supplemental figure 1. 2+ - plant cell · supplemental data. zhang et al. (2010). plant cell...
TRANSCRIPT
![Page 1: Supplemental Figure 1. 2+ - Plant Cell · Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257 Supplemental Figure 3. The level of VLN1 and VLN2 transcripts was](https://reader034.vdocuments.net/reader034/viewer/2022042419/5f35fb8d22cbc0157e09812f/html5/thumbnails/1.jpg)
Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257
Supplemental Figure 1. VLN5 retains conserved residues at both type 1 and type 2 Ca2+-binding
sites in the G1 domain.
Multiple sequence alignment was performed with DNAMAN6.0.40. Secondary structural
elements of human villin were predicted by Predict Protein Server
(http://cubic.bioc.columbia.edu/pp/). The six gelsolin-homology domains (G1 to G6) and the villin
headpiece (VHP) domain are marked with lines above the sequence. Alpha-helices and β-strands
are represented with revolving lines and broad arrows below the sequence, respectively. Amino
acids with 100% conservation were marked with black blocks, whereas amino acids with greater
than 50% identity were marked with gray blocks. The protein accession numbers are as follows:
human villin (HV; NP_009058), lily 135-ABP (AAD54660), Arabidopsis thaliana VLN1
(NP_029567), VLN2 (NP_565958) and VLN5 (NP_200542). Type 1 and type 2 Ca2+ ion
coordinating residues are highlighted with green and yellow, respectively. Residues for site 1 and
1
![Page 2: Supplemental Figure 1. 2+ - Plant Cell · Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257 Supplemental Figure 3. The level of VLN1 and VLN2 transcripts was](https://reader034.vdocuments.net/reader034/viewer/2022042419/5f35fb8d22cbc0157e09812f/html5/thumbnails/2.jpg)
Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257
site 2 calcium-regulation sites within the G1 domain are indicated with asterisks and closed circles,
respectively.
2
![Page 3: Supplemental Figure 1. 2+ - Plant Cell · Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257 Supplemental Figure 3. The level of VLN1 and VLN2 transcripts was](https://reader034.vdocuments.net/reader034/viewer/2022042419/5f35fb8d22cbc0157e09812f/html5/thumbnails/3.jpg)
Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257
Supplemental Figure 2. VLN5 is expressed preferentially in mature pollen and at higher levels
than other Arabidopsis villins.
The expression data for Arabidopsis villins was extracted from a currently available database
(http://www.bar.utoronto.ca/efp/development/; Schmid et al., 2005). The expression data was
normalized with the GCOS (Gene Chip Operating Software) method, Target intensity (TGT) value
of 100, which was expressed as GCOS expression signal and was plotted against Arabidopsis
tissues. Error bars represent SD (n = 3-5). (A) VLN1; (B) VLN2; (C) VLN3; (D) VLN4 and (E)
VLN5. Arabidopsis tissues are as follows: (1) Dry seed; (2) Imbibed seed, 24 h; (3) 1st node; (4)
Flower stage 12, stamens; (5) Cauline leaf; (6) Cotyledon; (7) Root; (8) Entire rosette after
transition to flowering; (9) Flower stage 9; (10) Flower stage 10/11; (11) Flower stage 12; (12)
3
![Page 4: Supplemental Figure 1. 2+ - Plant Cell · Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257 Supplemental Figure 3. The level of VLN1 and VLN2 transcripts was](https://reader034.vdocuments.net/reader034/viewer/2022042419/5f35fb8d22cbc0157e09812f/html5/thumbnails/4.jpg)
Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257
Flower stage 15; (13) Flower stage 12, carpels; (14) Flower stage 12, petals; (15) Flower stage 12,
sepals; (16) Flower stage 15, carpels; (17) Flower stage 15, petals; (18) Flower stage 15, sepals;
(19) Flower stage 15, stamen; (20) Flowers stage 15, pedicels; (21) Leaf 1 + 2; (22) Leaf 7, petiole;
(23) Leaf 7, distal half; (24) Leaf 7, proximal half; (25) Hypocotyl; (26) Root; (27) Rosette leaf 2;
(28) Rosette leaf 4; (29) Rosette leaf 6; (30) Rosette leaf 8; (31) Rosette leaf 10; (32) Rosette leaf
12; (33) Senescing leaf; (34) Shoot apex, inflorescence; (35) Shoot apex, transition; (36) Shoot
apex, vegetative; (37) Stem, 2nd internode; (38) Mature pollen; (39) Seeds stage 3 w/ siliques; (40)
Seeds stage 4 w/ siliques; (41) Seeds stage 5 w/ siliques; (42) Seeds stage 6 w/o siliques; (43)
Seeds stage 7 w/o siliques; (44) Seeds stage 8 w/o siliques; (45) Seeds stage 9 w/o siliques; (46)
Seeds stage 10 w/o siliques; (47) Vegetative rosette.
(F) The expression signal of Arabidopsis villins in mature pollen was plotted. The results show
that the expression of VLN5 is higher than that of other Arabidopsis villins in mature pollen. Error
bars represent SD (n = 3-5).
4
![Page 5: Supplemental Figure 1. 2+ - Plant Cell · Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257 Supplemental Figure 3. The level of VLN1 and VLN2 transcripts was](https://reader034.vdocuments.net/reader034/viewer/2022042419/5f35fb8d22cbc0157e09812f/html5/thumbnails/5.jpg)
Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257
Supplemental Figure 3. The level of VLN1 and VLN2 transcripts was not reduced in VLN5 RNAi
flowers.
Flowers from WT Col-0 and three VLN5 RNAi lines (Line 1–3) were subjected to RT treatment.
Tubulin 2 was used as an internal loading control, whereas VLN1 and VLN2 primer pairs were
used to detect whether VLN5 was silenced specifically. The number of PCR cycles was 25 for
Tubulin 2 and 35 for VLN1 and VLN2, respectively.
5
![Page 6: Supplemental Figure 1. 2+ - Plant Cell · Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257 Supplemental Figure 3. The level of VLN1 and VLN2 transcripts was](https://reader034.vdocuments.net/reader034/viewer/2022042419/5f35fb8d22cbc0157e09812f/html5/thumbnails/6.jpg)
Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257
Supplemental Figure 4. VLN5 loss-of-function does not affect pollen germination rate.
Pollen grains from WT Col-0 and homozygous vln5 plants were germinated on germination
medium. The germination rate was plotted versus time. White columns, gray columns and black
columns represent WT Col-0, vln5-1 and vln5-2, respectively. Error bars represent ± SE, n = 500.
6
![Page 7: Supplemental Figure 1. 2+ - Plant Cell · Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257 Supplemental Figure 3. The level of VLN1 and VLN2 transcripts was](https://reader034.vdocuments.net/reader034/viewer/2022042419/5f35fb8d22cbc0157e09812f/html5/thumbnails/7.jpg)
Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257
Supplemental Figure 5. Pollen tube growth rate was reduced in VLN5 RNAi lines.
WT Col-0, black bar; Line 1, gray bar; Line 2, white bar, Line 3, crosshatched bar. Error bars
represent mean values ± SE, n ≥ 97. Pollen tube growth rate of VLN5 RNAi pollen tubes was
significantly different from that of WT Col-0 pollen tubes as determined by ANOVA followed by
Dunnett post hoc multiple comparisons, **P < 0.01.
7
![Page 8: Supplemental Figure 1. 2+ - Plant Cell · Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257 Supplemental Figure 3. The level of VLN1 and VLN2 transcripts was](https://reader034.vdocuments.net/reader034/viewer/2022042419/5f35fb8d22cbc0157e09812f/html5/thumbnails/8.jpg)
Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257
Supplemental Figure 6. Root hair length of vln5 homozygous mutant plants is not significantly
different from that of WT Col-0.
(A) Micrographs of root hairs after germination for four days. (a) WT Col-0; (b) vln5-1; (c) vln5-2.
Bar = 300 µm in (a) for (a-c).
(B) The length of root hairs was plotted against each genotype. The average length of root hairs is
235.4 ± 30.7 (n = 144), 246.4 ± 18.9 (n = 155) and 247.5 ± 18.9 (n = 179) for WT Col-0, vln5-1
and vln5-2, respectively. Error bars represent ± SE. There is no significant difference of the length
of root hairs between vln5 mutants and WT Col-0 (P = 0.62 for vln5-1 and P = 0.56 for vln5-2).
8
![Page 9: Supplemental Figure 1. 2+ - Plant Cell · Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257 Supplemental Figure 3. The level of VLN1 and VLN2 transcripts was](https://reader034.vdocuments.net/reader034/viewer/2022042419/5f35fb8d22cbc0157e09812f/html5/thumbnails/9.jpg)
Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257
9
![Page 10: Supplemental Figure 1. 2+ - Plant Cell · Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257 Supplemental Figure 3. The level of VLN1 and VLN2 transcripts was](https://reader034.vdocuments.net/reader034/viewer/2022042419/5f35fb8d22cbc0157e09812f/html5/thumbnails/10.jpg)
Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257
Supplemental Figure 7. Actin distribution in WT Col-0 and VLN5 loss-of-function pollen tubes.
(A) Actin distribution in WT Col-0 pollen tubes. (a-f) showing different actin staining patterns in
WT Col-0 pollen tubes.
(B) Actin distribution in vln5-1 pollen tubes. (a-f) showing different actin staining patterns in
vln5-1 pollen tubes.
(C) Actin distribution in vln5-2 pollen tubes. (a-f) showing different actin staining patterns in
vln5-2 pollen tubes.
(D) Actin distribution in VLN5 RNAi line 1 pollen tubes. (a-f) showing different actin staining
patterns in VLN5 RNAi line 1 pollen tubes.
(E) Actin distribution in VLN5 RNAi line 2 pollen tubes. (a-f) showing different actin staining
patterns in VLN5 RNAi line 2 pollen tubes. Bar = 10 µm.
10
![Page 11: Supplemental Figure 1. 2+ - Plant Cell · Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257 Supplemental Figure 3. The level of VLN1 and VLN2 transcripts was](https://reader034.vdocuments.net/reader034/viewer/2022042419/5f35fb8d22cbc0157e09812f/html5/thumbnails/11.jpg)
Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257
Supplemental Figure 8. VLN5 loss-of-function does not alter the level of actin polymer in pollen
tubes.
Quantification of actin polymer level in WT Col-0 and vln5 mutant pollen tubes. The relative
amount of F-actin was determined by measuring the fluorescence pixel intensity of phalloidin
staining. WT Col-0, black bar; vln5-1, white bar; vln5-2, gray bar. Error bars represent ± SE (n >
39), (P = 0.13 for vln5-1 and P = 0.87 for vln5-2 by a student’s t-test).
11
![Page 12: Supplemental Figure 1. 2+ - Plant Cell · Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257 Supplemental Figure 3. The level of VLN1 and VLN2 transcripts was](https://reader034.vdocuments.net/reader034/viewer/2022042419/5f35fb8d22cbc0157e09812f/html5/thumbnails/12.jpg)
Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257
Supplemental Figure 9. Pollen tube growth of VLN5 RNAi plants is hypersensitive to LatB
treatment.
To determine the effect of LatB on pollen tube growth rates of VLN5 RNAi plants, 3 nM LatB
was added to the germination medium. The growth rate of pollen tubes from WT Col-0, and VLN5
RNAi plants in standard germination medium was normalized to 100%. WT Col-0 grew
significantly better than did VLN5 RNAi pollen in the presence of LatB. WT Col-0, black bar;
Line 1, gray bar; Line 2, white bar, Line 3, crosshatched bar. Error bars represent mean ± SE (n ≥
65), **P < 0.01 (Student’s t-test).
12
![Page 13: Supplemental Figure 1. 2+ - Plant Cell · Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257 Supplemental Figure 3. The level of VLN1 and VLN2 transcripts was](https://reader034.vdocuments.net/reader034/viewer/2022042419/5f35fb8d22cbc0157e09812f/html5/thumbnails/13.jpg)
Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257
Supplemental Figure 10. VLN5 loss-of-function renders the growth of pollen tubes resistant to
cytochalasin D (CD).
To determine the effect of CD on pollen tube growth rates, 200 nM and 500 nM CD were added to
the germination medium. The growth rate of pollen tubes from WT Col-0 and vln5 homozygous
mutant plants in standard germination medium was normalized to 100%. vln5 pollen tubes grew
significantly better than did WT Col-0 plant in the presence of CD. WT Col-0, black bar; vln5-1,
gray bar; vln5-2, crosshatched bar. Error bars represent mean ± SE, n ≥ 121, *P < 0.05 and **P <
0.01 (student’s t-test). Experiments were repeated three times for each treatment.
13
![Page 14: Supplemental Figure 1. 2+ - Plant Cell · Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257 Supplemental Figure 3. The level of VLN1 and VLN2 transcripts was](https://reader034.vdocuments.net/reader034/viewer/2022042419/5f35fb8d22cbc0157e09812f/html5/thumbnails/14.jpg)
Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257
Supplemental Figure 11. The amount of VLN5 sedimented was decreased in the presence of
Ca2+/calmodulin (CaM).
A high-speed cosedimentation assay was employed to determine whether the binding of VLN5 to
actin filaments was regulated by Ca2+/CaM. Three micromolar polymerized actin was incubated
with 500 nM VLN5 with or without 50 µM CaM in the presence of 1 mM free Ca2+. The mixtures
were centrifuged at 200,000g for 1 h to separate bound versus unbound VLN5.
(A) SDS-PAGE separation showing that the amount of VLN5 bound to actin filaments was
decreased in the presence of Ca2+/CaM. Lanes 1 and 2 represent samples of supernatant and pellet
for actin alone; lanes 3 and 4 represent samples of supernatant and pellet for actin plus 500 nM
VLN5; lanes 5 and 6 represent samples of supernatant and pellet for actin plus 500 nM VLN5 in
the presence of 50 µM CaM, respectively.
(B) Plot of the percentage of VLN5 in the pellet. Error bars represent mean ± SE (n = 3), *P <
0.05 (student’s t-test).
14
![Page 15: Supplemental Figure 1. 2+ - Plant Cell · Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257 Supplemental Figure 3. The level of VLN1 and VLN2 transcripts was](https://reader034.vdocuments.net/reader034/viewer/2022042419/5f35fb8d22cbc0157e09812f/html5/thumbnails/15.jpg)
Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257
Supplemental Figure 12. Ca2+/CaM inhibits the bundling activity of VLN5.
A low-speed cosedimentation assay was employed to determine whether the bundling activity of
VLN5 was regulated by Ca2+/CaM. Three micromolar polymerized actin was incubated with 500
nM VLN5 with or without 50 µM CaM in the presence of 1 mM free Ca2+. The mixtures were
centrifuged at 13,600g for 30 min.
(A) SDS-PAGE separation showing that the amount of sedimented actin filaments was decreased
in the presence of CaM. Lanes 1 and 2 represent samples of supernatant (S) and pellet (P) for actin
alone; lanes 3 and 4 represent samples of supernatant and pellet for actin plus 500 nM VLN5;
lanes 5 and 6 represent samples of supernatant and pellet for actin plus 500 nM VLN5 in the
presence of 50 µM CaM, respectively.
(B) Plot of the percentage of VLN5 and actin in the pellet. Error bars represent mean ± SD (n = 3),
(*P < 0.05 by a student’s t-test).
(C-E) Micrographs of actin filaments stained with rhodamine-phalloidin.
(C) Individual actin filaments in the absence of villin. The image was captured at a 500-ms
exposure time.
(D) Actin filament bundles formed in the presence of 0.5 µM VLN5. The image was captured at
150-ms exposure time.
(E) Actin bundles formed in the presence of 0.5 µM VLN5 with the addition of CaM. The image
15
![Page 16: Supplemental Figure 1. 2+ - Plant Cell · Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257 Supplemental Figure 3. The level of VLN1 and VLN2 transcripts was](https://reader034.vdocuments.net/reader034/viewer/2022042419/5f35fb8d22cbc0157e09812f/html5/thumbnails/16.jpg)
Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257
was captured at a 150-ms exposure time. Bar in (D) = 10 µm.
16
![Page 17: Supplemental Figure 1. 2+ - Plant Cell · Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257 Supplemental Figure 3. The level of VLN1 and VLN2 transcripts was](https://reader034.vdocuments.net/reader034/viewer/2022042419/5f35fb8d22cbc0157e09812f/html5/thumbnails/17.jpg)
Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257
Supplemental Figure 13. Direct visualization of VLN severing activity by time-lapse TIRFM.
The detail method is described in the method section and Figure 11A legend.
(A) Time-lapse images of actin filaments severing in the presence of 0.5 nM human villin at 1 µM
free Ca2+. See Supplemental Movie 4 for the entire time series.
(B) Time-lapse images of actin filaments severing in the presence of 5 nM VLN5 at 100 nM free
Ca2+. See Supplemental Movie 5 for the entire time series.
(C) Time-lapse images of actin filaments severing in the presence of 5 nM VLN5 at 10 µM free
Ca2+. See Supplemental Movie 6 for the entire time series.
(D) Time-lapse images of actin filaments severing in the presence of 5 nM VLN5 at 100 µM free
Ca2+. See Supplemental Movie 7 for the entire time series.
(E) Time-lapse images of actin filaments severing in the presence of 5 nM VLN5 at 1 mM free
Ca2+. See Supplemental Movie 8 for the entire time series. Scale bar = 20 µm.
17
![Page 18: Supplemental Figure 1. 2+ - Plant Cell · Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257 Supplemental Figure 3. The level of VLN1 and VLN2 transcripts was](https://reader034.vdocuments.net/reader034/viewer/2022042419/5f35fb8d22cbc0157e09812f/html5/thumbnails/18.jpg)
Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257
Supplemental Table 1. List of primers used in genotyping, plasmid construction and RT-PCR
Name Primer sequence(5’-3’) DescriptionLP5-1 CCAAGAATCAGAGGTTCCACC For
genotyping of
VLN5 T-DNA
insertion lines
RP5-1 AAAATTCAGGTCTGGCGAATC
LP5-2 AAAGATCCTTCTCGAAGCAGC
RP5-2 GAGGATCACTCTCTCCATCCC
LP2-1 CCAAGAATCAGAGGTTCCACC
RP2-1 AAAATTCAGGTCTGGCGAATC
LP2-2 AAAGATCCTTCTCGAAGCAGC
RP2-2 GAGGATCACTCTCTCCATCCC
LBGABI ATATTGACCATCATACTCATTGC
LBSAIL GCCTTTTCAGAAATGGATAAATAGCCTTGCTTCC
v5pF GGGGACAAGTTTGTACAAAAAAGCAGGCTACTCGTTAGTCCGTTTTGTT For VLN5
promoter
GUS fusion
construction
v5pR GGGGACCACTTTGTACAAGAAAGCTGGGTCTCTGGTTTTTGCAAATCTTT
v5IF TCTAGACCATGGCTAAATATAAGAAACCAATC For VLN5
RNAi
construction
v5IR GGATCCATTTAAATCCTCTGAGTCGGTTTTAAGG
pLat52F GAATTCTGTCGACATACTCGACTCAG
pLat52R CTCGAGTTTAAATTGGAATTTTTTTT
v5F1 GCCCATGGCGTTTTCCATGAGAGATTTA For VLN5
full-length
CDS cloning
and VLN5
insertion lines
RT-PCR
analysis
v5R1 CGGCGGCCGCTTAGAAGAGATTGACAGACAT
v5F2 CTCGGTAAAGATTCCAGCCA
v5R2 CAATGTATGGCTTCGGTTCG
v5F3 ACAAGTTGACCCAAAGAAGA
v5R3 TTAGAAGAGATTGACAGACA
v1TF TCTTACTCTTGGTCTGAAAT
v1TR TTAGAAAAGATGAAGAGATA
v2TF CATCGTTGTTATTTGGCACT
v2TR CTAGAACAAGTCGAACTTCT
eIF4AF GGGTATCTATGCTTACGGTTTCG
eIF4AR CAGAGAACACTCCAACCTGAATC
v5F1 GCCCATGGCGTTTTCCATGAGAGATTTA For RT-PCR
(VLN5 tissue
distribution)
V5bR CTTAACCAGGCCTTGAACGTTAACTCCTTG
Tubulin2F GGTATCCAGGTCGGAAATGC
Tubulin2R TCCCGTAGTCAACAGAAAGT
qVLN5F GTTTCGGGTTCAAGGTTCTG For Real-time
PCR (vln5
RNAi lines)
qVLN5R GAGGAAGTAAGATTGCCACACC
qeIF4AF TGACCAGAGGCTGAATGAAGT
qeIF4AR CGTAAGCATAGATACCCCTAAGAA
18
![Page 19: Supplemental Figure 1. 2+ - Plant Cell · Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257 Supplemental Figure 3. The level of VLN1 and VLN2 transcripts was](https://reader034.vdocuments.net/reader034/viewer/2022042419/5f35fb8d22cbc0157e09812f/html5/thumbnails/19.jpg)
Supplemental Data. Zhang et al. (2010). Plant Cell 10.1105/tpc.110.076257
Supplemental References: Schmid, M., Davison, T.S., Henz, S.R., Pape, U.J., Demar, M., Vingron, M., Scholkopf, B., Weigel,
D., and Lohmann, J.U. (2005). A gene expression map of Arabidopsis thaliana development. Nat Genet 37, 501-506.
19