superoxide dismutase mrna and protein level in human colorectal cancer

Central European Journal of Biology

* E-mail: hanna.czeczot.wp.pl

Research Article

Received 29 September 2009; Accepted 17 May 2010

Keywords: SOD isoenzymes • Expression • Oxidative stress • Colorectal cancer • Metastases

Chair and Department of Biochemistry, Warsaw Medical University, 02-097 Warsaw, Poland

Michał Skrzycki, Monika Majewska, Hanna Czeczot*

Superoxide dismutase mRNA and protein level in human colorectal cancer

Abstract: Impairments of antioxidant enzyme expression are often concomitant with the onset of cancer. Due to epigenetic factors causing an inflammatory state the gastrointestinal tract can become exposed to reactive oxygen species. The purpose of our work was to evaluate mRNA and protein levels of superoxide dismutase isoenzymes in human colorectal adenocarcinoma due to its clinical advancement, and in colorectal cancer liver metastases. Evaluation of SOD expression in regard to CRC advancement, seems useful for clinical applications due to different tumor cells sensitivity to reactive oxygen species based treatment. Studies were conducted on a group of 27 patients: 15 diagnosed with colorectal adenocarcinoma and 12 diagnosed with colorectal cancer liver metastases. The mRNA level was determined by RT-PCR, and protein level by Western blotting. We observed significant (P≤0.05) changes of mRNA and protein level of SOD isoenzymes in subsequent stages of colorectal adenocarcinoma advancement and in colorectal cancer liver metastases. Differences in mRNA and protein level of SOD isoenzymes in colorectal adenocarcinoma and its liver metastases indicates that SOD participate in adaptation of tumor cells to oxidative stress, and maintain certain level of ROS, necessary for appropriate cell proliferation. Expression of superoxide dismutase isoenzymes seems to be regulated not only at transcriptional level, but also posttranscriptional.

1. IntroductionColorectal cancer (CRC) is the second most common cancer in developed countries [1,2] and has one of the highest levels of malignant cancer related mortality. The molecular basis for CRC includes accumulation of various mutations and genetic alterations in normal cells. There are three pathways of mutation events leading to CRC: the Chromosomal Instability, the Microsatellite Instability, and the Methylator pathway [3-5]. Cancerous phenotypes must develop conditions permissive to mutations allowing for the progression of cancer. This process of genomic instability ensures that subsequent mutations occur at progressively greater chance [6]. The reasons for genetic instability might be congenital (i.e. Lynch syndrome) or epigenetic. Numerous epigenetic factors such as chemical compounds, bacteria, viruses, parasites, food antigens threaten the digestive tract [7-10].

Exposition of the digestive tract to epigenetic factors can lead to an inflammatory state. Inflammation is often accompanied by oxidative stress and, consequently,

by generation of large amounts of reactive oxygen species (ROS). In general, phagocytosing neutrophils activated by inflammation produce toxic amounts of ROS, which act as bactericidal and cytotoxic agents. ROS, particularly hydroxyl radical - HO*, are known to be DNA damaging agents. Hydroxyl radicals modify pyrimidines mainly in position C5 and C6 and purines in positions C4, C5 and C8 [11,12]. Oxidation of deoxyribose leads to single and double breaks in DNA chain. Modified products of nitrogen bases oxidation (8-hydroxyguanine, 8-hydroxyadenine, thymine glycol) act as mutagens, causing base pair substitutions (mainly transversions G-C and A-T) and frameshifts [13]. Repeatable cycles of DNA damage and repair can lead to the onset and accumulation of mutations. In time, it could cause dysplasia, which by acquiring further mutations could transform into invasive cancer. ROS are therefore important factors that might strongly contribute to increase genetic instability of cells.

Superoxide dismutase (SOD) protects and preserves cells against oxidative stress and damage caused by ROS. SOD is the key enzyme that eliminates

© Versita Sp. z o.o.

590

Cent. Eur. J. Biol.• 5(5) • 2010 • 590-599DOI: 10.2478/s11535-010-0054-9


ROS by scavenging O2- from precursor of all ROS.

Human cells have three isoforms of SOD including cytosolic (CuZnSOD; SOD1), mitochondrial (MnSOD; SOD2) and extracellular (EC-SOD; SOD3) [14,15]. The unique function of SOD in detoxification of ROS suggests that this enzyme participates in initiation and progression of cancer. Initial studies on the role of SOD in cancer suggested that in numerous types of tumors, SOD1 activity was unchanged or more often decreased, and SOD2 had decreased activity or was not present [16]. This work also pointed out the role of superoxide anion in induction of cancer. Damage done by increased amounts of O2

- resulting from loss of SOD activity or from altered O2

- generation rate leads to appearance of cancerous phenotype in cells. Therefore, the rise of superoxide anion level has greater significance for cancer development, than the loss or decrease of SOD activity [16]. Increased level of superoxide anion in tumor cells is one of the major features of tumor cell metabolism [17]. Many authors found increased activity of both SOD isoenzymes (SOD1 and SOD2) in tumors (particularly in adenocarcinoma type), however others confirmed low activity of SOD in tumors [18-21]. Discrepancies might result from studies conducted in different stages of tumor clinical advancement. Another explanation is that superoxide anion might damage the active site of SOD lowering its activity [22]. It is therefore necessary to study the level of expression of SOD isoenzymes in regard to stage of tumor advancement and differentiation. Clinical value is another reason for assessment of SOD in different stages of tumor clinical advancement or differentiation. SOD might be useful as a tumor disease marker, reflecting changes of cancer cell redox state. Numerous anticancer drugs rely on

generation of lethal amount of ROS in cancer cells. Since SOD is a key antioxidant enzyme, differences of its level might be responsible for sensitivity of cancer to anticancer drugs. Determination of SOD level in the particular stage of cancer development could support estimation of exact dose and moment of anticancer drugs application.

In this paper we determine the expression of SOD isoenzymes in human CRC and in colorectal cancer liver metastases. We evaluated mRNA and protein level of SOD isoenzymes (SOD1, SOD2) in subsequent stages of human colorectal adenocarcinoma clinical advancement (Union Internationale Contra le Cancer, UICC), including its liver metastases.

2. Experimental Procedures2.1 SamplesTumor specimens were obtained from 27 patients, mean age 62±9.7 (range 44-82), operated on for colorectal adenocarcinoma (CRC) or colorectal cancer liver metastases (CRCLM) at the Department of General, Gastroenterological Surgery and Nutrition, in Department of General, Transplantation and Liver Surgery, and in Department of General and Transplantation Surgery at Medical University of Warsaw. There were 15 subjects with colorectal adenocarcinoma, and 12 with metachronous colorectal cancer liver metastases. The time since diagnosis of cancer varied from 3 weeks to 2 months. Patients were nonsmokers, and not treated by radio- or chemotherapy before surgery (Table 1).

Studies were approved by the Bioethics Committee of the Warsaw Medical University (decision

Colon cancer Metastases

Number of patients 15 12

Gender (male/female)(n/n) 8/7 5/7

Mean age (years) 62 ± 9.7 58.4 ± 10.8

Age range (years) 44-82 44-82

Diagnosis Colorectal adenocarcinoma Colorectal adenocarcinoma metachronous liver metastases

Staging (n) (UICC) II(6); III(5); IV(4) n/a

Grading (G) G2(15) n/a

Control Normal colon adjacent to colorectal cancer * n-15 Normal colon adjacent to colorectal cancer * n-15

Table 1. Characteristics of studied subjects.

* - Since control tissues are adjacent to cancers, number, age and gender proportions are the same as the cancer tissue.

591

M. Skrzycki et al.

KB/164/2001), and informed consent was obtained from all patients.

Control for CRC and CRCLM was normal mucosa (15 patients). Cancer specimens were taken by surgery, and normal mucosa (control tissue) was histologically examined and taken from corresponding adjacent tissue more than 6-7 cm away from tumor border. Evaluation of colorectal cancer clinical advancement complies such cancer features like: size, penetration of colon tissue and outside, lymph nodes and vascular invasion, ability to distant metastases. Those features allow for the precise set of clinical advancement stage, according to classification UICC (Union Internationale Contre le Cancer) based on TNM (Tumor, Node, Metastases) division. There was 6 patients with stage II, 5 with stage III, and 4 with stage IV. We were unable to get samples from patients with stage I of UICC. The grade of differentiation (G1-G3) of cancer cells was also histologically evaluated, however all colorectal adenocarcinomas were in G2 grade.

2.2 Samples preparationDirectly after surgery, tissue specimens were washed in 0.9% NaCl and stored frozen at –70°C to –80°C. Tissues were cut to100 mg and homogenized in 1 ml of TRI reagent. Chloroform (0.2 ml) was added to each sample and RNA precipitated by isopropanol followed by freezing at -70°C for 24 h. The pellet was washed with 75% ethanol and dissolved in H2O containing diethyl pyrocarbonate (DEPC). Protein was precipitated from the organic phase by isopropanol, and then washed 3 times with 0.3 M guanidine chloride and once with ethanol. The pellet was vacuum dried and then dissolved in 1% SDS in water. RNA and protein extracts were used to determine SOD1 and SOD2 mRNA and protein level.

2.3 Biochemical analysis2.3.1 Determination of superoxide dismutase mRNA levelFor, reverse transcription the mixture containing 1 μg of DNaseI-treated RNA and 0.25 mM of oligo(dT)15 primer (Sigma-Proligo) was preheated at 70°C for 5 min to denature secondary structures and then chilled on ice. RNA was reverse transcribed in a 20 μl reaction m ixture containing 0.2 mM dNTPs, 1 mM DTT, 2 U/ml RNase inhibitor and 10 U/ml M-MLV reverse transcriptase (Fermentas). The mixture was incubated at 42°C for 60 min and then heated at 70°C for 10 min.

Fragments of SOD1 and SOD2 genes were amplified using PCR. Primers for SOD1 were 5’CCTAGCGAGTTATGGCGACG 3’ (sense) and 5’CAACATGCCTCTCTTCATCC 3’ (antisense) and for SOD2 were 5’AACCTCACATCAACGCGCAG 3’

(sense) and 5’CCAACAGATGCAGCCGTCAG 3’ (antisense). Primers were designed to be a single, base paired band, without hairpins, and span an exon-exon boundaries. Product sizes were 258 bp for SOD1, and 307 bp for SOD2. The reaction mixture contained: 1.0 mM MgCl2, 1 mM primer pairs, 0.2 mM dNTPs,1 U/ml Taq DNA polymerase.

The PCR cycle consisted of initial denaturation: 94°C for 3 min, and 30 cycles of denaturing: 94°C for 1 min, annealing 54.2°C for SOD1, 56.4°C for SOD2, and 55°C for b-2 microglobulin, all for 1 min and extension: 72°C for 2 min. At the end of the 30 cycles, reactions were heated 72°C for 4 min, and cooled to 4°C. Reaction was conducted in MJ RESEARCH thermocycler (PCT 200 DNA ENGINE).

The level of mRNA was measured densitometrically using UVI - KS 4000 I camera and programs Scion – Image and ZERO – DSCAN (Syngen Biotech). Optical density (OD) values (measured in UV light) of SOD1 and SOD2 mRNA were compared with OD of b-2 microglobulin mRNA yielding semi quantitative units of SOD1 and SOD2 mRNA level (Figure 1).

2.3.2 Determination of superoxide dismutase protein levelProtein levels of SOD1 and SOD2 were determined using Western blotting technique. Immunoelectrophoretic determination of SOD isoenzymes was performed by separation of the samples prepared according to Lowry method [23] on a 14% polyacrylamide gel containing 0.1% SDS. This was followed by semi-dry electrotransfer on PVDF membrane. To block non-specific binding, the PVDF membrane was preincubated with TTBS buffer (Tris buffered saline, pH 7.6, containing 0.05% Tween-20 and 10% nonfat milk) for 1 h. The membrane was then incubated with antibodies anti-SOD1 or anti-SOD2 for 1.5 h in RT. After incubation, the membrane was washed with TTBS buffer and then incubated with secondary antibodies conjugated with horseradish peroxidase. The bound antibodies were detected by chemiluminescence by means of a ECL kit (Amersham Life Sciences).

Proteins were measured densitometrically and expressed as optical density values (OD- in visible light) referred to relative density of protein band. Measurement of optical density were taken with a UVI - KS 4000 I camera and data analysed using Scion – Image and ZERO – DSCAN (Syngen Biotech).

Policlonal antibodies anti-SOD1 and anti-SOD2 were purchased from Calbiochem, and diluted 1:2000 or 1:500 respectively. The presence of SOD1 in examined biological material was confirmed with use of protein standards of purified SOD1 enzyme from human erytrocytes. Presence of SOD2 protein was confirmed on the basis of known subunit

592


Figure 1. PCR for SOD isoforms in a) colorectal cancer (CRC), and b) colorectal cancer liver metastases (CRCLM). RNA isolated from tissue specimens was used to RT-PCR reaction. DNA for SOD1, SOD2 and b2-microglobulin genes was amplified by PCR and detected on agarose gel electrophoresis. Frames mean separate parts of gels.

Figure 2. Western Blots for SOD isoforms in a) colorectal cancer (CRC), and b) colorectal cancer liver metastases (CRCLM). Proteins isolated from tissue specimens were separated by SDS-PAGE and transferred to a PVDF membrane. Primary antibodies were anti SOD1, anti SOD2 or anti b-actin. Protein was detected by photochemical reaction of horse radish peroxidase. Frames mean separate parts of gels.

593

M. Skrzycki et al.

molecular weight with use of molecular weight marker Rainbow Colour High Range (Amersham) (Figure 2). To confirm equal load of proteins on gel, after removal of antibodies by striping in reducing buffer, the PVDF membrane was incubated again with antibodies against actin (Santa Cruz).

2.4 Statistical analysis Statistical analysis was conducted using Statistica 6.0 program. Student`s t test, Wilcoxon test, and ANOVA/MANOVA were applied for comparison of variables. Differences were considered significant, if the p value was smaller than or equal to 0.05 (P≤0.05). SOD isoenzymes mRNA and protein level, were presented as mean values and standard deviations (x ± SD). Amount of protein was expressed in optical density values (OD), and level of mRNA as semi quantitative ratio of SOD`s and b-2 microglobulin optical densities.

3. Results3.1 Determination of SOD isoenzymes

expression in colorectal cancer (CRC) and colorectal cancer liver metastases (CRCLM)

The mRNA level of SOD1 in CRC and CRCLM did not differ significantly from the control. SOD2 mRNA level was significantly lower in CRCLM than in CRC and control tissue.

There were no significant differences in protein level of SOD1 in CRC and the control, however SOD2 protein level was significantly lower in CRCLM than CRC and the control (Figure 3 and 4).

3.2 SOD isoenzymes expression in relation to UICC stages of CRC clinical advancement

Classifiers of clinical advancement, known as the UICC system based on TNM division are sensitive for detecting differences in CRC. We evaluated SOD`s mRNA and protein level using ANOVA/MANOVA. This test allows for analysis of data patterns with a single quality predictor, which here is defined as the UICC stage of CRC advancement. Differences between the control and the UICC stages of CRC and differences between each stage were significant (P≤0.05). We compared stage II with control, stage III with stage II, and stage IV with stage III, since they are subsequent events in CRC development.

Changes of mRNA level of both SOD isoenzymes were similar. In stage II, III and IV of UICC, mRNA level was lower than the control. In stage III mRNA level was increased, reaching the highest level.

Protein level of SOD1 and SOD2 was increased in stage II, in stage III protein level of both SOD isoenzymes was decreased and the lowest. In stage IV protein level of SOD1 was almost unchanged comparing with stage III, and SOD2 protein level was increased comparing to stage III and control (Figure 5).

4. DiscussionThe expression of SOD genes is affected by numerous factors. The most important are cytokines, mitogenes, growth factors, lipopolisacharides, phorbol esters, nitrogen oxide, radiation (UV and ionizing), some drugs and toxins. All of those factors cause generation of ROS and their derivatives.

In physiological conditions, SOD is synthesised at constant level. In oxidative stress, expression of SOD increase. SOD synthesis is mainly regulated at the transcription level. In promoter regions of both SOD1 and SOD2 are sequences binding AP-1 and NF-kB transcription factors. They are ROS sensitive proteins, activated in oxidative stress conditions, able to modify SOD genes transcription level in different ways [9,15,24].

In our study we found only small differences of mRNA and protein level of SOD izoenzymes between control tissue and CRC. It might indicate minor participation of superoxide dismutase in CRC development, however colon is weakly endowed with antioxidant system enzymes (including SOD), and it is possible that even small changes in SOD`s expression might cause imbalance between removal and generation of ROS [25].

Significantly decreased expression of SOD2 in colorectal cancer liver metastases indicates greater leakage of superoxide anion from mitochondria, due to impaired capability of O2

- scavenging by mitochondrial antioxidant system. This might cause DNA damage (mtDNA is yet more prone to oxidative damage), leading to increased genetic instability of tumor cells. To achieve metastatic potential, tumor cells must be subjected to numerous changes in their phenotype via accumulation of specific mutations [26].

Evaluation of SOD isoenzyme expression at each stage of CRC clinical advancement (UICC) showed significant changes of their mRNA and protein level. The highest protein level of SOD1 and SOD2 observed in UICC stage II, when cancer penetrates the colon wall and begins to invade neighboring tissues, indicates defensive action of immunological system. Cytokines generated by activated lymphocytes induce synthesis of SOD proteins [27,28]. It seems that increased protein level of SOD1 and SOD2 provides effective protection against oxidative

594


Figure 3. SOD1 mRNA and protein level in CRC and CRCLM. The level of mRNA and protein of SOD1 was determined by RT-PCR and Western Blotting respectively in tissue specimens from patients with colorectal cancer (CRC) and colorectal cancer metachronous liver metastases (CRCLM). There were 15 CRC,12 CRCLM and 15 normal colons adjacent to cancer were used as control tissues. SD – standard deviation, SE – standard error.

Figure 4. SOD2 mRNA and protein level in CRC and CRCLM. The level of mRNA and protein of SOD2 was determined by RT-PCR and Western Blotting respectively in tissue specimens from patients with colorectal cancer (CRC) and colorectal cancer metachronous liver metastases (CRCLM). There were 15 CRC and 12 CRCLM, 15 normal colons adjacent to cancer were used as control tissues. SD – standard deviation, SE – standard error, * - significant versus control (P<0.05), ** - significant versus CRC (P<0.05).

595

M. Skrzycki et al.

stress caused by inflammation. Our results indicate adaptation of tumor cells to oxidative stress conditions.

Decreased protein level of SOD isoenzymes in stage III, when cancer invades lymph nodes, indicates weakened oxidative defense of tumor cells, leading to more oxidizing environment and in turn to higher rate of mutations. This allows for changes of tumor cells phenotype necessary to pass into further stages of CRC clinical advancement.

In stage IV of UICC, protein level of SOD2 raises distinctly, however level of SOD1 remains almost unchanged. It seems, that tumor cells attempt to limit ROS level in mitochondria to avoid apoptosis, but still maintain the oxidizing environment in the cytoplasm necessary for genetic instability. Furthermore high level of SOD2 provides increased concentration of hydrogen peroxide. It is well known that H2O2 stimulates cell proliferation, and metastases. Hindered apoptosis and continuous proliferation are characteristic features of tumor cells [17]. Our data have been supported by research of Skrzydlewska et al. [29] They found increased activity of SOD1 in all UICC stages of CRC. Although, they studied only SOD1 activity, and there are some discrepancies, because in our study in some

stages protein level of SOD1 is below the control value, and the tumor cells adapted to oxidative stress [29].

The final stage of malignant cancer are distant metastases. In our study we included group of patients with metachronous colorectal cancer metastases to liver, and excluded patients with synchronous metastases (with both primary cancer and metastases) because they are targets of chemotherapy, which could disturb antioxidant system. In case of metachronous metastases the time between onset of primary cancer and appearance of metastases is long enough (few years) to withdraw effects of chemotherapy.

In CRCLM, changes in protein level for SOD isoenzymes indicates adaptation to the liver environment. While colonizing other tissue, tumor cells are exposed to metabolites that could penetrate to their cytoplasm. Liver cells produce large amounts of ROS due to their detoxification function (cytochrome P450 complex). Therefore tumor cells that settled in the liver must protect their cytoplasm against increased amount of ROS, what is confirmed by increased protein level of SOD1 found in CRCLM.

Considering mRNA levels of SOD isoenzymes in UICC stages of CRC clinical advancement, important

Figure 5. mRNA and protein level of SOD isoenzymes in subsequent stages of CRC clinical advancement. Obtained colorectal cancer specimens were classified according to stages of clinical advancement (UICC). Stage II had 6 patients, stage III had 5 patients and stage IV had 4 patients. To analyze differences of variables between subsequent UICC stages single factor ANOVA test was applied. Number of stage was used as an ANOVA prediction factor. All differences between control, II, III and IV stage of UICC were found significant (P≤0.05). C – control, CRC II - IV – stages of UICC.

596


conclusion arises that SOD mRNA has an inverse relationship with SODs protein level. One explanation of such discrepancy is regulation of SOD isoenzymes synthesis is at a posttranscriptional level. Similar results were found by Nishimura et al. [30] for SOD expression under oxidative stress. They suggested that increase of mRNA level indicates posttranscriptional down regulation of SOD2 (reduction in protein level) and activation of SOD2 gene transcription by the increased ROS. They also found that SOD1 mRNA expression was transiently suppressed [30]. Other authors also found various discrepancies between mRNA and protein level of SOD isoenzymes. They postulated that this difference depends on changes in the redox state of the cell in conditions like hypoxia, anoxia, and oxidative stress caused by cytokines [31-34].

The mechanisms of posttranscriptional regulation of SOD genes are poorly investigated. Recently Santillo et al. [35] provided evidence for posttranscriptional regulation of SOD2 protein level by Ki-Ras, a signaling protein involved in regulation of cell growth, differentiation, and stress response. Protein level of SOD2 seems to be regulated by concentration of O2

- that stimulates Ki-Ras mediated signaling, and then Ki-Ras at the ERK 1/2 dependent pathway increases protein levels of SOD2 [35].

SOD genes expression seems to be controlled on at least two levels: transcriptional and posttranscriptional, and cellular signals activating each of those levels seems to be different, depending on endogenous cell conditions. SOD isoenzymes participate in maintenance of the balance between production and generation of ROS in tumor cells, and might be one of the key factors deciding of death or survival of tumor cells population.

Determination of only activity and protein level of SOD might not be sufficient to fully evaluate adaptation potential of tumor cells against oxidative stress. High level of mRNA might act as some kind of hidden reserve able to produce additional amounts of SOD in response to oxidative stress stimuli, whereas low level of SOD mRNA might be a reaction of cells to increased amounts of hydrogen peroxide, due to its proapoptotic action in high concentrations [17,36].

It is important for clinical and therapeutic reasons to precisely evaluate the ability of tumor cells to defend against oxidative stress, because many antitumor treatments rely on generation of ROS in cancer cells. Some studies showed that overexpression of SOD2

in human melanoma A375 and human histiocytic lymphoma U937 cell lines increased their resistance to doxorubicin [37]. However data from other studies point to SOD2 potential as an antitumor agent. Transfection of SOD2 into mouse C3H10T1/2 cells reduced the incidence of neoplastic transformation after gamma irradiation. Overexpression of SOD2 inhibits growth and proliferation of cancer cells [38,39]. Therefore, the future of antitumor genomic therapy could rely on direct transfection of cancer cells with SOD2 gene, however the level of SOD2 must be well-matched to achieve its tumor suppressive and not tumor promoting effect.

Another therapeutic approach is to provide cancer cells with such an amount of active enzyme (SOD1 or SOD2) that increase concentration of hydrogen peroxide to a level leading to apoptosis of cancer cells. Enzyme could be packed into a liposomes and introduced to blood circulation, which than be absorbed by cells. Normal cells have low levels of ROS, therefore they will be able to survive increased generation of H2O2, but cancer cells have already increased level of ROS, and its further increase will lead to their apoptosis [17,36,40,41].

SOD activity in cancer cells could also be decreased by specific inhibitors (2-methoxy estradiol) to increase their sensitivity to ROS based therapy. If such inhibitor is applied and cancer cells are directly treated with ROS increasing agent (i.e. exposure to laser radiation – photodynamic therapy), their viability is significantly decreased [42].

Our study revealed that tumor cells adjust to oxidative stress via increased protein level of SOD isoenzymes. However, in some stages of cancer progression, tumor cells maintain a certain level of ROS, which is necessary for tumor cells permanent proliferation, and have important roles in generating environmental conditions conducive to causing genetic instability. It seems that synthesis of SOD isoenzymes is very precisely regulated, not only at a transcriptional level, but also at a level that is posttranscriptional. This aspect of SOD expression needs further investigations.

Acknowledgements This work was financed by a grants from the Medical University of Warsaw No. 1WK/W1/08 and 1WK/W1/09.

597

M. Skrzycki et al.

[1] Benson A.B. 3rd, Epidemiology, disease progression, and economic burden of colorectal cancer, J. Manag. Care Pharm., 2007, 13, S5-S18

[2] Ballinger AB., Anggiansah C., Colorectal cancer, BMJ, 2007, 335, 715-718

[3] Soreide K., Janssen EA., Soiland H., Korner H., Baak J.P., Microsatellite instability in colorectal cancer, Br. J. Surg., 2006, 93, 395-406

[4] Thibodeau S.N., Bren G., Schaid D., Microsatellite instability in cancer of the proximal colon, Science, 1993, 260, 816-819

[5] Worthley D.L., Whitehall V.L., Spring K.J., Leggett B.A., Colorectal carcinogenesis: road maps to cancer, World J. Gastroenterol., 2007, 13, 3784-3791

[6] Grady W.M., Genomic instability and colon cancer, Cancer Metastasis Rev., 2004, 23, 11-27

[7] Hampel H., Frankel W.L., Martin E., Arnold M., Khanduja K., Kuebler P., Screening for the Lynch syndrome (hereditary nonpolyposis colorectal cancer), N. Engl. J. Med., 2005, 352, 1851-1860

[8] Hoeijmakers J.H., Genome maintenance mechanisms for preventing cancer, Nature, 2001, 411, 366-374

[9] Hsu S.M., Chen Y.C., Jiang M.C., 17 beta-estradiol inhibits tumor necrosis factor-alpha-induced nuclear factor-kappa B activation by increasing nuclear factor-kappa B p105 level in MCF-7 breast cancer cells, Biochem. Biophys. Res. Commun., 2000, 279, 7-52

[10] Jass J.R., Whitehall V.L., Young J., Leggett B.A., Emerging concepts in colorectal neoplasia, Gastroenterology, 2002, 123, 862-876

[11] Kawanishi S., Hiraku Y., Oikawa S., Mechanism of guanine-specific DNA damage by oxidative stress and its role in carcinogenesis and aging, Mutat. Res., 2001, 488, 65-76

[12] Williams G.M., Jeffrey A.M., Oxidative DNA damage: endogenous and chemically induced, Regul. Toxicol. Pharmacol., 2000, 32, 283-292

[13] Cheng K.C., Cahill D.S., Kasai H., Nishimura S., Loeb L.A., 8-Hydroxyguanine, an abundant form of oxidative DNA damage, causes G----T and A----C substitutions, J. Biol. Chem,. 1992, 267, 166-172

[14] Fridovich I., Superoxide anion radical (O2-), superoxide dismutases, and related matters, J. Biol. Chem., 1997, 272, 18515-18517

[15] Zelko I.N., Mariani T.J., Folz R.J., Superoxide dismutase multigene family: A comparison of the Cu,ZnSOD (sod1), Mn-SOD (sod2), and EC-SOD (sod3) gene structures, evolution, and expression, Free Radic. Biol. Med., 2002, 33, 337-349

[16] Oberley L.W., Buettner G.R., Role of Superoxide Dismutase in Cancer: A Review, Cancer Res., 1979, 39, 1141-1149

[17] Nicco C., Laurent A., Chereau C., Weill B., Batteux F., Differential modulation of normal and tumor cell proliferation by reactive oxygen species, Biomed. Pharmacother., 2005, 59, 169-174

[18] Van Driel B.E., Lyon H., Hoogenraad D.C., Anten S., Hansen U., Van Noorden CJ., Expression of CuZn- and Mn-superoxide dismutase in human colorectal neoplasms, Free Radic. Biol. Med., 1997, 23, 435-444

[19] Janssen A.M., Bosman C.B., Kruidenier L., Griffioen G., Lamers C.B., van Krieken J.H., et al., Superoxide dismutases in the human colorectal cancer sequence, J. Cancer Res. Clin. Oncol., 1999, 125, 327-335

[20] Devi G.S., Prasad M.H., Saraswathi I., Raghu D., Rao D.N., Reddy P.P., Free radicals antioxidant enzymes and lipid peroxidation in different types of leukemias, Clin. Chim. Acta, 2000, 293, 53-62

[21] Hileman E.O., Liu J., Albitar M., Keating M.J., Huang P., Intrinsic oxidative stress in cancer cells: a biochemical basis for therapeutic selectivity, Cancer Chemother. Pharmacol., 2004, 53, 209-219

[22] Santiard D., Inactivation of Cu,Zn-superoxide dismutase by free radicals derived from ethanol metabolism: a gamma radiolysis study, Free Radic. Biol. Med., 1995, 19, 121-127

[23] Lowry O.H., Rosebrough N.J., Farr A.L., Randall R.J., Protein measurement with the Folin phenol reagent, J. Biol. Chem., 1951, 193, 265-275

[24] Wang T., Zhang X., Li J.J., The role of NF-kappaB in the regulation of cell stress responses, Int. Immunopharmacol., 2002, 2, 1509-1520

[25] Skrzycki M., Czeczot H., Expression of superoxide dismutase genes in oxidative stress conditions, Post. Biol. Kom., 2004, 31, 81-92, (in Polish)

[26] Loeb L.A., Mutator phenotype may be required for multistage carcinogenesis, Cancer Res., 1991, 51, 3075-3079

[27] Visner G.A., Dougall W.C., Wilson J.M., Burr I.A., Nick H.S., Regulation of manganese superoxide dismutase by lipopolysaccharide, interleukin-1, and tumor necrosis factor. Role in the acute inflammatory response, J. Biol. Chem., 1990, 265, 2856-2864

[28] Wong G.H.W., Goeddel D.V., Induction of manganous superoxide dismutase by tumor necrosis factor: possible protective mechanism, Science (Washington DC), 1988, 242, 941-944

References

598


[29] Skrzydlewska E., Sulkowski S., Koda M., Zalewski B., Kanczuga-Koda L., Sulkowska M., Lipid peroxidation and antioxidant status in colorectal cancer, World J. Gastroenterol., 2005, 11, 403-406

[30] Nishimura H., Sanaka T., Nihei H., Nishikawa M., Aikawa E., Mechanism of elevated local oxidant stress in early anti-glomerular basement membrane nephritis: an evaluation of oxidant production and superoxide dismutase expression, Nippon Jinzo Gakkai Shi, 1996, 38, 441-448

[31] Ahlemeyer B., Bauerbach E., Plath M., Steuber M., Heers C., Tegtmeier F., et al., Retinoic acid reduces apoptosis and oxidative stress by preservation of SOD protein level, Free Radic. Biol. Med., 2001, 30, 1067-1077

[32] Monje M.L., Chatten-Brown J., Hye S.E., Raley-Susman K.M., Free radicals are involved in the damage to protein synthesis after anoxia/aglycemia and NMDA exposure, Brain Res., 2000, 28, 172-182

[33] Niu C.S., Chang C.K., Lin L.S., Jou S.B., Kuo D.H., Liao S.S., et al., Modification of superoxide dismutase (SOD) mRNA and activity by a transient hypoxic stress in cultured glial cells, Neurosci. Lett., 1998, 251, 145-148

[34] Tsan M.F., White J.E., Shaffer J.B., Molecular basis for tumor necrosis factor-induced increase in pulmonary superoxide dismutase activities, Am. J. Physiol., 1990, 259, L506-L512

[35] Santillo M., Mondola P., Serù R., Annella T., Cassano S., Ciullo I., et al., Opposing functions of Ki- and Ha-Ras genes in the regulation of redox signals, Curr. Biol., 2001, 11, 614-619

[36] Antunes F., Cadenas E., Cellular titration of apoptosis with steady state concentrations of H2O2: submicromolar levels of H2O2 induce apoptosis through Fenton chemistry independent of the cellular thiol state, Free Radic. Biol. Med., 2001, 30, 1008-1018

[37] Suresh A., Guedez L., Moreb J., Zucali J., Overexpression of manganese superoxide dismutase promotes survival in cell lines after doxorubicin treatment, Br. J. Haematol., 2003, 120, 457-463

[38] StClair D., Zhao Y., Chaiswing L., Oberley T., Modulation of skin tumorigenesis by SOD, Biomed. Pharmacother., 2005, 59, 209-214

[39] Oberley L.W., Mechanism of the tumor suppresive effect of MnSOD overexpression, Biomed. Pharmacother., 2005, 59, 143-148

[40] Dominguez A., Modifying superoxide dismutase for improved biopharmaceutical properties, Biotecnologia Aplicada, 2006, 23, 17-21

[41] Szatrowski T.P., Nathan C.F., Production of large amounts of hydrogen peroxide by human tumor cells, Cancer Res., 1991, 51, 794-798

[42] Golab J., Nowis D., Skrzycki M., Czeczot H., Baranczyk-Kuzma A., Wilczynski GM, et al., Antitumor effects of photodynamic therapy are potentiated by 2-methoxyestradiol - a superoxide dismutase inhibitor, J. Biol. Chem., 2003, 278, 407-414

599

superoxide dismutase mrna and protein level in human colorectal cancer

Documents