supplementary materials for - science signaling · 6/10/2011 · supplementary materials for ......
TRANSCRIPT
www.sciencesignaling.org/cgi/content/full/4/177/ra41/DC1
Supplementary Materials for
TRPS1 Targeting by miR-221/222 Promotes the Epithelial-to-Mesenchymal Transition in Breast Cancer
Susanna Stinson, Mark R. Lackner, Alex T. Adai, Nancy Yu, Hyo-Jin Kim, Carol
O’Brien, Jill Spoerke, Suchit Jhunjhunwala, Zachary Boyd, Thomas Januario, Robert J. Newman, Peng Yue, Richard Bourgon, Zora Modrusan, Howard M. Stern, Søren Warming, Frederic J. de Sauvage, Lukas Amler, Ru-Fang Yeh, David Dornan*
*To whom correspondence should be addressed. E-mail: [email protected]
Published 14 June 2011, Sci. Signal. 4, ra41 (2011)
DOI: 10.1126/scisignal.2001538 The PDF file includes:
Materials and Methods References Fig. S1. Plot of miR-221, miR-222, and miR-200c expression across luminal and basal-like cell lines. Fig. S2. Triple-negative breast cancers have more abundant miR-221/222 than ER/PR breast cancers. Fig. S3. Phase contrast and immunofluorescence images of MCF10A cells transfected with miR-221/222. Fig. S4. miR-221/222 abundance correlates with that of the mRNA encoding vimentin. Fig. S5. miR-221/222 abundance inversely correlates with that of the mRNA encoding E-cadherin. Fig. S6. miR-221/222 abundance inversely correlates with that of the mRNA encoding TRPS1. Table S1. Luminal-basal specific differential gene expression. Table S2. miR-221/222 gene targets down-regulated in basal-like subtype and in MCF10A cells overexpressing miR-221/222. Table S3. Filtered candidate target genes for miR-221/222 based on CRS.
Stinson et al. Supplemental Material
Page 1 of 16
Supplemental Materials and Methods
Luciferase Reporters
The FOS-like antigen 1 (FOSL1) binding site upstream of the miR-221/222 gene cluster,
as well as mutated binding sites, was cloned into the pGL3 Promoter Vector (Promega).
Sense and antisense oligonucleotides containing the binding site or mutated binding site
(underlined) and 24 nucleotides on each side were annealed and cloned between nheI and
xhoI (boxed). FOSL1 binding site sense: 5’-
ACGCGTGCTAGCTGTGTGGTGGCTGGGCACTGCAAAATGAGTCAGTTCCTGC
AGTTTGGTTACAAGTTCCTCGAGATCTGC-3’ antisense: 5’-
GCAGATCTCGAGGAACTTGTAACCAAACTGCAGGAACTGACTCATTTTGCAG
TGCCCAGCCACCACACAGCTAGCACGCGT-3’. FOSL1 mutated binding site sense:
5’-
ACGCGTGCTAGCTGTGTGGTGGCTGGGCACTGCAAAATGGGCCCGTTCCTGC
AGTTTGGTTACAAGTTCCTCGAGATCTGC-3’ antisense: 5’-
GCAGATCTCGAGGAACTTGTAACCAAACTGCAGGAACGGGCCCATTTTGCAG
TGCCCAGCCACCACACAGCTAGCACGCGT-3’. Cells were co-transfected with
luciferase reporters (200 ng/ml final concentration), phRL-CMV transfection control
plasmid (Promega, 50 ng/ml final concentration), and miRNA inhibitors or mimics. 18 to
72 hours after transfection, Dual Glo (Promega) was used to measure luciferase activity.
Retrieval and Construction of pMir TRPS1 3’UTR
Stinson et al. Supplemental Material
Page 2 of 16
A human bacterial artificial chromosome (BAC) clone containing the 3’UTR of TRPS1,
CTD-2122H18, was obtained from Invitrogen. To introduce the recombineering
machinery into the bacteria containing the BAC, the cells were electroporated with
pSIM18(1). The retrieval vector for the 3’UTR was amplified using pBR322 as template.
Long oligos were used, with ~80 bp serving as homology arms for the retrieval of the 3’
UTR. The primer sequences are (italics corresponds to pBR322, added SpeI sites are
underlined):
TRPS1 pBR fwd: 5’-
GCAAACAATCTTCAGGCAGCAAAGATGTCTGTTACATCTAAACTTGAATAAT
AAAGTTTTACCACCAGTTACACAACTAGTGATACGCGAGCGAACGTGA-3’;
TRPS1 pBR rev: 5’-
CATAAGACATTACAAGCTATTGAATTCCCATCAAGAAAACCTATTTCTATTTA
ATTGTGCTAAGTGCTAAGGTTACTAGTTTAGACGTCAGGTGGCAC-3’
PCR conditions were 95°C for 30 s, 58°C for 30 s and 72°C for 3 min, for 25 cycles.
Primers were from Integrated DNA Technologies (IDT), and the Expand High-Fidelity
PCR System, Roche Applied Science, was used. After PCR, 1 µl of DpnI was added to
the 50uL reaction for 1 hr at 37°C to remove all plasmid template. The reaction mix was
run on a 1% agarose gel, and the PCR product was purified (GFX kit, GE healthcare) and
eluted in 30ul ddH2O.
Bacteria containing pSIM18 as well as CTD-2122H18 BAC were heat-shocked and made
electrocompetent. 150 ng of the purified retrieval PCR product was electroporated into
the cells using standard settings. After electroporation, the bacteria were recovered in 1
ml LB for 1 hr in a 32°C shaking water bath, then plated on carbenicillin 50 µg/ml LB
Stinson et al. Supplemental Material
Page 3 of 16
agar and incubated at 37°C overnight. Correct retrieval clones were confirmed by
restriction digest of minprep DNA.
The SpeI fragment containing the TRPS1 3’UTR was then subcloned into the pMir
luciferase vector and checked for correct orientation.
Insertion of seedbox mutation into 3’UTR
An em7-neomycin cassette was amplified with oligos containing 46 bp homology arms
corresponding to the sequence flanking the wildtype seedbox in the 3’UTR. The primer
sequences are (italics corresponds to either em7 or neomycin, added AscI or SwaI sites
are underlined):
TRPS1 em7 AscI fwd: 5’-
GCATTAGAGTCAGTTCTGGCTCTGCCTAGCTGTTTACATTTGCAAAGGCGCGC
CGTTGACAATTAATCATCGGCATAG -3’;
TRPS1 neo SwaI rev: 5’-
ATCTACTGCAATAGAAATAGTTGCTTCATTACCTTGTTTGCTATCAATTTAAA
TCAGAAGAACTCGTCAAGAAGGCG -3’
PCR conditions were 95°C for 30 s, 58°C for 30 s and 72°C for 1 min, for 25 cycles.
After completion of the PCR, 1 ml of DpnI was added to the 50 ml reaction for 1hr at
37°C to remove all plasmid template. The reaction mix was run on a 1% agarose gel, and
the PCR product was purified and eluted in 30 ul of ddH20. pMir luciferase TRPS1
3’UTR plasmid and em7-neo PCR product were then co-transformed into heat-shocked
and electrocompetent SW102 cells (2) using electroporation. The bacteria were recovered
in 1 ml LB for 1 h in a 32°C shaking water bath, and then plated on kanamycin 50 µg/ml
Stinson et al. Supplemental Material
Page 4 of 16
LB agar and incubated at 32°C overnight. Kan-resistant clones were analyzed by
restriction digest, and the em7-neo selection marker was cut out of a targeted clone by
AscI/SwaI restriction digest. The digest was run out on a 1% gel and the vector was gel
purified. The mutated seedbox with 144bp (5’) and 124bp (3’) flanking homologies to
the TRPS1 3’UTR was synthesized by Blue Heron Biotechnology. Sequence is as
follows (mutation underlined):
CTAGTAAATATTAATGTATTACATTTCAAATAATGGTGCCTGACATATTGAAT
AATTATTTTCTACAGTGTACGTATGCAACAAAGATATTCCATCATGCATTAGA
GTCAGTTCTGGCTCTGCCTAGCTGTTTACATTTGCAAAACTAGCAAACAAGGT
AATGAAGCAACTATTTCTATTGCAGTAGATATCCTTTTGTGTGTGTGTGTGTG
CATTAAAGTTGTAAACGGTAACATGAAACAAATGAAAGTTCTTGCTATAATG
GTATGG
The linearized pMir 3’UTR vector and mutant seedbox synthesis fragment were co-
transformed into heat-shocked and electrocompetent SW102 cells. After electroporation,
the bacteria were recovered in 1 ml LB for 1 h in a 32°C shaking water bath, then plated
on carbenicillin 50 µg/ml LB agar and incubated at 32°C overnight. Correctly modified
clones were identified by restriction digest and confirmed by sequencing.
Cumulative Regulatory Score
The Cumulative Regulatory Score, CRS, is a heuristic to rank the potential cumulative
regulatory effect several miRNAs have on one target gene. CRS was designed to
establish context-dependent miRNA target identification. For example, a candidate list
can be established based on biologically-relevant criteria, such as luminal or basal-
specific gene expression. The score is defined as
Stinson et al. Supplemental Material
Page 5 of 16
CRSg ! ng,m * tm"# $%m&F
' * tgF
' = CRSg,FF
'
where tm is the t-statistic of the miRNA m; tg is the t-statistic of the target gene g; ng,m is
the number of target sites for m in the 3’UTR of g; the inner sum is over all miRNAs in
the same family F (miRNAs with the same seed sequences); the outer sum is over all
miRNA families that target g. The t-statistic is calculated using the limma package in R
(3). The CRS can be determined for a single family of miRNAs by excluding the outer
sum or for a single miRNA by excluding both sums. For our analysis, we calculated the
CRS for every gene in the context of luminal-specific expression. The number of target
sites, ng,m, draws from TargetScan 3.0 predictions(4) and is equal to 0 if a gene is not
predicted to be a target. Some comforting implications arise from CRS. CRS scores are
better (numerically lower) if g and m are strongly anti-correlated (opposing t-statistics),
and g has more target sites for m. The ng,m scale factor is appropriate because the
additivity of target sites has previously been demonstrated(5). Note that CRS assumes the
seed sequences are independent between miRNAs and families, and also assumes the
miRNA microarray platform can distinguish between family members. As a result, the
most useful conclusions derived from CRS are between families, and not within families
because family members tend to have positively correlated expression.
The CRS estimate produces positive and negative scores because some miRNAs are
positively correlated to genes that are predicted targets whereas others are anti-correlated.
The positive correlation of miRNAs and potential targets could be due to the false
Stinson et al. Supplemental Material
Page 6 of 16
positive prediction of targets or weak t-Statistics. In either case, we consider positive
CRS scores as a sort of null distribution, whereas negative (and biologically meaningful)
CRS scores represent the mRNA::miRNA combinations of interest. To generate a high
quality list for specific mir-221/222 targets, we performed the following enrichment
strategy. Assuming negative scores were “True” and positive scores were “False”, we
sorted the absolute value of the CRS estimates in descending order, and used precision-
recall analysis to estimate a good candidate cutoff. Precision is the same as positive
predictive value or TP/(TP+FP), whereas recall is the same as sensitivity or true positive
rate, and it is equal to TP/TotalTrues. We used a precision ~70% at ~13.5% recall when
sorting the scores by absolute values. Note that ‘True’ targets (negative CRS scores)
beyond the ~13.5% recall start to become increasingly diluted with ‘False’ targets
(positive CRS scores). This gave 9 top ranked genes that are likely targeted by mir-
221/222: TRPS1, IRX5, ESR1, SHANK2, VASH1, ZNF385, TP53INP1, CROP,
CDKN1B. These 9 genes had negative CRS scores that tended to be much higher than the
distribution of positive CRS scores, and represent a good set of hypotheses to investigate
for future research. Note that ESR1 and CDKN1B have already been confirmed as targets
of miR-221/222.
References:
1. W. Chan, N. Costantino, R. Li, S. C. Lee, Q. Su, D. Melvin, D. L. Court, P. Liu, A recombineering based approach for high-throughput conditional knockout targeting vector construction. Nucleic acids research 35, e64 (2007).
2. S. Warming, N. Costantino, D. L. Court, N. A. Jenkins, N. G. Copeland, Simple and highly efficient BAC recombineering using galK selection. Nucleic acids research 33, e36 (2005).
Stinson et al. Supplemental Material
Page 7 of 16
3. G. K. Smyth, Linear models and empirical bayes methods for assessing differential expression in microarray experiments. Statistical applications in genetics and molecular biology 3, Article3 (2004).
4. B. P. Lewis, I. H. Shih, M. W. Jones-Rhoades, D. P. Bartel, C. B. Burge, Prediction of mammalian microRNA targets. Cell 115, 787 (2003).
5. J. G. Doench, C. P. Petersen, P. A. Sharp, siRNAs can function as miRNAs. Genes & development 17, 438 (2003).
Stinson et al. Supplemental Material
Page 8 of 16
Fig. S1. Plot of miR-221, miR-222, and miR-200c expression luminal and basal-like
cell lines. Blue and red represents expression values from microarrays in luminal or
basal-like cell lines, respectively.
0 2 4 6 8 10 12 14
log2(Expression)
!!!
!!
!
!
!!
!!
!
!!
!
!
!
!!
!
!
!!
!
!
!
! !!
!
!
!!!
! !
!
!
!
!
!
! !
!
!!
!!
!!
!
!
!! !
!!!
!
!!
!
!
!
!
!
!
!!
!
!
!!
!
!
!!
!
!
!!
!
!
!!
!!
!
! !!
!
!
!
!
!
!!
!
!
!!
!
!
!!
!
!
!
!!
! !!!
!!
!
!
!!!
!!
!
!! !
!
!
!
!!!
!!!
!
!
!!
!
!!
!
!!
!!!
!
!
!
!!
!!!
!
!
!
!
!
!!
!
!!
!! !!
!!!
!
!!
!!!
!
!
!
!
!!!!
!!!
!!
!
!
!!!
!
!
!!
!!
!
!
!
!!
!!
!!
!
! !!!
! !
!
!!
!
!
! !
!
!!
! !!!!
!!!
!!!
!
!
!!!
!!
!!
!!
!
!!!
!
!
!
!
!!
!!
!!!
!!
!
!
!
!
!!
!
!
!!
!
!
!!
!!
!
!
!!
!
!
!!!
!
!!!
!
!
!
!
!!
!!!
!
! !!!
!
!!
!
!!
!
!!
!
!!
!!
!!!!
! !!!
!
!
!
!!!!
!!
!
!
!!!!
!
!
!
!
!
!!
!
!!
!!!
!!!
!!
!
!
!
!
!
!!! !
!!
!
!!
!!
!!
!!
!!
!
!!
!
!
!
!
! !
!!
!
miR−200c
miR−221
miR−222
0 2 4 6 8 10 12 14
log2(Expression)
!!!
!
!
!!
!
!
!!
!
!!!
! !! !!
!
!
!!
!
!
!!
!!
!!
!
!!!!
!
!
!
!
!
!
!!!
!
!
!
!
!
!!
!
!!
!!
!
!!
!!
!!
!!
!
!!!
!
!
!
!
!
!
!
!
!
!
miR−200c
miR−221
miR−222
A
across
Stinson et al. Supplemental Material
Page 9 of 16
Fig. S2. Triple negative breast cancers have more abundant miR-221/222 than
ER/PR breast cancers. RNA was extracted from primary breast tumors and abundance
of miR-221/222 was determined by qRT-PCR. Statistical significance was determined
using a Wilcoxon test.
-
Stinson et al. Supplemental Material
Page 10 of 16
Fig. S3. Phase contrast and immunofluorescence images of MCF10A cells
transfected with miR-221/222. Cells were viewed four days post-transfection with 100
nM of either scrambled control mimic or miR-221/222 mimic in triplicate. Upper panel:
Phase contrast images. Lower left panel: Cells stained with Hoescht nuclear stain (blue)
and Phalloidin-AlexFluor546 (red). Lower right panel: Cells stained with Hoescht
nuclear stain (blue) and vimentin (red).
Stinson et al. Supplemental Material
Page 11 of 16
Fig. S4. miR-221/222 abundance correlates with that of the mRNA encoding
vimentin. RNA was extracted from primary breast tumors (n = 27, a subset from Figure
S2) and vimentin mRNA abundance was determined. Statistical significance for
correlation was determined by a Spearman rank correlation.
Stinson et al. Supplemental Material
Page 12 of 16
Fig. S5. miR-221/222 abundance inversely correlates with that of the mRNA
encoding E-cadherin. RNA was extracted from primary breast tumors (n = 27, a subset
from Figure S2) and E-cadherin mRNA abundance was determined. Statistical
significance for correlation was determined by a Spearman rank correlation.
Stinson et al. Supplemental Material
Page 13 of 16
Fig. S6. miR-221/222 abundance inversely correlates with that of the mRNA encoding TRPS1. RNA was extracted from primary breast tumors (n = 27, a subset from Figure S2) and TRPS1
mRNA abundance was determined. Statistical significance for correlation was
determined by a Spearman rank correlation.
Stinson et al. Supplemental Material
Page 14 of 16
Name logFC t P.Value adj.P.Val B
hsa-miR-222 -6.1389 -7.5218 0.0000 0.0000 9.0457
hsa-miR-221 -6.3296 -7.1339 0.0000 0.0000 8.0806
hsa-miR-146a -4.1826 -5.6077 0.0000 0.0006 4.1256
hsa-miR-203 4.0934 5.1355 0.0000 0.0017 2.8710
hsa-miR-138 -3.4977 -4.9999 0.0000 0.0018 2.5103
hsa-miR-26b 1.7994 4.9926 0.0000 0.0018 2.4909
hsa-miR-34a 2.1894 4.9079 0.0000 0.0019 2.2658
hsa-miR-29a -2.5257 -4.8836 0.0000 0.0019 2.2012
hsa-miR-30a-5p -1.2388 -4.7280 0.0001 0.0025 1.7886
hsa-miR-136 -2.0683 -4.6973 0.0001 0.0025 1.7071
hsa-miR-425 1.5985 4.5497 0.0001 0.0031 1.3170
hsa-miR-100 -3.9965 -4.5229 0.0001 0.0031 1.2462
hsa-miR-30a-3p -2.3252 -4.4706 0.0001 0.0034 1.1087
hsa-miR-155 -3.3616 -4.4239 0.0001 0.0036 0.9860
hsa-miR-375 3.9213 4.2985 0.0002 0.0048 0.6571
hsa-miR-18a-AS -1.2451 -4.1884 0.0002 0.0062 0.3701
hsa-miR-30e-5p -1.1351 -4.0618 0.0003 0.0082 0.0422
Table S1. Luminal-basal specific differential gene expression.
A list of significantly differentially expressed miRNAs according to moderated t-statistic
calculations. Luminal-basal specific is defined in a two category t-test of luminal vs.
basal cell lines.
Stinson et al. Supplemental Material
Page 15 of 16
Table S2. miR-221/222 gene targets down-regulated in basal-like subtype and in
MCF10A cells overexpressing miR-221/222.
A list of genes that are decreased in basal vs. luminal subtype breast cancer cell lines and
in MCF10A cells expressing miR-221/222 mimic. ANOVA was run on 54 basal and
luminal breast cell lines and MCF10A cells treated with miR-221/222 mimic or control
and the list was filtered on miR-221/222 predicted targets based on TargetScan 5.0.
probe ID gene description
gene
symbol
pvalue
(basal vs
luminal)
ratio
(basal vs
luminal)
fold
change
(basal vs
luminal)
pvalue
(MCF10A
mimic vs
control)
ratio
(MCF10A
mimic vs
control)
fold
change
(MCF10A
mimic vs
control)
210239_at iroquois homeobox 5 IRX5 2.32E-08 0.076344 -13.0987 2.21E-05 0.468204 -2.13582
222651_s_at trichorhinophalangeal syndrome I TRPS1 2.13E-09 0.077465 -12.909 8.69E-06 0.146571 -6.82265
243386_at castor zinc finger 1 CASZ1 2.33E-07 0.13 -7.69234 0.007521 0.198786 -5.03053
214855_s_at GTPase activating Rap/RanGAP domain-like 1 GARNL1 1.28E-15 0.201494 -4.96292 0.000341 0.320624 -3.11892
213508_at chromosome 14 open reading frame 147 C14orf147 4.68E-08 0.20276 -4.93193 3.99E-05 0.060915 -16.4163
226045_at fibroblast growth factor receptor substrate 2 FRS2 0.000671 0.251274 -3.97972 0.000212 0.40672 -2.45869
212310_at melanoma inhibitory activity family, member 3 MIA3 0.000295 0.282735 -3.53688 7.51E-05 0.312399 -3.20103
1553227_s_at bromodomain and WD repeat domain containing 1 BRWD1 1.62E-08 0.294848 -3.39157 0.000596 0.326321 -3.06447
209586_s_at prune homolog (Drosophila) PRUNE 3.31E-08 0.38278 -2.61247 8.92E-05 0.246807 -4.05176
225954_s_at midnolin MIDN 0.000987 0.485532 -2.0596 0.001668 0.39944 -2.50351
221744_at WD repeat domain 68 WDR68 2.82E-05 0.521975 -1.9158 7.50E-06 0.437055 -2.28804
227112_at transmembrane and coiled-coil domain family 1 TMCC1 0.005756 0.533137 -1.87569 6.75E-06 0.424676 -2.35474
226119_at protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 PCMTD1 0.014609 0.580794 -1.72178 0.003747 0.417613 -2.39456
218128_at nuclear transcription factor Y, beta NFYB 0.005503 0.589614 -1.69603 6.48E-05 0.341201 -2.93083
229418_at chromosome 17 open reading frame 63 C17orf63 0.002616 0.591174 -1.69155 0.000325 0.1264 -7.91138
213229_at dicer 1, ribonuclease type III DICER1 0.012694 0.611474 -1.63539 0.004241 0.486179 -2.05686
202550_s_at VAMP (vesicle-associated membrane protein)-associated protein B and C VAPB 0.001983 0.617837 -1.61855 5.52E-05 0.275772 -3.62619
225888_at chromosome 12 open reading frame 30 C12orf30 0.003405 0.649243 -1.54025 2.60E-05 0.38186 -2.61876
212652_s_at sorting nexin 4 SNX4 0.001954 0.653071 -1.53123 0.000141 0.199977 -5.00057
208942_s_at SEC62 homolog (S. cerevisiae) SEC62 0.000505 0.699807 -1.42897 2.06E-05 0.113318 -8.82474
223130_s_at myosin regulatory light chain interacting protein MYLIP 0.047672 0.976139 -1.02444 1.87E-05 0.230185 -4.34433
Stinson et al. Supplemental Material
Page 16 of 16
Gene Symbol logFC t P.Value
TRPS1 -1.2551 -13.892 7.10E-44
IRX5 -0.73186 -8.1007 5.46E-16
CDKN1B -0.65233 -7.2204 5.18E-13
TP53INP1 0.39419 4.3632 1.28E-05
VASH1 -0.18017 -1.9943 0.0461
CROP -0.16178 -1.7907 0.0733
SHANK2 0.16109 1.7830 0.0746
ESR1 -0.15521 -1.7179 0.0858
ZNF385 -0.011407 -0.12626 0.90
Table S3. Filtered candidate target genes for miR-221/222 based on CRS.
A filtered list of significantly differentially expressed miRNAs according to basal
vs. luminal differential expression and downregulation by miR-221/222 in
MCF10A cells. A p-value of <0.05 was required for significance.