www.sciencemag.org/cgi/content/full/science.aaf6056/DC1

Supplementary Materials for

A selective insecticidal protein from Pseudomonas for controlling corn

rootworms

Ute Schellenberger, Jarred Oral, Barbara A. Rosen, Jun-Zhi Wei, Genhai Zhu, Weiping

Xie, Mark J. McDonald, David C. Cerf, Scott H. Diehn, Virginia C. Crane, Gary A.

Sandahl, Jian-Zhou Zhao, Timothy M. Nowatzki, Amit Sethi, Lu Liu, Zaiqi Pan, Yiwei

Wang, Albert L. Lu, Gusui Wu, Lu Liu*

*Corresponding author: E-mail lu.liu@pioneer.com

Published 22 September 2016 on Science First Release

DOI: 10.1126/science.aaf6056

This PDF file includes:

Materials and Methods

Figs. S1 to S3

Tables S1 to S5

References

2

Materials and Methods 25

Strain Isolation and identification. Soil samples were collected from various DuPont Pioneer 26

owned corn fields located in Iowa, Illinois and Wisconsin. Bacterial isolates were obtained by 27

suspending 5 g of soil with 20 ml of phosphate-buffered saline (PBS). Suspensions were plated 28

at dilutions ranging from 1:10 to 1:1000 onto Tryptic Soy broth (TSB) agar plates. Colonies 29

appearing after 2 days at 26oC were selected for growth in TSB medium at 26

oC. Cell pellets 30

were harvested by centrifugation and lysed with 25% BPER II (Thermo Fisher Scientific, 31

Waltham, MA, USA) in water (v/v) containing protease inhibitor cocktail V (Calbiochem, 32

Billerica, MA, USA), endonuclease and lysozyme at their respective vendor-recommended 33

working concentrations (Epicentre Biotechnologies, Madison, WI, USA). After 1 hour at 37 oC 34

lysates were cleared by centrifugation at 3000g and subjected to WCR bioassay. For species 35

identification of the WCR active isolate, genomic DNA was extracted with a bacterial Genomic 36

DNA Extraction Kit (Sigma-Aldrich, St. Louis, MO, USA) for 16S rDNA analysis (12). The 37

DNA concentration was determined using a NanoDrop spectrophotometer (Thermo Fisher 38

Scientific, Waltham, MA, USA). A 25 µl PCR reaction was set up by combining 80 ng genomic 39

DNA, 2 µl of 5 µM 16S ribosomal DNA primers AGAGTTTGATCMTGGCTCAG (forward) 40

and TACCTTGTTACGACTT (reverse), 1 µl 10 mM dNTP, 1x Phusion High-Fidelity buffer, 41

and 1 unit of Phusion High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA, 42

USA). The PCR reaction was run in a MJ Research PTC-200 Thermo Cycler (Bio-Rad 43

Laboratories, Hercules, CA, USA) using the following program: 96°C 1 min; 30 cycles 96°C 15 44

seconds, 52°C 2 minutes, 72°C 2 minutes; 72°C 10 minutes, followed by a holding step at 45

4°C. The PCR product was purified with QiaQuick DNA purification Kit (QIAGEN, Hilden, 46

Germany) and sequenced. The sequence was searched against the NCBI database using BLAST 47

(16) to identify the species of the isolate. 48

Bacterial genome sequencing. A bacterial genome sequencing sample of the active isolate was 49

prepared according to a library construction protocol developed by Illumina (San Diego, CA, 50

USA) and sequenced using the Illumina Genome Analyzer IIx. Sequences and quality scores 51

were generated with the Illumina Pipeline software for image analysis and base calling. After 52

initial base calling and processing, the sequencing files were converted to FASTQ format and 53

additional custom quality filtering was performed, such that reads were trimmed if they harbored 54

one or more base at their 3’ end with a quality score <15. Quality-filtered reads were assembled 55

into contigs using the Velvet assembler (25) set at default parameters. Contigs greater than 500 56

bp were considered for further analysis. For annotation, predicted open reading frames 57

(minimum size 100 nt) were identified between stop codons by the EMBOSS program getorf 58

(26). The predicted peptide sequences were annotated for function by BLASTP searches against 59

the NCBI NR database. 60

3

Isolation and Identification of IPD072Aa. An overnight culture of the WCR active 61

Pseudomonas isolate grown in Luria Broth was inoculated into shake flasks filled with 2x yeast 62

tryptone broth. Cell cultures were grown for 24 hours at 26°C at 250 rpm. Cells were harvested 63

by centrifugation, washed once with PBS, resuspended in 25 mM sodium acetate buffer, pH 5 64

(buffer A) and lysed by high pressure at 30,000 psi (Cell disrupter, Constant Systems Ltd., 65

Kennesaw, GA, USA). The crude lysate was cleared by centrifugation at 12,000g, filtered and 66

dialyzed against buffer A. This lysate was loaded onto two 5 mL HiTrap SP-HP columns (GE 67

Healthcare, Pittsburgh, PA, USA) coupled in tandem and equilibrated in buffer A. The column 68

was washed with 8 column volumes (cv) of buffer A before bound protein was eluted with a 15 69

cv linear sodium chloride gradient from 0 to 0.25 M. Each fraction was desalted and subjected 70

to WCR activity assays. Fractions containing active protein were pooled and buffer exchanged 71

into 25 mM Tris, pH 8 (buffer B) before loading onto a 1 ml MonoQ column (GE Healthcare, 72

Pittsburgh, PA, USA), equilibrated with the same buffer. Bound protein was eluted with a 45 cv 73

linear sodium chloride gradient from 0 to 0.3 M in buffer B and fractions were again subject to 74

WCR activity assay. Confirmed active fractions were further purified by hydrophobic interaction 75

chromatography. In this step, the active MonoQ pool was adjusted to a final concentration of 0.8 76

M ammonium sulfate and loaded onto a 1 mL HiTrap Butyl-HP column (GE Healthcare, 77

Pittsburgh, PA, USA), equilibrated with 25 mM Tris, containing 0.8 M ammonium sulfate. The 78

WCR activity was recovered in the unbound fraction. SDS-PAGE using precast 10-20% 79

NuPAGE gels according to the vendor’s protocols (Thermo Fisher Scientific, Waltham, MA, 80

USA) showed a highly purified sample after staining with Coomassie Blue dye, as depicted in 81

supplemental Figure S1. 82

For protein identification by Mass spectrometry the major stained band was excised, digested 83

with trypsin (Promega, Madison. WI, USA) using standard protocols and analyzed by nano-84

liquid chromatography/electrospray tandem mass spectrometry (nano-LC/ESI-MS/MS) on a 85

Thermo Q ExactiveTM

Orbitrap mass spectrometer (Thermo Fisher Scientific, Waltham, MA, 86

USA ) interfaced with an Eksigent NanoLC 1-D Plus nano-LC system (AB Sciex, Framingham, 87

MA, USA). Ten product ion spectra were collected in an information dependent acquisition 88

mode after a MS1 survey scan. Protein identification was done by database searches using 89

Mascot (Matrix Science, Boston, MA, USA) against combined protein databases including 90

DuPont Pioneer internal bacterial protein sequences from various microbial genomes and the 91

public database Swiss-Prot. 92

Recombinant expression and purification of IPD072 proteins. The genes of IPD072Aa and a 93

subset of its homologs were amplified by PCR using genomic DNA isolated from the respective 94

host strain listed in suppl. Table S1. Forward and reverse cloning primers are listed in suppl. 95

Table S2. The resulting PCR products were DNA sequence verified and sub-cloned into 96

pCOLD™ I (Takara, Kusatsu, Shiga, Japan) in frame with an N-terminal Histidine (6 residues) 97

purification tag followed by a Factor Xa cleavage site. The gene for IPD072Fb was obtained 98

through gene synthesis with compatible 5’ and 3’ ends for downstream cloning into the same 99

4

expression vector. pCOLD™ I plasmid DNA, containing the respective IPD072 gene insert was 100

transformed into competent BL21(DE3) E. coli cells for recombinant protein expression. E. coli 101

cells were grown overnight at 37°C with carbenicillin selection and then inoculated (1:25 v/v) 102

into fresh 2x yeast tryptone medium with the same antibiotic selection. Cultures were grown at 103

37°C to an optical density of A600 ~ 0.8, at which point protein expression was induced by 104

chilling the cells to 16°C followed by IPTG addition to a final concentration of 1 mM. Cultures 105

were grown at 16°C for an additional 16 hours before harvesting by centrifugation. The 106

expressed soluble IPD072 proteins were purified by immobilized metal ion chromatography 107

using Ni-NTA agarose (Qiagen, Hilden, Germany) according to the manufacturer’s protocols. 108

Insect artificial diet feeding assay. WCR larvae are from a nondiapausing colony reared in 109

DuPont Pioneer insectary. It was originally obtained from the U.S. Department of Agriculture–110

Agricultural Research Service (USDA-ARS) North Central Agricultural Research Laboratory in 111

Brookings, SD, where it had been maintained for>30 years (33). For screening microbial samples 112

and purification fractions, testing insecticidal activity of IPD072Aa and its homologs, and 113

assessing the activity of IPD072Aa on NCR, a 96-well plate based corn rootworm bioassay was 114

used as described (24). Screening samples were tested in a single step bioassay containing six 115

repeats per sample with 3 to 5 neonate larvae infested per well. Screening bioassays were scored 116

on day 4 for larval growth inhibition and mortality. For a more quantitative bioassay with 117

purified proteins, a two-step process was used. In the first step, each well at a given protein 118

concentration was infested with 3-5 neonates. After incubation for 24 hours, a single live 119

neonate from the first step incubation was transferred to a new well containing the same 120

concentration of sample and incubated for additional days. Each purified protein was tested at six 121

concentrations ranging from 12.5-400 µg/ml for WCR or 3.13 – 100 µg/ml for NCR, with a total 122

sample size at each concentration of 32 for WCR and 16 for NCR respectively. The plates with 123

a single corn rootworm larva per well were scored as dead, severely stunted (>60% reduction in 124

size compared to control larvae) or not affected after incubation for 6 to 8 days in total. Buffer 125

alone was included as a negative control and showed zero mortality in these assays. The 126

mortality data for each sample bioassay were analyzed by the PROBIT procedure (using the 127

“C=0” option for zero control mortality) in SAS software (Version 9.4, SAS Institute. Cary, NC, 128

USA) to determine the lethal concentrations affecting 50% of larvae (LC50). Similarly, the total 129

numbers of dead and severely stunted larvae were used to calculate the growth inhibition 130

concentrations affecting 50% of the larvae (IC50). 131

Feeding assays with neonate larvae of the lepidopteran species were conducted in 96-well plates 132

containing 40 µl of artificial diet (128 g/l Southland Multiple Species Diet without agar, 20 g/l 133

low melting agar) (Southland Products Incorporated, Lake Village, AK, USA). Ten microliter 134

aliquots of purified IPD072Aa proteins were mixed with diet in each well. Ten concentrations 135

ranging from 1.71-875 µg/ml were tested with 4 repeats for each concentration. Sample buffer 136

served as the negative control. Wells were manually infested with 3 to 5 neonate larvae and 137

sealed with a perforated Mylar sheet. The plates were scored on day 4 for larval growth 138

5

inhibition or mortality. The western tarnished plant bug diet bioassay was conducted using 20 µl 139

of purified IPD072Aa mixed with 75 µl insect diet (Bio-Serv F9644B, Frenchtown, NJ, USA) in 140

each well of a 96 well plate as described (27). Three to five second instar nymphs were placed 141

into each well. The assay was run for 4 days and scored for growth inhibition or mortality of the 142

nymphs. 143

Vector construction. Maize expression vector ZmIPD072Aa contains the BSV(AY) TR 144

promoter (nucleotides number from 252 to 665 of GenBank accession# DQ092436.1) and maize 145

HPLV9 INTRON 1 (nucleotides number from 174287642 to 174286787 complement of 146

GenBank accession# NC_024465 GPC_000001518) followed by a IPD072Aa gene and a 147

transcriptional terminator (Pin II) from Solanum tuberosum (28) . A plant expression cassette 148

containing these elements was sub-cloned into a binary plant transformation vector backbone by 149

GatewayTM

mediated recombination (Thermo Fisher Scientific, Waltham MA, USA). The 150

resulting vector (ZmIPD072Aa) contains the IPD072Aa cassette upstream of the selectable 151

marker gene, phosphomannose isomerase (PMI) (29), driven by the maize Ubiquitin promoter, 152

5’UTR and intron (30). The transient expression vectors contain the DMMV viral promoter (14) 153

followed by a IPD072Aa or Cry1F gene and a transcriptional terminator (Pin II). Plant 154

expression cassettes containing those elements were sub-cloned into a binary plant 155

transformation vector backbone with a kanamycin selectable marker (NPTIII) (31). 156

Stable transformation in maize. Agrobacterium-mediated stable maize transformation was 157

performed by the method of Cho et al. (18) using PMI with mannose selection. Briefly, immature 158

embryos (IEs) derived from a Pioneer elite inbred line (HC69) were infected with an 159

Agrobacterium suspension containing ZmIPD072Aa. IEs and Agrobacterium were co-cultivated 160

on solid medium in the dark at 21oC for 3 days and subsequently transferred to resting medium 161

without selection agent but supplemented with carbenicillin (ICN, Costa Mesa, CA, USA) to 162

eliminate Agrobacterium. IEs were transferred to the appropriate resting medium for 10-11 days 163

before transferring to PMI medium containing mannose (Sigma- Aldrich Corp, St Louis, MO, 164

USA) with antibiotic(s). Multiple rounds of selection were performed until sufficient quantities 165

of tissue were obtained. Regenerative green tissues were transferred to PHI-XM medium (32) 166

with mannose selection. Shoots were transferred to tubes containing MSB rooting medium for 167

rooting and plantlets were transplanted to soil in pots in the greenhouse (18). 168

Transient expression in common bean and leaf disc insect feeding assay. Transient 169

expression vector containing IPD072Aa, Cry1F or vector backbone was transformed in 170

Agrobacterium cells. Common bean plantlets were vacuum infiltrated with the transformed cell 171

cultures as described (13). Leaf discs were generated and pooled from six common bean 172

plantlets 3 days after Agrobacterium infiltration. Six randomly picked leaf discs were infested 173

with 2 to 3 neonates of each of the five lepidopteran species tested. The degree of leaf disc 174

consumption was visually evaluated (Fig. S2) 175

6

In planta efficacy assessment. First-generation maize (T1) plants transformed with vector 176

ZmIPD072Aa were grown in the greenhouse as follows. Seeds from efficacious T0 events (CR 177

node injury score < 0.1) were transplanted from tissue culture vessels into 32-cell flats filled with 178

Fafard superfine germinating mix (Sungro Horticulture, Agawam, MA, USA) and grown 179

under standard greenhouse conditions. After a period of approximately 18 days, plants were 180

transplanted into 3.5 liter plastic pots with Fafard superfine germinating mix and 1 tsp. Osmocote 181

(The Scotts Company, Marysville, OH, USA) added in approximately the middle layer of each 182

pot. Plants were watered to maintain moderate soil moisture and fertilized daily with Peters 183

Excel 15-5-15 Cal-Mag Special at a rate of ~75ppm. Non-diapausing WCR eggs (colony 184

originally from Brookings USDA facility) were washed and suspended in a 0.08% agar solution. 185

200 eggs each were pipetted into the soil near the plants at approximately stage V3 and again one 186

week later. Approximately 20 days after the first infest, plant roots were washed and scored 187

using the scale developed by Oleson et al. (19). 188

Expression analysis of IPD072 in transgenic T1 maize plants and common bean transient 189

tissues. Root tissue or common bean tissue was lyophilized and pulverized. 6-7 mg of each 190

sample was resuspended in 350µL phosphate buffered saline –Tween 20 (PBST) containing 191

cOmplete™ proteinase inhibitor/EDTA-free (Roche, Indianapolis, IN, USA). The samples were 192

sonicated for 2 min and then centrifuged at 4oC, 13,000g for 15 min. Total protein 193

concentrations were determined with the BCA assay kit (Thermo Fisher Scientific, Waltham 194

MA, USA). Supernatants were mixed with Novex SDS-PAGE LDS loading buffer (Thermo 195

Fisher Scientific, Waltham MA, USA) and run on NOVEX 4-12% Bis-Tris Midi gels with MES 196

running buffer. Proteins were transferred for 13 min using an I-Blot apparatus (Thermo Fisher 197

Scientific, Waltham MA, USA). After blocking with 5% skim milk powder in PBST, purified 198

rabbit anti-IPD072Aa primary antibody was used at 1:20,000, and secondary goat anti-rabbit 199

HRP conjugate was used at 1:20,000. Images were obtained on a Fujifilm imager, after brief 200

incubation in the presence of ECL™ Western Blotting Reagent (GE Healthcare, Pittsburgh, PA, 201

USA). Phoretix 1D software was used for quantification with optimized exposure time (Cleaver 202

Scientific, Warwickshire, UK). 203

Field Evaluation. The experimental unit was a single-row plot of corn 3 meters in length and a 204

row spacing of 76 cm. The experiment was conducted as a multiple-location randomized 205

incomplete block design with subsamples, with treatments randomized within each of 3 206

replications and blocked to account for field variability. Treatments included 5 IPD072Aa 207

transformation events from construct ZmIPD072Aa (15 plots per location), 2 entries of the 208

commercial event DAS-59122-7 as the positive control (6 plots per location), and 3 entries with 209

no events for CR protection as the negative control (9 plots per location). Additional 210

experimental constructs not related to ZmIPD072Aa were included in the experiment but are not 211

reported. The commercial event DAS-59122-7 expresses the Cry34Ab1/Cry35Ab1 proteins 212

from Bacillus thuringiensis strain PS149B1 that act together as a binary insecticidal crystal 213

protein that provides protection against CR larvae (20). All treatments were tested in a single 214

7

hybrid with the same genetic background. A seed treatment containing the insecticide, 215

thiamethoxam, at a rate of 0.25 mg a.i./kernel (Cruiser 250; Syngenta Crop Protection, Inc., 216

Greensboro, NC, USA) was applied to seeds in all treatments. This is the labeled rate for control 217

of certain secondary insect pests of corn, but does not control CR. 218

The source of infested WCR eggs was a non-diapausing colony maintained by the DuPont 219

Pioneer Insect Production Research group located in Johnston, IA. Root injury to the treatments 220

was evaluated after the peak period of CR larval feeding had occurred at each location. Roots 221

were evaluated by digging a sub-sample of 5 roots per plot, washing the root systems clean of 222

soil, and then visually assessing the amount of CR larval injury (node-injury score) using the 223

Iowa State 0-3 node-injury scale (19). 224

A linear mixed model was applied to model node-injury scores for each location separately. 225

Data for node-injury score (Yijmnks) of replication (R)i, incomplete block (B)j, construct (P)m, 226

event (E)n, plot (K)k and plant s, were modeled as a function of an overall mean μ, factors for 227

replication, incomplete block within replication, construct, event, plot and a residual ɛijmnks. The 228

model can be specified as: 229

230

𝑌𝑖𝑗𝑚𝑛𝑘𝑠 = 𝜇 + 𝑅𝑖 + (𝐵 × 𝑅)𝑖𝑗 + 𝑃𝑚 + 𝐸𝑛 + (𝑅 × 𝐵 × 𝑃 × 𝐸 × 𝐾 )𝑖𝑗𝑚𝑛𝑘 + 𝜀𝑖𝑗𝑚𝑛𝑘𝑠

231

where construct was treated as fixed effect, and all the other effects were treated as independent 232

normally distributed random variables with means of zero. F-tests were used to assess 233

significance for fixed effects. T-tests using standard errors from the model were conducted to 234

compare treatment (construct) effects. A difference was considered statistically significant if the 235

P-value of the difference was less than 0.05. All data analysis and comparisons were made in 236

ASReml 3.0 (VSN International, Hemel Hempstead, UK, 2009) 237

Testing for cross resistance to IPD072Aa caused by selection with mCry3A. A WCR colony 238

resistant to mCry3A (24) was used to evaluate cross-resistance to IPD072Aa. For purified 239

IPD072Aa in a two-step bioassay six concentrations ranging from 5–160 µg/ml were tested for 240

each of the susceptible and resistant colonies. Buffer alone was included as a negative control. 241

The total sample size at each concentration was 32 and the plates were scored for mortality 8 242

days after the initial infestation. Buffer control showed zero mortality for both colonies. The 243

mortality data were analyzed using PROC PROBIT in SAS software (Version 9.4, SAS Institute. 244

Cary, NC, USA) to determine the value of LC50. The resistance ratio (RR) was calculated by 245

dividing the LC50 value of the resistant colony by that of the susceptible colony for each protein. 246

The resistance ratio for mCry3A was obtained as described (24). To further assess the cross- 247

resistance potential between IPD072Aa and mCry3A, we applied a different probit model with 248

the Probit procedure. This probit model includes the insect population type, dose levels of 249

IPD072Aa and their interaction. The model equation in the SAS Probit procedure is as below: 250

8

num_dead/num_obs = insect dose insect*dose 251

where the response variable is the percentage mortality, expressed as the number of dead divided 252

by the number of observations at each dose. The main effect is the insect term including larvae 253

resistant to mCry3A and susceptible larvae. The dose term is the covariate in the model, so we 254

can still test whether the main effect is statistically significant in the model or not even if 255

different dose/ concentration levels were used in bioassays. The interaction term of insect and 256

dose is used to check if the two dose-response curves are parallel or not. The type III analysis of 257

effects is provided to assess if these effects are statistically significant or not. If p-values of both 258

the insect population and the interaction terms are greater than 0.05, we can conclude there is no 259

cross resistance between IPD072Aa and mCry3A. 260

Testing for cross resistance to IPD072Aa caused by selection with Cry34Ab1/Cry35Ab1. A 261

laboratory generated WCR colony selected for increased injury capacity in Cry34Ab1/Cry35Ab1 262

expressing plants (23) was used to assess cross resistance to IPD072Aa. Cry34Ab1/Cry35Ab1-263

resistant and susceptible WCR colonies were subjected to maize plant Rootrainer assays as 264

described with slight modifications (23). The Rootrainer system is made up of deep seed tray, 265

divided into four separate segments known as ‘book, because they open up like a book for easy 266

inspection. The following seed types were tested with each WCR colony: non-transformed maize 267

line (negative control), two independent transgenic events expressing IPD072Aa and corn plant 268

expressing Cry34Ab1/Cry35Ab1 (positive control). Briefly, seeds were planted in seedling trays 269

using soilless potting mixture and allowed to germinate for approximately 5 days. After 270

emergence, seedlings were transplanted into the Rootrainer system. The seedlings were 271

transplanted into every other segment of the book. Stage V3-V5 plants were infested with WCR 272

eggs from either susceptible or Cry34Ab1/Cry35Ab1–resistant colonies. WCR eggs were 273

suspended in 0.08% agar solution and ~125 viable eggs were injected with a wide bore pipette 274

tip aiming 1 inch into the root zone. In parallel, hatch tests were set up in triplicate to monitor 275

hatch date and egg viability. For this, eggs were deposited at the bottom of an agar-filled Petri 276

dish (about 50 eggs / dish). Sealed dishes were placed in an environmental chamber set at 25o C 277

and 65% relative humidity. Hatch rate was monitored periodically. Roottrainer books were 278

opened 17 days after hatching was complete, plant roots were washed and scored for node-injury 279

(19). 280

The experimental design included 3 rounds of 8 treatments arranged in a randomized complete 281

block design (RCBD) with 10 replicates (i.e. 10 books) of each treatment in each round. Each 282

book contained two plants and each book was an experimental unit. Statistical analyses were 283

conducted using SAS software (Version 9.3, SAS Institute Inc., Cary, NC, USA) to compare 284

node-injury scores between treatments. A linear mixed model with heteroscedastic variance was 285

used to fit data, and the restricted maximum likelihood estimation (REML) method was used to 286

estimate treatment means 287

9

The model can be specified as: 288

289

𝑌𝑖𝑗𝑘𝑛𝑠 = 𝜇 + 𝐶𝑖 + 𝑃𝑗 + (𝐶 × 𝑃)𝑖𝑗 + 𝑅𝑘 + 𝐵𝑛(𝑘) + 𝜀𝑖𝑗𝑘𝑛𝑠

290

where Yijkns is the average of node-injury scores of two plants in sth

book, μ denotes the overall 291

mean, Ci denotes the ith

colony main effect, Pj denotes the jth

plant type main effect, (C×P)ij 292

denotes the ijth

colony and plant type interaction effect, Rk denotes the kth

round effect, Bn(k) 293

denotes the effect of the nth

replicate within the nth

block, and εijkns denotes residual. 294

Colony, plant type, and their interaction were treated as fixed effect; round and replicate nested 295

within round were treated as independent normally distributed random effects with means of 296

zero. Heterogeneity in the covariance structure was specified by 4 levels (whether plant type is 297

IPD072Aa and type of colony). Pair-wise statistical comparisons between all treatments were 298

conducted with Tukey’s multiplicity adjustments. Letters were assigned to each treatment and 299

treatments followed by a common letter were not statistically different from each other at the 300

significance level of 0.05. 301

302

10

303

Fig. S1. Isolation of IPD072 from the active Pseudomonas isolate after multi-step 304

chromatography. 305

The unbound fraction from the Butyl-FF-column showed strong WCR stunting activity. Purity 306

was assessed by SDS-PAGE and bands were excised for identification by LC-MS/MS. 307

Molecular weight markers in kDa are indicated. 308

309

11

310

Fig. S2. No feeding inhibition of transiently expressed IPD072Aa on lepidopteran species. 311

Shown here are examples of the leaf disc images after insect infestation and the level of 312

IPD072Aa expression in common bean (A) Images of leaf discs after 3 day feeding by soybean 313

looper (Pseudoplusia includes Walker). (B) Images of leaf discs after 3 day feeding by fall 314

armyworm (Spodoptera frugiperda J.E. Smith). (C) Semi-quantitative western blot analysis of 315

IPD072Aa expression in six common bean plantlets. Number above each band is the amount of 316

IPD072Aa protein loaded or estimated. Normalized total extracted protein (4.68 µg each) was 317

loaded and expression level was estimated using pixel counts comparing to protein standards as 318

ng per mg of total extracted protein (TEP). Mean value ± standard error is 3067 ± 594 (ng/mg 319

TEP). 320

321

12

322

Fig. S3. Detection of IPD072Aa protein expression in T1 stable corn roots. 323

IPD072Aa protein expression was detected from corn roots (four plants per event) of each of the 324

same five events corresponding to Fig. 2 using western blot analysis. 325

326

13

Table S1. Homologous proteins of IPD072Aa derived from microbial genomes. 327

Protein Sequence

ID (%)

Organism Accession

number

Source/

prior annotation

IPD072Aa 100.0 Pseudomonas chlororaphis KT795291 DuPont Pioneer strain

collection

IPD072Ba 82.8 Pseudomonas rhodesiae KT795292 DuPont Pioneer strain

collection

IPD072Ca 71.3 Pseudomonas chlororaphis KT795293 DuPont Pioneer strain

collection

IPD072Cb 70.0 Pseudomonas mandelii KT795294 DuPont Pioneer strain

collection

IPD072Da 68.6 Pseudomonas congelans KT795295 DuPont Pioneer strain

collection

IPD072Db 69.0 Pseudomonas mandelii KT795296 DuPont Pioneer strain

collection

IPD072Dc 69.0 Pseudomonas ficuserectae KT795297 DuPont Pioneer strain

collection

IPD072Ea 51.7 Pseudomonas congelans KT795298 DuPont Pioneer strain

collection

IPD072Fa 40.7 Pseudomonas mosselii KT795299 DuPont Pioneer strain

collection

IPD072Fb 44.2 Burkholderia pseudomallei

MSHR346 WP_012730641

NCBI - hypothetical

protein

IPD072Fc 41.9 Switchgrass rhizosphere

microbial community SRBS_294080

JGI Metagenomics

Project - hypothetical

protein

IPD072Fd 40.7 Switchgrass rhizosphere

microbial community

SwRhRL2b_072

2.00008190

JGI Metagenomics

Project - hypothetical

protein

IPD072Fe 40.7 Switchgrass rhizosphere

microbial community SwiRh_1014910

JGI Metagenomics

Project - hypothetical

protein

14

IPD072Ff 41.9 Pseudomonas chlororaphis KT795300 DuPont Pioneer strain

collection

IPD072Ga 36.0 Pseudomonas protegens

Pf-5 WP_011062086

NCBI - hypothetical

protein

IPD072Gb 38.4 Pseudomonas chlororaphis KT795301 DuPont Pioneer strain

collection

IPD072Gc 39.3 Xenorhabdus bovienii SS-

2004 WP_012987635

NCBI - hypothetical

protein

IPD072Gd 37.6 Photorhabdus luminescens

subsp. laumondii TTO1 WP_011146608

NCBI - hypothetical

protein

IPD072Ge 38.4 Pseudomonas chlororaphis AIC20633.1 NCBI - uncharacterized

protein

328

329

15

Table S2. Cloning primers for IPD072 homologs for expression in E.coli 330

Gene Forward primer Reverse primer

IPD072Aa atatatgcatgcatatgggtattaccgttacaaacaattc aaggatccttacgagagcggctcgatcaacc

IPD072Ba gggaaacatatgggtattactgttaaaaacaattcatcc tttccccgatccttacgagagcgggtggataggc

IPD072Ca ttattcatatgggtattaccgttaccaacaaatc aaggatcctcaggcgaccgggtgaatagtctcacc

IPD072Da atcatcatatgggtattaccgttaccaacaaatc aaggatccttacgcgaccgggtgaatggtttcac

IPD072Fb Synthetic gene

331 332

16

Table S3. Field testing locations and dates of key activities in 2014. 333

Location Planting date Infestation datea Root evaluation date

Volga, SD April 25 June 6 August 5

Rochelle, IL May 23 June 9 July 31

Johnston, IA May 7 May 27 July 22

Janesville, WI May 22 June 10 August 5

Readlyn, IA May 19 June 3 July 24

aDate plots were manually infested with WCR eggs at a rate of 900 eggs/plant. 334

335

17

Table S4a. Fixed effects of construct (treatment) on corn rootworm node-injury scores 336

from field evaluations at all 5 locations in 2014. 337

Location Source dfa Sum of Squares Mean Square F value P-value

b

Volga, SD Construct 9, 79.8 8.47 0.94 29.96 <0.01

Rochelle, IL Construct 9, 45.3 4.41 0.49 7.23 <0.01

Janesville, WI Construct 9, 39.9 27.77 3.09 19.54 <0.01

Johnston, IA Construct 9, 41.8 27.16 3.02 14.92 <0.01

Readlyn, IA Construct 9, 42.5 73.45 8.16 54.02 <0.01

adf: numerator degrees of freedom, denominator degrees of freedom.

bF-test: considered 338

significant difference if the P-value was less than 0.05. 339

18

Table S4b. Random effects of replication, replication x incomplete block, event and plot on 340

corn rootworm node-injury scores from field evaluations at 5 locations in 2014. 341

Location Effect Estimate Standard

error Z-ratio

a

Volga, SD

Replication 0.000 0.001 0.446

Replication X Incomplete_Block 0.000 0.000 12.306

Event 0.000 0.000 12.306

Plot 0.003 0.002 1.726

Residual 0.031 0.003 12.306

Rochelle,

IL

Replication 0.016 0.019 0.850

Replication X Incomplete_Block 0.000 0.000 14.888

Event 0.020 0.017 1.170

Plot 0.102 0.018 5.637

Residual 0.068 0.005 14.888

Janesville,

WI

Replication 0.028 0.034 0.809

Replication X Incomplete_Block 0.018 0.017 1.021

Event 0.018 0.023 0.783

Plot 0.128 0.027 4.766

Residual 0.158 0.011 14.901

Johnston,

IA

Replication 0.122 0.135 0.902

Replication X Incomplete_Block 0.042 0.033 1.264

Event 0.025 0.039 0.628

Plot 0.250 0.049 5.107

Residual 0.202 0.013 15.346

Readlyn,

IA

Replication 0.023 0.029 0.789

Replication X Incomplete_Block 0.026 0.015 1.738

Event 0.010 0.013 0.721

Plot 0.062 0.016 3.819

Residual 0.151 0.010 15.194

a Z-ratio is the ratio between the estimate of the random effect and its own standard error. The 342

effect is considered significantly greater than 0 if Z-ratio is greater than 2. 343

19

Table S5. Type III analysis of main effect of susceptible and mCry3A resistant WCR 344

population on IPD072Aa 345

Effect df Wald Chi-Square Pr > ChiSqa

insect 1 0.0460 0.8301

Log10(dose) 1 113.8514 <.0001

Log10(dose)*insect 1 1.2391 0.2656

aP-values of both the insect population and the interaction terms are greater than 0.05 suggesting 346

there is no cross-resistance between IPD072Aa and mCry3A 347

References and Notes

1. R. L. Metcalf, “Foreward” in Methods for the Study of Pest Diobrotica, J. L. Krysan, T. A.

Miller, Eds. (Springer, New York, 1986), pp. vii–xv.

2. D. A. Andow, S. G. Pueppke, A. W. Schaafsma, A. J. Gassmann, T. W. Sappington, L. J.

Meinke, P. D. Mitchell, T. M. Hurley, R. L. Hellmich, R. P. Porter, Early detection and

mitigation of resistance to Bt maize by western corn rootworm (Coleoptera:

Chrysomelidae). J. Econ. Entomol. 109, 1–12 (2016).doi:10.1093/jee/tov238 Medline

3. M. E. Gray, T. W. Sappington, N. J. Miller, J. Moeser, M. O. Bohn, Adaptation and

invasiveness of western corn rootworm: Intensifying research on a worsening pest. Annu.

Rev. Entomol. 54, 303–321 (2009).doi:10.1146/annurev.ento.54.110807.090434 Medline

4. J. Fernandez-Cornejo, J. J. Wechsler, M. Livingston, A. Mitchell, Genetically Engineered

Crops in the United States: Economic Research Report No. ERR-162 (United States

Department of Agriculture, 2014).

5. K. E. Narva, B. D. Siegfried, N. P. Storer, Transgenic approaches to western corn rootworm

control. Adv. Biochem. Eng. Biotechnol. 136, 135–162 (2013).doi:10.1007/10_2013_195

Medline

6. G. Sanahuja, R. Banakar, R. M. Twyman, T. Capell, P. Christou, Bacillus thuringiensis: A

century of research, development and commercial applications. Plant Biotechnol. J. 9,

283–300 (2011).doi:10.1111/j.1467-7652.2011.00595.x Medline

7. D. L. Frank, A. Zukoff, J. Barry, M. L. Higdon, B. E. Hibbard, Development of resistance to

eCry3.1Ab-expressing transgenic maize in a laboratory-selected population of western

corn rootworm (Coleoptera: Chrysomelidae). J. Econ. Entomol. 106, 2506–2513

(2013).doi:10.1603/EC13148 Medline

8. A. J. Gassmann, J. L. Petzold-Maxwell, E. H. Clifton, M. W. Dunbar, A. M. Hoffmann, D. A.

Ingber, R. S. Keweshan, Field-evolved resistance by western corn rootworm to multiple

Bacillus thuringiensis toxins in transgenic maize. Proc. Natl. Acad. Sci. U.S.A. 111,

5141–5146 (2014).doi:10.1073/pnas.1317179111 Medline

9. S. N. Zukoff, K. R. Ostlie, B. Potter, L. N. Meihls, A. L. Zukoff, L. French, M. R. Ellersieck,

B. Wade French, B. E. Hibbard, Multiple assays indicate varying levels of cross

resistance in Cry3Bb1-selected field populations of the western corn rootworm to

mCry3A, eCry3.1Ab, and Cry34/35Ab1. J. Econ. Entomol. 109, 1387–1398

(2016).doi:10.1093/jee/tow073 Medline

10. S. N. Zukoff, A. L. Zukoff, R. W. Geisert, B. E. Hibbard, Western corn rootworm

(Coleoptera: Chrysomelidae) larval movement in eCry3.1Ab+mCry3A seed blend

scenarios. J. Econ. Entomol. 109, 1834–1845 (2016).doi:10.1093/jee/tow046 Medline

11. J. A. Baum, T. Bogaert, W. Clinton, G. R. Heck, P. Feldmann, O. Ilagan, S. Johnson, G.

Plaetinck, T. Munyikwa, M. Pleau, T. Vaughn, J. Roberts, Control of coleopteran insect

pests through RNA interference. Nat. Biotechnol. 25, 1322–1326

(2007).doi:10.1038/nbt1359 Medline

12. W. G. Weisburg, S. M. Barns, D. A. Pelletier, D. J. Lane, 16S ribosomal DNA amplification

for phylogenetic study. J. Bacteriol. 173, 697–703 (1991). Medline

13. J. Kapila, R. De Rycke, M. Van Montagu, G. Angenon, An Agrobacterium-mediated

transient gene expression system for intact leaves. Plant Sci. 122, 101–108 (1997).

doi:10.1016/S0168-9452(96)04541-4

14. N. Dey, I. B. Maiti, Structure and promoter/leader deletion analysis of mirabilis mosaic virus

(MMV) full-length transcript promoter in transgenic plants. Plant Mol. Biol. 40, 771–782

(1999).doi:10.1023/A:1006285426523 Medline

15. P. Jones, D. Binns, H.-Y. Chang, M. Fraser, W. Li, C. McAnulla, H. McWilliam, J. Maslen,

A. Mitchell, G. Nuka, S. Pesseat, A. F. Quinn, A. Sangrador-Vegas, M. Scheremetjew,

S.-Y. Yong, R. Lopez, S. Hunter, InterProScan 5: Genome-scale protein function

classification. Bioinformatics 30, 1236–1240 (2014).doi:10.1093/bioinformatics/btu031

Medline

16. S. F. Altschul, T. L. Madden, A. A. Schäffer, J. Zhang, Z. Zhang, W. Miller, D. J. Lipman,

Gapped BLAST and PSI-BLAST: A new generation of protein database search programs.

Nucleic Acids Res. 25, 3389–3402 (1997).doi:10.1093/nar/25.17.3389 Medline

17. R. H. ffrench-Constant, A. Dowling, N. R. Waterfield, Insecticidal toxins from Photorhabdus

bacteria and their potential use in agriculture. Toxicon 49, 436–451

(2007).doi:10.1016/j.toxicon.2006.11.019 Medline

18. M. J. Cho, E. Wu, J. Kwan, M. Yu, J. Banh, W. Linn, A. Anand, Z. Li, S. TeRonde, J. C.

Register III, T. J. Jones, Z.-Y. Zhao, Agrobacterium-mediated high-frequency

transformation of an elite commercial maize (Zea mays L.) inbred line. Plant Cell Rep.

33, 1767–1777 (2014).doi:10.1007/s00299-014-1656-x Medline

19. J. D. Oleson, Y. L. Park, T. M. Nowatzki, J. J. Tollefson, Node-injury scale to evaluate root

injury by corn rootworms (Coleoptera: Chrysomelidae). J. Econ. Entomol. 98, 1–8

(2005).doi:10.1093/jee/98.1.1 Medline

20. D. J. Moellenbeck, M. L. Peters, J. W. Bing, J. R. Rouse, L. S. Higgins, L. Sims, T.

Nevshemal, L. Marshall, R. T. Ellis, P. G. Bystrak, B. A. Lang, J. L. Stewart, K. Kouba,

V. Sondag, V. Gustafson, K. Nour, D. Xu, J. Swenson, J. Zhang, T. Czapla, G. Schwab,

S. Jayne, B. A. Stockhoff, K. Narva, H. E. Schnepf, S. J. Stelman, C. Poutre, M. Koziel,

N. Duck, Insecticidal proteins from Bacillus thuringiensis protect corn from corn

rootworms. Nat. Biotechnol. 19, 668–672 (2001).doi:10.1038/90282 Medline

21. Z. Dun, P. D. Mitchell, M. Agosti, Estimating Diabrotica virgifera virgifera damage

functions with field trial data: Applying an unbalanced nested error component model. J.

Appl. Entomol. 134, 409–419 (2010). doi:10.1111/j.1439-0418.2009.01487.x

22. N. A. Tinsley, R. E. Estes, M. E. Gray, Validation of a nested error component model to

estimate damage caused by corn rootworm larvae. J. Appl. Entomol. 137, 161–169

(2013). doi:10.1111/j.1439-0418.2012.01736.x

23. S. A. Lefko, T. M. Nowatzki, S. D. Thompson, R. R. Binning, M. A. Pascual, M. L. Peters,

E. J. Simbro, B. H. Stanley, Characterizing laboratory colonies of western corn rootworm

(Coleoptera: Chrysomelidae) selected for survival on maize containing event DAS-

59122-7. J. Appl. Entomol. 132, 189–204 (2008). doi:10.1111/j.1439-0418.2008.01279.x

24. J. Z. Zhao, M. A. Oneal, N. M. Richtman, S. D. Thompson, M. C. Cowart, M. E. Nelson, Z.

Pan, A. P. Alves, T. Yamamoto, mCry3A-selected western corn rootworm (Coleoptera:

Chrysomelidae) Colony exhibits high resistance and has reduced binding of mCry3A to

midgut tissue. J. Econ. Entomol. 109, 1369–1377 (2016).doi:10.1093/jee/tow049

Medline

25. D. R. Zerbino, E. Birney, Velvet: Algorithms for de novo short read assembly using de

Bruijn graphs. Genome Res. 18, 821–829 (2008).doi:10.1101/gr.074492.107 Medline

26. P. Rice, I. Longden, A. Bleasby, EMBOSS: The European Molecular Biology Open Software

Suite. Trends Genet. 16, 276–277 (2000).doi:10.1016/S0168-9525(00)02024-2 Medline

27. J. Habibi, C. L. Goodman, M. K. Stuart, Distribution of elongation factor-1α in larval tissues

of the fall armyworm, Spodoptera frugiperda. J. Insect Sci. 6, 1–9

(2006).doi:10.1673/2006_06_33.1 Medline

28. G. An, A. Mitra, H. K. Choi, M. A. Costa, K. An, R. W. Thornburg, C. A. Ryan, Functional

analysis of the 3′ control region of the potato wound-inducible proteinase inhibitor II

gene. Plant Cell 1, 115–122 (1989). Medline

29. J. Reed, L. Privalle, M. L. Powell, M. Meghji, J. Dawson, E. Dunder, J. Sutthe, A. Wenck, K.

Launis, C. Kramer, Y.-F. Chang, G. Hansen, M. Wright, Phosphomannose isomerase: An

efficient selectable marker for plant transformation. In Vitro Cell. Dev. Biol. Plant 37,

127–132 (2001). doi:10.1007/s11627-001-0024-z

30. A. H. Christensen, R. A. Sharrock, P. H. Quail, Maize polyubiquitin genes: Structure,

thermal perturbation of expression and transcript splicing, and promoter activity

following transfer to protoplasts by electroporation. Plant Mol. Biol. 18, 675–689

(1992).doi:10.1007/BF00020010 Medline

31. C. Xiang, P. Han, I. Lutziger, K. Wang, D. J. Oliver, A mini binary vector series for plant

transformation. Plant Mol. Biol. 40, 711–717 (1999).doi:10.1023/A:1006201910593

Medline

32. E. Wu, B. Lenderts, K. Glassman, M. Berezowska-Kaniewska, H. Christensen, T. Asmus, S.

Zhen, U. Chu, M.-J. Cho, Z.-Y. Zhao, Optimized Agrobacterium-mediated sorghum

transformation protocol and molecular data of transgenic sorghum plants. In Vitro Cell.

Dev. Biol. Plant 50, 9–18 (2014).doi:10.1007/s11627-013-9583-z Medline

33. T. F. Branson, The selection of a non-diapause strain of Diabrotica virgifera (Coleoptera:

Chrysomelidae). Entomol. Exp. Appl. 19, 148–154 (1976). doi:10.1111/j.1570-

7458.1976.tb02591.x