standards alignment north carolina essential standards

Microsoft Word - MALB Printable 5E 2.docx5E LESSON PLAN MORE ALIKE THAN DIFFERENT
Funding and support for the More Alike Than Different Lesson provided by
Standards Alignment
North Carolina Essential Standards
NCES.5.L.3 Understand why organisms differ from or are similar to their parents based on the characteristics of the organism.
5.L.3.1 Explain why organisms differ from or are similar to their parents based on the characteristics of the organism. 5.L.3.2 Explain why organisms differ from or are similar to their parents based on the characteristics of the organism.
NCES.8.L.2.1 Understand how biotechnology is used to affect living organisms. Summarize aspects of biotechnology including:
• Specific genetic information available • Careers • Economic benefits to North Carolina • Ethical issues • Implications for agriculture
NCES.Bio.3.1 Explain how traits are determined by the structure and function of DNA. Bio.3.1.1 Explain the double-stranded, complementary nature of DNA as related to its function in the cell. Bio.3.1.2 Explain how DNA and RNA code for proteins and determine traits.
NCSES.Bio.3.3 Understand the application of DNA technology. Bio.3.3.1 Interpret how DNA is used for comparison and identification of organisms. Bio.3.3.2 Summarize how transgenic organisms are engineered to benefit society. Bio.3.3.3 Evaluate some of the ethical issues surrounding the use of DNA technology (including cloning, genetically modified organisms, stem cell research, and Human Genome Project).
Next Generation Science Standards Disciplinary Core Ideas
LS1.A: Structure and Function • All cells contain genetic information in the form of DNA molecules. Genes are regions in the DNA
that contain the instructions that code for the formation of proteins.
5E LESSON PLAN MORE ALIKE THAN DIFFERENT
LS3.A: Inheritance of Traits • Each chromosome consists of a single very long DNA molecule, and each gene on the
chromosome is a particular segment of that DNA. The instructions for forming species’ characteristics are carried in DNA. All cells in an organism have the same genetic content, but the genes used (expressed) by the cell may be regulated in different ways. Not all DNA codes for a protein; some segments of DNA are involved in regulatory or structural functions, and some have no as-yet known function.
MORE ALIKE THAN DIFFERENT
1 BE PART OF A DNA STRAND 30 minutes
• Follow the instructions in the Be DNA! video to create a visual representation of DNA using people. Create a model with just one class, or involve the entire school! For very large groups, chalk or string works well to outline where they should stand. For smaller groups, construction paper or poster board can be used as shown in the video. You may also wish to show the video to the students and let them help figure out how best to make their own human-sized DNA molecule.
• Students learning at home can use chalk, string, natural items such as sticks and rocks, or whatever else is available to create a giant sized DNA similar to the one in the video. They can take a photo to share with their teacher and the rest of their classmates.
2 HOW ARE WE ALIKE? 15 minutes
• Show students the animated, 78-second video How Are We Alike? about a group of friends discussing what they have in common with their lunch, and with each other. Let the students know that they will revisit the problem posed in this video later in the lesson.
• Ask students to think about what they have in common with a banana, a chicken and each other. Then, using the How Are We Alike? Student Handout, they can work in pairs to list the similarities and differences among the three organisms and then share results with the class.
• Students learning at home can complete the Student Handout interactively using Google Docs or other online document-sharing app to complete the list in groups, or they can print it out and fill it in. They may also brainstorm with parents or siblings.
EXPLORE
1 IS IT GENETIC? 90 minutes
• What parts of our appearance do DNA and genes determine? Check out the Ear Sort activity from the Exploratorium at https://www.exploratorium.edu/snacks/ear-sort. Watch the video and then complete the activity. Make sure students recognize that sometimes sorting traits is not easy and there are often variations.
• As homework have students complete the Is it Genetic? Trait Inventory Student Handout of physical characteristics from their family members. Students do not need to be biologically related to their families for this activity.
• In class, compile the results of the inventory on the board or using a spreadsheet. Assign a trait to student groups and have them create a bar graph of the class results and research whether genetics determine that trait or not. Observable traits, determined by genetics along with environmental factors are called phenotypes. Each group can then share their results with the class.
• Students learning at home can complete the Ear Sort activity on their own along with the genetic trait inventory. Students can share their data on Google Sheets or some other document-sharing app to compile and visualize their data. Students can research a trait individually and share their results virtually with the class or teacher.
2 BUILD A BIRD 30-50 minutes
• Full instructions for this activity can be found on the Build a Bird Teacher Handout. Using the Build a Bird Student Handout, students create and decode DNA instructions for a bird to observe how variations in DNA lead to different traits. Short sections of DNA or genes are randomly selected and used to assemble a DNA molecule. Students read the DNA recipe to create a drawing of their bird.
• Compare the birds created by the class to note similarities and differences. Are any two birds alike? Point out that every bird shares some traits in common with others, but each has an overall combination of traits that is unique. Variations in each DNA strand (the sequence of symbols) lead to different traits.
• Revisit ENGAGE Activity 2. Do the birds have more in common with each other or with a human or banana? For example, while the birds might have different looking beaks, they all have beaks. Humans and bananas, on the other hand, don't have beaks. How different do the students think the birds are from each other?
• Students learning at home can use bird DNA provided by the teacher, instead of drawing slips of paper from a bag, to build their bird. Students can then share a photo of their bird from home for a virtual class discussion.
3 EXTRACT DNA 60-70 minutes
• Full instructions for this activity can be found on both the DNA Extraction Teacher Handout and the DNA Extraction Student Handout.
• Ask the students what they think DNA looks like. Do they think it is visible with the naked eye?
• Perform the DNA extraction activity using bananas. If possible, let the students observe the extracted DNA using magnifying glasses and/or a microscope. How does the DNA compare to what they expected? Are they surprised at the amount of DNA they could pull out of half of a banana?
• Students learning at home can also perform the DNA extraction activity as it is written. If bananas are not available, other foods such as strawberries, kiwi, spinach and even chicken liver will work. If 90% ethanol is not available, rubbing alcohol will work, though less DNA will be visible.
4 MODELING DNA 40 minutes
• Full instructions for this activity can be found on the Modeling DNA Teacher Handout.
• Begin by explaining that if we could zoom in to see DNA it would look like a twisted ladder called a double helix. The rungs of the ladder are where the information in DNA is stored. The rungs are made of just 4 molecules or nucleotides bases.
• Following instructions on the Modeling DNA Student Handout, students will make a model of a short sequence of DNA to wear as a bracelet. The DNA sequence is from the cytochrome b gene found in many animals and plants. This gene creates proteins that help to release energy from food. All living things get energy from food in the same way, which is why it is found in so many animals and plants. Students can choose to make their model from one of ten different organisms.
• After making the model, students will compare the 10 different sequences for the gene on the handout. How do the genetic sequences for the ten organisms compare to each other? How much of the DNA sequence is the same?
• Students learning at home can perform this activity as written. If they do not have access to beads they can use different types of pasta, round cereal, candies (see the link above) or even just color and cut round beads out of paper or cardboard. Instead of comparing the organism they chose with a partner’s chosen organism, they can choose another organism from the list for comparison.
EXPLAIN
1 DIGITAL INTERACTIVE LESSON 1-2 class periods, or homework
Allow one or more class periods for students to complete the Life’s Instruction Manual lesson, which includes the following all-online components:
• An animated glossary that defines and illustrates terms that are important to the interactive lesson
• Three short animations entitled, respectively
1) Genome 101 2) DNA 101 3) Genes 101
• Formative quizzes that follow each of the three animations
• A final review that can serve as a summative assignment for the Life’s Instruction Manual Interactive Lesson.
For details on how to use the Life’s Instruction Manual Interactive Lesson, download the Teaching Tips from the lesson’s home page.
2 CLASS DISCUSSION 15 minutes
• Ask students to revisit the question posed in the How Are We Alike? animation and discuss how DNA, genes and an organism’s entire genome can be used to develop an answer. Using the information that they learned in the interactive lesson, how is their understanding of the problem different from when they first viewed the animation? They can record their answers on the How Are We Alike? (Part 2) Student Handout.
• Students learning at home can write a paragraph or record a video of their response to the question.
EVALUATE
Ask students to create a visual and/or written artifact—poster, infographic, play, comic strip, essay—that demonstrates their understanding of DNA and answers the central question of the lesson: “How are all humans more than 99% alike?” They should include
• Definitions of DNA, genes, chromosomes, and genome. • Descriptions of the shape of DNA and how information is stored. • Explanation of how every organism has unique traits that are specified by their DNA. • Explanation of how DNA sequences for different organisms can be similar.
Students learning at home can participate in this activity individually or virtually with a partner.
EXTEND
Students can complete the following EXTEND activity, using the Applications of DNA Student Handout:
Students can take what they have learned about DNA's role in an organism’s instruction manual and apply it to modern technological uses of DNA. They will work in small groups of 2 or 3 and choose from two topics:
• Precision Medicine • Genetically Modified Organisms
They can watch a corresponding UNC-TV Sci NC segment and explore additional resources to collect information about the topic. Students will create a poster, infographic, or digital presentation to answer the following questions about the DNA based tool or technology:
• How does the tool or technology work in general terms? • How is DNA involved? • How can it improve our lives? • What are potential problems?
Students learning at home can participate in this activity individually or virtually with a partner.
STUDENT HANDOUT MORE ALIKE THAN DIFFERENT
ENGAGE
How Are We Alike? Part 1
A banana, a chicken and a human walk into a classroom, and ask YOU what they have in common. Brainstorm with your group about what these three organisms have in common and what is different. For example, all three have skin but only the banana is part of a plant.
Banana & Chicken Both have… Only a banana has… Only a chicken has…
EXPLORE
Is It Genetic? A Trait Inventory Every person has his, her or their own combination of different traits. Some of them, such as the ones shown in the example below, are inherited, or genetic, while others are not.
Genetic Trait Examples
Widow’s Peak
Roll Tongue
Cleft Chin
Attached Earlobe
Interview each member of your family (and any friends an neighbors you want to include as well). Fill in the physical traits for each person in the grid on the next page. (The “Maria” entry is an example.)
Name Attached earlobe Dimples Eye
color Widows Peak Freckles
No Yes Brown No Yes Brown Yes Straight Right No
TEACHER HANDOUT MORE ALIKE THAN DIFFERENT
1
EXPLORE Build a Bird
Learning Objectives: After completing this activity, students will be able to:
• Explain that every organism has unique traits that are specified by their DNA. • Explain that DNA contains information in segments called genes and differences in the DNA cause
differences in traits. Materials Needed: Paper bags (or other containers) Paper Crayons or colored pencils Scissors Procedure: 1. Prior to class, make copies of the DNA segments and cut up the segments for each trait. Put the segments into
8 paper bags (or other container) from which the students will randomly draw. Label the bags with the name of the trait it contains. Students will place their segments back in the bag so you can laminate to reuse for multiple classes.
2. Introduce the activity by recalling the Is it Genetic? activity in which students surveyed friends and family for different traits. In this activity we will see how DNA determines an organism’s traits.
3. Read the beginning paragraph on the student handout as a class. You may want to show them a sample piece
of DNA. For example TCTGAGTTCTTACTTCGAAGG is a small part of a gene that is involved in determining eye color in humans. Most genes have hundreds or thousands of nucleotide bases (letters) and most traits are determined by more than one gene.
4. Review the instructions on the student handout and allow them to work in pairs. When students have
finished, have them hang their bird drawings on the wall along with the DNA that describes their traits so everyone can see.
5. After all the birds are complete, lead a class discussion.
a. Compare the birds created by the class to note similarities and differences. Are any two birds alike? Point out that every bird shares some traits in common with others, but each has an overall combination of traits that is unique. Variations in each DNA strand (the sequence of letters) lead to different traits.
2
b. Revisit Engage Activity 2. Do the birds have more in common with each other or with a human or banana? For example, while the birds might have different looking beaks, they all have beaks but humans and bananas don’t have beaks. How different do the students think the birds are from each other?
Remind students that this activity is highly simplified. Genes are much longer than 3 nucleotide bases. Traits are usually determined by more than one gene. However, genes are always found in the same place in the bigger DNA sequence (called a chromosome) just like each bird has their traits in the same order on their DNA sequence or chromosome. Humans have 23 pairs of chromosomes with over 2,000 genes. Their birds have 1 chromosome with just 8 genes.
Body Size
Beak
Neck
Color
Legs
Feet
Tail Shape
Wingspan
EXPLORE
Build A Bird
The instruction manual for all organisms is written with an alphabet called DNA. The DNA alphabet has just 4 letters that are arranged in words and sentences to describe the different traits of the organism. Those sentences are called genes. Differences in the sentences or genes cause differences in the traits of the organism.
Materials Needed: Student Handout Paper Crayons or colored pencils Scissors Procedure: 1. Draw one paper from each bag to assemble the DNA for your bird. Make sure to write each gene in the
appropriate space at the bottom of the page and return the paper to the bag. 2. Use the DNA Trait Key to figure out each of the bird’s traits based on its DNA sequence or genes. Circle the
sequence you drew from the bag for each trait. 3. Make a drawing of your bird with all of these traits on a blank piece of paper. Cut off the DNA sequence below
and attach it to your drawing. 4. Hang the drawing on the wall. Is your bird different from or the same as other birds in your class? Build a Bird DNA
Body Beak Neck Color Legs Feet Tail Wingspan
DNA Trait Key Trait
Beak ATC / Long and pointy
ACC / Short and pointy
ATA / Short and hooked
Color CAT / brown TAT / red CAG / multi colored
Legs CGG / short TGG / medium GGG / long
Feet TAG / webbed AAG / talons TAC / perching
Tail Shape ACT / forked ACG / fanned CCT/ pointed
Wingspan ATG / small TTG / medium GTG / wide
Body Size
Beak
Neck
Color
Legs
Feet
Tail Shape
Wingspan
1
EXPLORE DNA Extraction
Summary: In this activity, students will extract DNA from banana cells.
Learning Objectives: After completing this activity, students will be able to:
• Describe the process for removing DNA from cells
• Practice measuring substances and following a laboratory protocol.
Materials Needed: Distilled Water
Shampoo or dish soap
Coffee filters
Rubber bands
Ziploc bags
Bamboo sticks, large toothpicks, or glass rods
Procedure: 1. Prior to class mix the extraction buffer. Combine 900 ml of water, 100 ml of shampoo and 2 teaspoons of
salt in a bottle. Slowly stir or invert the bottle to mix without creating bubbles from the soap.
2. Students should follow the instructions and answer the questions on the DNA Extraction worksheet.
When they add ethanol to the banana extract they will see fine white strands of DNA precipitate. The
DNA fibers can be pulled out and spooled onto the bamboo stick.
3. (Optional) Use magnifying glasses or a microscope to inspect the DNA more closely.
4. (Optional) DNA can also be extracted from human cheek cells using the same method on a smaller scale.
Details are at https://www.pbs.org/wgbh/nova/teachers/activities/2809_genome.html
2
*Freezing the bananas and then thawing weakens the cell walls making it easier to extract more DNA. You can peel and freeze the bananas halves in Ziploc bags to make distributing the bananas and bags easier and less messy.
Activity Background from NOVA Teachers: Cracking the Code of Life, See Your DNA
DNA is only about 50 trillionths of an inch long. The reason it can be seen in this activity is that
students are releasing DNA from a large number of cells. This happens when the detergent or
dishwashing liquid breaks, or lyses, the membranes around the cell and around the nucleus.
Once released, the DNA from the broken open cells intertwines with DNA released from other
cells. Eventually, enough DNA intertwines to become visible to the eye as whitish strands. Tell
students that one strand of DNA is so thin (.0000002mm) they would never be able to see it
without using a microscope.
Detergents break open cells by destroying the fatty membrane that encloses them. This releases
the cell contents, including DNA, into the solution. Detergents also help strip away proteins that
may be associated with the DNA.
DNA is not soluble at high ethanol concentrations, so it precipitates out as long strands. Salts,
such as sodium chloride, also greatly aid in precipitating DNA. The ethanol also causes gases
dissolved in the water to be released, which may be observed as small bubbles.
EXPLORE
DNA Extraction
The long, thick fibers of DNA store the information for creating all living things. DNA is found in every cell of plants and animals. The DNA in banana cells can be extracted using common materials. We will use an extraction buffer to gain access to the DNA inside the banana cells. The extraction buffer contains soap to dissolve the banana cell wall and nuclear membrane so the DNA can get out of the cells.
Salt in the extraction buffer breaks up protein chains that bind around the nucleic acids so the DNA strands can clump together and we can see them. Finally, ethanol is added to the mixture. DNA can’t dissolve in ethanol so it clumps together and can be pulled out to inspect more closely. Before the Lab
1. What do you think the DNA will look like?
2. Where is the DNA in the banana?
Materials
• Extraction buffer • Half of a frozen and thawed banana • Ziploc Bag • Coffee filter • Rubber band • Ethanol • 250 ml beaker • Bamboo stick or glass rod
Procedure
1. Place the banana in the Ziploc bag and seal it completely
2. Smash up the banana with your hands for 2 minutes. Be careful not to break the bag!
3. Add 10mL of extraction buffer (salt and soap solution) to the bag.
4. Gently mush the banana with the extraction buffer in the bag again for 5 minutes.
5. Use the rubber band to attach a coffee filter to the top of the 250 ml beaker. Leave the filter loose so it can hold all of the banana mixture in the bag.
6. Slowly pour the banana slurry into the filter and let it drip directly into your
250ml beaker. Clean up your lab station while you wait.
7. Once all the liquid is in the beaker, remove the filter and throw it away. Measure out 20 mL of ethanol. Tilt the beaker and pour the cold ethanol down the side so it stays on top of the banana slurry.
8. Write and draw what you see.
9. Dip the stick or glass rod into the beaker where the banana slurry and ethanol layers come into contact with each other and twist it to pull up the white strands.
10. Write and draw what you see.
How does this compare to what you expected the DNA to look like?
Conclusions Describe in your own words how each step helps remove DNA from the cells so you can see it.
1. Mush the banana.
3. Filter banana slurry
4. Add ethanol If I put one grain of sand on your desk and asked you to stand across the room, you would have a hard time seeing it. But if I dumped an entire bag of sand on the desk you’d have a much easier time observing it from your position on the other side of the room. How does this story relate to the activity?
1
EXPLORE Modeling DNA
Summary: In this activity, students will create a model of DNA they can wear and compare genetic sequences. Learning Objectives: After completing this activity, students will be able to:
• Describe the shape of DNA and how information is stored. • Explain how DNA sequences for different organisms can be similar.
Materials Needed: String Beads in 4 different colors (60 for each student)* Needles (depending on the size of the beads) *The DNA sequences are 30 bases long in 3 sections. If you wish to use fewer beads, use one or two sections instead of all 3. Procedure:
1. Prior to class, prepare the string by cutting 12-inch lengths and tying two strings together at one end. You should prepare a pair of strings for each student.
2. Introduce the activity by reviewing the information at the top of the Modeling DNA Student Handout. a. First point out the picture of a DNA molecule. DNA stands for Deoxyribonucleic acid. Point out
that the double helix shape is described as a twisted ladder. The sides of the ladder that give it structure are made of phosphates. The information in the molecule is stored in the rungs of the ladder where two nucleotide bases connect. In this model we will focus on the bases that make up the rungs of the ladder.
b. There are 4 different nucleotide bases, adenine (A), thymine (T), guanine (G) and cytosine (C). The order of these bases is what determines DNA's instructions, or genetic code. Human DNA has around 3 billion bases. In DNA, adenine (A) always connects to thymine (T), and guanine (G) always connects to cytosine (C). And the bases always come in pairs.
3. Ask students to choose the animal whose DNA they would like to model. Then fill in the corresponding
base pairs and follow the instructions for making the model on the handout.
2
4. After completing the models, students will find a partner with a different organism. They will compare
their models (or the sequences used to make them), to determine how many of the pairs are the same and how many are different. For example, humans and chimpanzees only have three pairs that don’t match on this particular sequence. They can then calculate how much of the DNA is in common by dividing the number of pairs in common by the total number of pairs (in this activity, 30). So humans and chimpanzees are 27/30 or 90% similar. After sharing results, ask how similar they think their own personal DNA sequence for this piece of gene is to their partner’s own personal DNA. The answer is 100% because they are both human!
EXPLORE
Modeling DNA
In this activity you will make a model of DNA that you can wear as a bracelet or necklace. DNA has a twisted ladder shape. The information is stored in two nucleotide bases, or base pairs, that make up the rungs of the ladder. The base pairs are adenine (A) and thymine (T), and cytosine (C) and guanine (G). The pairs are always AT, TA, CG or GC. These four combinations contain all the information needed to make you. There are 3 billion base pairs in the human genetic sequence or genome. The DNA sequence in this activity is from the cytochrome b gene found in many animals and plants. This gene creates proteins that help to release energy from food. All living things get energy from food in the same way, so this gene is found in most animals and plants.
Materials
Procedure
1. Choose the organism you will use from the last 2 pages of this document.
2. Decide which color beads will represent the bases A, T, C and G.
3. String the beads on to the strings in the order of the genetic sequence for your animal. One string will contain the sequence given above and the other will have the corresponding pairs that you wrote in below. Be very careful to put the beads on the string in the correct order.
4. When all the beads are on the strings, twist them to resemble the twisted double helix and tie the ends together to create a bracelet or necklace.
5. Find a partner with a different organism. Compare the genetic sequence on your DNA models (or using the printed sequences above). How many pairs are the same and how many are different? There are 30 base pairs in each sequence. Organism 1 __________________________________________ Organism 2 __________________________________________ # of Same base pairs = _______________ # of Different base pairs = _______________
6. How similar are the two organisms based on the cytochrome b gene? (# of Same base pairs / 30 ) x 100 = _________________%
Follow-up
1. Describe and draw the shape of the DNA molecule?
2. Where information is stored in the DNA molecule?
3. How many different bases are needed to store all genetic information?
4. Name the bases and show how they connect to each other.
5. Why do different organisms have the same (or similar) genes?
Choose your organism. From Step 1 of procedure: Which organism will you use for your DNA model? Fill in the corresponding
bases to complete the base pairs.
HUMAN atgaccccaa tacgcaaaat taacccccta ---------- ---------- ---------- CHIMPANZEE atgaccccga cacgcaaaat taacccacta ---------- ---------- ----------
GRIZZLY BEAR
atggccccca acatccgcaa gtcccaccct
EXPLAIN
How Are We Alike? (Part 2)
Earlier in the lesson you compared a banana, a chicken and a human. This time you will compare yourself to a lab partner. Brainstorm with your lab partner about what you have in common and what is different. For example, you both have hair, but it might be a different color.
You & Your Lab Partner Both have… Only a banana has… Only a chicken has…
EXTEND
Applications of DNA in Technology
Now that scientists completely understand the purpose and structure of DNA they are constantly creating new uses and technologies based on genetics.
1. Choose one of the topics below.
2. Watch the video and explore the links to learn more about how DNA is used as a new tool or technology, its benefits and its problems.
3. Create a poster, infographic, or digital presentation that answers the following 3 questions:
• How does the tool or technology work?
(Do not worry about specific details. You can describe the process generally.)
• How is DNA involved?
• What are potential problems?
Video Precision Medicine http://science.unctv.org/content/precision-medicine Precision medicine is a new way to fight cancer. Scientists use a person’s unique genetic makeup to develop an individualized treatment plan to target cancer cells. Resources
• DNA on Drugs https://www.theglobeandmail.com/canada/article-dna-on-drugs-how-genetic- tests-could-make-prescriptions-more-precise/
• A Very Personal Problem https://www.scientificamerican.com/article/a-very-personal-problem/
GENETICALLY MODIFIED ORGANISMS
Video New Fields for Food http://science.unctv.org/content/new-fields-food Mary-Dell Chilton's DNA discoveries launched the field of genetically modifying plants to ward off pests, use less water, and improve yields. Supporters say it could help feed the world. Opponents say it's not safe, threatening the environment and people in ways that may not be known yet. By discovering the mechanism of DNA transfer, Chilton bestowed that power to humans. Resources
• Spider Silk http://science.unctv.org/content/spider-silk • GMOs: What they are, are they safe and which foods have them
https://www.cnet.com/news/gmos-what-they-are-are-they-safe-and-which-foods-have-them/ • What are GMOs and GM Foods? https://www.livescience.com/40895-gmo-facts.html • GM Crops Advantages and Disadvantages https://www.agrifarming.in/gm-crops-advantages-and-

standards alignment north carolina essential standards

Documents

South Carolina Well Standards

Overview Of Standards Based Curriculum Alignment

Common Core State Standards Alignment - FIRST

STANDARDS ALIGNMENT DOCUMENT for TRANSITIONAL …

ELEMENTARY STANDARDS ALIGNMENT TEAM Standards Transformation and Realignment in Thompson

North Carolina Essential Standards for Social Studies ...€¦ · North Carolina Essential Standards for Social Studies ... Carolina Essential Standards for Social Studies, ... Analyze

SPARK Alignment with CA Physical Education Standards Grade 6sparkpe.org/standards/CA standards - Middle School only.pdf · SPARK Alignment with CA Physical Education Standards

North carolina teaching standards

Common Core State Standards & North Carolina Essential Standards

North Carolina Professional Teaching Standards · North Carolina Professional Teaching Standards Commission to align the Core Standards for the Teaching Profession ... Carolina Professional

New Hampshire Standards Alignment Kindergarten through

South Carolina Standards Alignment Prekindergarten through …doc.renlearn.com/KMNet/R004177128GH5A8C.pdf · 2010-09-24 · We hope this report answers your questions regarding the

Standards Alignment - Code.org

Math Alignment: Florida’s Standards and SAT

South Carolina Mathematics Standards for Algebra 1 · PDF fileSouth Carolina Mathematics Standards for Algebra 1 ... Project with Rubric Cumulative ... South Carolina Mathematics Standards

Montana Standards Alignment 2009 ... - doc.renlearn.com

Module 5: “Alignment to Standards

Alignment with emerging Web Service Standards

WIDA Standards and ESL Curriculum Alignment• Adoption into administrative code 1998 • Alignment to NJ LAL Standards 1999 • Alignment of NJLAL Standards to Goal 2 of TESOL Standards—2003---

Alignment to Academic Standards - East Carolina …mast.ecu.edu/modules/tsess/lib/documents/Good_Vibrations.pdfActivity Plan: Good Vibrations (i.e., Recognizing Vibrations Are Transferred

Connecticut Standards Alignment: Preschool Curriculum Framework, Kindergarten Science ... · · 2012-07-02Connecticut Standards Alignment: Preschool Curriculum Framework, ... Development

Standards Alignment MN France

Standards Alignment

Alignment with California Content Standards

South Carolina science standards

Pennsylvania Standards Alignment Prekindergarten through

Alignment of KANSAS’S...Early Learning Standards with Matrix showing the alignment between The Carolina Curriculum Items and the Kansas Early Learning Standards Early Skills LevelApproaches

ELEMENTARY STANDARDS ALIGNMENT TEAM

What Does Alignment to Academic Standards Mean? · What Does Alignment to Academic Standards Mean? ... Chapter 1 • What Does Alignment to Academic Standards Mean? 9 ... Write narratives

FLORIDA SCIENCE STANDARDS K-5 GRADE-LEVEL STANDARDS AN ALIGNMENT … · 2011-10-10 · florida science standards . k-5 grade-level standards . an alignment with polk county textbooks

Alignment to State Standards: Mississippi Math Standards

1 Alignment of Standards, Large-scale Assessments, and Curriculum: A Review of the Methodological and Empirical Literature Meagan Karvonen Western Carolina

Science Standards Alignment

Curriculum Alignment Pre-Kindergarten Standards

Evaluating Alignment in Large-Scale Standards-Based ... Evaluating... · Evaluating Alignment in Large-Scale Standards-Based Assessment Systems EvALuAting ALignmEnt in LArgE-SCALE