IL-8, pg/ml802.0

(556.6) 3375.2 (1418.0) 3757.1 (1675.0) 3777.6 (1534.4) <0.001 0.04 0.39

IP-10, pg/ml 1.3 (0.3) 1.3 (0.2) 1.3 (0.2) 1.2 (0.1) 0.56 0.55 0.33

MCP-1, pg/ml364.4

(558.2) 1445.3 (762.2) 1589.1 (935.9) 1617.7 (1104.0) 0.001 0.16 0.29

MIG, pg/ml 0.0 (0.0) 3.7 (5.2) 3.9 (5.1) 5.3 (4.8) 0.05 0.88 0.19

MIP-1α, pg/ml 5.9 (6.3) 10.0 (3.1) 10.0 (3.3) 10.1 (3.4) 0.06 0.92 0.57

MIP-1β, pg/ml 0.6 (1.8) 9.1 (3.1) 8.8 (4.1) 10.7 (4.0) <0.001 0.76 0.08RANTES, pg/ml 0.0 (0.0) 28.4 (17.0) 35.5 (16.5) 31.6 (17.4) <0.001 0.003 0.38

VEGF, pg/ml 29.0 (24.0) 40.1 (11.5) 40.7 (11.2) 44.6 (12.8) 0.21 0.58 0.02

22

Figure 1: Effect of rhinovirus and vitamin D metabolites on RV-16 RNA and cytotoxicity. In A549 cells pre-treated with 10-7M 25(OH)D or 10-7M 1,25(OH)2D for

48h prior to infection with RV-16, viral RNA was significantly reduced compared to

vehicle control at 6 hours post-infection (A). At 24 hours post-infection, pre-treatment

with vitamin D metabolites enhanced viability of RV-infected cells at the 24-hour time

point, as indicated by reduced LDH release (B). Values are the mean and SEM of six

(A) and three (B) experiments.

23

Figure 2: Effect of rhinovirus and vitamin D metabolites on expression of ICAM1 and IKBA. Infection with RV-16 induced ICAM1 expression at 6 hours (A)

and at 24 hours (B) post-infection. Pre-treatment with both 25(OH)D and

1,25(OH)2D attenuated RV-16-induced ICAM1 gene expression at both time-points.

Pre-treatment of A549 cells with 25(OH)D induced constitutive expression of IKBA

(C). In the presence of RV-16, pre-treatment with both 25(OH)D and 1,25(OH)2D

augmented IKBA expression at 6h post-infection (D). Values are the mean and SEM

of nine (A, B) and three (C,D) experiments.

24

Figure 3. Influence of RV-16 and vitamin D metabolites on expression of CAMP and PTAFR. Both 25(OH)D and 1,25(OH)2D induced CAMP expression in the

absence of RV infection (A). At 6h post-infection, RV suppressed CAMP expression

in the absence of vitamin D metabolites, but this effect was attenuated by pre-

treatment with both 25(OH)D and 1,25(OH)2D (B). The same pattern was observed

at 24h post-infection (C). Neither 25(OH)D nor 1,25(OH)2D modulated constitutive

expression of PTAFR in A549 cells (D). At 6h post-infection, RV-16-induced PTAFR

expression was attenuated by pre-treatment with both 25(OH)D and 1,25(OH)2D (E).

At 24h post-infection, RV-16 reduced PTAFR expression, and this effect was not

modulated by pre-treatment with either vitamin D metabolite investigated (F). Values

are the mean and SEM of three experiments.

25