supplemental data: evidence for multiple species of sunda ... · supplemental data: evidence for...

Supplemental Data: Evidence for Multiple Species of Sunda Colugo Jan E. Janečka, Kristofer M. Helgen, Norman T-L. Lim, Minoru Baba, Masako Izawa, Boeadi, and William J. Murphy Supplemental Experimental Procedures Phylogenetic Analysis. We compiled an alignment of 2 mitochondrial gene segments (totaling 1,442 bp from Cytochrome b and the non-coding 12S rRNA) and 8 nuclear non-coding intronic segments (totaling 4,291 bp, BTK, CHRNA1, CYP1A1, FAH, FES, GHR, HK1, and MAOA) for the Sunda colugo (Galeopterus variegatus) and the Philippine colugo (Cynocephalus volans). Both mtDNA and nuclear segments were generated for 3 Sunda colugos from the Malay Peninsula and 3 samples from western Java (see Table S1 for details on specimens, Figure S1 for map of west Java). The data for the Sunda colugo from Borneo was obtained from GenBank and therefore only mtDNA sequences were available. All segments were obtained for the outgroup, the Philippine colugo. Novel sequences were acquired using methods described previously [S1]. The GenBank accession numbers of sequences used in this study are given in Table S2. Primer Sequences (fragment length represents sequence used in the matrix): Cytochrome b, 1071 bp: [S2], 377 bp: L14724 F-5’AATTGGATCCGATATGAAAAACCATCGTTG H15419 R-5’TTAAGAATTCCTCAGAATGATATTTGTCCTCA

(This study), 694 bp: F-5’TCCATATTTTTCATTTGCCTCTT R-5’TGAGGATAAGGATGGTGGAGA

12S rRNA [S3], 371 bp: 12SA-5’AAACTGGGATTAGATACCCCACTAT 12SB-5’GAGGGTGACGGGCGGTGTGT

BTK (This study), 571 bp: F-5’CAAGTTCAGCAGCAAATCTGA R-5’CAGATGAGGCCTGTAGAGACG

CHRNA1 [S4], 346 bp: F-5’ GACCATGAAGTCAGACCAGGAG R-5’ GGAGTATGTGGTCCATCACCAT

CYP1A1 [S5], 584 bp:

F-5’ TTGGACCTCTTTGGAGCTGG R-5’ TGGTTGATCTGCCACTGGTT

FAH (this study), 725 bp:

F-5’TGGTCCTTATGAACGACTGG R-5’GAGCATCCATGGGCACCAC

FES [S5], 440 bp:

F-5’ GGGGAACTTTGGCGAAGTGTT R-5’ TCCATGACGATGTAGATGGG

GHR [S5], 673 bp:

F-5’ CCAGTTCCAGTTCCAAAGAT R-5’ TGATTCTTCTGGTCAAGGCA

HK1 [S6], 332 bp: F-5’GTGGAAATGCACAACAAGATCTAC R-5’GGAGACAATGTGATCAAACAGC

MAOA (this study), 620 bp:

F-5’GGAAAATCTGTGAGCTGTATGC R-5’GCTCCTCACACCAGTTCTTCTC

Sequences for each gene segment were aligned in CLUSTAL (version X) [S7] using default parameters and manually corrected to minimize the number of indels. The full sequence alignments can be obtained from the authors. The mtDNA and nuclear DNA matrices were analyzed separately, and combined. A total of 83 bp of ambiguous alignment was excluded from consideration in the nuclear matrix (21 bp of FAH, 25 bp of FES, 24 bp of GHR, and 13 bp of MAOA). Likelihood, parsimony, and Bayesian approaches were used for reconstructing phylogenies. MODELTEST (version 3.7) [S8] was used to select the most appropriate evolutionary model with the Akaike Information Criterion (AIC; mtDNA, TrN+I; nuclear, HKY; mtDNA+nuclear, GTR+I) and to estimate parameters. These parameters were used to reconstruct a maximum likelihood (ML) tree with an exhaustive search in PAUP* (version 4) [S9] (Figures S2, S3, and S4). A ML bootstrap evaluation was performed using 1000 heuristic replicates with tree-bisection-reconnection (TBR) branch swapping. The Maximum Parsimony (MP) algorithm was also used to reconstruct a phylogeny with an exhaustive search, and evaluated with 1000 bootstrap replicates using TBR. Finally, the phylogeny of these sequences was also estimated with MRBAYES (version 3.1.2) [S10]. For the MRBAYES analysis, the combined mtDNA and nuclear matrix was divided into 2 segments and each was assigned its own model of evolution. Model selection was based on MODELTEST results. Two independent runs were performed with 4 independent chains, sampled every 1,000th generation for 2 million generations. The first 400,000 generations were discarded as burn-in. We determined convergence between the two runs when the average standard deviation of split-frequencies was less than 0.01. All three approaches produced identical topologies. The ML tree for mtDNA, nuclear, and mtDNA+nuclear are shown in Figures S2, S3, and S4, with ML bootstrap support (BS) values, Bayesian posterior probabilities (PP), and MP BS values above nodes. Supplemental Results Sequence Divergence. Uncorrected sequence divergence between Galeopterus variegatus subspecies was 5.7–7.1% for Cytochrome b, 3.0–6.5% for 12S rRNA (Table S3), and 0.38–0.48% for nuclear intron segments (Table S4). Variable sites are shown in Figure S4. For Cytochrome b, all haplotypes were in frame, with no stop codons present. Within Galeopterus variegatus, among 109 variable sites there were 20 non-synonymous mutations, yielding five amino acid differences unique to Java, five unique to Borneo, and three unique to mainland

Singapore. The mtDNA divergence was comparable to the divergence previously observed between sister-taxa (Table S5, S6) that inhabit Southeast Asia including the northern (Macaca leonina) [S11, S12]/southern (Macaca nemestrina) [S13,S14] pig-tailed macaque, Bornean (Pongo pygmaeus) [S15]/Sumatran (Pongo abelii) [S16] orangutan, and Asian leopard cat (Prionailurus bengalensis) [S17] /fishing cat (Prionailurus viverrinus) [S17]. Comparable nuclear sequences were not available for these taxa. However, Galeopterus interpopulation nuclear intron divergence at four segments (CHRNA1, CYP1A1, FES, GHR) was compared to published canid species-pairs sequenced at the same four loci (Table S5, S6) [S18].

Molecular Dating. Because of the markedly different nuclear and mitochondrial substitution rates we estimated divergence dates for the mtDNA and nuclear data separately. The mtDNA and nuclear ML trees reconstructed using techniques described above were tested for clock-like sequence evolution. Differences between likelihood scores of ML trees constructed with and without a molecular clock enforced were used to test if sequences were clock like. The molecular clock assumption could not be rejected for either the mtDNA or nuclear data sets (P = 0.57, d.f. = 5; P = 0.30, d.f. = 4, respectively). Branches were re-estimated with the molecular clock enforced using the topologies in Figures S2 and S3. The divergence between the Sunda and Philippine colugos (20 Mya) from Janečka et al. (2007) [S19] was used to estimate evolutionary rate, i.e., substitutions per site per million years. The Janečka et al. [S19] date was used as a surrogate calibration point because no fossil calibrations are available for the Sunda/Philippine colugo split. The divergence dates within Galeopterus were estimated from the point calibration, as well as from the minimum (14 My) and maximum (27 My) dates [S19] to obtain surrogate confidence intervals (Table S7). Morphometry. Twelve skulls of adult colugos (Malay Peninsula, n = 3; Borneo, n = 5; Java, n = 4, Table S8) were measured in the collections of the United States National Museum of Natural History, Smithsonian Institution (Washington, D.C.) and the Naturalis Museum (Leiden, Netherlands), two of the largest museum holdings of colugos. Adult specimens were judged to be those in which the basilar (basioccipital-basisphenoid) cranial suture was fully, or nearly, fused and in which the molars were fully erupted and showed signs of some wear. Specimens were measured with digital calipers to the nearest 0.1 mm. Because male and female colugos differ significantly in skull size (with most variables measuring considerably larger in females), sexes must be treated separately in morphometric assessments. Figure 2 (in manuscript) presents a bivariate contrast of condylobasal length versus zygomatic width in adult males only.

Supplemental References S1. Murphy, W.J., Eizirik, E., Johnson, W.J., Zhang, Y.P., Ryder, O.A., and O’Brien, S.J.

(2001). Molecular phylogenetics and the origins of placental mammals. Nature 409, 614–618.

S2. Masuda, R., Lopez, J.V., Pecon Slattery, J., Yuhki, N., and O’Brien, S.J. (1996). Molecular phylogeny of mitochondrial Cytochrome b and 12S rRNA sequences in the Felidae: Ocelot and domestic cat lineages. Mol Phylogenet Evol 6, 351–365.

S3. Palumbi, S. (2006). Nucleic acids II: the polymerase chain reaction. In Molecular Systematics, D.M. Hillis, C. Mortiz, BK Mable, eds. (Sunderland: Sinauer). pp. 205–247.

S4. Lyons, L.A., Laughlin, T.F., Copeland, N.G., Jenkins, N.A., Womack, J.E., and O’Brien, S.J. (1997). Comparative anchor tagged sequences (CATS) for integrative mapping of mammalian genomes. Nature Genet 15, 47–56.

S5. Venta, P.J., Brouillette, J.A., Yuzbasiyan-Gurkan, V., and Brewer, G.J. (1996). Gene-specific universal mammalian sequence-tagged sites: application to the canine genome. Biochem Genet 34, 321–341.

S6. Murphy, W.J., and O’Brien, S.J. (2007). Designing and optimizing comparative anchor primers for comparative gene mapping and phylogenetic inference. Nature Protocols 2, 3022–3030.

S7. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., and Higgins, D.G. (1997). The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 25, 4876–4882.

S8. Posada, D., and Crandall, K.A. (1998). Modeltest: testing the model of DNA substitution. Bioinformatics 19, 301–302.

S9. Swofford, D.L. (2003). PAUP*: phylogenetic analysis using parsimony (*and other methods). (Sinauer Associates, Sunderland, MA).

S10. Ronquist, F., and Huelsenbeck, J.P. (2003). MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19, 1572–1574.

S11. Ziegler, T., Abegg, C., Meijaard, E., Perwitasari-Farajallah, D., Walter, L., Hodges, J.K., and Roos, C. (2007). Molecular phylogeny and evolutionary history of Southeast Asian macaques forming the M. silenus group. Mol Phylogenet Evol 42, 807–816.

S12. Li, Q.Q., and Zhang, Y.P. (2005). Phylogenetic relationships of the macaques (Cercopithecidae: Macaca) inferred from mitochondrial DNA sequences. Biochem Genet 43, 375–386.

S13. Tosi, A.J., Morales, J.C., and Melnick, D.J. (2003). Paternal, maternal, and biparental molecular markers provide unique windows onto the evolutionary history of macaque monkeys. Evolution 57, 1419–1435.

S14. Roos, C., Ziegler, T., Hodges, J.K., Zischler, H., and Abegg, C. (2003). Molecular phylogeny of Mentawai macaques: taxonomic and biogeographic implications. Mol Phylogenet Evol 29, 139–150.

S15. Horai, S., Hayasaka, K., Kondo, R., Tsugane, K., and Takahata, N. (1995). Recent African origin of modern humans revealed by complete hominoid mitochondrial DNAs. Proc Natl Acad Sci USA 92, 532–536.

S16. Xu, X., and Arnason, U. (1996). The mitochondrial DNA molecule of Sumatran orangutan and a molecular proposal for two (Bornean and Sumatran) species of orangutan. J Mol Evol 43, 431–437.

S17. Tamada, T., Siriaroonrat, B., Subramaniam, V., Hamachi, M., Lin, L.-K, Oshida, T., Rerkamnuaychoke, and W., Masuda, R. (2008). Molecular diversity and phylogeography of the Asian leopard cat, Felis bengalensis, inferred from mitochondrial and Y-chromosomal DNA sequences. Zool Sci 25, 154–163.

S18. Bardeleben, C., Moore, R.L., and Wayne, R.K. (2005). A molecular phylogeny of the Canidae based on 6 nuclear loci. Mol Phylogenet Evol 37, 815–831.

S19. Janečka, J.E., Miller, W., Pringle, T.H., Wiens, F., Zitzmann, A., Helgen, K.M., Springer, M.S., and Murphy, W.J. (2007). Molecular and genomic data identify the closest living relative of Primates. Science 318, 792–794.

Tables and Figures Table S1. Geographic origin and sources of samples used in this study.

Sample ID Region Specific Location Accession Number Source

Galeopterus variegatus

GVA1 Malay Peninsula Surat Thani, Thailand CMNH 87909 Museum of Texas Tech University

GVA2 Malay PeninsulaBukit Timah Nature Reserve, Singapore

ZRC.4.8119Raffles Museum of Biodiversity Research

GVA3 Malay Peninsula MacRitchie, Singapore ZRC.4.8122Raffles Museum of Biodiversity Research

GVA4 Java Sumur, West Java No. 1Kitakyushu Museum of Natural History and Human History

GVA5 Java Pandeglang, West Java No. 2Kitakyushu Museum of Natural History and Human History

GVA6 Java Saketi, West Java No. 3Kitakyushu Museum of Natural

History and Human History

GVAB Borneo unknown unknown Arnason et al. 2002

Cynocephalus volans

CVO1 Philippines Leyte Island, Philippines USNM 458982 National Museum of Natural History

Table S2. List of the GenBank (NCBI) accession numbers for the two mitochondrial and eight nuclear gene segments analyzed in this study. n.a. = not available

Nuclear

GHR MAOA FAH BTK HK1

GVA1 FJ151300 FJ151307 FJ151314 FJ151321 FJ151328

GVA2 FJ151301 FJ151308 FJ151315 FJ151322 FJ151329

GVA3 FJ151302 FJ151309 FJ151316 FJ151323 FJ151330

GVA4 FJ151303 FJ151310 FJ151317 FJ151324 FJ151331

GVA5 FJ151304 FJ151311 FJ151318 FJ151325 FJ151332

GVA6 FJ151305 FJ151312 FJ151319 FJ151326 FJ151333

GVAB n.a. n.a. n.a. n.a. n.a.

CVO1 FJ151306 FJ151313 FJ151320 FJ151327 FJ151334

Mitochondrial Nuclear

12S CYTB CHRNA1 CYP1A1 FES

GVA1 FJ151335 FJ151342 FJ151279 FJ151286 FJ151293

GVA2 FJ151336 FJ151343 FJ151280 FJ151287 FJ151294

GVA3 FJ151337 FJ151344 FJ151281 FJ151288 FJ151295

GVA4 FJ151338 FJ151345 FJ151282 FJ151289 FJ151296

GVA5 FJ151339 FJ151346 FJ151283 FJ151290 FJ151297

GVA6 FJ151340 FJ151347 FJ151284 FJ151291 FJ151298

GVAB AJ428849 AJ428849 n.a. n.a. n.a.

CVO1 FJ151341 AB075974 FJ151285 FJ151292 FJ151299

Table S3. Uncorrected pair-wise sequence divergence between colugos sampled at two mitochondrial segments analyzed in this study. The top matrix shows distances for Cytochrome b (CYTB) and the bottom for 12S rRNA (12S).

CYTB GVA1 GVA2 GVA3 GVA4 GVA5 GVA6 GVAB CVO1

GVA1 -

GVA2 1.21% -

GVA3 1.21% 0.00% -

GVA4 7.01% 7.10% 7.10% -

GVA5 6.84% 6.93% 6.93% 0.19% -

GVA6 7.01% 7.10% 7.10% 0.37% 0.09% -

GVAB 6.26% 6.16% 6.16% 5.79% 5.71% 5.80% -

CVO1 17.18% 17.65% 17.65% 16.55% 16.48% 16.54% 16.34% -

12S GVA1 GVA2 GVA3 GVA4 GVA5 GVA6 GVAB CVO1

GVA1 -

GVA2 0.81% -

GVA3 0.81% 0.00% -

GVA4 6.54% 6.27% 6.27% -

GVA5 6.54% 6.27% 6.27% 0.00% -

GVA6 6.40% 6.13% 6.13% 0.00% 0.00% -

GVAB 3.79% 2.98% 2.98% 6.54% 6.54% 6.39% -

CVO1 8.71% 7.90% 7.90% 10.67% 10.67% 10.59% 8.44% -

Table S4. Uncorrected pair-wise sequence divergence observed in the concatenated, 8-segment nuclear matrix for colugos examined in this study.

concatenated 8 nuclear segments

GVA1 GVA2 GVA3 GVA4 GVA5 GVA6 CVO1

GVA1 -

GVA2 0.38% -

GVA3 0.38% 0.14% -

GVA4 0.41% 0.38% 0.41% -

GVA5 0.43% 0.45% 0.48% 0.14% -

GVA6 0.41% 0.43% 0.45% 0.10% 0.02% -

CVO1 2.32% 2.40% 2.44% 2.24% 2.27% 2.24% -

Table S5. Comparison of uncorrected pair-wise sequence divergence between Sunda colugos (Galeopterus variegatus) examined in this study, and representative sister-taxa for Cytochrome b and 12S rRNA, and a concatenated alignment of four nuclear intronic segments that were among those generated in this study. GenBank accession numbers for representative taxa used in the comparison are given in Table S6.

Species 1 Distribution Species 1 Species 2 Distribution Species 2 bpUncorrected

Divergence

Cytochrome b

G. v. peninsulae mainland G. v. borneanus Borneo 1071 6.19% (mean)

G. v. peninsulae mainland G. v. variegatus Java 1071 7.01% (mean)

G. v. borneanus Borneo G. v. variegatus Java 1071 5.77% (mean)

Macaca leonina Indochina Macaca nemestrina Indochina/ Sundaland 567 3.79% (mean)

Northern pig-tailed macaque Southern pig-tailed macaque

Pongo pygmaeus Borneo Pongo abelii Sumatra 1141 7.63%

Bornean orangutan Sumatran orangutan

Prionailurus bengalensis Asia Prionailurus viverrinus Asia 1140 5.09% (mean)

Leopard cat Fishing cat

12S rRNA

G. v. peninsulae mainland G. v. borneanus Borneo 377 3.25%

G. v. peninsulae mainland G. v. variegatus Java 377 6.31% (mean)

G. v. borneanus Borneo G. v. variegatus Java 377 6.49% (mean)

Pongo pygmaeus Borneo Pongo abelii Sumatra 954 2.94% (mean)

Bornean orangutan Sumatran orangutan

Macaca leonina Indochina Macaca nemestrina Indochina/Sundaland 239 2.95% (mean)

Northern pig-tailed macaque Southern pig-tailed macaque

Nuclear Concatenated CHRNA1, CYP1A1, FES, GHR

G. v. peninsulae mainland G. v. variegatus Java 2,004 0.43% (mean)

G. v. peninsulae mainland Thailand G. v. variegatus mainland Singapore 2,004 0.38% (mean)

Canis adustus Africa Canis mesomelas Africa 2,010 0.35%

Side-striped jackal Black-backed jackal

Lycalopex griseus South America Lycalopex gymnocercus South America 2,010 0.25%

Argentine grey fox Pampas fox

Canis lupus North America/Asia Canis latrans North/Central America 2,010 0.15%

Wolf Coyote

Table S6. GenBank accession numbers for sequences used in pair-wise divergence comparisons shown in Table S5.

Species 1 Source Species 2 Source

CYTB

Macaca leonina Macaca nemestrina

DQ355487 Zeigler et al. 2007 [S11] AY151108 Roos et al. 2003 [S13]

DQ355488 Zeigler et al. 2007 [S11] AY151111 Roos et al. 2003 [S13]

Pongo pygmaeus Pongo abelii

D38115 Horai et al. 1992 [S15] X97707 Xu and Arnanson 1996 [S17]

NC_001646 Horai et al. 1995 [S16] NC_002083 Xu and Arnanson 1996 [S17]

Prionailurus bengalensis Prionailurus viverrinus

AB210237 Tamada et al. 2008 [S18] AB210239 Tamada et al. 2008 [S18]

AB210238 Tamada et al. 2008 [S18] AB210240 Tamada et al. 2008 [S18]

12S

Macaca leonina Macaca nemestrina

AY685889 Li and Zhang 2005 [S12] AY224253 Tosi et al. 2003 [S14]

AY685890 Li and Zhang 2005 [S12] AY224254 Tosi et al. 2003 [S14]

Pongo pygmaeus Pongo abelii

D38115 Horai et al. 1992 [S15] X97707 Xu and Arnanson 1996 [S17]

NC_001646 Horai et al. 1995 [S16] NC_002083 Xu and Arnanson 1996 [S17]

CHRNA1, CYP1A1, FES, GHR1

Canis adustus Canis mesomelas

AY885310, AY885334 Bardeleben et al. 2005 [S19] AY885316, AY885340 Bardeleben et al. 2005 [S19]


Lycalopex griseus Lycalopex griseus



Canis lupus Canis latrans



1. GenBank accessions for nuclear segments are in the respective order.

Table S7. The estimated divergence dates (million years ago = Mya) between colugos based on molecular sequence evolutionary rate and the molecular estimate of the split between the Sunda and Philippine colugos (20 Mya, 95% Credibility Interval = 14–27 Mya) [S19] used as a secondary calibration point.

Node G. variegatus Subspecies Geographic Region Mya95% Credibility

Interval

MtDNA

GVA2/GVA3 within peninsulae mainland Singapore 0.00 n.a.

GVA1/(GVA2,3) within peninsulae mainland Thailand/mainland Singapore 0.73 (0.51-0.98)

GVAB/(GVA1,(2,3)) borneanus/peninsulae Borneo/mainland 4.28 (2.99-5.77)

GVA5/GVA6 within variegatus west Java 0.05 (0.04-0.07)

GVA4/(GVA5,6) within variegatus west Java/west Java 0.16 (0.12-0.22)

(GVA1,(2,3),GVAB)/(GVA4,(5,6)) (peninsulae,borneanus)/variegatus (mainland,Borneo)/Java 5.40 (3.78-7.28)

Nuclear

GVA2/GVA3 within peninsulae mainland Singapore 1.00 (0.70-1.35)

GVA1/(GVA2,3) within peninsulae mainland Thailand/mainland Singapore 2.73 (1.91-3.68)

GVAB/(GVA1,(2,3)) borneanus/peninsulae Borneo/mainland n.a. n.a.

GVA5/GVA6 within variegatus west Java 0.20 (0.14-0.27)

GVA4/(GVA5,6) within variegatus west Java/west Java 1.39 (0.97-1.87)

(GVA1,(2,3))/(GVA4,(5,6)) peninsulae/variegatus mainland/Java 3.95 (2.76-5.33)

Table S8. Accession numbers and the geographic origin of specimens used in the morphometric comparison (Figure 2 of manuscript). USNM = United States National Museum of Natural History, Smithsonian Institution (Washington, D.C.), RMNH = Naturalis Museum (Leiden, Netherlands). Museum Accession Number Region Specific Location

Galeopterus variegatus peninsulae

USNM 115493 Malay Peninsula Rumpin River, Pahang, Malaysia

USNM 307554 Malay Peninsula Mount Brinchong, Cameron Highlands, Pahang, Malaysia

USNM 535139 Malay Peninsula Ban Na, Fhang, Nakhon Si Thammarat, Thailand

Galeopterus variegatus variegatus

RMNH 33812 Java Kromong Mountains, West Java, Indonesia

RMNH 33813 Java Kromong Mountains, West Java, Indonesia

RMNH "cat v" Java Cirebon, West Java, Indonesia

RMNH "cat w" Java Cirebon, West Java, Indonesia

Galeopterus variegatus borneanus

RMNH 33802 Borneo Mahakam (Koetei), East Kalimanatan, Indonesia

USNM 145642 Borneo Sempang River, West Kalimantan, Indonesia

USNM 176431 Borneo Talisaian Mountain, East Kalimantan, Indonesia

USNM 198051 Borneo Kari Orang, East Kalimantan, Indonesia

USNM 198704 Borneo "Lahan", Indonesia

Figure S1. Map showing the approximate locations of Sunda colugos sampled in West Java. Figure S2. Maximum likelihood tree (-ln L = 3315.5.8) reconstructed in PAUP* using the 1,442-bp concatenated mtDNA sequence alignment, with a TrN+I model and the following parameters: Base frequencies, 0.3122, 0.3197, 0.1354, 0.2327; rate matrix, 1.0000, 14.7692, 1.0000, 1.000, 22.7639; rates for variable sites = equal; proportion of invariant sites = 0.6208. Numbers above nodes are ML BS support, Bayesian PP, and MP BS values, respectively. Figure S3. Maximum likelihood tree (-ln L = 6632.7.3) reconstructed in PAUP* using the 4,291-bp concatenated nuclear sequence alignment, with a HKY model and the following parameters: Base frequencies, 0.2736, 0.2304, 0.2304, 0.2656; rates for variable sites = equal; transition/transversion ratio = 1.2727; proportion of invariant sites = 0. Numbers above nodes are ML BS support, Bayesian PP, and MP BS values, respectively. Figure S4. Maximum likelihood tree (-ln L = 10230.1) reconstructed in PAUP* using the 5,733-bp combined mtDNA and nuclear concatenated sequence alignment, with a GTR+I model and the following parameters: Base frequencies, 0.2835, 0.2543, 0.2057, 0.2565; rates for variable sites = equal; rate matrix, 2.5917, 11.0721, 1.4237, 1.6542, 23.1506; proportion of invariant sites = 0.8306. Numbers above nodes are ML BS support, Bayesian PP, and MP BS values, respectively. Figure S5. (a) 160 variable sites observed in 1,442 bp of mtDNA (b) and 120 variable sites in 4,291 bp of nuclear segments among Sunda and Philippine colugos examined in this study. IUPAC ambiguity codes indicate heterozygous sites. Born = GVAB, the rest of the taxa names follow those of other figures and tables.

Figure S1.

Figure S2.

Figure S3.

Figure S4.

(a) Figure S5.

(b) Figure S5.

supplemental data: evidence for multiple species of sunda ... · supplemental data: evidence for...

Documents