supplementary materials for · 6/22/2016 · were purchased commercially with the exception of the...
TRANSCRIPT
![Page 1: Supplementary Materials for · 6/22/2016 · were purchased commercially with the exception of the antisera against Svp2, which we produced in rabbits against a bacterially-expressed](https://reader036.vdocuments.net/reader036/viewer/2022090516/604360293e2f73035932cbc1/html5/thumbnails/1.jpg)
www.sciencemag.org/content/352/6293/1576/suppl/DC1
Supplementary Materials for
Identification of an NKX3.1-G9a-UTY transcriptional regulatory network that controls prostate differentiation
Aditya Dutta, Clémentine Le Magnen, Antonina Mitrofanova, Xuesong Ouyang, Andrea Califano, Cory Abate-Shen*
*Corresponding author. Email: [email protected]
Published 24 June 2016, Science 352, 1576 (2016) DOI: 10.1126/science.aad9512
This PDF file includes:
Materials and Methods Supplementary Text Figs. S1 to S11 Tables S1 to S6 References
Other Supplementary Material for this manuscript includes the following: (available at www.sciencemag.org/cgi/content/full/352/6293/1576/DC1)
Databases S1 to S4
![Page 2: Supplementary Materials for · 6/22/2016 · were purchased commercially with the exception of the antisera against Svp2, which we produced in rabbits against a bacterially-expressed](https://reader036.vdocuments.net/reader036/viewer/2022090516/604360293e2f73035932cbc1/html5/thumbnails/2.jpg)
Dutta et al.
2
Materials and Methods
DescriptionoflentiviralvectorsAllproceduresusing lentivirusesweredoneaccording toapprovedproceduresas
specifiedbytheOfficeofEnvironmentalHealthandSafetyatColumbiaUniversityMedicalCenter. For expression of exogenous genes,we used the pTRIPZ vector (Dharmacon, GEHealthcareLifeSciences),whichwasengineeredtointroduceeitherIRES-RFPorIRES-GFPbetweenuniqueEcoRIandMluIsites(hereafterreferredtoas“modifiedpTRIPZ”).cDNAsequencesencodinggenesofinterest(i.e.,NKX3.1andothers)wereclonedintouniqueAgeIandEcoRIsitesinthemodifiedpTRIPZplasmid;theserestrictionsiteswereintroducedinthecDNAsbyPCRamplificationusingprimersthatalsocontainedsequencestointroduceFLAG and/or HA epitope tags at the 5-prime end. The pTRIPZ plasmid also contains atetracycline response element (TRE) such that gene expression can be regulated in adoxycycline-dependent manner. Gene knock-down studies were done using pGIPZlentiviruses (Dharmacon, GE Healthcare Life Sciences), which constitutively express therelevantshRNAmir(mircoRNA-adaptedshRNA,hereafterreferredtoasshRNA)aslistedinTableS5.AminimumoftwoindependentshRNAwereusedforeachgene;dataareshownforoneof them.Lentivirusesweregeneratedusingsecondgenerationpackagingvectors,psPAX2 and pMD2.G (Addgene), in HEK-293T cells (ATCC), and concentrated using theLenti-XConcentratorreagent(Clonetech)accordingtothemanufacturer.
AnalysesofNkx3.1germlinemutantmiceAllexperimentsusinganimalswereperformedaccordingtoprotocolsapprovedby
theInstitutionalAnimalCareandUseCommittee(IACUC)atColumbiaUniversityMedicalCenter.TheNkx3.1germlinemutantmicehavebeendescribedpreviously(3).Expressionprofilingof anteriorprostate and seminal vesicle from15monthNkx3.1mutantorwild-typemice was done on an Affymetrix platform (Mu74AV2) as described previously (6).Geneexpressionprofileswereanalyzedasin(29).DifferentiallyexpressedgenesfromthemouseseminalvesiclearelistedinDatasetS2.
Forexpressionprofilingofanteriorprostatefrom4-monthmice,RNAwaspreparedusing MagMAX-96 Total RNA Isolation Kit (Life Technologies, Grand Island, NY). RNAsequencinganalysiswasdoneat the JPSulzbergerColumbiaGenomeCenteratColumbiaUniversity Medical Center. A TruSeq RNA Sample Prep Kit v2 (Illumina) was used forlibrarypreparation followedby sequencing (30million reads, singleend)onan IlluminaHiSeq 2500. RNAseq data raw counts were normalized and the variance was stabilizedusingDESeqpackage(Bioconductor) inR-systemv3.1.1(TheRFoundation forStatisticalComputing,ISBN3-900051-07-0).TherawandnormalizeddatafilesaredepositedinGeneExpression Omnibus (GEO) (GSE81440). Differentially expressed genes are listed inDatasetS1.
For histological and immunofluorescence analyses, anterior prostatewas fixed in10%formalinandembedded inparaffin. Immunofluorescencestainingwasdoneusing3µmparaffinsectionsandanalyzedusingaLeicaTCSSP5confocalmicroscopeasdescribedpreviously(4,30).DetectionofmouseNkx3.1wasenhancedusingtyramideamplification(Perkin Elmer) with horseradish peroxidase (HRP)-conjugated secondary antibody(Invitrogen), followed by incubation with tyramide 488 as described (4). Details of all
![Page 3: Supplementary Materials for · 6/22/2016 · were purchased commercially with the exception of the antisera against Svp2, which we produced in rabbits against a bacterially-expressed](https://reader036.vdocuments.net/reader036/viewer/2022090516/604360293e2f73035932cbc1/html5/thumbnails/3.jpg)
Dutta et al.
3
primaryandsecondaryantibodiesusedinthisstudyareprovidedinTableS6.Allantiserawerepurchased commerciallywith the exceptionof the antisera against Svp2,whichweproducedinrabbitsagainstabacterially-expressedrecombinantprotein.Quantificationofstainingwas done using 5-10 independent sections (as indicated) from4-5 independentmice as done previously (4). Quantitative Real-time PCR (qRT-PCR) analysis wasperformed using total RNA isolated from anterior prostate using the QuantiTect SYBRGreenPCRkit(Qiagen)asdescribedpreviously(30).ThesequencesofallprimersusedinthisstudyareprovidedinTableS5.
AnalysesofRWPE1humanprostatecellsRWPE1cells(31)wereobtainedfromATCCandgrowninKeratinocyte-serumfree
media (K-SFM; Gibco, Life technologies). Sub-confluent cells were infected with pTRIPZlentiviruses expressing exogenous genes (or control) for 2 consecutive days at amultiplicity of infection (MOI) of approximately5, followedby selectionwithpuromycin(0.5μg/ml))forupto4days.Whereindicated,cellsweresubsequentlyinfectedwithpGIPZlentiviruses expressing the relevant shRNA (or control) using a similar procedure.Exogenous gene expressionwas inducedwith doxycycline (0.5 μg/ml).Where indicated,infectedcellswereenrichedbyFACSsortingonaBD-FACSAriacellsorter(BDBiosciences)to isolate those expressing RFP (561nm excitation, 582nm emission) and/or GFP (488excitation, 530nm emission). For expression profiling, RNA was prepared from infectedcellsandRNA-sequencinganalysiswasperformedasdescribedabove.Rawandnormalizeddata files are deposited in Gene Expression Omnibus (GEO) (GSE81440). DifferentiallyexpressedgenesarelistedinDatasetS4.
Forwesternblotanalysis, totalproteinextractswerepreparedby lysisof infectedcellswith1Xradioimmunoprecipitationassay(RIPA)buffer(0.1%SDS,1.0%deoxycolate-sodium salt, 1.0% Triton X-100, 0.15 M NaCl, 10 μmol/L Tris-HCl (pH 7.5), 1 mmol/LEDTA)with fresh 1% protease inhibitor (#1697498; Roche Basel) and 1% phosphataseinhibitor(#P2850;Sigma-Aldrich).Proteinlysates(20µgperlane)wereresolvedbySDSpage,followedbyimmunoblottingwiththeappropriateprimaryandsecondaryantibodies,andvisualizedusinganECLPlusWesternBlottingDetectionKit(GEHealthcare/AmershamBiosciences).DetailsofprimaryandsecondaryantibodiesusedinthisstudyareprovidedinTableS6.
Nuclearextractswerepreparedbylysisofcellsinhypotonicbuffer(20mMHEPES(pH 7.4), 5 mM NaCl, 1 mM EDTA (pH 8.0), 10 mM MgCl2, 1 mM DTT with fresh 1%protease inhibitor (#1697498; Roche Basel) and 1% phosphatase inhibitor (#P2850;Sigma-Aldrich). Nuclei were collected by centrifugation and proteins extracted withnuclearextractionbuffer(20mMHEPES(pH7.4),0.45MNaCl,0.2mMEDTA(pH8.0),25%glycerol,0.5mMDTT,0.5mMPMSFwith fresh1%protease inhibitor(#1697498;RocheBasel)and1%phosphataseinhibitor(#P2850;Sigma-Aldrich))followedbycentrifugation.Gel shift assays were done using nuclear extracts (5 μg) as described (32) with a DNAprobe corresponding to a previously describedNKX3.1 binding site containing themotif(TAAGTA)(33,34).
For identification of NKX3.1-interacting proteins by mass spectrometry, nuclearextractsfromcellsexpressingtheFlag-HA-taggedNKX3.1weresubjectedtotwosuccessiveroundsofimmunoprecipitation,firstwithAnti-Flag(M2)agarose(Sigma-Aldrich,A-2220)
![Page 4: Supplementary Materials for · 6/22/2016 · were purchased commercially with the exception of the antisera against Svp2, which we produced in rabbits against a bacterially-expressed](https://reader036.vdocuments.net/reader036/viewer/2022090516/604360293e2f73035932cbc1/html5/thumbnails/4.jpg)
Dutta et al.
4
and eluted with a Flag peptide (Sigma-Aldrich, F3290), and then with Anti-HA (HA-7)agarose (Sigma-Aldrich, A2095) and eluted with HA peptide (Sigma-Aldrich, I2149).Immunoprecipitated protein complexes were resolved by SDS PAGE gel electrophoresisand visualized by silver staining (for detection of protein bands) or Coomassie blue (formassspectrometricanalysis).
Mass spectrometric analysiswas done at the Proteomics Shared Resource at theHerbert IrvingComprehensiveCancerCenter,ColumbiaUniversityMedicalCenter. In-geldigestionwascarriedoutonrehydrateddriedgelpiecesusingTrypsinGold(Promega)in50mMammoniumbicarbonateovernightat37°C.Peptideswereextractedwithamixtureofacetonitrile(ACN)andformicacid(FA)andLC-MS/MSanalysiswasperformedusingaThermoFusionTribridmassspectrometerequippedwithanEASY-Spraysource(ThermoScientific).Massspectrometer-scanningfunctionsandHPLCgradientswerecontrolledbyan Xcalibur data system (Thermo Finnigan, San Jose, CA). Tandem mass spectra weresearched against a Bsubilits168 human protein database using the ProteomeDiscoverer1.4(ThermoFinnigan,SanJose,CA),whichusesaprobability-basedscoringsystemtoratethe relevance of the best matches found by the SEQUEST algorithm. For validation ofinteracting proteins, RWPE1 cells expressing Flag-HA-taggedNKX3.1were lysed inRIPAbuffer (asabove),pre-clearedusingProteinA/G, followedby immunoprecipitationusingAnti-Flag (M2) agarose (Sigma, A-2220). Eluted proteins were subject to western blotanalyses.
TissueandcellrecombinationassaysTissue recombination assays were done using adult mouse epithelium and rat
embryonic urogenitalmesenchyme as previously described (3,4,35). Briefly, embryonicurogenital sinus mesenchyme was isolated from embryonic day 18.0 rat embryos, anddissociated cell suspensions were obtained following manual dissection and a series ofenzymatic digestions as described (4, 35). For isolation of the mouse epithelial cells,prostate (all lobes combined) or seminal vesicle was isolated from 8-10week oldmalemiceandepithelialcellswereisolatedfollowingdissociationbymanualdissectionfollowedbyaseriesofenzymaticdigestionsasdescribed(4,35).Thedissociatedmouseepithelialcellswereinfectedusingthespininfectionmethod.Briefly,500,000cellsin1mlofmedia(DMEM+10%FBS+1%PenStrep)supplementedwith8μg/mlpolybrenewereinfectedwith lentiviruses (MOIof15) inacentrifugepreheated to32°Cat1500g for60minutes.Cells were resuspended by pipetting, transferred to a 1.5 ml tube and recentrifuged asabove. For recombinantsmadewithhumanRWPE1 cells as a source of epithelium, cellswere infected with indicated lentiviruses followed by FACS sorting to enrich for cellsexpressingtherelevantlentivirusesasdescribedabove.
Tissuerecombinantsweremadebymixingthedissociatedmesenchymalcellswiththeepithelialcells(mouseorhuman;250,000totalcells)inaratioof3:1(mesenchymaltoepithelial cells) in rat collagen(BDBiosciences) insettingsolution (10XEarle’sBalancedSalt Solution (Life Technologies), 0.2MNaHCO3, 50mMNaOH). The recombinantswereculturedovernight inDMEMmediaplus10%FBS(formouserecombinants)or inK-SFMmedia (for RWPE1 recombinants) supplementedwith 10-7M dihydrotestosterone (DHT,Sigma-Aldrich) and 1x Rock Inhibitor (Stem Cell Technologies). On the following day,recombinants were grafted under the kidney capsule of 6-8 week old male nude mice
![Page 5: Supplementary Materials for · 6/22/2016 · were purchased commercially with the exception of the antisera against Svp2, which we produced in rabbits against a bacterially-expressed](https://reader036.vdocuments.net/reader036/viewer/2022090516/604360293e2f73035932cbc1/html5/thumbnails/5.jpg)
Dutta et al.
5
(Taconic); the mice were implanted with a testosterone pellet (90 day release, 12.5mg/pellet, Innovative Research of America). The grafts were grown for 90 days duringwhich time the nude host mice were fed doxycycline in drinking water to maintainexogenous gene expression. At the conclusion, host mice were sacrificed and the renalgrafts collected for histological and immunochemical analyses, as described above. Forexpressionprofiling,RNAwasprepared from the recovered tissue recombinants (mouseonly) and RNA-sequencing analysis was performed as described above. Raw andnormalized data files are deposited in Gene Expression Omnibus (GEO) (GSE81440).DifferentiallyexpressedgenesarelistedinDatasetS3.
AnalysisofNKX3.1targetgenesThe NKX3.1 target genes studied herein were selected from those reported
previouslyformouseprostate(36)thatwerealsofoundtobetargetgenesforNKX3.1inhumancells(RWPE1).GeneswereprioritizedbyfocusingonGOannotationsforprocessesassociated with development or differentiation, namely “embryonic organ development”,“chromatinmodification”,“multicellularorganismaldevelopment”,“Wntsignalingpathway”,“endothelial cell proliferation”, “post-embryonic development”, “anterior/posterior patternspecification”, “determination of left/right symmetry”, and “pattern specification process”.ConfirmationofNKX3.1bindingtothesesiteswasdonebychromatinimmunoprecipitationfollowedbyrealtimePCR(ChIP-qPCRanalysis)asdescribed(37).Theexpressionlevelsoftarget genes in RWPE1 cells or NKX3.1-expressing RWPE1 cells was performed asdescribed(30).ChIPdataareexpressedasfoldenrichmentofNKX3.1orG9Abinding,andnormalized to input; IgG controls were used for all pull down experiments. PrimersequencesandantibodiesaredescribedinTablesS5andS6,respectively.
StatisticalanalysisStatistical analyses were conducted using a 2-tailed t-test, χ2 test, or Fisher's exact test as
appropriate. Differential gene expression was estimated with a 2-tailed student t-test. Gene set enrichment analysis (GSEA) (38) was performed as described previously (30); p-value<0.05 was considered significant. GraphPad Prism software (Version 5.0) and R-system v3.1.1 (The R Foundation for Statistical Computing, ISBN 3-900051-07-0) were used for all statistical analyses and data visualization.
![Page 6: Supplementary Materials for · 6/22/2016 · were purchased commercially with the exception of the antisera against Svp2, which we produced in rabbits against a bacterially-expressed](https://reader036.vdocuments.net/reader036/viewer/2022090516/604360293e2f73035932cbc1/html5/thumbnails/6.jpg)
Dutta et al.
6
Supplementary Text
Loss-of-function of Nkx3.1 in aged and young mice leads to impaired prostatedifferentiation
ToinvestigatemolecularchangesfromprostatesofNkx3.1wild-type(Nkx3.1+/+)andNkx3.1mutant(Nkx3.1—/—)mice,wecomparedexpressionprofilesfromyoungadults(i.e.,~2-4months of age), which display differentiation defects, with agedmice (i.e.,~12-15monthsofage),whichdisplayaprominentPINphenotype(3,29)(Figs.1,S1,andS2). Inparticular, in prostates from both young and aged Nkx3.1—/— versus Nkx3.1+/+ mice,differentially-expressed genes include down-regulation of those associatedwith prostatedifferentiation and luminal epithelial cell differentiation, and up-regulation of thoseassociated with basal cells (Figs. 1A,B, S1B, S2A,B; Dataset S1 and (6)). In addition, weobserved up-regulation of genes that are not normally expressed in prostate, includingthoseexpressed in theseminalvesicle(Figs.1A,B,S1B,S2A,B;DatasetsS1andS2, (7,39,40).AmonggenesthatdistinguishprostateandseminalvesicleinbothmiceandhumansisFOXA1, which has been shown to play a role in prostate differentiation and cancerpredisposition(41).
Expressionofaprostate-specificmarker,probasin,wassignificantlyreducedinyoungandagedNkx3.1—/—prostatesatboththeproteinandmRNAlevels;conversely,expressionof the seminal vesicle marker, Svp2, was significantly up-regulated in the Nkx3.1—/—
prostate, while it was rare/negligible in Nkx3.1+/+prostate (Figs. S1C,D, S2C; Table S1).Although Svp2-postive cells were present in both young and agedNkx3.1—/—prostates,theywereapproximately4-timesmoreprevalentintheagedmice,wheretheyrepresented8% (N=683/8727)of the total epithelial cells (Figs. S1E;Tables S2,3).Notably, all of theSvp2-positivecellsexaminedinboththeyoungandagedprostates(N=782total)expresscytokeratin8 (Ck8), consistentwith their relationship toNkx3.1-expressing luminal cells(Fig. S1E; Tables S2,3). These Svp2-positive cells retained the ability to proliferate,particularly in the young mice in which approximately 13% of the Svp2-positive cells(N=27/213) express Ki67, a marker of cellular proliferation (Fig. S1E; Tables S2,3).Interestingly,theseSvp2-positivecells,particularlyintheagedmice,frequentlyco-expresscytoplasmic p21 (43% of the Svp2-positive cells; N=277/648) (Fig. S1E; Tables S2,3),which has oncogenic functions (42), suggesting that these Svp2-positive cells mayrepresentpre-neoplasticcells.
InductionofprostatedifferentiationbyNKX3.1ismediatedbyUTY(KDM6c)WeinvestigatedbonafidetargetgenesofNKX3.1,whichwedefineasthosethatare
bothdirectlyboundbyNKX3.1at theirpromoter/enhancerregions inprostatecells,andwhoseexpressionisregulatedbyNKX3.1.Amongpotentialcandidates(36),wefocusedonthose that have functions predicted for differentiation, and that are conserved betweenmice and humans (Fig. S8). Although NKX3.1 has been reported to function as atranscriptional repressor in transient transfection assays (43), its bona fidetarget genesinclude those that are both activated and repressed by NKX3.1 in mouse and humanprostate (Fig. S8B,C). Someof these targetgenes, includingbothactivatedand repressedones,werealsoboundbyG9a(Fig.4A,S9).Notably,althoughbindingbyG9atothesegeneswasdependentonNKX3.1,bindingofNKX3.1wasnotdependentonG9a(Fig.4A,S9).
![Page 7: Supplementary Materials for · 6/22/2016 · were purchased commercially with the exception of the antisera against Svp2, which we produced in rabbits against a bacterially-expressed](https://reader036.vdocuments.net/reader036/viewer/2022090516/604360293e2f73035932cbc1/html5/thumbnails/7.jpg)
Dutta et al.
7
Supplementary Figures Figure S1
Fig. S1. Loss-of-function of Nkx3.1 leads to impaired prostate differentiation in aged mice (A) Diagram of the male urogenital system in adult mice highlighting the embryological origins of the tissues. Tissues in dark grey (i.e., prostate and others) are derived from the urogenital sinus, which is of endodermal origin, whereas those in light grey (i.e., seminal vesicle and others) are derived from the Wolffian duct, which is of mesodermal origin. Reprinted from (2, 3). (B) Heat map representations of differentially expressed genes comparing mouse (top; 15 months of age) or human (bottom) normal (i.e., wild-type) prostate versus seminal vesicle. The mouse heatmap (top) represents a subset of differentially expressed genes listed in Dataset S2 (p < 0.0001), and the human heatmap (bottom) represents a subset of differentially expressed genes published in (44). (C) Histological analyses of anterior prostate from Nkx3.1+/+ or Nkx3.1-/- mice at 12 months of age. Representative H&E stained sections or confocal images showing co-staining of Probasin or Svp2 with E-cadherin and DAPI as indicated. Scale bars represent 50 µm
![Page 8: Supplementary Materials for · 6/22/2016 · were purchased commercially with the exception of the antisera against Svp2, which we produced in rabbits against a bacterially-expressed](https://reader036.vdocuments.net/reader036/viewer/2022090516/604360293e2f73035932cbc1/html5/thumbnails/8.jpg)
Dutta et al.
8
in the H&E images and 20 µm in the immunofluorescence images. (D) (Left) Real-time PCR showing relative mRNA levels for probasin or Svp2(Svs4) in anterior prostate. (Right) Quantification of Svp2-positive cells in anterior prostate. (E) (Left) Confocal images from representative sections of anterior prostate from Nkx3.1-/- mice at 12 months of age showing co-staining of Svp2-positive cells with Ck8, a marker of luminal cells, Ki67, a marker of cellular proliferation, and cytoplasmic p21, a marker of neoplasia. (Right) Quantification of co-expression of these markers with Svp2. The graphs in D and E show quantification of the data provided in Table S1-3.
![Page 9: Supplementary Materials for · 6/22/2016 · were purchased commercially with the exception of the antisera against Svp2, which we produced in rabbits against a bacterially-expressed](https://reader036.vdocuments.net/reader036/viewer/2022090516/604360293e2f73035932cbc1/html5/thumbnails/9.jpg)
Dutta et al.
9
Figure S2
Fig. S2. Loss-of-function of Nkx3.1 leads to impaired prostate epithelial differentiation in young mice
(A)HeatmaprepresentationsofdifferentiallyexpressedgenesfromtheanteriorprostateofNkx3.1+/+versusNkx3.1-/-miceat4monthsofage.TheheatmaprepresentsasubsetofdifferentiallyexpressedgeneslistedinDatasetS1(p<0.0001).(B)GSEAperformedusingas a query gene set the differentially-expressed genes from the mouse seminal vesicleversusprostate(wild-type)(fromDatasetS2(p<0.0001))comparedwithareferencegenesignatureofNkx3.1-/-versusNkx3.1+/+mouseprostate(4monthsofage)(fromDatasetS1).(C)HistologicalanalysesofanteriorprostatefromNkx3.1+/+orNkx3.1-/-miceat4monthsof age. Shown are representative H&E stained sections or immunofluorescence imagesshowingco-stainingofProbasinorSvp2withE-cadherinandDAPI,asindicated. Scalebarsrepresent 50 µm in the H&E images and 20 µm in the immunofluorescence images.QuantificationoftheseimmunofluorescenceisprovidedinTablesS1-3.
![Page 10: Supplementary Materials for · 6/22/2016 · were purchased commercially with the exception of the antisera against Svp2, which we produced in rabbits against a bacterially-expressed](https://reader036.vdocuments.net/reader036/viewer/2022090516/604360293e2f73035932cbc1/html5/thumbnails/10.jpg)
Dutta et al.
10
Figure S3
Fig.S3.Controlexperimentsfortissuerecombinationstudies(A) Whole mount images showing low and high power views of control recombinantsgenerated using only rat urogenital mesenchyme (left) or mouse prostate epithelium(right).Therulershowscmscale.Summaryofdata isprovided inTableS4. (B)Confocalimages using DAPI staining of tissue recombinants to distinguish ratmesenchymal cellsandmouseepithelialcells,asshown.
![Page 11: Supplementary Materials for · 6/22/2016 · were purchased commercially with the exception of the antisera against Svp2, which we produced in rabbits against a bacterially-expressed](https://reader036.vdocuments.net/reader036/viewer/2022090516/604360293e2f73035932cbc1/html5/thumbnails/11.jpg)
Dutta et al.
11
Figure S4
Fig. S4. Analyses of expression profiling of mouse tissue recombinants
These analyses compare tissue recombinants made from mouse prostate epithelium (PE) or mouse seminal vesicle epithelium (SVE), which were infected with a control lentivirus or with a lentivirus expressing a mouse Nkx3.1 (+Nkx3.1). The epithelial tissues were recombined in vitro with mesenchyme from rat embryonic urogenital sinus and grown in host mice for 3 months. Following sacrifice, RNA was made from the tissue recombinants and the samples were
![Page 12: Supplementary Materials for · 6/22/2016 · were purchased commercially with the exception of the antisera against Svp2, which we produced in rabbits against a bacterially-expressed](https://reader036.vdocuments.net/reader036/viewer/2022090516/604360293e2f73035932cbc1/html5/thumbnails/12.jpg)
Dutta et al.
12
subjected to RNASeq analysis (see materials and methods). A complete list of differentially expressed genes is provided in Dataset S3. (A) Real-time PCR showing relative mRNA levels for the indicated genes in the indicated tissue recombinants. Experiments were done using 4 samples per group and performed in triplicate; values were normalized to GAPDH. The p-values were calculated using a 2-tailed t-test. (B) Principal component analysis showing a comparison of the gene expression profiles from the PE, SVE, and SVE+Nkx3.1 tissue recombinants. (C) GSEA performed using as a query gene set the differentially-expressed genes from the mouse seminal vesicle versus prostate (wild-type) (from Dataset S2) compared with a reference gene signature of SVE and SVE+Nkx3.1 (left) or SVE and PE (right) (from Dataset S3).
![Page 13: Supplementary Materials for · 6/22/2016 · were purchased commercially with the exception of the antisera against Svp2, which we produced in rabbits against a bacterially-expressed](https://reader036.vdocuments.net/reader036/viewer/2022090516/604360293e2f73035932cbc1/html5/thumbnails/13.jpg)
Dutta et al.
13
Figure S5
![Page 14: Supplementary Materials for · 6/22/2016 · were purchased commercially with the exception of the antisera against Svp2, which we produced in rabbits against a bacterially-expressed](https://reader036.vdocuments.net/reader036/viewer/2022090516/604360293e2f73035932cbc1/html5/thumbnails/14.jpg)
Dutta et al.
14
Fig.S5.PhenotypeofhumanRWPE1cellsShown are wholemounts and H&E images of the tissue recombinant phenotypesmadefrom human RPWE1 cells, which had been infected with a control lentivirus or with alentivirusexpressinghumanNKX3.1withorwithouttheindicatedshRNA.Epithelialcellswere recombined in vitro with mesenchyme from rat embryonic urogenital sinus andgrowninhostmicefor3months(asinmaterialsandmethods).Representativeimagesareshown;asummaryofalltissuerecombinantsisprovidedinTableS4.Scalebarsrepresent500µm,100µm,and50µm,intheupper,middle,andlowerpanels,respectively.
![Page 15: Supplementary Materials for · 6/22/2016 · were purchased commercially with the exception of the antisera against Svp2, which we produced in rabbits against a bacterially-expressed](https://reader036.vdocuments.net/reader036/viewer/2022090516/604360293e2f73035932cbc1/html5/thumbnails/15.jpg)
Dutta et al.
15
Figure S6
Fig.S6.Massspectrometryanalysis(A)DiagramoftheexperimentalstrategyforFigs.3A,B,S6andS7.HumanRWPE1prostateepithelialcellswereinfectedwitha lentivirusexpressinghumanNKX3.1taggedattheN-terminus with Flag and HA epitopes (Flag-HA-NKX3.1), or with a series of truncatedNKX3.1 proteins, or the control vector (see Fig. S7). Nuclear extracts from the Flag-HA-NKX3.1-expressingRWPE1 cells (or the control)were subjected to immunoprecipitationfollowed by mass spectrometry to identify the associated proteins (Fig. 3A, S6B,C).Alternatively, extracts were analyzed by immunoprecipitation or gel retardation assays(Fig.3B,S7).(B)SilverstainshowingtheresultsofimmunoprecitationofFlag-HA-NKX3.1to identify endogenous interacting proteins. *NS, non-specific protein bands. Relativepeptide counts are indicated for NKX3.1 (bait) and other interacting partners. (C) Tabledescribingtheproteinsidentifiedfrommassspectrometryanalysis.
![Page 16: Supplementary Materials for · 6/22/2016 · were purchased commercially with the exception of the antisera against Svp2, which we produced in rabbits against a bacterially-expressed](https://reader036.vdocuments.net/reader036/viewer/2022090516/604360293e2f73035932cbc1/html5/thumbnails/16.jpg)
Dutta et al.
16
Figure S7
Fig.S7:NKX3.1interactswithG9ahistonemethyltransferaseviathehomeodomain(A)Diagramshowingrelevantproteindomainspresent in theNKX3.1truncatedproteinsas well as a summary of their DNA binding properties and protein interactions. (+++)indicates strong interaction, (-) indicates no detectable interaction. (B) Western blotanalysis following immunoprecipitation of Flag-HA-NKX3.1, or the indicated truncatedproteins, fromRWPE1cellsconfirmingassociationwithG9aand itspartnerGLP,butnotwithtwounrelatedhistonemethyltransferases,EZH2andSUV39H1.Inputshows5%ofthetotal inputprotein, and immunoprecipitation (IP) showsproteins recovered following IPusinganantibodytoFlag.Actinisacontrolforproteinloading.(C)GelretardationanalysisdoneusingnuclearextractsfromRWPE1cellsexpressingthecontrolvector,NKX3.1,orthevarious truncated proteins as shown. The arrow indicates the free DNA probe. Allimmunoprecipitation and gel shift experiments were performed with 3 independentbiologicalreplicates;representativedataareshown.
![Page 17: Supplementary Materials for · 6/22/2016 · were purchased commercially with the exception of the antisera against Svp2, which we produced in rabbits against a bacterially-expressed](https://reader036.vdocuments.net/reader036/viewer/2022090516/604360293e2f73035932cbc1/html5/thumbnails/17.jpg)
Dutta et al.
17
Figure S8
Fig. S8: Gene expression and chromatin binding analyses of NKX3.1 target genes
(A) Table describing NKX3.1 target genes investigated in this study. These represent asubsetof thegenesdescribed in (36). (B)Real timePCRshowingexpressionanalysesofNKX3.1targetgenesinmouseprostate(left;comparingNkx3.1wild-typeandmutantmice)andhumanRWPE1prostatecells(right;comparingcellsexpressingexogenousNKX3.1orthe control vector). (C) ChIP-qPCR analyses showing the relative levels of NKX3.1 atNKX3.1binding sites at target genes inRWPE1 cells expressing exogenousNKX3.1. ChIPdataisexpressedasenrichmentofNKX3.1bindingrelativetoinput.Realtimeexpressionanalysiswasperformedwith4independentbiologicalreplicates.ChIP-qPCRanalysiswasperformedwith3 independentbiologicalreplicates.Statisticalanalyseswasdoneusinga2-tailedt-test;dataareindicatedasmean+/-SD.
![Page 18: Supplementary Materials for · 6/22/2016 · were purchased commercially with the exception of the antisera against Svp2, which we produced in rabbits against a bacterially-expressed](https://reader036.vdocuments.net/reader036/viewer/2022090516/604360293e2f73035932cbc1/html5/thumbnails/18.jpg)
Dutta et al.
18
Figure S9
Fig.S9.BindingofG9atoNKX3.1targetgenes(A) Diagram of the experimental strategy for Figs. 4A and S9. Human RWPE1 prostateepithelialcellswereinfectedwithalentivirusexpressinghumanNKX3.1(withRFP)orthecorrespondingcontrolvector, followedbyinfectionwithanshRNAforG9a(withGFP)orthe corresponding control vector. The cells were FACS sorted to enrich for those co-infectedwithbothplasmids(i.e.,expressingbothRFPandGFP)andanalyzedbyreal-timePCRorChIPanalysis.(B,C)ChIP-qPCRanalysesshowingtherelativelevelsofNKX3.1(B)orG9a(C)atNKX3.1bindingsitesinRWPE1cellswithcontrolvector(control),expressingexogenous NKX3.1, exogenous G9a, and/or with shG9a, as indicated. ChIP data areexpressed as enrichment ofNKX3.1orG9abinding relative to input. ChIP-qPCRanalysiswasperformedwith3independentbiologicalreplicates.Statisticalanalysiswasdoneusinga2-tailedt-test;dataareindicatedasmean+/-SD.
![Page 19: Supplementary Materials for · 6/22/2016 · were purchased commercially with the exception of the antisera against Svp2, which we produced in rabbits against a bacterially-expressed](https://reader036.vdocuments.net/reader036/viewer/2022090516/604360293e2f73035932cbc1/html5/thumbnails/19.jpg)
Dutta et al.
19
Figure S10
Fig. S10. Analyses of expression profiling of mouse tissue recombinants
These analyses compare expression profiles of tissue recombinants made from mouse prostate epithelium (PE) or seminal vesicle epithelium (SVE) infected with a control lentivirus or with a lentivirus expressing a mouse Nkx3.1 (+Nkx3.1) (as in Fig. S4) compared with those generated using SVE expressing an shUty (SVE+shUty) or with SVE expressing an shUty as well as exogenous Nkx3.1 (SVE+Nkx3.1+shUty). A complete list of differentially expressed genes is provided in Dataset S3. (A) Principal component analysis showing a comparison of PE, SVE, and SVE+Nkx3.1 with SVE+shUTY and SVE+Nkx3.1+shUTYtissue recombinants. (B) GSEA performed using as a query gene set differentially expressed genes from the mouse seminal vesicle versus prostate (wild-type) (from Dataset S2) compared with a reference gene signature of SVE+Nkx3.1+shUty and SVE+Nkx3.1.
![Page 20: Supplementary Materials for · 6/22/2016 · were purchased commercially with the exception of the antisera against Svp2, which we produced in rabbits against a bacterially-expressed](https://reader036.vdocuments.net/reader036/viewer/2022090516/604360293e2f73035932cbc1/html5/thumbnails/20.jpg)
Dutta et al.
20
Figure S11
Fig.S11.Model(A)DiagramdepictingtheabilityforexogenousNkx3.1tore-specifymouseseminalvesicleepithelium to form prostate in vivo, which is abrogated following knock-down of Uty(shUty). In human RPWE1 cells, exogenous NKX3.1 promotes prostate growth in vivo,which isabrogated followingknock-downofG9a(shG9a)orUTY(shUTY). (B)Schematicdiagramshowing theexpressionofNKX3.1 in threescenariosand itsrelationship toG9aandUTY.Innon-prostatictissues,NKX3.1isnotexpressedandthereforedoesnotrecruitG9a to target genes, such asUTY. Scenario 2 shows normal prostate,whereinNKX3.1 isexpressed and recruits G9a to target genes such as UTY to promote their expression.Scenario 3 shows abnormal prostate,wherein reduced levels of NKX3.1 lead to reducedactivation of target genes such at UTY, which is likely associated with cancerpredisposition.
![Page 21: Supplementary Materials for · 6/22/2016 · were purchased commercially with the exception of the antisera against Svp2, which we produced in rabbits against a bacterially-expressed](https://reader036.vdocuments.net/reader036/viewer/2022090516/604360293e2f73035932cbc1/html5/thumbnails/21.jpg)
Dutta et al.
21
Table S1: Quantification of SVP2-positive cells in mouse anterior prostate
Mouse # Age (months)
Total epithelial cells
Total SVP2+ cells
Percentage of SVP2+cells
Nkx3.1-/- 1 12 2869 178 6.2% 2 12 2847 324 11.8% 3 12 3011 181 6.0% Total 8727 683 8.0% +/- 3.3 4 4 3353 65 1.9% 5 4 2626 32 1.2% Total 5979 97 1.6%+/- 0.5 Nkx3.1+/+ 1 12 2104 0 0% 2 12 1942 0 0% Total 4046 0 0% 3 4 2478 0 0% 4 4 1565 0 0% Total 4043 0 0%
![Page 22: Supplementary Materials for · 6/22/2016 · were purchased commercially with the exception of the antisera against Svp2, which we produced in rabbits against a bacterially-expressed](https://reader036.vdocuments.net/reader036/viewer/2022090516/604360293e2f73035932cbc1/html5/thumbnails/22.jpg)
Dutta et al.
22
Table S2: Cellular characteristics of SVP2 positive cells in the Nkx3.1—/— anterior prostate
Cytokeratin Staining Mouse # Age
(mths) Total
SVP2+ Total
SVP2+ CK8+
Percent SVP2+ CK8+
Total SVP2+ CK5+
Percent SVP2+ CK5+
1 12 194 193 99.5 1 0.5 2 12 219 219 100 0 0 3 12 141 141 100 1 0.7 Total 554 553 99.8 +/- 0.3 2 0.4 +/- 0.4 4 4 97 97 100 0 0 5 4 131 131 100 0 0 Total 228 228 100 +/- 0 0 0 p21 staining Mouse # Age
(mths) Total SVP+
Total SVP2+ cyto 21+
Percent SVP2+ cyto 21+
1 12 270 96 35.6 2 12 102 45 44.1 3 12 276 136 49.2 Total 648 277 43.0 +/- 6.9 4 4 54 12 22.2 5 4 135 41 30.4 Total 189 53 26.3 +/- 5.8 Ki67 (proliferation) Mouse # Age
(mths) Total
SVP2+ Total SVP2+
Ki67+ Percent SVP2+
Ki67+ 1 12 185 6 3.2 2 12 109 2 1.8 Total 294 8 2.5 +/- 1.0 3 4 35 7 20.0 4 4 116 11 9.5 5 4 62 9 14.5 Total 213 27 14.7 +/- 5.3
![Page 23: Supplementary Materials for · 6/22/2016 · were purchased commercially with the exception of the antisera against Svp2, which we produced in rabbits against a bacterially-expressed](https://reader036.vdocuments.net/reader036/viewer/2022090516/604360293e2f73035932cbc1/html5/thumbnails/23.jpg)
Dutta et al.
23
Table S3: Cellular characteristics of SVP2 positive cells in Nkx3.1+/+ anterior prostate
Cytokeratin Staining Mouse # Age
(mths) Total
SVP2+ Total
SVP2+ CK8+
Percent SVP2+ CK8+
Total SVP2+ CK5+
Percent SVP2+ CK5+
1 12 0 0 0 0 0 2 12 0 0 0 0 0 Total 0 0 0 0 0 3 4 0 0 0 0 0 4 4 0 0 0 0 0 Total 0 0 0 0 0 p21 staining Mouse # Age
(mths) Total SVP+
Total SVP2+ cyto 21+
Percent SVP2+ cyto 21+
1 12 0 0 0 2 12 0 0 0 Total 0 0 0 3 4 0 0 0 4 4 0 0 0 Total 0 0 0 Ki67 (proliferation) Mouse # Age
(mths) Total
SVP2+ Total SVP2+ plus Ki67+
Percent SVP2+ plus Ki67+
1 12 0 0 0 2 12 0 0 0 Total 0 0 0 3 4 0 0 0 4 4 0 0 0 Total 0 0 0
![Page 24: Supplementary Materials for · 6/22/2016 · were purchased commercially with the exception of the antisera against Svp2, which we produced in rabbits against a bacterially-expressed](https://reader036.vdocuments.net/reader036/viewer/2022090516/604360293e2f73035932cbc1/html5/thumbnails/24.jpg)
Dutta et al.
24
Table S4: Summary of cell and tissue recombination assays
Description Phenotypec # Analyzed
Control grafts
UGMa without epithelium No tissue growth 4
Mouse prostate epithelium (PE) without UGM No tissue growth 2
Mouse seminal vesicle epithelium (SVE) without UGM No tissue growth 2
Human RWPE1 cells alone without UGM No tissue growth 2
Grafts made with mouse epitheliumb
PE infected with control vector + UGM (Positive control for prostate)
Prostate phenotype 19
SVE infected with control vector + UGM (Positive control for seminal vesicle)
Seminal vesicle phenotype 20
SVE infected with Nkx3.1 + UGM Prostate phenotype 26
SVE infected with NKX3.1 (human) + UGM Prostate phenotype 4
SVE infected with Msx1 + UGM Seminal vesicle phenotype 3
SVE infected with shUty + UGM Seminal vesicle phenotype 8
SVE infected with Nkx3.1 + shUty + UGM Seminal vesicle phenotype 8
Grafts made with human epithelium (RWPE1 cells)
RWPE1 infected with control vector + UGM No tissue growth 12
RWPE1 infected with NKX3.1 + UGM Prostate phenotype 15
RWPE1 infected with NKX3.1(T164A) + UGM No tissue growth 7
RWPE1 infected with shG9A + UGM No tissue growth 9
RWPE1 infected with NKX3.1 plus shG9A + UGM No tissue growth 9
RWPE1 infected with shSUV39H1 + UGM No tissue growth 7
RWPE1 infected with NKX3.1 plus shSUV39H1 + UGM Prostate phenotype 9
RWPE1 infected with shUTY + UGM No tissue growth 8
RWPE1 infected with NKX3.1 plus shUTY + UGM No tissue growth 8
RWPE1 infected with shEDEM2 + UGM No tissue growth 4
RWPE1 infected with NKX3.1 plus shEDEM2 + UGM Prostate phenotype 4
a) UGMstandsforurogenitalsinusmesenchymeobtainedfromratembryosb) Mouseepitheliumobtainedfrom2-4montholdadultmice(wild-type)c) Prostate phenotype was assessed by the following criteria: (1) morphological appearance of
prostaticducts;(2)histologicalappearanceofprostate-likemorphology;(3)expressionofprostatemarkersincludingprobasinandFOXA1.
![Page 25: Supplementary Materials for · 6/22/2016 · were purchased commercially with the exception of the antisera against Svp2, which we produced in rabbits against a bacterially-expressed](https://reader036.vdocuments.net/reader036/viewer/2022090516/604360293e2f73035932cbc1/html5/thumbnails/25.jpg)
Dutta et al.
25
Table S5: Description of primers and shRNA used in this study
Real Time qPCR Forward Reverse
Human genes
ASNS GGAAGACAGCCCCGATTTACT AGCACGAACTGTTGTAATGTCA
HDLBP GAGAGCGACCCTCCAACCTA CTCCAGGGGTACATGGAACAC
PRDX6 GTGACAGCTCGTGTGGTGTT CTGGGGTGGCAACCCTTTT
CTSB AGAGTTATGTTTACCGAGGACCT GATGCAGATCCGGTCAGAGA
NEDD4L GGACAATTTAGGCCGAACTTACT CTCCAAGTCTTCGCTGATGTG
UTRN CCATCCGTGAGGTAGAGACAC CTCGGGGACTCTCATGCTC
EDEM2 CTGGTCGGCAACCACATTGAT CATCGAAGCGGGTGTAGTTCC
UTY TTAGCCTGACAGTCGAGGAAA GTAGGGTCTTCGTTCTGGCG
IGF1R TCGACATCCGCAACGACTATC CCAGGGCGTAGTTGTAGAAGAG
HK2 TGCCACCAGACTAAACTAGACG CCCGTGCCCACAATGAGAC
ANGPT2 AACTTTCGGAAGAGCATGGAC CGAGTCATCGTATTCGAGCGG
GAPDH ACAACTTTGGTATCGTGGAAGG GCCATCACGCCACAGTTTC
Mouse genes
Asns GCAGTGTCTGAGTGCGATGAA TCTTATCGGCTGCATTCCAAAC
Hdlbp GGAAAGAGCGGAGCCAACAT CCCTCAATTCGGATCAGGTTAC
Prdx6 CGCCAGAGTTTGCCAAGAG TCCGTGGGTGTTTCACCATTG
Ctsb TCCTTGATCCTTCTTTCTTGCC ACAGTGCCACACAGCTTCTTC
Nedd4l CACGGGTGGTGAGGAATCC GCCGAGTCCAAGTTGTGGT
Utrn GTATGGGGACCTTGAAGCCAG ATCGAGCGTTTATCCATTTGGT
Edem2 ATGCCTTTCCGGCTACTCATC CCTTGACTCGCTCCCTGTAGT
Uty GAGGTTTTGTGGCATGGGAG TGCAGAAGATAACGAAGGAGCTA
Igf1r GTGGGGGCTCGTGTTTCTC GATCACCGTGCAGTTTTCCA
Hk2 TGATCGCCTGCTTATTCACGG AACCGCCTAGAAATCTCCAGA
Angpt2 CCTCGACTACGACGACTCAGT TCTGCACCACATTCTGTTGGA
Gapdh AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA
Probasin AAGGCTCACCATTGAGAACCT CAGTTGGCACTTAGTCCCTTTC
Svp2 GTTCTGAGCCAGAGGTATTTGTT TCGAGTGCATCTTGAGAAAACC
Exogenous Nkx3.1 GATTACAAGGATGACGACGATAAGGGT GAAGGAGGTGAGCCGCTTG
Total Nkx3.1 ATGCTTAGGGTAGCGGAGC TGCGGATTGCCTGAGTGTC
Sva TGAACCCCGTAACTACACACT GGCATTGCTTCACGTTGTTTT
FoxA1 ATGAGAGCAACGACTGGAACA TCATGGAGTTCATAGAGCCCA
ChIP Forward Reverse
![Page 26: Supplementary Materials for · 6/22/2016 · were purchased commercially with the exception of the antisera against Svp2, which we produced in rabbits against a bacterially-expressed](https://reader036.vdocuments.net/reader036/viewer/2022090516/604360293e2f73035932cbc1/html5/thumbnails/26.jpg)
Dutta et al.
26
ASNS CTGATGTAATTAGTAAAATACGATTTAAGA CCCCATCTCTAAAACAATAAAATC
HDLBP ATTCCGTTCCGCCCAGT ATTCCTTATGTCCCTCACTTTTATAAACTA
PRDX6 TCGCCATGCCCGGAGGTCTGCTTC GGCTGAGCGGCCGGGAGG
CTSB GAAGGTGGCGGGAGGGGG GAGAGCCTGCAGCCCAGCC
NEDD4L CCAAGTAGGCACTTTGACGTTTCCTTTT CACCCAGCTACCGTTTCTCTAGC
UTRN CTCGGGGCCTCAGTTTAGCTCCC ATCACTGGCCCAGCGCCC
EDEM2 CTTCCTTCTTTAACCCGGT ATGTTTTAATAATAACAGCTAGCATGTATT
UTY CGAGCTGTCCCTCTTACC AACACCACTTTTTTCTTACTTTCTCAATTG
IGF1R GCAAGGCAGTTTTTCATCTAA TGTCATTAAATTAATATTTGGGTTTGAATC
HK2 CTGGGCAACATATCGAGTCCCTGC AAAGGTTCAGGGAAGGAAGATGAAGGTCTG
ANGPT2 AGGAACTTTCATTGTACTTCAACATTAAAG GAATGCCTGCCCTCCAAC
Gel Shift Top strand Bottom strand
NKX3.1 GATCCATATATTAAGTATATATAGGATC GATCCTATATATACTTAATATATGGAT
shRNA Clone ID Mature Antisense
shG9a #1 V3LHS_364364 TGAGTTGAAGCGCAAACCA
shG9a #2 V2LHS_44409 TAAATTCCTGGAGCAATCG
shSUV39H1 #1 V2LHS_153686 TGTAATCAAAGGTGAGCTC
shSUV39H1 #2 V3LHS_403672 AGAGCAGGTAGGAGCAGGT
shUTY #1 V3LHS_380228 TAAACTAGACTTGTAGTCT
shUTY #2 V3LHS_380229 TCATTGTTAGCTTCTACCA
shEDEM2 #1 V2LHS_156353 TATCAAAGTCCACGCTGTC
shEDEM2 #2 V2LHS_156355 TATACTCTAGGAACATGGC
shUty #1 V3LMM_491456 ATCTGAACATGTTGATTCA
shUty #2 V2LMM_50864 TTATTAAGGCTGGAAATCG
shUty #3 V2LMM_49926 TAGAGAAAGTGTTTCTGTG
Scramble RHS4743 N/A
![Page 27: Supplementary Materials for · 6/22/2016 · were purchased commercially with the exception of the antisera against Svp2, which we produced in rabbits against a bacterially-expressed](https://reader036.vdocuments.net/reader036/viewer/2022090516/604360293e2f73035932cbc1/html5/thumbnails/27.jpg)
Dutta et al.
27
Table S6: List of antibodies used in this study
Antigen Company Catalog # Type Use and dilution
IF Western ChIP IP AR Abcam ab133273 Rabbit mAb 1:100 1:1000
β-actin Cell Signaling 4970 Rabbit mAb 1:2000
Cytokeratin 5 Covance SIG-3475 Chicken pAb 1:1000
Covance PRB-160P Rabbit pAb 1:1000
Cytokeratin 8 Covance MMS-162P Mouse mAb 1:500 1:1000
E-cadherin BD Biosciences 610181 Mouse mAb 1:1000
Cell Signaling 3195 Rabbit mAb 1:500
Edem2 Sigma E1782 Rabbit pAb 1:1000
Ezh2 Millipore 07-689 Rabbit pAb 1:2000
Flag Sigma A2220 Mouse mAb 1:10 1:40
FoxA1 Abcam ab55178 Mouse mAb 1:100 1:1000
G9a MBL D141-3 Hamster mAb 1:1000
Abcam ab40542 Rabbit pAb 1:40
Glp MBL D220-3 Hamster mAb 1:1000
H3K9me2 Abcam ab1220 Mouse mAb 1:2000 1:40
H3K9me3 Abcam ab8898 Rabbit pAb 1:3000
H3K27me3 Millipore 07-449 Rabbit pAb 1:2000
HA Sigma A2095 Mouse mAb 1:40
HoxB13 Santa Cruz sc66923 Rabbit pAb 1:50 1:200
Ki67 eBiosciences 14-5698-82 Rat 1:500
NKX3.1 Abate-Shen Lab 67 Rabbit pAb 1:1000
Nkx3.1 Gift from C. Bieberich
0315 Rabbit pAb 1:1000
Abate-Shen Lab DE1 Rabbit pAb 1:2000 1:2000
p21 BD Biosciences 556431 Mouse mAb 1:10
P63 Santa Cruz sc-8431 Mouse mAb 1:500
Probasin Santa Cruz sc-17124 Goat pAb 1:500
PSA Dako M0750 Mouse mAb 1:500
Suv39h1 Millipore 07-550 Rabbit pAb 1:250
SVP2 Abate-Shen Lab -- Rabbit pAb 1:700
T TMPRSS2 Abcam ab92323 Rabbit mAb 1:1000
UTY Abcam ab85969 Rabbit pAb 1:500
Secondary antibodies used:
![Page 28: Supplementary Materials for · 6/22/2016 · were purchased commercially with the exception of the antisera against Svp2, which we produced in rabbits against a bacterially-expressed](https://reader036.vdocuments.net/reader036/viewer/2022090516/604360293e2f73035932cbc1/html5/thumbnails/28.jpg)
Dutta et al.
28
Antibody Fluorochrome Company Catalog # Dilution
Goat anti-rabbit IgG Alexa Fluor® 488 Life Technologies A11008 1/1000
Goat anti-rabbit IgG Alexa Fluor® 555 Invitrogen A21428 1/1000
Goat anti-mouse IgG Alexa Fluor® 488 Life Technologies A11001 1/1000
Goat anti-mouse IgG Alexa Fluor® 555 Life Technologies A21424 1/1000
Goat anti-mouse IgG Alexa Fluor® 647 Life Technologies A21237 1/1000
Goat anti-chicken IgG Alexa Fluor® 488 Invitrogen A11039 1/1000
Donkey anti-goat IgG Alexa Fluor® 555 Invitrogen A21432 1/1000
Donkey anti-mouse IgG Alexa Fluor® 488 Invitrogen A21202 1/1000
Goat anti-rabbit IgG HRP None Invitrogen T30954 1/1000
![Page 29: Supplementary Materials for · 6/22/2016 · were purchased commercially with the exception of the antisera against Svp2, which we produced in rabbits against a bacterially-expressed](https://reader036.vdocuments.net/reader036/viewer/2022090516/604360293e2f73035932cbc1/html5/thumbnails/29.jpg)
Dutta et al.
29
Additional Data table S1 (separate file)
DatasetS1:DifferentiallyexpressedgenescomparingNkx3.1wild-typeandmutantmiceat4months(p<0.0001)
DatasetS2:Differentiallyexpressedgenescomparingprostateandseminalvesicleat15months(p<0.001)
DatasetS3:Differentiallyexpressedgenescomparingmousetissuerecombinants(p<0.0001)
Dataset S4: Differentially expressed genes comparing control and NKX3.1-expressingRWPE1cells(p<0.0001)
![Page 30: Supplementary Materials for · 6/22/2016 · were purchased commercially with the exception of the antisera against Svp2, which we produced in rabbits against a bacterially-expressed](https://reader036.vdocuments.net/reader036/viewer/2022090516/604360293e2f73035932cbc1/html5/thumbnails/30.jpg)
References 1. C. Abate-Shen, M. M. Shen, Molecular genetics of prostate cancer. Genes Dev. 14, 2410–2434
(2000). Medline doi:10.1101/gad.819500
2. G. R. Cunha, A. A. Donjacour, P. S. Cooke, S. Mee, R. M. Bigsby, S. J. Higgins, Y. Sugimura, The endocrinology and developmental biology of the prostate. Endocr. Rev. 8, 338–362 (1987). Medline doi:10.1210/edrv-8-3-338
3. R. Bhatia-Gaur, A. A. Donjacour, P. J. Sciavolino, M. Kim, N. Desai, P. Young, C. R. Norton, T. Gridley, R. D. Cardiff, G. R. Cunha, C. Abate-Shen, M. M. Shen, Roles for Nkx3.1 in prostate development and cancer. Genes Dev. 13, 966–977 (1999). Medline doi:10.1101/gad.13.8.966
4. X. Wang, M. Kruithof-de Julio, K. D. Economides, D. Walker, H. Yu, M. V. Halili, Y. P. Hu, S. M. Price, C. Abate-Shen, M. M. Shen, A luminal epithelial stem cell that is a cell of origin for prostate cancer. Nature 461, 495–500 (2009). Medline doi:10.1038/nature08361
5. Z. A. Wang, R. Toivanen, S. K. Bergren, P. Chambon, M. M. Shen, Luminal cells are favored as the cell of origin for prostate cancer. Cell Reports 8, 1339–1346 (2014). Medline doi:10.1016/j.celrep.2014.08.002
6. X. Ouyang, T. L. DeWeese, W. G. Nelson, C. Abate-Shen, Loss-of-function of Nkx3.1 promotes increased oxidative damage in prostate carcinogenesis. Cancer Res. 65, 6773–6779 (2005). Medline doi:10.1158/0008-5472.CAN-05-1948
7. M. C. Ostrowski, M. K. Kistler, W. S. Kistler, Purification and cell-free synthesis of a major protein from rat seminal vesicle secretion. A potential marker for androgen action. J. Biol. Chem. 254, 383–390 (1979). Medline
8. Materials and methods are available as supplementary materials on Science Online.
9. S. L. Zheng, J. H. Ju, B. L. Chang, E. Ortner, J. Sun, S. D. Isaacs, J. Sun, K. E. Wiley, W. Liu, M. Zemedkun, P. C. Walsh, J. Ferretti, J. Gruschus, W. B. Isaacs, E. P. Gelmann, J. Xu, Germ-line mutation of NKX3.1 cosegregates with hereditary prostate cancer and alters the homeodomain structure and function. Cancer Res. 66, 69–77 (2006). Medline doi:10.1158/0008-5472.CAN-05-1550
10. T. R. Bürglin, M. Affolter, Homeodomain proteins: An update. Chromosoma 2015, 1–25 (2015). Medline http://dx.doi.org/10.1007/s00412-015-0543-8
11. Y. Shinkai, M. Tachibana, H3K9 methyltransferase G9a and the related molecule GLP. Genes Dev. 25, 781–788 (2011). Medline doi:10.1101/gad.2027411
12. M. Tachibana, K. Sugimoto, M. Nozaki, J. Ueda, T. Ohta, M. Ohki, M. Fukuda, N. Takeda, H. Niida, H. Kato, Y. Shinkai, G9a histone methyltransferase plays a dominant role in euchromatic histone H3 lysine 9 methylation and is essential for early embryogenesis. Genes Dev. 16, 1779–1791 (2002). Medline doi:10.1101/gad.989402
13. J. Wang, C. Abate-Shen, The MSX1 homeoprotein recruits G9a methyltransferase to repressed target genes in myoblast cells. PLOS ONE 7, e37647 (2012). Medline doi:10.1371/journal.pone.0037647
14. B. Lehnertz, C. Pabst, L. Su, M. Miller, F. Liu, L. Yi, R. Zhang, J. Krosl, E. Yung, J. Kirschner, P. Rosten, T. M. Underhill, J. Jin, J. Hébert, G. Sauvageau, R. K. Humphries, F. M. Rossi,
30
![Page 31: Supplementary Materials for · 6/22/2016 · were purchased commercially with the exception of the antisera against Svp2, which we produced in rabbits against a bacterially-expressed](https://reader036.vdocuments.net/reader036/viewer/2022090516/604360293e2f73035932cbc1/html5/thumbnails/31.jpg)
The methyltransferase G9a regulates HoxA9-dependent transcription in AML. Genes Dev. 28, 317–327 (2014). Medline doi:10.1101/gad.236794.113
15. C. Wang, J. E. Lee, Y. W. Cho, Y. Xiao, Q. Jin, C. Liu, K. Ge, UTX regulates mesoderm differentiation of embryonic stem cells independent of H3K27 demethylase activity. Proc. Natl. Acad. Sci. U.S.A. 109, 15324–15329 (2012). Medline doi:10.1073/pnas.1204166109
16. K. B. Shpargel, T. Sengoku, S. Yokoyama, T. Magnuson, UTX and UTY demonstrate histone demethylase-independent function in mouse embryonic development. PLOS Genet. 8, e1002964 (2012). Medline doi:10.1371/journal.pgen.1002964
17. G. van Haaften, G. L. Dalgliesh, H. Davies, L. Chen, G. Bignell, C. Greenman, S. Edkins, C. Hardy, S. O’Meara, J. Teague, A. Butler, J. Hinton, C. Latimer, J. Andrews, S. Barthorpe, D. Beare, G. Buck, P. J. Campbell, J. Cole, S. Forbes, M. Jia, D. Jones, C. Y. Kok, C. Leroy, M. L. Lin, D. J. McBride, M. Maddison, S. Maquire, K. McLay, A. Menzies, T. Mironenko, L. Mulderrig, L. Mudie, E. Pleasance, R. Shepherd, R. Smith, L. Stebbings, P. Stephens, G. Tang, P. S. Tarpey, R. Turner, K. Turrell, J. Varian, S. West, S. Widaa, P. Wray, V. P. Collins, K. Ichimura, S. Law, J. Wong, S. T. Yuen, S. Y. Leung, G. Tonon, R. A. DePinho, Y. T. Tai, K. C. Anderson, R. J. Kahnoski, A. Massie, S. K. Khoo, B. T. Teh, M. R. Stratton, P. A. Futreal, Somatic mutations of the histone H3K27 demethylase gene UTX in human cancer. Nat. Genet. 41, 521–523 (2009). Medline doi:10.1038/ng.349
18. Y. F. Lau, J. Zhang, Expression analysis of thirty one Y chromosome genes in human prostate cancer. Mol. Carcinog. 27, 308–321 (2000). Medline doi:10.1002/(SICI)1098-2744(200004)27:4<308::AID-MC9>3.0.CO;2-R
19. C. P. Chaturvedi, A. M. Hosey, C. Palii, C. Perez-Iratxeta, Y. Nakatani, J. A. Ranish, F. J. Dilworth, M. Brand, Dual role for the methyltransferase G9a in the maintenance of beta-globin gene transcription in adult erythroid cells. Proc. Natl. Acad. Sci. U.S.A. 106, 18303–18308 (2009). Medline
20. B. Lehnertz, J. P. Northrop, F. Antignano, K. Burrows, S. Hadidi, S. C. Mullaly, F. M. Rossi, C. Zaph, Activating and inhibitory functions for the histone lysine methyltransferase G9a in T helper cell differentiation and function. J. Exp. Med. 207, 915–922 (2010). Medline doi:10.1084/jem.20100363
21. D. Bittencourt, D. Y. Wu, K. W. Jeong, D. S. Gerke, L. Herviou, I. Ianculescu, R. Chodankar, K. D. Siegmund, M. R. Stallcup, G9a functions as a molecular scaffold for assembly of transcriptional coactivators on a subset of glucocorticoid receptor target genes. Proc. Natl. Acad. Sci. U.S.A. 109, 19673–19678 (2012). Medline doi:10.1073/pnas.1211803109
22. D. Y. Lee, J. P. Northrop, M. H. Kuo, M. R. Stallcup, Histone H3 lysine 9 methyltransferase G9a is a transcriptional coactivator for nuclear receptors. J. Biol. Chem. 281, 8476–8485 (2006). Medline doi:10.1074/jbc.M511093200
23. V. K. Arora, E. Schenkein, R. Murali, S. K. Subudhi, J. Wongvipat, M. D. Balbas, N. Shah, L. Cai, E. Efstathiou, C. Logothetis, D. Zheng, C. L. Sawyers, Glucocorticoid receptor confers resistance to antiandrogens by bypassing androgen receptor blockade. Cell 155, 1309–1322 (2013). Medline doi:10.1016/j.cell.2013.11.012
24. H. J. Cooke, P. T. Saunders, Mouse models of male infertility. Nat. Rev. Genet. 3, 790–801 (2002). Medline doi:10.1038/nrg911
31
![Page 32: Supplementary Materials for · 6/22/2016 · were purchased commercially with the exception of the antisera against Svp2, which we produced in rabbits against a bacterially-expressed](https://reader036.vdocuments.net/reader036/viewer/2022090516/604360293e2f73035932cbc1/html5/thumbnails/32.jpg)
25. B. A. Weir, M. S. Woo, G. Getz, S. Perner, L. Ding, R. Beroukhim, W. M. Lin, M. A. Province, A. Kraja, L. A. Johnson, K. Shah, M. Sato, R. K. Thomas, J. A. Barletta, I. B. Borecki, S. Broderick, A. C. Chang, D. Y. Chiang, L. R. Chirieac, J. Cho, Y. Fujii, A. F. Gazdar, T. Giordano, H. Greulich, M. Hanna, B. E. Johnson, M. G. Kris, A. Lash, L. Lin, N. Lindeman, E. R. Mardis, J. D. McPherson, J. D. Minna, M. B. Morgan, M. Nadel, M. B. Orringer, J. R. Osborne, B. Ozenberger, A. H. Ramos, J. Robinson, J. A. Roth, V. Rusch, H. Sasaki, F. Shepherd, C. Sougnez, M. R. Spitz, M. S. Tsao, D. Twomey, R. G. Verhaak, G. M. Weinstock, D. A. Wheeler, W. Winckler, A. Yoshizawa, S. Yu, M. F. Zakowski, Q. Zhang, D. G. Beer, I. I. Wistuba, M. A. Watson, L. A. Garraway, M. Ladanyi, W. D. Travis, W. Pao, M. A. Rubin, S. B. Gabriel, R. A. Gibbs, H. E. Varmus, R. K. Wilson, E. S. Lander, M. Meyerson, Characterizing the cancer genome in lung adenocarcinoma. Nature 450, 893–898 (2007). Medline doi:10.1038/nature06358
26. M. M. Winslow, T. L. Dayton, R. G. Verhaak, C. Kim-Kiselak, E. L. Snyder, D. M. Feldser, D. D. Hubbard, M. J. DuPage, C. A. Whittaker, S. Hoersch, S. Yoon, D. Crowley, R. T. Bronson, D. Y. Chiang, M. Meyerson, T. Jacks, Suppression of lung adenocarcinoma progression by Nkx2-1. Nature 473, 101–104 (2011). Medline doi:10.1038/nature09881
27. C. M. Li, V. Gocheva, M. J. Oudin, A. Bhutkar, S. Y. Wang, S. R. Date, S. R. Ng, C. A. Whittaker, R. T. Bronson, E. L. Snyder, F. B. Gertler, T. Jacks, Foxa2 and Cdx2 cooperate with Nkx2-1 to inhibit lung adenocarcinoma metastasis. Genes Dev. 29, 1850–1862 (2015). Medline doi:10.1101/gad.267393.115
28. E. L. Snyder, H. Watanabe, M. Magendantz, S. Hoersch, T. A. Chen, D. G. Wang, D. Crowley, C. A. Whittaker, M. Meyerson, S. Kimura, T. Jacks, Nkx2-1 represses a latent gastric differentiation program in lung adenocarcinoma. Mol. Cell 50, 185–199 (2013). Medline doi:10.1016/j.molcel.2013.02.018
29. S. Irshad, M. Bansal, M. Castillo-Martin, T. Zheng, A. Aytes, S. Wenske, C. Le Magnen, P. Guarnieri, P. Sumazin, M. C. Benson, M. M. Shen, A. Califano, C. Abate-Shen, A molecular signature predictive of indolent prostate cancer. Sci. Transl. Med. 5, 202ra122 (2013). Medline doi:10.1126/scitranslmed.3006408
30. A. Aytes, A. Mitrofanova, C. W. Kinkade, C. Lefebvre, M. Lei, V. Phelan, H. C. LeKaye, J. A. Koutcher, R. D. Cardiff, A. Califano, M. M. Shen, C. Abate-Shen, ETV4 promotes metastasis in response to activation of PI3-kinase and Ras signaling in a mouse model of advanced prostate cancer. Proc. Natl. Acad. Sci. U.S.A. 110, E3506–E3515 (2013). Medline doi:10.1073/pnas.1303558110
31. D. Bello, M. M. Webber, H. K. Kleinman, D. D. Wartinger, J. S. Rhim, Androgen responsive adult human prostatic epithelial cell lines immortalized by human papillomavirus 18. Carcinogenesis 18, 1215–1223 (1997). Medline doi:10.1093/carcin/18.6.1215
32. C. Abate, D. Luk, R. Gentz, F. J. Rauscher 3rd, T. Curran, Expression and purification of the leucine zipper and DNA-binding domains of Fos and Jun: Both Fos and Jun contact DNA directly. Proc. Natl. Acad. Sci. U.S.A. 87, 1032–1036 (1990). Medline doi:10.1073/pnas.87.3.1032
33. P. J. Sciavolino, E. W. Abrams, L. Yang, L. P. Austenberg, M. M. Shen, C. Abate-Shen, Tissue-specific expression of murine Nkx3.1 in the male urogenital system. Dev. Dyn. 209, 127–138 (1997). Medline doi:10.1002/(SICI)1097-0177(199705)209:1<127::AID-AJA12>3.0.CO;2-Z
32
![Page 33: Supplementary Materials for · 6/22/2016 · were purchased commercially with the exception of the antisera against Svp2, which we produced in rabbits against a bacterially-expressed](https://reader036.vdocuments.net/reader036/viewer/2022090516/604360293e2f73035932cbc1/html5/thumbnails/33.jpg)
34. D. J. Steadman, D. Giuffrida, E. P. Gelmann, DNA-binding sequence of the human prostate-specific homeodomain protein NKX3.1. Nucleic Acids Res. 28, 2389–2395 (2000). Medline doi:10.1093/nar/28.12.2389
35. Z. A. Wang, A. Mitrofanova, S. K. Bergren, C. Abate-Shen, R. D. Cardiff, A. Califano, M. M. Shen, Lineage analysis of basal epithelial cells reveals their unexpected plasticity and supports a cell-of-origin model for prostate cancer heterogeneity. Nat. Cell Biol. 15, 274–283 (2013). Medline doi:10.1038/ncb2697
36. P. D. Anderson, S. A. McKissic, M. Logan, M. Roh, O. E. Franco, J. Wang, I. Doubinskaia, R. van der Meer, S. W. Hayward, C. M. Eischen, I. E. Eltoum, S. A. Abdulkadir, Nkx3.1 and Myc crossregulate shared target genes in mouse and human prostate tumorigenesis. J. Clin. Invest. 122, 1907–1919 (2012). Medline doi:10.1172/JCI58540
37. J. Wang, R. M. Kumar, V. J. Biggs, H. Lee, Y. Chen, M. H. Kagey, R. A. Young, C. Abate-Shen, The Msx1 homeoprotein recruits polycomb to the nuclear periphery during development. Dev. Cell 21, 575–588 (2011). Medline doi:10.1016/j.devcel.2011.07.003
38. A. Subramanian, P. Tamayo, V. K. Mootha, S. Mukherjee, B. L. Ebert, M. A. Gillette, A. Paulovich, S. L. Pomeroy, T. R. Golub, E. S. Lander, J. P. Mesirov, Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. U.S.A. 102, 15545–15550 (2005). Medline doi:10.1073/pnas.0506580102
39. Y. H. Chen, B. T. Pentecost, J. A. McLachlan, C. T. Teng, The androgen-dependent mouse seminal vesicle secretory protein IV: Characterization and complementary deoxyribonucleic acid cloning. Mol. Endocrinol. 1, 707–716 (1987). Medline doi:10.1210/mend-1-10-707
40. C. Guilbaud, A. M. Simon, G. Veyssière, C. Jean, Cloning and sequence analysis of a cDNA encoding an androgen-dependent mouse seminal vesicle secretory protein. J. Mol. Endocrinol. 10, 279–288 (1993). Medline doi:10.1677/jme.0.0100279
41. D. J. DeGraff, M. M. Grabowska, T. C. Case, X. Yu, M. K. Herrick, W. J. Hayward, D. W. Strand, J. M. Cates, S. W. Hayward, N. Gao, M. A. Walter, R. Buttyan, Y. Yi, K. H. Kaestner, R. J. Matusik, FOXA1 deletion in luminal epithelium causes prostatic hyperplasia and alteration of differentiated phenotype. Lab. Invest. 94, 726–739 (2014). Medline doi:10.1038/labinvest.2014.64
42. T. Abbas, A. Dutta, p21 in cancer: Intricate networks and multiple activities. Nat. Rev. Cancer 9, 400–414 (2009). Medline doi:10.1038/nrc2657
43. S. O. Simmons, J. M. Horowitz, Nkx3.1 binds and negatively regulates the transcriptional activity of Sp-family members in prostate-derived cells. Biochem. J. 393, 397–409 (2006). Medline doi:10.1042/BJ20051030
44. M. Thompson, J. Lapointe, Y. L. Choi, D. E. Ong, J. P. Higgins, J. D. Brooks, J. R. Pollack, Identification of candidate prostate cancer genes through comparative expression-profiling of seminal vesicle. Prostate 68, 1248–1256 (2008). Medline doi:10.1002/pros.20792
33