st. patrick parish · s t. patrick parish. st. patrick t. patrick parishparish 12 main street,...

8
12 Main Street Pelham, NH 03076 Go, therefore, and make disciples of all nations, baptizing them in the name of the Father, and of the Son, and of the Holy Spirit, teaching them to observe all that I have commanded you. (Go, Make, Baptize, Teach) MATTHEW 28:19-20 We are a community of Catholic Christians who desire to grow closer to the living God. It is seen in the way we… - build Christ-like relationships with others (GO), - help people to fall in love with God (MAKE), - fall deeper in love with God by entering the life of the church through the Sacraments, especially the Eucharist (BAPTIZE), - serve and witness inspired by the Holy Spirit (TEACH). We do this because we are children of God who long for all to share in eternal life. S t . Pat rick Parish

Upload: others

Post on 19-Jul-2020

11 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: St. Patrick Parish · S t. Patrick Parish. St. Patrick t. Patrick ParishParish 12 Main Street, Pelham, NH 03076 s 3DJH w á t r t r

12 Main StreetPelham, NH 03076

Go, therefore, and make disciples of all nations, baptizing them in the name of the Father, and of the Son, and of the Holy Spirit, teaching them to observe all that I have commanded you.(Go, Make, Baptize, Teach)

M A T T H E W 2 8 : 1 9 - 2 0

We are a community of Catholic Christians who desire to grow closer to the living God.

It is seen in the way we…- build Christ-like relationships with others (GO),

- help people to fall in love with God (MAKE),- fall deeper in love with God by entering the life of the church through

the Sacraments, especially the Eucharist (BAPTIZE),- serve and witness inspired by the Holy Spirit (TEACH).

We do this because we are children of God who long for all to share in eternal life.

St. Patrick Parish

Page 2: St. Patrick Parish · S t. Patrick Parish. St. Patrick t. Patrick ParishParish 12 Main Street, Pelham, NH 03076 s 3DJH w á t r t r

Page 956 1

Twenty-Fourth Sunday in Ordinary Time September 13, 2020

Saturday September 12 4pm ~ Jeanne & Raymond Gagne, 2nd & 15th

Anniversary, requested by Rick, Gail & family Sunday September 13 8am ~ Patricia Dube, 33rd Anniversary,

requested by her family Andrew Scarpellino requested by the Halpin family

10:30am ~ Bob Doucette requested by Shirley Paul Faucher, 4th Anniversary, requested by

his wife & children 6pm ~ Intentions of all our Parishioners Monday September 14 8am ~ Nicholas Betancur requested by his

family Raymond A. Bernard requested by his wife Katherine

Tuesday September 15 8am ~ John Gutt requested by the Raby family In Honor of St. Joseph requested by Donna M.

Taylor Wednesday September 16 8am ~ Mario Matos requested by his wife Rita Marcell Boisvert requested by Tony & Loretta

Marino Thursday September 17 8am ~ For the Holy Spirit Friday September 18 8am ~ No Mass Saturday September 19 4pm ~ The Choquette & Loiselle Families &

Rita & Gerry Trottier requested by Al & Shirley Choquette & family

The DiGiantommaso Family requested by their family

Sunday September 20 8am ~ Patricia “Honey” Kosik, Lori Ann

Croteau & Joey Kosik requested by husband & father Walter Kosik, Sr.

10:30am ~ Rev. John Sledziona & Robert J. Ducharme requested by Donna Smith

6pm ~ Intentions of all our Parishioners

Sunday, September 13 Men & Women AA, 7:00-8:00 PM, in the school Tuesday, September 15 Food Pantry, 6:30-7:30 PM Wednesday, September 16 Adoration, 8:30-9:30 AM and 2:00-8:00 PM Blood Drive, 11:00 AM–4:00 PM, in the parish center Food Pantry, 1:00-3:00 PM Women’s AA, 7:00-8:30 PM, in the school Thursday, September 17 Men’s AA, 7:00 PM, in the school Friday, September 18 Men & Women AA, 7:00-8:00 PM, in the school

This week the Altar Flowers are in memory of Patricia Dube, 33rd Anniversary, by her family

VOCATION “None of us lives for oneself,…” If the Lord invites you to follow Him in humble obedience as a priest or in the consecrated life, how will you respond? Call Father Matthew Mason 663-0132, or write: [email protected].

SANCTUARY CANDLE

If anyone would like to sign-up for the Sanctuary Candle in memory of a loved one for 2020-2021, please contact the parish office at 603-635-3525.

Page 3: St. Patrick Parish · S t. Patrick Parish. St. Patrick t. Patrick ParishParish 12 Main Street, Pelham, NH 03076 s 3DJH w á t r t r

Page 956 2

My Dear Brothers and Sisters, In today’s Gospel, Jesus speaks to us of the need to forgive. Peter asks if he

needs to forgive his brother as many as seven times. Jesus’ response is, in essence, “seventy, seventies of seventy times”… in other words, there is no limit to how many times you are to forgive.

For all of those times that someone has lied to me or taken something without asking, for all of the times that I am annoyed by another, it may seem “small potatoes” to forgive. But Jesus doesn’t just say we are to forgive the small sins against us, but all of the sins against us. Some people have been seriously hurt. Some people have experienced such deep betrayal, that it effects their whole lives. And Jesus tells us that we must forgive them, as well. Why?! How can this be?! How can this be done?!

Jesus gives us this parable today. In essence, the first servant owes the master something comparable to $100 billion (yes, billion, not million). Even should the servant win Powerball, he is so far from ever being able to pay it, it is laughable that he says that he will pay the master back in full. This is our debt to God. This is where sin leaves us with God. We are in a position where it is utterly impossible to redeem our debt to Him. Every sin, even the tiniest, is such an offense against the infinite love of God, that our debt is infinite. The Good News, of course, is that God has forgiven that debt by becoming one of us, taking that debt to the Cross, and destroying its power in the Resurrection. All we need to do is receive that gift, that forgiveness. The problem with this first servant is that he doesn’t accept the forgiveness – he has in his mind that he will pay it back in full. When the second servant comes along, he owes the first servant the equivalent of $5,000. Large, yes, but payable given enough time. But the first servant refuses to forgive the debt.

This, Jesus says, is our relationship with God and each other. God has forgiven all. The relatively small sins that we endure from others (small compared to how we have betrayed God, not necessarily “small” in terms of our own hurt or wounds), God has said we must forgive. Why? Because, in order to live in eternity, we must become one with the Heart of God… and God is a God who forgives.

So how do I forgive? Forgiveness is both a choice and a process. We can do anything, even the impossible, with the help of God.

We begin in prayer and, with Jesus and Mary taking us by the hand, make ourselves aware of the reality of the sin we have experienced at the hands of another and any hurt or wounds that sin has caused. From that place of hurt, we invite Jesus into our choice to forgive, “In the name of Jesus, I forgive for .” Be specific with the person and the hurt, as well as any negative effects that it has had on your life. Remember that forgiveness is a choice and, while it is closely akin to healing of the heart, they are not identical. The hurt may not go away immediately… or even for a while. At this point, you may have to forgive again tomorrow, and the next day… and seventy times seven days after that. Don’t doubt that you have really forgiven, but remember that wounds can go deep and so forgiveness must go deep.

I can hear the objection, “But I don’t even want to forgive.” Then we take a step back and begin with praying for the person who hurt you. By spending time each day immersing that person in prayer, God will begin to change and heal our hearts to the point where we will be able to make the decision to forgive.

I hear another objection, “I can’t even bring myself to pray for that person.” Then we begin by praying for ourselves, asking God to change our hearts, to help us to want to forgive because we want to be like Him and His all forgiving love.

I want to bring up one other important point. Sometimes, the person in our lives who most needs forgiveness is ourselves. Sometimes, we can forgive anyone else, “But I knew better… and I sinned.” It’s okay, even good to forgive ourselves. After all, Jesus has forgiven us. How can we hold something against ourselves that even God doesn’t hold against us. We can start forgiving ourselves in the same way – being aware of how I have hurt me, and then making a choice with Jesus to forgive myself. It may mean spending days and weeks ahead of time praying for ourselves so that we can get to the point of making the choice to forgive (with Jesus).

Jesus says that we must forgive each other from the heart. May He pour His grace upon us, and may we be open to that grace, so that we may truly forgive!

Page 4: St. Patrick Parish · S t. Patrick Parish. St. Patrick t. Patrick ParishParish 12 Main Street, Pelham, NH 03076 s 3DJH w á t r t r

Page 956 3

Knights of Columbus Annual Charity Raffle

The Knights of Columbus will be selling their State Council Raffle tickets after Masses on Saturday and Sunday, September 19th & 20th. Tickets will also be available for sale at the Parish Office starting Monday, August 31st. Please see Kathy or Therese to buy your tickets. Our Council earns 50 cents for each dollar we sell in tickets. We have, in recent years, given our earnings to the Pelham Food Pantry and will continue that for this year. Last year’s amount given to the Pantry from this source was $247.00 enabling us to contribute a total donation of $1,000 to the Food Pantry. The drawing will take place on Saturday, October 3rd, at the State Council Ball at Ste. Marie Parish in Manchester, NH. In addition to the 1st prize of $3,000 there are 2nd prize $1,000 and 3rd prize $500 and (5) $100 4th prizes. Please consider purchasing tickets for yourselves or to sell to family and friends. You will be helping both our Council and the Pelham Food Pantry. Ticket prices are $1.00 per ticket or a book of 6 for $5.00. Thank you for your support of this endeavor.

CATHOLIC CHARITIES NH: Supporting our Neighbors in Crisis 75 years

Whether isolated seniors, homeless and struggling veterans, families facing chronic hardship or individuals searching for ways to cope in the “new norm” of life, Catholic Charities NH remains steadfast in our commitment to be there for those who need us most – especially in times of crisis like these. Our programs remain fully operational during the COVID-19 pandemic. We prayerfully ask for your support to continue to help your neighbors facing difficulties, we encourage you to make a gift today: cc-nh.org/everything. You may also mail your gift to CCNH, PO Box 9510, Manchester, NH 03108-9510.

Rite of Christian Initiation for Adults (RCIA) Are you someone, or do you know someone, who… ⦁ Has expressed an interest in becoming Catholic? ⦁ Is desiring to live the Catholic faith more fully? We offer an opportunity to come together in a small group to learn more about our faith. Sessions focus on the teachings and experience of Church and prepare individuals to celebrate the Sacraments of Baptism, Confirmation, and Eucharist during the Easter season. You are welcome to participate in the process with your questions, your perspectives and your faith story in a warm accepting setting. For information, please contact Ron Turturici at 603-898-1555 or at [email protected] ††††††††††††††††††††††††††††††††††††††††

WORLDWIDE MARRIAGE ENCOUNTER

Has gone “Virtual”! To support married couples during this time of social distancing, Worldwide Marriage Encounter is sponsoring a virtual marriage experience called Restore – Rekindle – Renew. This Enrichment Experience will meet via Zoom for seven sessions on Monday evenings September 14th to October 26th from 7:00-9:30 PM. Couples will explore their individual personality styles, improve listening and communication skills, understand God’s plan for their marriage, and learn how to keep their relationship a priority. Registration is limited and a $100 application fee is required. For more information or to apply, call Stephen & Michelle O’Leary at 800-710-9963 or visit them at https://wwmema.org/.

Page 5: St. Patrick Parish · S t. Patrick Parish. St. Patrick t. Patrick ParishParish 12 Main Street, Pelham, NH 03076 s 3DJH w á t r t r

Page 956 4

AMAZON If you have an Amazon account, you can have St. Patrick Parish as your Charity. You sign in to smile.amazon.com on your desktop or mobile phone browser. From your desktop, go to Your Account from the navigation at the top of any page, and then select the option to Change your Charity. Select St. Patrick as your new charitable organization to support us.

TALK ON ST. JOHN PAUL II Mark your calendars: Thursday, October 22nd, former Swiss Guard, Mario Enzler, Ph.D., will speak to us about St. John Paul II. The evening begins with Mass at 6:00 PM, followed by his talk. Mario recently published a book I Served a Saint: Reflections of a Swiss Guard in honor of the centenary of the birth of St. John Paul II.

FORMED

To help you grow in your faith go to www.formed.org. They really have some good materials like Movies, Daily Reflection, Documentaries and much more. To register, go to pelham.formed.org

Acts of Mercy

How many Spiritual ___ Instruct the Uninformed ___ Counsel the doubtful ___ Admonish sinners ___ Comfort the sorrowful ___ Bear wrongs patiently ___ Forgive Offenses ___ Pray for the living and the dead How many Corporal ___ Feed the hungry ___ Clothe the naked ___ Give drink to the thirsty ___ Shelter the homeless ___ Comfort the imprisoned ___ Visit the sick ___ Bury the dead

PARISH COLLECTIONS In order for the parish to meet its regular expenses, our offertory and other designated parish collections must bring in $8,700 per week. Parish Collections for the week of 9/6/20 Offertory Envelopes $6,360

Offertory Electronic Giving $1,545 Total Offertory $7,905 Total Offertory $7,905

As of 9/6 we have an offertory deficit of $4,646

Thank you to all of our parishioners who have been supporting us during this

pandemic. I appreciate your generosity. ~Fr. Von~

Catholic University

collected as of 9/6/20 $1,005

Thank you for your generosity!

SECOND ENVELOPES

FOR THE FOLLOWING WEEKS Sept. 20 Utility This collection helps with the cost of utilities for the Church, Rectory, Parish Center and School. Sept. 27 NH Diocesan Priest Retirement This collection supports the NH Diocesan Priest Retirement Trust Fund. This fund provides retirement benefits to retired NH diocesan priests. Your contributions toward the support of the parish and its ministries are greatly appreciated.

Page 6: St. Patrick Parish · S t. Patrick Parish. St. Patrick t. Patrick ParishParish 12 Main Street, Pelham, NH 03076 s 3DJH w á t r t r

Page 956 5

CHURCH & PARISH OFFICES 12 Main St.

Pelham, NH 03076 603-635-3525 (office)

603-635-3919 (fax number) Office Hours: Monday-Friday 8:30-4:00

PARISH WEBSITE

Website: www.stpatricks-pelham.com Pastor Rev. Volney J. DeRosia - Ext. 15 Email: [email protected] Priest in Residence Msgr. Richard J. Kelley Email: [email protected] Deacon Deacon John Ross Email: [email protected] Faith Life Director Adam Castor 603-635-1447 Ext. 14 Email: [email protected] Business Manager Therese Soucy - Ext. 11 Email: [email protected] Secretary Kathleen Jean - Ext. 10 Email: [email protected] Music Ministry Gary Williams 603-635-7669 Email: [email protected] Steve Caruso 603-401-0837

Help Souls on their way to Heaven When Fr. Von gets called to anoint people who are dying, he calls on a group of people to pray a Divine Mercy Chaplet for them. If you would like to join this ministry or want more information, contact Fr. Von at (603)-635-3525 or [email protected].

MASS SCHEDULE Saturday 4PM Sunday 8AM, 10:30AM, 6PM

WEEKDAYS MASS SCHEDULE

Monday through Thursday 8am Friday No Mass First Friday and First Saturday 8am HOLY DAY MASS SCHEDULE Holy Day 8am, 10am & 7pm

ADORATION Monday-Thursday 6:30-7:40am Wednesday 8:30-9:30am 2:00-8:00pm 1st Wednesday Adoration is for Vocations Contact Jackie Hynes at 603-425-8459

RECONCILIATION

Saturday 3pm to 3:45pm or by appointment

ANOINTING OF THE SICK &

COMMUNION TO THE SICK & HOMEBOUND Please contact the Parish Office for arrangements

BAPTISM

Please contact the Parish Office to schedule a baptism. Parents are required to meet with the pastor and participate in a baptismal catechetical session prior to the celebration of the sacrament.

MARRIAGE Arrangements with the parish must be made at least nine months prior to the wedding. Fulfillment of a Diocesan, pre-marriage program is required.

FORMED To help you grow in your faith go to www.formed.org to register, go to pelham.formed.org

KNIGHTS OF COLUMBUS Care to join the Knights of Columbus?

Please contact Erick Wright at 603-635-8772 or [email protected]. More information online: www.kofcpelhamnh.org

Page 7: St. Patrick Parish · S t. Patrick Parish. St. Patrick t. Patrick ParishParish 12 Main Street, Pelham, NH 03076 s 3DJH w á t r t r

956 St. Patrick, Pelham, NH (I) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net

SALEM 66 AUTO SALES

Sales • Repair • Auto BodyUSED CARS

Richard Wunderlich503 Bridge Street

Rt. 38 Pelham, NH 03076

603-635-3222

WHARF INDUSTRIES PRINTING

* PRINTING & COMPLETE ** DIRECT MAILING SERVICES *

STATIONERY • BUSINESS CARDSBROCHURES • 1-4 COLOR

3 LEXINGTON RD., UNIT 2WINDHAM, NH 03087

603-421-2566WWW.WHARFINDUSTRIES.COM

Rosaries From Flowers“Handmade from the Flowers

of your Loved One”

841 MAIN STREETTEWKSBURY, MA 01876

www.rosariesfromfl owers.com(978) 851-9103

Skilled Nursing Facility & Assisted Living

Heal, Comfort and Empower.

21 Searles Rd. • Windham603-890-1290

www.wardehealthcenter.org

B U I L DB U I L DY O U R Y O U R

C O M M U N I T YC O M M U N I T Y- Shop Local -

P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !

What’s My Name?The #WHATSMYNAME Movement asks everyone to simply ask drivers “What’s my name?” before entering their vehicle to make sure it is the car they

are supposed to enter.

In Rememberance of Samantha Josephson

#WHATSMYNAME

Mallory’s Army FoundationUnited Together In The Fight Against Bullying...

Don’t Just Teach Kindness... BE KINDNESS!www.MallorysArmy.com

(973) 440-8657 • [email protected] It’s easy to join our mailing list! Just send

your email address by text message: Text MALLORYSARMY to 22828 to get started.

Message and data rates may apply.

BRANDEN JUDKINS

Loan OfficerNMLS#: 1646503

436 Amherst Street, Suite 102Nashua, NH 03063(c) (603) 490-6113 (f) (603) 876-6084

[email protected]/branden.judkins

Team RoseEd, Paula & Justin Rosamilio

[email protected] [email protected] [email protected] 603-494-0879

www.teamroserealty.com

Multi Million Dollar Sales - Hall of Fame WinnerKeller Williams Realty

130 Main St., Salem NH 03079 - Offi ce 603-912-5470

“The Perfect Place”

for ChildrenKara Kubit

Owner/Director125 Main Street

Pelham, NH 03076603-635-9207

www.qualitylearningcenters.com

Quilt Shop

70 Bridge St., Unit 6PO Box 975

Pelham, NH 03076603-635-9705

[email protected] Hours: Mon: 10-8,

Tues, Wed, Fri: 10-6, Thur: 10-7Sat: 9-5, Sun: 10-5

BONNIE J. LAFERRIERE, CTC, DSPELHAM’S FULL SERVICE TRAVEL AGENCY

38 YEARS OF EXPERIENCE603-635-4981 • CONNECTIONSBYOBRIENTRAVEL.COM

AUTO REPAIR & TOWINGHeavy Duty Towing & Recovery

COMPLETE AUTO REPAIRSAIR CUSHION RECOVERY

BODY SHOP603.635.3371 • Pelham, N.H.

Mary De Jesus, OwnerCell: 978.788-3551

We tailor to your needs. Whether you need care for 2 or 24 hours, we’ll be there. Call or email us to schedule your appointment.

O: (603) 751-8260 • [email protected]

5 Mossey Ln.Pelham, NH

www.atyourhaven.com

Commercial Rates are at an All Time Low. Contact us today to get a free analysis to see if we can help Save you moneywith your monthly payments on your

commercial property. Multi-Family, Retail, Offi ce Building, Apartment and Condos.

Can close in as little as 45 days! Four season customer service is our top priority.

www.duqfunding.com1650 Market Street - Suite 3600

Philadelphia, PA 19103

ThisSpace

is Available!

800-333-3166ext. 161

www.jppc.net

9 Dick Tracy DrivePelham, NH 03076

[email protected]/familypaving

978-957-5022

Petal PushersPetal Pushersof Pelhamof Pelham

[email protected]

A UNIQUEA UNIQUEFLORAL COMPANYFLORAL COMPANY

Page 8: St. Patrick Parish · S t. Patrick Parish. St. Patrick t. Patrick ParishParish 12 Main Street, Pelham, NH 03076 s 3DJH w á t r t r

956 St. Patrick, Pelham, NH (B) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net

• Complete Auto &

Diagnostics

• State Inspections

• Towing & Recovery

24 Hr. 603-505-76719 Ledge Rd., Pelham, NH

603-898-9077ASE-Certifi ed Mechanics

Light & Medium Duty ServicesAll Major Credit Cards Accepted

P.O. Box 553Atwood Rd.

PelhamNH 03076

603-635-7555Fax 603-635-9627

PropertiesNina Maglio Bisson

Realtor®/Hall of Fame Licensed in NH & MA

100 Bridge St., Pelham, NH 03076Offi ce 603-635-8900Offi ce 603-635-8900Cell 603-490-3468Cell 603-490-3468

Email [email protected]

MARK D. DUPONT, CPA, PCMARK D. DUPONT, CPA, PCCertifi ed Public AccountantsCertifi ed Public AccountantsTax & Business ConsultantsMark Dupont, CPA, MST1794 Bridge St., Unit 32

Dracut, MA 01826978-970-0270

Fax: 978-970-0261Email: [email protected]

Pelham Funeral Home11 Nashua Road • 635-3333

Licensed New HampshireFuneral Directors

John W. Crane • James F. O’Donnell, Jr.Ron Meltzer

30 Middlesex St.Lowell, MA 01852

978-458-7999washingtonsavings.com

Premier Roofi ng & Painting

www.premierroofi ngnh.com603-890-9019 • Cell 603-235-5731

All Types of Roofi ngInterior & Exterior Painting

FreeEstimates

FullyInsured

Dr. Nilfa Collins, D.M.D.100 Bridge St., PO Box 728, Pelham, NH 03076-0728

603.635.1166 • Fax 603.635.1186 • [email protected]

www.collinsdentistry.com

Pelham Insurance Service, Inc.Pelham Insurance Service, Inc.DBA

EVERGREEN INSURANCEAuto • Home • Business

Financial ServicesHillside Plaza, Unit 3

PO Box 960122 Bridge St., Pelham NH

603-635-2434Fax: 635-2464

Santo Insurance & Financial Services, Inc.www.santoinsurance.com

Providing the: Most Options. Best Service. Fastest Response.

AUTO | HOME BUSINESS | LIFE | HEALTH

Call Jamie Santo603-475-4295

Lawn Maintenance • CleanupsMulch, Loam, Stone • Block Walls & Pavers Snow Plowing & Sanding • Bobcat Service

Ryan Gagne • 603-508-6326

Free Estimate

Carrier FamilyFuneral Home & Crematory

Honoring the lives of those we love.

Th e diff erence you need when you need it the most.

State-of-the-Art Funeral FacilityCafe • Function Hall • Kids Play Room

On-site Crematory

38 Range Road • Route 111 • Windham, NHServing Windham, Pelham & Salem

603-898-9552carrierfuneralhome.com

RL

www.rlberubeelectric.com978-453-2338

Residential • CommercialIndustrial

Master LicenseMA - 12171 • NH - 7733

Ronald [email protected]

Leonard [email protected]

BERUBEELECTRIC, INC.

BEAVERBEAVERVALLEY FARMVALLEY FARMwww.BeaverValleyFarm.com

603-635-259717 Main Street, Pelham

(Across the street from St. Pat Church)

LOW PET FOOD PRICESSamples & Free Bags

FROMM-NOW-VICTOR-EARTHBORNNUTRI SOURCE - SOJOS

GRANDMA LUCYS & MOREFINICKY PETS OUR SPECIALTY

CANINE FRIENDS ARE WELCOME!Local Eggs & Local Raw Honey

Proud Supporter of

Foster Homes & Volunteers Neededwww.arnne.org 603.233.4801

Wedding InvitationsWedding Invitations Holiday CardsHoliday Cards

Log ontoLog onto www.JPPC.netwww.JPPC.net conveniently from your home or office.conveniently from your home or office.

ONLINE CATALOG - ONLINE ORDERING - ONLINE PROOFINGONLINE CATALOG - ONLINE ORDERING - ONLINE PROOFING

All Major Credit Cards Accepted All Major Credit Cards Accepted FREE UPS GROUND SHIPPINGFREE UPS GROUND SHIPPING!

Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-tor - Waste & Waterwaste - Trans-portation & Logistics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Work-ers - Critical Manufacturing - Chemi-cal & Hazardous Materials Financial Service - Private & Public Healthcare - Law Enforcement, Public Safety - Of-fi cers & First Responders - Food & Agriculture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & G W k C i i l M

To all those essential workers keeping us safe,

yourservice is

invaluable & appreciated.

afety --- OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOf cercercercercececeFirst Responders - Food & d & d & d &d &d &d &d &d &d d d d d d AgAgAAAAgAgAgAgrAgrAgrAgAgAgrAg

y Sector - WaWaWaWaWaWaWaWaWaWaWaWaWaWaWastestestestestesteteestestestestestestest &Waterwaste - Transportatatatttttttttion ionion ionioionion ioniononion onion & L& L& L& L& L& L& L& Lo& L& L& L& L& & gis

cs - Public Works & - Infrnfrnfrnfrnfrnfrnfnfnfnfnfrnfrnfrnfrnfrastructuucucucucucucuc rCommunications & IIIIIIIIIIIIIIInfornfornfornfornfornfornfornfornfornfornfornfornfornfornformatimammmmmmammmmmm o

echnology Workers - ComComComComComComComComComComComComComComCommunimumumummmmmmm ty &Workers -s -s -s -s -s -s -s -s -s -s --- CriCriCriririririiiiriiticacaticacacaticaticaticaticaticaticaticaticaticatical Ml Ml Ml Ml Ml Ml Ml Ml Ml Ml Mal l Ml M n

acturing - Chemical &&&&&&&&&&&l &l & l & l & HazaHazaHazaHazaHazaHazaHazaHazaHazaHazaHHHH rdourdrdrdrdrdrdrrdrdrdrdncial Services - DDDDDDDDDefeeeeeeefefens

dustrial Base - Commercial Faciles Workerssrssssss - RResidesidesidesidesidesidesidesididesidesidesidesideentientientientientientientientientiential &aaaaaaaa Shelteervices & FFFFFFFFFFFFFFFaciaciacilacilacilacilacilacilacilcilaciacilacilacilacilitieitieitieitieitieitietieitietieitieies -s -s - - - - - HyHyHygiHyHyHyHyHyHyHyHyHH ene Prodcts & Services es esesesesesesesesessss - Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Priiiiivivivivivivivaivaivativ e & Publiealthcare - Lawawawawawawawawawaw EnfEnfEnfnfnfnffnfnffffffforcorcorcorcorcorcorcorcorcorcorcorceorc ment, Publiafety - Officercercercercerererercercers &&&s &s &s &s &s &s &s &s &s &s &s &s & FiFiFiFFirsFFFFFFFFF t ResponderFood & Agrgrgrgrrrrriculiculiculiculiculiculiculiculiculiculicuiculiculicic turturturturturturureturturturturturtutut - Energy Secr - Waste e eee ee & Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& ttttterwtttettt aste - Trans

ortation &&&&& & && & &&&&&& LogiLogiLogiLogiLogiogiogiogiLogiLogLogLogiLogLogLog stististststststisticststststsss s - Public Work- Infrastrtrrrrrrrrrrrrrrucucucucucuctctctuucucucucuctucuc re -e e e ee e CommunicationInformatioatioatioiooooooioooooonnn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Technology Worker

CoCoCoCoCoCoCoCoCoCoCoCoCoCoCommunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunity ity ity ity ity ity ity ity ity ity ity ity ityityity & Go&&&&&&&&&&& vernment Works - CrCrCrCrCrCrCrCrCrCrCrCrCrCrCriticiticiticticiticiticticiticiticticiiticiticiticitical al Mal Mal Mal Mal Mal Mal Mal a anufacturing - Cheml l ll & Ha& Ha& H& H& H& H& H& H& H& H&&&&& zardzardzardzardzardzardardardardardardardzardardardooooooous ooooooo Materials Financia

ervrvrvvvvice ice ice ice ice iceicicice icicicicicic - P- Pr- Pr- P- P- P- P- - - P- - - - ivativaivivvvvvvv e & Public HealthcarLaw EnEEE forcforcforcffforcforcforcforcforcforcforceement, Public Safety - O

To all those nforcement, Public Sanforcement, Public Sa

essentiallture - Energylture - EnergyWater aste TraWater aste Tra

workerscs - Public Wors - Public WorCommunicatioCommunicatio

keeping echnology Wochnology Woovernment Wovernment W

us safe,acturing Caterials Finanaterials Finan

yournicationnicationWorkerWorke

service isovernment Workovernment Workacturing Chemacturing Chem

invaluable &us Materials Financiaus Materials Financiae & Public Healthcare & Public Healthcar

ment, Public Safety - OSafety - Othan

k yo

u

g gyWatateatttatatatattaaaaaa rwaswaswawaswaswawwwaswaswwwwwasswasawaw ste -tetttttttttteee Transportation & Log

cccscccccc - PPPPPPPPPPPPPPubliubliubliubliublililublibbliububuubuuubu c c WoWoc WoWWWoWoWoWWoWWWoWc oc WoWWc Woc WWc WWWWccc rks rksrrksrkskrkrkkkkkrr & - & -& -&& -&& -&&&& -&& -&&&&& -&&&& -&& InfrInfInfrnfrInfInfrnfrIInffI ffInI fnfI fInfnfInnnfn astructuCCoCoCoCoCoCoCCoCCoCCCoooCCCCCCCC mmunmmunmmmmmmunmmm nmmmm nmmmmm nmmmm nnm nm nmmmm nicatcaticaticatcatcatcatcattcatcatcatcattcatcatcatcatccacatcccacc ionsionsionsonsionononsonsiooionssonsonsonsiononoooon & I&&& I&& I&&& I& II& I& I& I&& nfornfornfornfornfornforforfornfornforforfnfnfornfornfornfornforfofornfornforrrfornnfforrmatimatimatmatmatiamatimatmattimatiatitimatiattatmatmatimattattmattmmmatim

echhhhhhhhhnolonononoonnoloonolonnoln lonolonoooloonnnn onolonoln oonoo ggy Wgggg orkers - Community

Lisa GrowLisa GrowREALTOR®Licensed inNew Hampshire& Massachusetts

[email protected]

I am never too busy for your referrals!I am never too busy for your referrals!Each office is independently owned and operatedEach office is independently owned and operated