standardization of pedigree collection. genetics of alzheimer’s disease alzheimer’s disease gene...
TRANSCRIPT
![Page 1: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/1.jpg)
Standardization of Standardization of Pedigree CollectionPedigree Collection
![Page 2: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/2.jpg)
Genetics of Alzheimer’s Genetics of Alzheimer’s DiseaseDisease
Alzheimer’s Disease
Gene 1 Gene 2
Environmental Factor 1
Environmental Factor 2
![Page 3: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/3.jpg)
Genetic Approaches to Genetic Approaches to Gene Identification In Gene Identification In Alzheimer’s DiseaseAlzheimer’s Disease
![Page 4: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/4.jpg)
Identifying genes for complex Identifying genes for complex diseasedisease
Association Test candidate gene Collect sample of
affected and control subjects
Compare frequency of a genetic polymorphism in 2 samples
Linkage Test entire
genome Collect families
with multiple affected members
Affected Control
![Page 5: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/5.jpg)
Linkage vs. AssociationLinkage vs. Association Linkage
Measures the segregation of alleles and a phenotype within a family
Detected over large physical distances
Association Measures preferential segregation of a
particular allele with a phenotype across families
Detected over shorter distances
![Page 6: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/6.jpg)
Meiosis and LinkageMeiosis and Linkage
Gamete formation Meiosis I: Homologous
chromosomes pair Crossing over occurs
Genes that are physically close together are more likely to be coinherited
Genes that are physically far apart on the chromosome are less likely to be coinherited
![Page 7: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/7.jpg)
Linkage ApproachLinkage Approach
Seeks to identify, IN FAMILIES, chromosomal regions that are consistently transmitted to affected individuals. Identify these regions using ‘markers’ Find a marker which is ‘linked’ to the
disease
![Page 8: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/8.jpg)
Linkage: Autosomal Linkage: Autosomal DominantDominant
![Page 9: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/9.jpg)
Traditional Linkage Traditional Linkage ApproachApproach
Successful in the identification of genes for Alzheimer’s disease
Amyloid precursor protein (APP)
Presenilin I (PS1) Presenilin II (PS2)
![Page 10: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/10.jpg)
Further Genetic StudiesFurther Genetic Studies
Clearly, most families with Alzheimer’s disease do not have a clear pattern of Mendelian inheritance
Already, one susceptibility gene has been identified whose alleles can either increase or decrease the risk of AD
There are certainly other genes which are to be identified
![Page 11: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/11.jpg)
How to tackle finding How to tackle finding these other genes?these other genes?
![Page 12: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/12.jpg)
Genetics of Alzheimer’s Genetics of Alzheimer’s DiseaseDisease
Alzheimer’s Disease
Gene 1 Gene 2
Environmental Factor 1
Environmental Factor 2
![Page 13: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/13.jpg)
Linkage in Complex Linkage in Complex DiseaseDisease
Identify families with multiple affected members Increases the likelihood that genes are
important in disease susceptibility in that family
Pattern of inheritance less certain Collect family members to follow
segregation of disease and marker alleles
![Page 14: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/14.jpg)
Identity By Descent (IBD)Identity By Descent (IBD)
Allele 1 AGCTCACACACACACACACACAATCGAllele 2 AGCTCACACACACACACAATCGTCGAAllele 3 AGCTCACACACACAATCGTCGACCGCAllele 4 AGCTCACACACAATCGTCGACCGCGG
![Page 15: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/15.jpg)
Linkage AnalysisLinkage Analysis
Employ nonparametric linkage methods Identify chromosomal regions that are
preferentially transmitted within a family to the affected individuals.
Method is not based on recombination but on IBD marker allele sharing
![Page 16: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/16.jpg)
Analysis of Affected Analysis of Affected RelativesRelatives
Look for chromosomal regions shared in common by affected relatives in the same family. Presume that affected individuals in
the same family will have some similar susceptibility genes.
Look at patterns across families to determine if the same chromosomal region is being shared.
![Page 17: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/17.jpg)
Genome Screen ApproachGenome Screen Approach
Evaluate the entire genome Analyze markers located at regular
intervals throughout the genome Identify regions that are
consistently shared by affected relatives
Marker
s
![Page 18: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/18.jpg)
Association StudiesAssociation Studies Once a chromosomal region has
been identified which is linked to AD, additional studies are necessary to identify the causative gene
Association studies typically test for linkage disequilibrium rather than linkage. Linkage disequilibrium extends over
shorter distances. Often employ SNPs.
![Page 19: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/19.jpg)
Association StudiesAssociation Studies Studies of linkage disequilibrium
can study: Transmission of alleles throughout a
family consisting of affected and unaffected individuals.
Compare allele frequencies between affected and unaffected individuals.
Many new methods are being developed to more effectively test for linkage disequilibrium.
![Page 20: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/20.jpg)
AD Genetics Initiative AD Genetics Initiative GoalsGoals
Identification of genes contributing to Mendelian forms of AD are very important. Provide insight into important pathways Provide potential candidate genes to
examine in non-Mendelian forms of disease
This study seeks to identify the genes contributing to non-Mendelian forms of AD.
![Page 21: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/21.jpg)
Design of the AD Design of the AD Genetics InitiativeGenetics Initiative
![Page 22: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/22.jpg)
Appropriate Families for Appropriate Families for StudyStudy
At least 2 living siblings with LOAD (onset > 60 years)
At least 1 other living related family member who :
Has AD (onset > 50 years)
Or
Is unaffected (> 60 years)
![Page 23: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/23.jpg)
Appropriate Families for Appropriate Families for StudyStudy
Who should be collected in this family? Why? If parents in generation I are
alive, they should be collected.
Collection of the parents will allow allele sharing to be determined more definitely in studies of the siblings in generation II.
More definitive allele sharing produces more definite linkage results -> more power to find genes for AD
II
IIII
![Page 24: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/24.jpg)
Appropriate Families for Appropriate Families for StudyStudy
Who should be collected in this family? Why? Collect all siblings in generation II
(AD and non-AD)
This is particularly important if the parents in generation I are deceased
Study allele sharing in generation II.
Studies can compare allele sharing among the AD siblings and the discordant siblings
Can evaluate linkage disequilibrium.
II
IIII
![Page 25: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/25.jpg)
Deceased Family MembersDeceased Family Members Testing markers in the parents and
offspring of a deceased person makes it possible to estimate what the individual must have inherited
![Page 26: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/26.jpg)
Reconstruction Reconstruction
Estimating a missing person’s likely genotype is termed ‘reconstruction’.
This is the principal being employed in the identification of specimens in many forensic cases.
![Page 27: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/27.jpg)
Power to ReconstructPower to Reconstruct
The power to reconstruct a missing genotype is dependent on how many closely related family members can be sampled.
The important people to sample are the offspring of a deceased, affected individual.
![Page 28: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/28.jpg)
Appropriate Families for Appropriate Families for StudyStudy
Who should be collected in this family? Why? Offspring of the individuals in
generation II can be important for genetic studies.
Do any individuals in generation III have symptoms of memory loss or AD? If so, collect them.
Are any of the individuals in generation III over the age of 60 years? Longitudinal follow-up of these individuals may identify new cases of AD.
II
IIII
![Page 29: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/29.jpg)
Appropriate Families for Appropriate Families for StudyStudy
Who should be collected in this family? Why? If any offspring in generation
III are collected, it is important to also collect both their parents, when possible.
The individual in blue is important when determining which alleles the offspring in generation III have inherited from her affected father.
II
IIII
IIIIII
![Page 30: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/30.jpg)
Appropriate Families for Appropriate Families for StudyStudy
Who should be collected in this family? Why? Did anyone in the family have
an autopsy and is tissue still available?
Collect information about these individuals and consider obtaining these materials, if possible.
II
IIII
![Page 31: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/31.jpg)
Who to collect?Who to collect?
A commonly asked question is who should I collect a blood sample from in a genetic study?
The answer is all genetically informative individuals!
![Page 32: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/32.jpg)
Who is genetically Who is genetically informativeinformative
Genetic analysis seeks to study the transmission of marker alleles throughout the family. When we can determine the
inheritance of all marker alleles unambiguously, we have the greatest power to find genes for disease!
Unaffected individuals may be very important for collection.
![Page 33: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/33.jpg)
Who is genetically Who is genetically informativeinformative
Collect affected individuals
Collect as many individuals with a • as are willing to participate
![Page 34: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/34.jpg)
Who is genetically Who is genetically informativeinformative
Insert pedigree with affected siblings + aunt
go through who to collect
summarize at bottom of slide
• Collect affected individuals
Collect as many individuals with a • as are willing to participate
![Page 35: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/35.jpg)
Which are the best Which are the best families?families?
Families with the largest number of affected individuals. Strong family history suggests more
genetic. Unaffected individuals in families with
many affected individuals are also very important, particularly if they are examined clinically.
![Page 36: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/36.jpg)
Who is genetically Who is genetically informativeinformative
Collect all affected individuals
Collect any living connecting relatives
Collect any unaffected siblings
![Page 37: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/37.jpg)
Which are the best Which are the best families?families?
Cooperative Families Families eager to participate in
research will typically complete the study faster.
Provide annual follow-up information more easily.
Assist in research if additional information/samples are needed.
Important to remain in contact with families and provide them with information about the study
![Page 38: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/38.jpg)
Who to CollectWho to Collect
Collect the parents in generation I, if available
Collect all siblings in generation II (affected and unaffected)
Collect any individuals in generation III with memory loss
Collect any individuals in generation III > 60 years
Query for any other affected cousins, half siblings, aunts, uncles??
II
IIII
IIIIII
![Page 39: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/39.jpg)
When in Doubt??When in Doubt??
Contact Susan LaRusse who will Contact Susan LaRusse who will help sites identify the critical help sites identify the critical individuals in their pedigrees.individuals in their pedigrees.
![Page 40: Standardization of Pedigree Collection. Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor](https://reader036.vdocuments.net/reader036/viewer/2022062300/56649e205503460f94b0b5e1/html5/thumbnails/40.jpg)