stimulation of de novo telomere addition by the rap1 ... · stimulation of de novo telomere...
TRANSCRIPT
![Page 1: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere](https://reader034.vdocuments.net/reader034/viewer/2022042301/5eccbc16a0af283cb577063e/html5/thumbnails/1.jpg)
Shyam Murali Mentor: Dr. Katherine Friedman
Stimulation of de novo telomere addition by the Rap1 protein of
yeast
![Page 2: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere](https://reader034.vdocuments.net/reader034/viewer/2022042301/5eccbc16a0af283cb577063e/html5/thumbnails/2.jpg)
CEN
W W W
Correct repair Incorrect repair GCR
Telomere addition
Translocation/deletion Resume cell cycle
Sequence loss
“Damage tolerance” De novo
Fates of a double-stranded break
Image from Dr. Friedman
No repair Resection
Cell death
![Page 3: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere](https://reader034.vdocuments.net/reader034/viewer/2022042301/5eccbc16a0af283cb577063e/html5/thumbnails/3.jpg)
Telomeres
• Repetitive sequence at the end of chromosome
• Protect ends of chromosome from “end-replication” problem and chromosome fusion
• TG- and Protein-rich
• Telomerase
![Page 4: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere](https://reader034.vdocuments.net/reader034/viewer/2022042301/5eccbc16a0af283cb577063e/html5/thumbnails/4.jpg)
Telomere Hotspot
• Chromosome V – Saccharomyces cerevisiae
8.4 kb 83 bp Highly TG-rich Rap1 binding site
Essential WWW Hotspot HO HYGR URA3
3 kb
Image from Kati Turner
![Page 5: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere](https://reader034.vdocuments.net/reader034/viewer/2022042301/5eccbc16a0af283cb577063e/html5/thumbnails/5.jpg)
HO Endonuclease Assay
8.4 kb 83 bp Highly TG-rich Rap1 binding site
Essential WWW Hotspot HO HYGR URA3
3 kb
GAL10 HO
Image from Kati Turner
![Page 6: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere](https://reader034.vdocuments.net/reader034/viewer/2022042301/5eccbc16a0af283cb577063e/html5/thumbnails/6.jpg)
Multiplex PCR Centromere proximal Telomere proximal
WWW
PCM1 URA3 HS
*
HO HYGR
Hotspot
Image from Kati Turner
![Page 7: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere](https://reader034.vdocuments.net/reader034/viewer/2022042301/5eccbc16a0af283cb577063e/html5/thumbnails/7.jpg)
Telomere Hotspot
• Chromosome V – Saccharomyces cerevisiae
5’ –GGATGTAGGATGAGTTGGTGTGGTGTTACTACTAGGATTTGGCGTGGATGAAGGACCTGCAGTGGAGGGTGTTGTTGTGGAGTT- 3’
AAAAAAAAAAAAAAAAAA
Essential WWW HS HO
HYGR URA3
Rap1 Binding Site
PolyA Mutation
Image from Kati Turner
![Page 8: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere](https://reader034.vdocuments.net/reader034/viewer/2022042301/5eccbc16a0af283cb577063e/html5/thumbnails/8.jpg)
Preliminary HO Endonuclease Assay Data
![Page 9: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere](https://reader034.vdocuments.net/reader034/viewer/2022042301/5eccbc16a0af283cb577063e/html5/thumbnails/9.jpg)
Rif1 Rif2 TLC1
Est2
Rap1
The Rap1/Rif1/Rif2 complex has different effects
TLC1
Est2 +
Centromere Telomere HOTSPOT
Rap1 Rap1 Rap1 Rap1
Rif1 Rif2
Rap1
ENDOGENOUS TELOMERE
Image from Dr. Friedman
![Page 10: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere](https://reader034.vdocuments.net/reader034/viewer/2022042301/5eccbc16a0af283cb577063e/html5/thumbnails/10.jpg)
Gal4 UAS Project: Important Objectives
• Is Rap1p sufficient for telomere addition at the hotspot?
• Determine which proteins, or protein domains, are required for de novo telomere addition
• Hypothesis:
• Rap1p is sufficient for telomere addition
• Rap1p C-terminus is sufficient
![Page 11: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere](https://reader034.vdocuments.net/reader034/viewer/2022042301/5eccbc16a0af283cb577063e/html5/thumbnails/11.jpg)
How will we do this?
![Page 12: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere](https://reader034.vdocuments.net/reader034/viewer/2022042301/5eccbc16a0af283cb577063e/html5/thumbnails/12.jpg)
![Page 13: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere](https://reader034.vdocuments.net/reader034/viewer/2022042301/5eccbc16a0af283cb577063e/html5/thumbnails/13.jpg)
UAS Sequence creation and integration
• Created a new strain
– JRL017 91-2 Rap1BS [UAS] Hxt13::URA3
• Used PCR to create constructs and cloned into pRS306
Rap1 Binding site UAS Mutation
TG rich (telomere-like)
HindIII
XbaI
XbaI
HindIII
Image from Jacob Seloff
![Page 14: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere](https://reader034.vdocuments.net/reader034/viewer/2022042301/5eccbc16a0af283cb577063e/html5/thumbnails/14.jpg)
Two-Step Integration
Plated On 5-FOA
URA3
1.
2.
BamH1 Cut Site
URA3
-Mutated Hotspot
-Deleted Hotspot
URA3
Image from Jacob Seloff
![Page 15: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere](https://reader034.vdocuments.net/reader034/viewer/2022042301/5eccbc16a0af283cb577063e/html5/thumbnails/15.jpg)
UAS strain Gal Assay
• Expectation: replacement of Rap1p binding domain should yield results similar to Rap1BS PolyA Mutant
![Page 16: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere](https://reader034.vdocuments.net/reader034/viewer/2022042301/5eccbc16a0af283cb577063e/html5/thumbnails/16.jpg)
Integration of Gal4 DBD constructs
1. Gal4 DBD (alone)
2. GBD+Rap1 fusion
3. GBD+Rap1c fusion
Only C-terminus of Rap1
How?
1. Clone GBD constructs into pRS304 (integrative) and pRS314 (centromeric)
2. Transform into UAS strain of yeast
3. Confirm Integration
4. Perform HO Endonuclease Assay
![Page 17: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere](https://reader034.vdocuments.net/reader034/viewer/2022042301/5eccbc16a0af283cb577063e/html5/thumbnails/17.jpg)
Southern #1 – GBD Probe
![Page 18: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere](https://reader034.vdocuments.net/reader034/viewer/2022042301/5eccbc16a0af283cb577063e/html5/thumbnails/18.jpg)
Southern #2 – TRP1 Probe
Ho
t 1
kb la
dd
er
Λ
+φx
DN
A m
arke
r H
ot
1kb
lad
de
r H
ot
1kb
lad
de
r G
BD
+Rap
1C
#6
W
ild-T
ype
GBD only GBD+Rap1
![Page 19: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere](https://reader034.vdocuments.net/reader034/viewer/2022042301/5eccbc16a0af283cb577063e/html5/thumbnails/19.jpg)
Future Goals
• Western Blot
• If GBD constructs have correct expression HO Endonuclease Assay
• Disparity between Positive (at hotspot) vs. Negative (at telomeres) regulation of telomerase by Rap1p. Why?
• Does number matter?
• Multiple UAS sites for more Rap1 recruitment
• Rif1p/Rif2p fusion?
![Page 20: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere](https://reader034.vdocuments.net/reader034/viewer/2022042301/5eccbc16a0af283cb577063e/html5/thumbnails/20.jpg)
Does the number of Rap1 molecules matter?
![Page 21: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere](https://reader034.vdocuments.net/reader034/viewer/2022042301/5eccbc16a0af283cb577063e/html5/thumbnails/21.jpg)
Caveat - Directionality
• Directionality of Rap1p
• Use other non-hotspot Rap1p binding sites
![Page 22: Stimulation of de novo telomere addition by the Rap1 ... · Stimulation of de novo telomere addition by the Rap1 protein of yeast. CEN WW W Incorrect repair GCR Correct repair Telomere](https://reader034.vdocuments.net/reader034/viewer/2022042301/5eccbc16a0af283cb577063e/html5/thumbnails/22.jpg)
Acknowledgements
• Lab Members:
• Dr. Katherine Friedman
• Margaret Platts
• Udo Obodo
• Ann Ding
• Kati Turner
• Laura Bechard
• Charlene Hawkins
• Committee Members:
• Dr. Woelfle
• Dr. Rokas
• Honors Program Coordinator
• Dr. Patton
• Beckman Scholars Program
• Dr. Johnston