Upload File

supplementary figure 2

3
Supplementary figure 2. Guillemin et al. Supplementary figure 2. Expression of BCL2L10 in human oocytes analyzed by immunofluorescence. Detection of BCL2L10 pertaining to different maturational stages of human oocytes.GV(A),MI(B),MII-stage (C) oocytes visualized by immunofluorescence with anti BCL2L10 antibody (upperpanel) and phase contrast (lower panel).Control staining without primary antibody) was consistently negative(D). Degenerating, unfertilized oocyte (E). For eight BCL-2 family proteins (BCL-2, BCL-X, BFL-1, BCL-W, MCL-1, BID, BIM, BMF, BAD) analyzed in this manner, no appreciable immunofluorescence was detected, except for BCL-X, MCL-1 and BAD (not shown).

Upload: lindsay

Post on 05-Jan-2016

48 views

Category:

Documents


1 download

Report

DESCRIPTION

Guillemin et al. Supplementary figure 2. Supplementary figure 2 . Expression of BCL2L10 in human oocytes analyzed by immunofluorescence. - PowerPoint PPT Presentation

TRANSCRIPT

Page 1: Supplementary figure 2

Supplementary figure 2.

Guillemin et al.

Supplementary figure 2. Expression of BCL2L10 in human oocytes analyzed by immunofluorescence.Detection of BCL2L10 pertaining to different maturational stages of human oocytes.GV(A),MI(B),MII-stage (C) oocytes visualized by immunofluorescence with anti BCL2L10 antibody (upperpanel) and phase contrast (lower panel).Control staining without primary antibody) was consistently negative(D). Degenerating, unfertilized oocyte (E). For eight BCL-2 family proteins (BCL-2, BCL-X, BFL-1, BCL-W, MCL-1, BID, BIM, BMF, BAD) analyzed in this manner, no appreciable immunofluorescence was detected, except for BCL-X, MCL-1 and BAD (not shown).

Page 2: Supplementary figure 2

Supplementary figure 3.

Supplementary figure 3. (A) Yeast two-hybrid interaction matrix for BCL2L10, BCL2, BAX and binding partners isolated in the screen. Yeast clones expressing BCL2L10, BCL2, and BAX in bait vector pGILDA were mated by replica plating with clones expressing BCL2L10, BAX, p53, ß-actin, -actin, HINT1 and TCTP in prey vector pJG4-5. Picture was taken after 48 h incubation at 30°C. Interactions are measured by the development of a blue color following induction of the LacZ reporter gene. BCL2L10 appears to bind to BAX, HINT1and TCTP as revealed by light blue coloration. BCL2 binds most strongly to BAX and TCTP, as well as to ß-actin, -actin and HINT1. BAX binds to itself but not to the other proteins. Expression of the different proteins has been checked by Western blotting (notshown). The BAX-BAX and BAX-BCL2 interactions served as positive controls for the yeast two-hybrid interaction assay. (B) Histidin pull down assay of the interaction in vitrobetween GST-BCL2L10 and TCTP-His6.TCTP-His6was fixed on Ni-NTA beads and GST (lane 2) or GST-BCL2L10 (lane 3) was applied on the complex. After elution, the attached protein complexes were resolved in a 12% polyacrylamidegel. Anti-GST and anti-TCTP antibodies were used in the Western blot. TCTP-His6bound specifically to GST-BCL2L10 (lane 3), whereas no interaction between TCTP-His6and GST was detected (lane2). Lane 1 (control): GST-BCL2L10 did not interact with Ni-NTA resin. (C) Indirect ELISA binding assay. Increasing concentrations of purified His-tagged TCTP was used to coat wells of a 96-well plate. Serial dilutions of GST-BCL2L10 were incubated with immobilized TCTP-His6. Binding was detected using anti-GST antibody. GST-BCL2L10 demonstrates dose-dependent binding to immobilized TCTP-His6. GST alone did not demonstrate significant binding to immobilized TCTP-His6. Intensity of the linear signal obtained with GST was subtracted from each experimental point.

Page 3: Supplementary figure 2

Supplementary figure 4.

Guillemin et al.

Supplementary figure 4. Confocal images of in vitro matured human oocytes showing TCTP/tubulin double-staining.MII-stage human oocytes (C, D) were double-stained with antibodies against TCTP and microtubules. Panels A5-A8 and B5-B8, are enlarged images from A1-A4 and B1-B4, respectively. Panel A and panel B represent two different focal planes of the same oocyte.Microtubules and TCTP are abundant in the peripheral region (A4, A8) and around the meiotic apparatus (B4, B8). Scale bar, 10μm.


Supplementary Figure 2. Kunogi M et al

images.nature.com · Web viewSupplementary Figure 7 Supplementary Figure 3 Supplementary Figure 1 Supplementary Materials Supplementary Figures S1-S7 Supplementary Tables S1-S7 Clinical

Supplementary Figure S1

Supplementary appendix · Supplementary Figure 1. Funnel Plot for total symptoms Supplementary Figure 2. ... positive, negative and general symptom scores are not reported we estimated

Supplementary Figure Legends

Supplementary Information SUPPLEMENTARY … · SUPPLEMENTARY INFORMATION 2 | RESEARCH Supplementary Information 3 Fig. S2 Figure S2: Carbon Rearrangement Networks Used in Various

Supplementary Figure 1. Removing one copy of Rb1 gene … · 2019-11-14 · Supplementary Figure 2 Supplementary Figure 2. The ganglion cells, bipolar cells and horizontal cells in

SUPPLEMENTARY INFORMATION - Geophysicsgeophysics.wustl.edu/seminar/2010_Tauzin_NatureGeo_SOM.pdf · SUPPLEMENTARY INFORMATION doi: 10.1038/ngeo969 2 Supplementary Figure S1 Global

Supplementary Figure 2

Supplementary Figure 3

Supplementary Figure 1 - Nature · Supplementary Figure 1 ... Supplementary Figure 3. Activation of HIF-1 activity by UCHL1 overexpression. ... EMT6/EF-Luc/EV-1, 2 and

Zuo -Supplementary Figure 1 (page 1 of 2)

Supplementary Figure 5

Supplementary Material Figure 2. Phylogenetic

1 Supplementary Figures 2 3 Supplementary Figure 1: TRPV1 expression … · 2017-05-10 · 1 1 Supplementary Figures 2 3 Supplementary Figure 1: TRPV1 expression in the ACC of both

Supplementary Figures: Supplementary Figure 1 – PANCAN ...df6sxcketz7bb.cloudfront.net/manuscripts/88000/88755/jci.insight.88755.sd.pdfSupplementary Figures: Supplementary Figure

Supplementary Figure 1

Supplementary Figure 1 - dm5migu4zj3pb.cloudfront.net · Supplementary Figure 1 A B 0 10 20 30 40 ... Oral glucose tolerance test (OGTT) ... Supplementary Figure 2 A) ) 0.5 0 1 1.5

SUPPLEMENTARY MATERIAL: SUPPLEMENTARY FIGURE 2cambridge.org:id:article:S... · SUPPLEMENTARY MATERIAL: SUPPLEMENTARY FIGURE 2 Image gallery to accompany John Robb (2015), “Prehistoric

Supplementary Figure · 2015. 1. 14. · 2 Supplementary Figure Supplementary Figure 1. Standard and Selected Samples. Chen et al. (2015) Asian Australas. J. Anim. Sci. 28:158-165

Supplementary figure 2

media.nature.com · 1 Supplementary Materials Supplementary Table S1 Supplementary Table S2 Supplementary Table S3 Supplementary Figure S1 Supplementary Figure S2 Supplementary Figure

Supplementary Figure 1. - NHGRI: Research Server Figure 1. ... Supplementary Figure 2. ... 16 rs2402354TCTGGGTGCCTGAAGTTTCT GAGGGACAGCTCCATTCATC 28,442,316 T T C T C T TTTTTTTTTT TCTCTT

Supplementary Figure 1. Supplementary Figure 2 Supplementary Figure 3 A B

Supplementary figure 2. Guillemin et al. Supplementary figure 2. Expression of BCL2L10 in human oocytes analyzed by immunofluorescence. Detection of BCL2L10

images.nature.com · Web viewVahid Asnafi2, Elizabeth Macintyre 2, Els Verhoeyen1,3 and Melania Tesio2 SUPPLEMENTA L DATA Supplementary figure 1 Supplementary figure 2 Supplementary

SUPPLEMENTARY FIGURE 2 - AACR Journals · 2015. 11. 26. · Vehicle ML264 (2 x 25 mg/kg) KL F5 # 1 A KL F5 # 2 KL F5 # 3 Supplementary Figure 2. Title: SUPPLEMENTARY FIGURE 2 Created

Supplementary Figure 1 - Welcome to the UCLA …€¦ ·  · 2016-06-151 Supplementary Figure 1 Supplementary Figure 1. ... Supplementary Figure 5 Supplementary Figure 5. ... JP10089

Supplementary Figure 1

Supplementary Figure 2

Supplementary information for: Discovery and … · Supplementary Figure S2 Supplementary Figure S3 Supplementary Figure S4 Supplementary Figure S5 Supplementary Figure S6 Supplementary

Supplementary Materials Supplementary Figure Legends

Supplementary Information Supplementary Figure S1. Phenotypic … · 2013-02-05 · 2 Supplementary Figures and Legends Fig.S1 Supplementary Figure S1. Phenotypic comparison of the

Supplementary Figure S26

SUPPLEMENTARY INFORMATIONmendel.stanford.edu/SidowLab/pdfs/2011ValouevEtAl_Supp.pdf · Supplementary Figure 2 Supplementary Figure 2. Schematic representation of in vitro reconstitution