supporting information - pnas · supporting information ... was molded by soft lithography with...

Supporting InformationMills et al. 10.1073/pnas.1707316114SI ResultsInitial screens were performed using hCOs derived from thehESC line, HES3, which were seeded in 1.6 mg/mL collagen I andformed for 2 d in CTRL medium. Subsequently, hCOs werecultured under serum-free conditions in 4% B27 in DMEM withGlutaMAX and 10 ng/mL TGFβ-1. When the same conditionswere assessed in H9-derived hCO, there were significant issueswith cell viability and mechanical instability or tissue “necking”(57), resulting in substandard hCO integrity (Fig. S1G) andfailure to recapitulate our initial screening results (Fig. S1 H andI). To ensure that culture conditions were robust and applicableto multiple hPSC lines, we optimized the serum-free mediumand matrix composition. Removal of TGFβ-1 increased cellsurvival and increased function (Fig. S1J), while the additionof more collagen together with Matrigel supplementationprevented necking (Fig. S1K) and improved function (Fig.S1L). Additionally, we increased hCO formation time inCTRL medium from 2 to 5 d to allow for sufficient tissuecondensation. These protocol modifications allowed improvedtissue viability, prevented tissue necking, and allowed robustgeneration of hCOs derived from all hPSC lines tested(H9 hESC- and hiPSC-derived hCOs viability in MM of 93 and90%, respectively).

SI MethodshPSCs. HES3 (female) and H9 (female) hESCs (WiCell) orhiPSCs (female, Sendai virus-reprogrammed CD34+ cells ATCC-BXS0116; ATCC) were maintained as TypLE (Thermo FisherScientific) passaged cultures using mTeSR-1 (Stem Cell Technol-ogies)/Matrigel (Millipore). Karyotyping and DNA fingerprintingwere performed as a quality control.

Human RNA Sample. The adult human heart sample was obtainedfrom Clontech. The adult sample was pooled from three heartsfrom 30- to 39-y-old Caucasian males who died from trauma.

Human Proteomics Sample. The human adult heart sample wasobtained from a healthy 49-y-old female and snap frozen.

Neonatal Rat Ventricular Cardiomyocytes. Cardiomyocytes werederived from P1 Sprague–Dawley neonatal rats as previously de-scribed (58); 1- to 2-d-old neonatal rats (Sprague–Dawley) wereused for cardiomyocyte isolation. Briefly, neonatal rats were killed;hearts were excised and washed in ADS buffer (116 mM NaCl,5.4 mM KCl, 1 mM NaH2PO4, 0.8 mM MgSO4, 5 mM glucose,20 mM HEPES), and atria were removed. Myocytes were isolatedusing collagenase II and separated with Percoll gradients. Percollgradients were constructed by layering a 1:1.2 Percoll:ADS layer ona 1:0.5 Percoll:ADS layer in a 15-mL Falcon tube. Isolated myo-cytes were plated in CTRL medium (see below) on gelatin-coatedglass coverslips at 1 × 105 cells per 1 cm2 and allowed to recoverovernight before experiments.

Heart-Dyno Fabrication.Heart-Dyno culture inserts were fabricatedusing standard SU-8 photolithography and PDMS molding prac-tices (16). Microfabricated cantilever array designs were draftedwith DraftSight (Dassault Systems), and a number of differentdesigns were initially tested for feasibility. Photomasks of the designwere then plotted with an MIVA photoplotter onto 7-inch HY2glass plates (Konica Minolta). SU-8 photolithography on 6-inchsilicon wafer substrates formed the structures to a depth of∼700 μm.Briefly, silicon wafers were cleaned with acetone, isopropanol,

and N2 and then degassed at 150 °C for 30 min. SU-8 2150photoresist (Microchem) was spin coated and soft baked fourtimes to build the SU-8 to the required thickness. The waferwas then exposed to UV light under the photomask for a totaldose of 1,082 mJ/cm2. The exposed wafer was then post-exposure baked (5 min at 65 °C, 40 min at 95 °C, 4 min at 65 °C)and developed in propylene glycol monomethyl ether acetatefor 45 min in a sonicator bath. Final feature height was mea-sured with an optical surface profiler (Veeco). The Heart-Dynowas molded by soft lithography with PDMS (Sylgard 184; DowCorning; mixed in 10:1 ratio of monomer:catalyst), with curingat 65 °C for 35 min. The molds were cut using a 6-mm holepunch and placed into 96-well plates, after which they were thensterilized with 70% ethanol and UV light, washed with PBS, andcoated with 3% BSA (Sigma) to prevent cell attachment to thebottom of the wells.

Cardiac Differentiation. Cardiac cells were produced using recentlydeveloped protocols (13, 55, 56). hPSCs were seeded at 2 × 104

cells per 1 cm2 in Matrigel-coated flasks and cultured for 4 d usingmTeSR-1. They were then differentiated into cardiac mesodermusing RPMI B27− medium (RPMI 1640 GlutaMAX + 2%B27 supplement without insulin), 200 μM L-ascorbic acid 2 phos-phate sesquimagnesium salt hydrate (Sigma), and 1% Penicillin/Streptomycin (all Thermo Fisher Scientific unless otherwise in-dicated) containing 5 ng/mL BMP-4 (RnD Systems), 9 ng/mLActivin A (RnD Systems), 5 ng/mL FGF-2 (RnD Systems), and1 μM CHIR99021 (Stem Cell Technologies) with daily mediumexchange for 3 d. Subsequently, they were specified into an hPSC-CM/stromal cell mixture using RPMI B27− containing 5 μM IWP-4(Stem Cell Technologies) for 3 d, followed by another 7 d ofRPMI B27+ (RPMI 1640 GlutaMAX + 2% B27 supplementwith insulin, 200 μM L-ascorbic acid 2 phosphate sesqui-magnesium salt hydrate, and 1% Penicillin/Streptomycin) withmedium exchange every 2–3 d. The differentiated cells werethen cultured in RPMI B27+ until digestion at 15 d using 0.2%collagenase type I (Sigma) in 20% FBS in PBS (with Ca2+ andMg2+) for 60 min at 37 °C followed by 0.25% trypsin-EDTA for10 min. The cells were filtered using a 100-μm mesh cellstrainer (BD Biosciences), centrifuged at 300 × g for 3 min, andresuspended at the required density in CTRL medium: α-MEMGlutaMAX, 10% FBS, 200 μM L-ascorbic acid 2 phosphate ses-quimagnesium salt hydrate, and 1% Penicillin/Streptomycin. Basedon flow cytometry, the cells generated and used for tissue engi-neering were ∼70% α-actinin+/CTNT+ hPSC-CMs, with the restbeing predominantly CD90+ stromal cells (13). The hPSC-CMsderived after 15 d of differentiation are defined as the startingpopulation (SP).

hCO Fabrication. CTRL medium: α-MEM GlutaMAX (Thermo-Fisher Scientific), 10% fetal bovine serum (FBS) (ThermoFisherScientific), 200 μM L-ascorbic acid 2 phosphate sesquimagnesiumsalt hydrate (Sigma) and 1% Penicillin/Streptomycin (Thermo-Fisher Scientific). For each hCO, 5 × 104 cardiac cells in CTRLmedium were mixed with collagen I to make a 3.5-μl final so-lution containing 2.6 mg/ml collagen I and 9% Matrigel. Thebovine acid-solubilized collagen I (Devro) was first salt-balancedand pH-neutralized using 10X DMEM and 0.1 M NaOH, re-spectively, prior to mixing with Matrigel and cells. The mixturewas prepared on ice and pipetted into the Heart-Dyno. TheHeart-Dyno was then centrifuged at 100 × g for 10 s to ensurethe hCO form halfway up the posts. The mixture was then gelled

Mills et al. www.pnas.org/cgi/content/short/1707316114 1 of 16

www.pnas.org/cgi/content/short/1707316114

at 37°C for 30 min prior to the addition of CTRL medium tocover the tissues (150 μl/hCO). The Heart-Dyno design facili-tates the self-formation of tissues around in-built PDMS exercisepoles (designed to deform ∼0.07 μm/μN). The medium waschanged every 2-3 days (150 μl/hCO).hCOs were cultured in CTRL medium for formation and then

changed to serum-free media as indicated for experiments. For allscreening experiments, after hCO formation, hCOs were culturedin serum-free conditions comprising DMEM without glucose,glutamine, and phenol red (ThermoFisher Scientific) supple-mented with 4% B27 (with or without insulin) (ThermoFisherScientific), 1% GlutaMAX (ThermoFisher Scientific), 200 μML-ascorbic acid 2 phosphate sesquimagnesium salt hydrate and 1%Penicillin/Streptomycin (ThermoFisher Scientific). Additions tothe medium included glucose, palmitic acid (conjugated to bovineserum albumin within B27 by incubating for 2h at 37°C, Sigma), orTGFβ-1 (Peprotech). A timeline of the finalized hCO fabrication,culture and maturation protocol can be found in Fig. 1M.

Force Analysis of hCO in Heart-Dyno. The pole deflection was usedto approximate the force of contraction. A Leica DMi8 invertedhigh-content imager was used to capture a 10-s time lapse ofeach hCO contracting in real time at 37 °C. Custom batchprocessing files were written in Matlab R2013a (Mathworks) toconvert the stacked .tiff image files to .avi movie files, track thepole movement (using vision.PointTracker), determine thecontractile parameters, produce a force-time figure, and exportthe batch data to an Excel (Microsoft) spreadsheet (Matlabfiles are available on request).The following formulas were used to determine the contractile

force at each time point.Maximum deflection at the end of a rectangular cantilever fixed

at one end with force applied at a specified distance was

F =�

6EI−x3 + 3Lx2

�δ [S1]

Irectangle =bh3

12. [S2]

Combining Eqs. S1 and S2,

F =�

Ebh3

2ð−x3 + 3Lx2Þ�δ, [S3]

where F = force, I =moment of inertia, E =Young’s modulus, b =length of the pole, h = width of the pole (direction of bending),L = height of the pole, x = position of tissue on the poles in the zdirection, and δ = pole deflection.Based on the parameters of our system, for each pole: E =

1,500 kPa, b = 0.5 mm, h = 0.2 mm, L = 0.7 mm, x = 0.35 mm(hCO halfway up the poles), k = 14 μN/μm, and

F = kδ. [S4]

We validated that these parameters using a sensitive isometricforce transducer (ADInstruments) and measured k = 14.2 ±2.4 μN/μm (n = 10).

Whole-Mount Immunostaining. hCOs were fixed for 60 min with 1%paraformaldehyde (Sigma) at room temperature and washed threetime with PBS, after which they were incubated with primaryantibodies (Table S1) in Blocking Buffer, 5% FBS, and 0.2%Triton X-100 (Sigma) in PBS overnight at 4 °C. Cells were thenwashed in Blocking Buffer two times for 2 h and subsequentlyincubated with secondary antibodies (Table S1) and Hoescht(1:1,000) overnight at 4 °C. They were washed in Blocking Buffer

two times for 2 h and imaged in situ or mounted on microscopeslides using Fluoromount-G (Southern Biotech).

ImmunostainingAnalysis.For screening, hCOs were imaged using aLeica DMi8 high-content imaging microscope for in situ imaging.Custom batch processing files were written in Matlab R2013a(Mathworks) to remove the background, calculate the imageintensity, and export the batch data to an Excel (Microsoft)spreadsheet.For more detailed images, an Olympus IX81 confocal micro-

scope or a NikonDiskovery Spinning Disk confocal microscope formounted imaging was used. For cell cycle analysis experiments,three random fields of view were imaged and manually quantifiedfor proliferation. These were added together to calculate the per-centage of hPSC-CM proliferation in each hCO.

Flow Cytometry. Cells were dissociated to single cells for flowcytometry. hCOs were first washed twice in perfusion buffer at37 °C (130 mMNaCl, 1 mMMgCl2, 5 mMKCl, 0.5 mMNaH2PO4,10 mM Hepes, 10 mM Taurine, 10 mM glucose, 10 μM 2,3-butanedione monoxime, pH 7.4). hCOs were incubated in EDTAbuffer at 37 °C for 5 min (130 mM NaCl, 5 mM KCl, 0.5 mMNaH2PO4, 10 mM Hepes, 10 mM Taurine, 10 mM glucose, 5 mMEDTA, 10 μM 2,3-butanedione monoxime, pH 7.4). hCOs werewashed twice in perfusion buffer and then incubated in perfusionbuffer plus 1 mg/mL collagenase B (Roche) for 30 min at 37 °C ona shaker at 750 rpm. hCOs were then centrifuged at 1,000 × g for3 min, collagenase was removed, and they were incubated in0.25% trypsin-EDTA for 15 min at 37 °C on a shaker at 750 rpm.Perfusion buffer with 5% FBS was then added, and the single cellswere pelleted by centrifuging at 1,000 × g for 3 min. The cells werethen stained for flow cytometry using published protocols (13),except that PBS was replaced by perfusion buffer to maintain cellviability of live cells. Flow cytometry was performed on a BectonDickinson LSR Fortessa X-20 cytometer and analyzed using Cyf-logic 1.2.1 (Cyflo Ltd).

hPSC-CM Dissociation for Single-Cell Electrophysiology and CalciumImaging. hPSC-CMs were dissociated for SP, using the sameprotocol as for hCO fabrication and seeded on gelatin-coatedcoverslips in CTRL medium. Cells were analyzed the follow-ing day.hPSC-CMs were dissociated from hCOs 9 d after switching to

MM by washing three times in calcium-free Tyrode’s buffer(120 mM NaCl, 1 mM MgCl2, 5.4 mM KCl, 22.6 mM NaHCO3,0.42 mM NaH2PO4, 5.5 mM glucose, pH 7.4) with 10 μM 2,3-butanedione monoxime (dissociation buffer). Cells were dissoci-ated using 1 mg/mL collagenase B in dissociation buffer for 30–60 min at 37 °C. The dissociated cells were washed in dissociationbuffer and centrifuged at 100 × g for 3 min. They were resus-pended in dissociation buffer, and the calcium concentrationgradually increased to 10, 50, 250, and finally, 1,250 μM usingCTRL medium or MM with 10 μM 2,3-butanedione monoxime.The cells were centrifuged at 100 × g for 3 min, resuspended inCTRL medium or MM with 10 μM 2,3-butanedione monoxime,and plated on growth factor-reduced Matrigel or laminin (Sigma)-coated coverslips. After 4 h of attachment, the medium waschanged to CTRL medium orMMwithout 10 μM 2,3-butanedionemonoxime, and the cells were analyzed the following day.

Electrophysiology.Electrophysiological recordings were obtained at37 °C using a TC-124A temperature controller (Warner Instru-ments) mounted onto the stage of an Olympus IX-51 invertedmicroscope. Data were acquired with pClamp 9 software (AxonInstruments) through a 16-bit AD/DA interface (Digidata 1322A;Axon Instruments) connected to an Axoclamp 200B amplifier(Axon Instruments). Recordings were sampled at 10 kHz, low passBessel-filtered at 5 kHz (−3-dB cutoff), and evaluated offline with



Clampfit 10 and GraphPad Prism 6. Pipettes were prepared fromstandard wall borosilicate glass capillaries (BF 120–69-10; SutterInstruments) on a P-87 horizontal puller (Sutter Instruments).hCO single–hPSC-CM action potentials (APs) were recorded

from dissociated cells bathed in 140 mM NaCl, 4 mM KCl, 2 mMCaCl2, 2 mM MgCl2, 5 mM Hepes, and 5 mM glucose, pH 7.4.Pipette potential offset and capacitance neutralization precededwhole-cell patch-clamp measurements in the current-clamp mode.Patch pipettes had resistances of 1–3 MΩ when backfilled with aninternal solution (10 mM NaCl, 140 mM KCl, 2 mM EGTA,1 mM MgCl2, 0.1 mM Na-GTP, 5 mM Mg-ATP, 10 mM Hepes,pH 7.2). hPSC-CMs were “clamped” to a membrane potentialof −80 mV by continuous current injection. APs were elicited at1 Hz by applying 4-ms rectangular current pulses at 125% thresholdlevel. hPSC-CMs were classified into ventricular-, atrial-, andnodal-like according to the following criteria. Ventricular-like APshad a clear plateau (a prolonged phase of at least 50 ms in du-ration with less than 20-mV drop in membrane potential), fastupstroke (>50 V/s), a large AP amplitude (>85 mV), and a smallratio of action potential duration at 90% (APD90) repolarizationto action potential duration at 50% repolarization (APD50;APD90/APD50 < 2.3). Atrial-like APs exhibited no clear plateaubut shared all other ventricular-like criteria. Finally, nodal-likeAPs lacked a plateau phase and were characterized by a slowerphase of repolarization (APD90/APD50 > 2.3).Membrane potentials and spontaneous electrical signals were

recorded from intact hCOs bathed in CTRL medium or MM with7 μM blebbistatin to inhibit contractions. Pipette potential offsetand capacitance were neutralized before impaling the tissue.Sharp electrodes had series resistances of 30–50MΩ when backfilledwith 3 M KCl. Tip potentials and liquid junction potentials amountedto a few millivolts and were not subjected to correction.

Calcium Imaging. Cells were loaded with 2.5 μM Fluo-4 AM(Thermo Fisher Scientific) added directly to the culture mediumfor 30 min at 37 °C. The medium was changed (CTRL medium orMM) and left for 30 min at 37 °C before recordings. For recordings,the cells were stimulated at 1 Hz (using a Panlab/Harvard Appa-ratus Digital Stimulator) at 37 °C on an Olympus IX81 confocalmicroscope using line scanning (∼1 ms per line for ∼10 s). Rawdata were processed, peaks were identified, and parameters werecalculated for each calcium transient in the recording and averagedfor that particular cell. This was performed using a custom writtenprogram in Matlab R2013a (Mathworks) to improve accuracy andeliminate bias.

RNA Extraction.RNA was extracted using TRIzol (Thermo FisherScientific), treated with DNase (Qiagen), and purified usingRNeasy Minielute Cleanup Kit (Qiagen).

RNA-Seq. For hCOs and the adult human heart sample, rRNA wasdepleted with Ribo Zero Gold, and cDNA was generated withSuperScript II Reverse Transcriptase (Thermo Fisher Scientific).RNA-seq libraries were created with TruSeq Stranded Total RNAkits (Illumina) and read with theHiSeq SRCluster v4 kit (Illumina)on a HiSeq 2500 sequencer. Sample read quality was determinedwith FASTQC, and Trimmomatic (59) was used to trim poor-quality sequence (<25 phred score) and adapter sequence. Eachsample was mapped to hg38 with STAR (60). Mapped reads werethen counted with htseq-count on union mode, and differentialexpression analysis was performed with EdgeR(v3.2.4).

Proteomics Sample Preparation. Nine hCOs from either CTRLmedium or MM condition were pooled per replicate and washedtwo times in PBS. Tissues were lysed in by tip-probe sonication in6 M guandinium chloride, 100 mM Tris, pH 8.0, 10 mM Tris(2-carboxyethyl)phosphine, and 40 mM 2-chloroacetamide andheated to 95 °C for 5 min. The samples were cooled to 4 °C and

centrifuged at 20,000 × g for 10 min. The supernatant was diluted1:1 with water followed by protein precipitation with 4 vol ace-tone. Protein pellets were washed with 80% acetone and resus-pended in 10% trifluoroethanol and 100 mM Tris, pH 8.0. Proteinwas quantified by bicinchoninic acid assay, and 50 μg weredigested with 1 μg LysC (Wako Chemicals) for 2 h at 37 °C fol-lowed by 1 μg trypsin (Sigma) for 16 h at 37 °C. Digests werediluted with 4 vol 0.5% trifluoroacetic acid and desalted withC18 microcolumns packed with POROS Oligo R2/R3 reversedphase particles (20 μm; Thermo Fisher Scientific). Peptides wereeluted in 50% acetonitrile and 0.1% trifluoroacetic acid and driedby vacuum centrifugation. Peptides were quantified by Qubitfluorescence, and 1-μg aliquots were removed for direct analysisby liquid chromatography–tandem MS (LC-MS/MS). A secondaliquot of peptides was removed from each of the hCO samples(totaling 30 μg) and pooled for fractionation. Peptides frompooled hCOs and myocardial tissue were fractionated on an320 μm × 30 cm in-house packed C18 μHPLC column (3 μmethylene bridged hybrid; Waters) using an Agilent 1200 HPLC.The gradient was 0–40% Buffer B over 60 min, with 2-min frac-tions collected followed by concatenation into 12 fractions foranalysis by LC-MS/MS (Buffer A = 10 mM ammonium bi-carbonate, pH 7.9; Buffer B = 90% acetonitrile).

LC-MS/MS and Data Analysis. Peptides were analyzed on a Dionex3500RS coupled to a Q-Exactive Plus with Tune v2.4.1824 inpositive polarity mode. Peptides were separated using an in-housepacked 75-μm × 50-cm pulled column (1.9-μm particle size,C18AQ; Maisch) with a gradient of 2–30% acetonitrile containing0.1% formic acid over 120 min at 250 nL/min at 55 °C. An first-stage mass spectrometry scan was acquired from 300–1,500 m/z(70,000 resolution, 3e6 automated gain control, 100-ms injectiontime) followed by MS/MS data-dependent acquisition of the20 most intense ions with higher energy collisional dissociation(17,500 resolution, 1e5 automated gain control, 60-ms injectiontime, 27 normalized collision energy, 1.2m/z isolation width). Rawdata were searched with Andromeda (61) in MaxQuant v1.5.3.30(62) against the human UniProt database (January 2016) using alldefault settings with peptide spectral matches and protein FDRset to 1%. Label-free quantification (63) was enabled, includingthe “match between runs” option, where single-shot replicates ofthe hCOs were matched into the pooled fractionated sample.Statistical analysis was performed in Perseus (64) and included atwo-sample t test corrected for multiple testing using Benjamini–Hochberg FDR. Only proteins quantified in all biological repli-cates were included in the final analysis, and significance wascalculated based on q < 0.05.

Bioinformatics. PCA was performed using Matlab R2013a (Math-works) using normalized log2-transformed count per million dataoutputted from EdgeR(v3.2.4) (65). The PCA included RNA-seqof hPSC-CMs cultured for 1 y or 20 d and adult and fetal humanheart tissue from a previous study for comparison (25). These 100-bppaired end read data were obtained from the Gene ExpressionOmnibus (accession no. GSE62913) and analyzed as above, ex-cept that Trimmomatic (59) and STAR (60) were run using pairedend sequencing settings. For our RNA-seq and proteomics data,GO analysis was performed with DAVID (66), and heat maps andhierarchical clustering were performed using GENE-E (BroadInstitute).

qPCR.RNA was reverse transcribed using SuperScript III (randomprimers), and qPCR was performed using SYBR Mastermix(Thermo Fisher Scientific) on a Applied Biosystems Step One Plusto determine cycle number (Ct). The 2−ΔΔCt method was used todetermine gene expression changes using HRPT1 as a house-keeping gene. Primer sequences are listed in Table S2 and wereused at 200 nM. For miR quantification Applied Biosystems�



TaqMan� MicroRNA Assays were used for miR-199a and miR-590 with RNU6B as a housekeeping control.

TEM. Samples were processed for TEM as described previously(67). Sections were analyzed unstained in a Jeol1011 transmissionelectron microscope.

Metabolite Extraction. To extract cellular metabolites, hCOs werepooled into n = 12 or 14 for hCOs cultured in CTRL medium orMM (for 9 d), respectively. They were washed three times in 3 mLice cold 0.9% NaCl, and the metabolites were extracted using1 mL ice cold 50% aqueous acetonitrile with multiple rounds ofvortexing over a 10-min period (68). The samples were snap frozenat −80 °C until processing and analysis. The extraction solutioncontained 50 nM azidothymidine per sample as an internal stan-dard to monitor extraction efficiency for HPLC-MS/MS analysis.

Central Carbon Metabolite Analysis. Intermediates of central carbonmetabolism (CCM) were analyzed following the method describedin ref. 69 with the following modifications. Sample extracts wereanalyzed at two concentrations to enhance the likelihood of de-tection for low-abundance metabolites as well as to dilute highlyabundant metabolites into range. Thus, 200 μL sample extract wasdried down in a vacuum centrifuge (Eppendorf Concentrator Plus;Eppendorf) for ∼60 min with no heating (i.e., at room tempera-ture) using the V-AQ program. The samples were resuspended in50 μL 95:5 water:acetonitrile to provide a fourfold concentratedsample, 5 μL of which were removed to a fresh vial and dilutedwith 95 μL 95:5 water:acetonitrile to provide an effective fivefolddilution of the original extract. Samples were transferred to HPLCvials for CCM analysis by injection onto the HPLC-MS/MS systemas described previously (69).

Seahorse Metabolic Profiling. Cellular bioenergetics (including oxy-gen consumption rates and extracellular acidification rates) weredetermined on a Seahorse XF24 Extracellular Flux Bioanalyser(Seahorse Bioscience). Briefly, hCOs were washed in unbufferedassay medium (pH 7.4; Seahorse Bioscience) supplemented withglucose (5.5 mM; Sigma), sodium pyruvate (1.0 mM; ThermoFisher Scientific), and GlutaMAX (2.0 mM; Thermo Fisher Sci-entific). After two washes, eight hCOs were seeded (in assay me-dium) into a 24-well XF24 cell culture microplate (SeahorseBioscience). Eight wells, which contained unbuffered assaymediumalone, were used as background controls. Specific aspects of mi-tochondrial and glycolytic bioenergetics were analyzed during amitochondrial stress test using consecutive administration of oli-gomycin (2 μM), FCCP (1.5 μM), etomoxir (4 μM), and rotenone/antimycin A (2 μM) as described previously (70).

MitogenScreening.For neonatal rat cardiomyocytes, small molecules/growth factors were added to CTRL medium and given to the cellsfor 24 or 48 h: DMSO (Sigma), CHIR99021, and NRG-1 (RnDSystems). For transfection experiments, the cells were transfected for8 h using Lipofectamine RNAiMax (3 μL per 24 wells) in 500 μLper 24-well OptiMEM followed by a medium change into CTRLmedium. The cells were transfected at 50 nM with scramble miRcontrol (All Stars Negative Control; Qiagen), miR mimic hsa-miR-199a-3p (Qiagen), or miR mimic hsa-miR-590–3p (Qiagen). Foroverexpression of constitutively active Yap1, cells were infected inCTRL medium with an adenovirus containing a mutated version ofmurine Yap1, CMV-YAP(S112A) or a GFP control (CMV-GFP),at an multiplicity of infection of 10.hCOs were cultured for 6 d after seeding in the Heart-Dyno in

CTRL medium before treatment. Small molecules were addedand given to the cells for 48 h: DMSO, CHIR99021, and NRG-1.For transfection experiments, the cells were transfected for 4 husing Lipofectamine RNAiMax (3 μL per hCO) in 150 μL perhCO OptiMEM followed by a medium change into CTRL me-dium. The cells were transfected at 50 nM with scramble miRcontrol, miR mimic hsa-miR-199a-3p, or miR mimic hsa-miR-590–3p. For overexpression of constitutively active YAP1, hCOswere infected with an AAV6 containing a mutated version ofhuman YAP1, CMV-YAP(S127A) (Vector Biolabs), at 1.25–2.5 ×1010 viral genomes (vg) per hCO. For overexpression of con-stitutively active β-catenin, hCOs were infected with an AAV6containing a mutated version of human CTNNB1 withoutthe amino acids 2–90, AAV6-ΔN90βCAT (Vector Biolabs), at1.25–2.5 × 1010 vg per hCO. Control AAV6-MCS or AAV6-GFP(Vector Biolabs) controls were used at the same titers in theseexperiments.

Quantification and Statistical Analyses. All key hCO experimentswere performed with multiple hCOs per condition in multipleexperiments to ensure reproducibility. For screening or experimentswhere multiple groups were analyzed, all groups were present ineach experiment, including controls, to ensure that results were notan artifact of comparing conditions over different experiments.Data are presented as mean ± SEM unless otherwise noted.

Statistics were analyzed using Microsoft Excel (Microsoft) orGraphPAD Prism 6 (Graphpad Software Inc.). Sample numbers,experimental repeats, statistical analyses, and P values are reportedin the figures.

Dataset Availability. RNA-seq data have been deposited in theGene Expression Omnibus as accession number GSE93841, andCTRLmedium vs. MM hCO proteomics data have been depositedin the PRIDE under accession number PXD005736. All Matlabm-files will be provided on request.



A B

C D

Force (μN)

2-5 2-7 2-9

0 105

1 123 74 37

3 51 55 20

10 36 10 0

TGF

(ng/

ml)

Duration (Days)

****

**

*

*

**

0 1 5.5 1 1 0 1 5.5 -VE +VE

0

200

400

600

800

1000

CTN

I(pg

/ml)

Glucose (mM)

Palmitate ( M) 0 1 10 100

LDH

0 0.5 1 5.5

0 3.70 1.80 1.51 1.53

1 1.48 1.58 1.52 1.82

10 1.96 1.75 1.58 1.84

100 1.90 1.91 1.86 2.13

80.2 1.00

+VE -VE

Glucose (mM)

Palm

itate

(μM

)

Force (μN)

0 0.5 1 5.5

0 131 193 147 106

1 69 94 130 125

10 68 119 113 74

100 86 154 111 127

237

Glucose (mM)

Palm

itate

(μM

)

CTRL

MLC2V Expression

0 0.5 1 5.5

0 0.90 1.00 1.03 1.00

1 0.89 0.94 1.06 1.04

10 0.86 1.03 1.01 1.00

100 0.86 0.90 0.92 0.93

1.45

Glucose (mM)Pa

lmita

te (μ

M)

CTRL

Low Col High Col High Col+ MG

0

200

400

600

800

Matrix Composition

Forc

e(

N)

CTRLSF

**

E F

K

HG

J

I

L

Fig. S1. Development, optimization, and characterization of Heart-Dyno (supporting data for Fig. 1). (A) Photomicrographs of Heart-Dyno culture inserts withhCOs in a 96-well plate. (B) Force of contraction responses to known repressors/activators of force of contraction; n = 5. (C) Proarrhythmogenic compoundscause prolonged relaxation time in hCO as expected; n = 5. (D) Validation of Ki-67 marker activation using whole-mount immunostaining; n = 5–7 from twoexperiments. hCOs treated with 0.05% DMSO and 5 μm CHIR 99021. (E) Lactate dehydrogenase (LDH) levels in response to a full factorial glucose (0, 0.5, 1, and5.5 mM) and palmitate (0, 1, 10, and 100 μM) screen in the presence of insulin. LDH levels were assessed after 5 d of serum-free culture after 2 d of hCOformation in CTRL medium; n = 8–9 from three experiments (HES3-derived hCOs). (F) Cardiac troponin (CTNI) levels for serum-free conditions. CTNI levels wereassessed after 5 d of serum-free culture after 2 d of hCO formation in CTRL medium; n = 2–3 from one experiment (HES3-derived hCOs). −VE, negative control;+VE, positive control (mechanically crushed hCO). (G) Whole-mount images of hCOs stained with α-actinin that mechanically failed from broken arms (Upper)and necking (Lower) issues after 5 d of serum-free culture after 2 d of hCO formation in CTRL medium. (Scale bars: 200 μm.) (H) Force heat map in response to afull factorial glucose (0, 0.5, 1, and 5.5 mM) and palmitate (0, 1, 10, and 100 μM) screen. Force was assessed after 5 d of serum-free culture after 2 d of hCOformation in CTRL medium; n = 8–12 tissues from three experiments (H9-derived hCOs). (I) Whole-mount MLC2v expression in response to a full factorialglucose (0, 0.5, 1, and 5.5 mM) and palmitate (0, 1, 10, and 100 μM) screen. MLC2v expression was assessed after 5 d of serum free culture after 2 d of hCOformation in CTRL medium; n = 8–12 from three experiments (H9-derived hCOs). MLC2v expression is relative to control serum-free conditions (5.5 mM glucose,no palmitate). (J) TGFβ-1 is detrimental to hCO function. Force heat map in response to TGFβ-1 concentration (0, 1, 3, and 10 ng/mL) and duration (days 2–5, 2–7, and 2–9). Force was assessed after 10 d of serum-free culture after 2 d of hCO formation in CTRL medium; n = 13–16 from three experiments (H9-derivedhCOs). (K) Increased collagen I and Matrigel improve tissue viability. Tissue viability was assessed after 10 d of serum-free culture following 2 d of hCO for-mation in CTRL medium. n = 18 from three experiments (H9-derived hCOs). Low Col = 1.6 mg/mL collagen matrix, High Col = 3.2 mg/mL collagen matrix, HighCol + MG = 2.6 mg/mL collagen plus 9% (vol/vol) Matrigel matrix. SF, Serum -free medium (1 mM Glucose, 10 μM Palmitate with insulin). (L) Influence of theamount and composition of ECM on the force of hCO. Tissue viability was assessed after 10 d of serum free culture after 2 d of hCO formation in CTRL medium;n = 6–15 from three experiments (H9-derived hCOs). Data are mean ± SEM. High Col, 3.2 mg/mL collagen matrix; High Col + MG, 2.6 mg/mL collagen plus 9%(vol/vol) Matrigel matrix; Low Col, 1.6 mg/mL collagen matrix; SF, serum-free medium (1 mM glucose, 10 μM palmitate with insulin). *P < 0.05; **P < 0.01;***P < 0.001; and ****P < 0.0001, one-way ANOVA plus Dunnet’s posttest relative to baseline or 0.2 mM Ca2+ (B and C); t test (D) with Dunnet’s posttestrelative to no TGFβ-1 (J); or using ANOVA comparing either CTRL medium or SF groups only with Tukey’s posttest (L).



WT-1 -actinin DNA

WT-1 -actinin DNAMLC2v CD90 DNA

MLC2v CD90 DNAMLC2v CD31 DNA

MLC2v CD31 DNA

-actinin -actinin MM: CD90CTRL: CD90

DB85 ± 0.8% 81 ± 2.7%

13 ± 0.8% 10 ± 0.8%

p-cad -actinin DNA

CTRL

MM

CTR

LM

MCA

E

F

Fig. S2. Culture of hCO in MM does not alter cellular composition. (A) DNA intensity in hCO indicates fewer cells in MM; n = 70–74 from 14 experiments.(B) Single hPSC-CMs dissociated from hCO. (Scale bars: 10 μm.) (C) Flow cytometry profiling of hPSC-CMs (α-actinin) dissociated from hCOs reveals a similarpurity in both CTRL medium and MM (not significant). (D) Flow cytometry profiling of stromal cells (CD90+) dissociated from hCO reveals a very modestdecrease in CD90+ cells in hCOs cultured in MM vs. CTRL medium (P < 0.05); n = 5. (E) CTRL medium hCOs have endothelial tubular structures (CD31) andstromal cells (CD90) present through the hPSC-CMs (MLC2v). There are also epicardial cells (WT-1) present on the outer surface of the hCO. Low magnificationimages of the entire hCO are shown on the left for each stain, and high magnification confocal images are shown on the right. (F) MM hCOs have endothelialtubular structures (CD31) and stromal cells (CD90) present through the hPSC-CMs (MLC2v). There are also epicardial cells (WT-1) present on the outer surface ofthe hCO. Low magnification of the entire hCO is shown on the left for each stain, and high-magnification confocal images are shown on the right. Data arepresented as mean ± SEM. (Scale bars: lowmagnification, 200 μm; highmagnification, 20 μm.) ***P < 0.001 using t test (A); statistics analyzed using t test (C and D).



H9 hCOs hIPSC hCOs

SP CTRL hCO MM hCO

0 2 4 6 8 10 120

0.5

1

1.5

2

Time (s)

F/F0

0 2 4 6 8 1000.5

11.5

22.5

33.5

44.5

Time (s)

F/F0

0 2 4 6 8 100

0.51

1.52

2.53

3.54

Time (s)

F/F0

Raw data Golay smoothing Peaks Start/End of of peak

CTRLmean s.e.m. MM

mean s.e.m. p-value

N (2 exp) 9 9AP amplitude (mV) 94 3 102 3Upstroke velocity (V/s) 56 13 33 9APD50 (s) 0.32 0.01 0.44 0.02 *APD90 (s) 0.39 0.005 0.53 0.003 *RMP (mV) -60 3 -59 2

H9 CTRLmean s.e.m. MM

mean s.e.m. p-value

N (2 exp) 29 17Force ( N) 228 22 170 16Rate (bpm) 27 3 30 250% Activation (s) 0.18 0.01 0.18 0.0150% Relaxation (s) 0.24 0.02 0.18 0.01 *

hIPSC CTRLmean s.e.m. MM

mean s.e.m. p-value

N (1 exp) 10 12Force ( N) 329 86 368 37Rate (bpm) 11 1 32 2 *50% Activation (s) 0.2 0.01 0.16 0.005 *50% Relaxation (s) 0.2 0.01 0.17 0.005 *

A

B

C D

Fig. S3. Supporting data for functional analysis presented in Fig. 2. (A) H9- and human induced pluripotent stem cell (hiPSC)-derived hCOs have similarcontraction properties as HES3 hCOs cultured in MM. Representative contraction curves and parameters of H9- or IPSC-derived hCOs in CTRL medium or MM.(B) Raw and processed data of representative calcium traces recorded from SP and hCOs cultured in CTRL medium and MM with Fluo-4 AM at 1-Hz pacing at37 °C. (C) Characterization of hPSC-CM subtype using patch clamp (more detail is in SI Methods). (D) Electrophysiological recordings using impaling electrodes.Data are mean ± SEM. RMP, resting membrane potential. *P < 0.05 using t test (A, B, and D).



MLC2v α-actinin DNA

TITIN α-actinin DNA

C DCTRL MM

CTRL MMMM

II Z

II Z

CTRL

II

Z

IIZ

B

Intensity of staining across sarcomere

Intensity of staining across sarcomere

EMM

M

MM

M

M

M

CTRL

M

M

M

FCTRL MM

T

T

T

T

A CTRL MM

G HMMCTRL

ID ID

CAV3 MLC2V DNA

CTRL MM

I

Cx43 α-actinin DNA

CTRL MMJ

p-cadherin α-actinin DNA

CTRL MM

Fig. S4. hCOs cultured in both CTRL medium and MM exhibit in vivo-like structure. (A) Transmission electron micrographs of CTRL medium and MM hCOs foran overview and higher focus on sarcomeres. Z, I–Z, and I bands, respectively. (Scale bars: overview, 2 μm; higher focus, 1 μm.) (B) Whole-mount immunos-taining of MLC2v and α-actinin reveals the presence of well-developed sarcomeres in hCOs in both CTRL medium and MM. Note the 5× Inset and intensityprofiles, where the MLC2v/α-actinin costaining reveals α-actinin in the Z bands and MLC2v only in the rest of the sarcomeres. (Scale bars: 20 μm.) (C) Whole-mount immunostaining of titin and α-actinin reveals the clear delineation of α-actinin in the Z bands and titin in the I bands. Note the 5× Inset and intensityprofiles, where the titin/α-actinin costaining reveals α-actinin in the Z bands and titin only in the I bands. (Scale bars: 20 μm.) (D) Quantification of sarcomerelength using α-actinin staining; n = 20 cells from two experiments. Data are mean ± SEM. NS, not significant using t test (P < 0.05). (E) Transmission electronmicrographs of mitochondria in CTRL medium and MM hCOs. M, mitochondria. (Scale bars: 0.5 μm.) (F) Transmission electron micrographs of t tubules in CTRLmedium and MM hCOs. T, t tubules. (Scale bars: 0.5 μm.) (G) Whole-mount immunostaining of CAV3 confirms t-tubule structures in hCOs in CTRL medium andMM. (Scale bars: 10 μm.) (H) Transmission electron micrographs of intercalated discs in CTRL medium and MM hCOs. ID, intercalated disc. (Scale bars: 0.5 μm.)(I) Whole-mount immunostaining of pancadherin confirms presence of intercalated discs in hCOs in CTRL medium and MM. (Scale bars: 10 μm.) (J) Whole-mount immunostaining of connexin 43 confirms presence of intercalated discs in hCOs in CTRL medium and MM. (Scale bars: 10 μm.)



RNA-seqProteomics

A

B

DGO-terms for genes lower in MM vs h adult heart Genes p-valuedefense response 105 8.10E-29immune response 110 1.30E-27inflammatory response 60 4.00E-18cell adhesion 90 3.60E-16biological adhesion 90 3.80E-16response to wounding 73 1.10E-14chemotaxis 32 8.60E-11taxis 32 8.60E-11positive regulation of immune system process 37 3.50E-09behavior 55 1.30E-08locomotory behavior 39 1.50E-08cell-cell adhesion 38 5.80E-08humoral immune response 19 5.90E-08leukocyte migration 16 9.80E-08regulation of cytokine production 29 1.20E-07positive regulation of immune response 25 2.70E-07activation of immune response 19 9.40E-07positive regulation of response to stimulus 32 1.10E-06chemical homeostasis 53 1.30E-06leukocyte chemotaxis 12 1.30E-06response to bacterium 28 1.60E-06innate immune response 23 1.60E-06regulation of tumor necrosis factor production 11 1.80E-06cell chemotaxis 12 2.40E-06cellular ion homeostasis 42 2.70E-06

log2(CPM) h adult heart MM MM MM MM

POU5F1 ND ND ND ND NDNANOG ND ND ND ND NDSOX2 ND ND ND ND ND

SOX10 ND ND ND ND NDNEUROD1 ND ND ND ND ND

TUBB3 -1.6 -0.7 -2.1 -1.7 -1.2

GATA1 -1.6 -7.2 -3.0 -3.3 -7.2

FOXA2 -7.2 -0.7 0.0 -2.7 -1.2

MYOD1 ND ND ND ND NDPAX7 ND ND ND ND ND

Pluripotent Stem Cells

Neural/Neural Crest

Skeletal Muscle

Endodermal

Hematopoietic Development

Non-cardiac markers

log2(CPM) h adult heart MM MM MM MM

NKX2-5 9.2 8.1 8.6 8.5 8.3TBX5 7.2 6.4 6.6 6.7 6.6

TNNT1 4.9 6.4 3.8 5.0 5.7

DDR2 3.2 5.5 3.8 4.0 5.0THY1 3.4 5.8 4.6 4.3 6.2

PDGFRA 4.4 5.8 5.1 5.1 5.8TCF21 4.4 2.3 1.3 0.8 3.0

WT1 3.1 6.0 2.6 3.9 5.0TBX18 1.7 6.4 3.4 4.4 5.6

ALDH1A2 4.9 7.9 1.2 4.6 6.2

PTPRC (CD45) 0.1 -7.2 -7.2 -7.2 -2.8ITGAM (CD11b) 4.8 -7.2 -7.2 -7.2 -4.2

SOX7 5.4 0.8 1.4 0.3 2.6VWF 10.9 0.2 1.8 2.3 2.7

CDH5 (VE-CAD) 8.2 3.1 4.2 4.0 5.3

Endothelial

Epicardial

Cardiac markers

Cardiomyocytes

Fibroblasts

Immune Cells

E F

G

CDay 20 (GSE62913)1 yr (GSE62913)

CTRL

MM

h Fetal Ventricle

h Adult Heart (GSE62913)

h Adult Heart (our study)

-100 0 100 200 300-100

-50

0

50

100

150

PC1 (39.8%)

PC2

(22.

3%)

Fig. S5. Supporting data for the RNA-seq and proteomic expression analyses of hCOs presented in Fig. 3. (A) RNA-seq expression of markers for potentiallycontaminating cell types; n = 4 experiments. (B) RNA-seq expression of markers expressed in different cardiac cell populations; n = 4 experiments. (C) PCA ofour RNA-seq data combined with RNA-seq data from Gene Expression Omnibus accession number GSE62913 (25) containing hPSC-derived 2D hPSC-CMs at 20 d(n = 3) and 1 y (n = 3), human fetal ventricles (n = 2), and human adult hearts (n = 2). All genes were >10 counts per million for at least one sample. (D) Top 25GO terms for the 1,000 genes with highest differential expression between hCOs in MM and human adult heart that are more abundant in the human adultheart. (E) Volcano plot illustrating the differential analysis of the RNA-seq data; n = 4 experiments. (F) Volcano plot illustrating the differential analysis of theproteomic data; n = 3 samples. (G) qPCR of sarcomeric genes known to switch/increase with maturation (TTN N2B, MYH7/6, TNNI3/1, and MYL2/7); n =4 experiments. Data are mean (A and B) or mean ± SEM (F). *P < 0.05 using Mann–Whitney (G). ND, not determined due to low abundance.



BPGMTPI1ALDOAALDOCENO1ENO2GPIGAPDHHK2LDHAPFKLPFKPPGK1PGAM1

BPGMTPI1ALDOAALDOCENO1ENO2GPIGAPDHHK2LDHAPFKLPFKPPGK1PGAM1

log2(FC)

-2 2

CTRL MM CTRL MM

HIBADHIMPDH2NDUFA10NDUFA11NDUFA12NDUFB6NDUFS1NDUFV1ACAD9ACADMADHFE1ALDH4A1ALDH5A1ALDH6A1ALDH7A1AASSAIFM1CATCRYZCYP27A1CYB5ACOX6B1DHTKD1DHFRDLDETFAETFBETFDHFTH1GLUD1GCDHGPD2GRHPRHADHHADHAHSD17B10IDH2MDH2OGDHPRDX3PCYOX1PYROXD2PDHA1PDHBSLC25A12SLC25A13SUOXTMLHEUQCRFS1

CTRL MM CTRL MM CTRL MM CTRL MM

A B CBDH1HIBADHIMPDH2NDUFA10NDUFA11NDUFA12NDUFA7NDUFB6NDUFS1NDUFV1NDUFV2ACAD9ACADMADHFE1ALDH4A1ALDH5A1ALDH6A1ALDH7A1AASSAIFM1BCKDHACATCRYZCYP27A1CYB5ACOX6B1DHTKD1DHFRDLDETFAETFBETFDHFTH1GLUD1GCDHGPD2GRHPRHADHHADHAHSD17B10IDH2MDH2OGDHPRDX3PCYOX1PYROXD2PDHA1PDHBSLC25A12SLC25A13SUOXTMLHEUQCRFS1;

BDH1HIBADHIMPDH2NDUFA10NDUFA11NDUFA12NDUFA7NDUFB6NDUFS1NDUFV1NDUFV2ACAD9ACADMADHFE1ALDH4A1ALDH5A1ALDH6A1ALDH7A1AASSAIFM1BCKDHACATCRYZCYP27A1CYB5ACOX6B1DHTKD1DHFRDLDETFAETFBETFDHFTH1GLUD1GCDHGPD2GRHPRHADHHADHAHSD17B10IDH2MDH2OGDHPRDX3PCYOX1PYROXD2PDHA1PDHBSLC25A12SLC25A13SUOXTMLHEUQCRFS1;UQCRFS1P1

ACADMCPT2CPT1BETFDHHADHAHADHBMAPK14

ACADMCPT2CPT1BETFDHHADHAHADHBMAPK14

Glycolysis Oxidation reduction Fatty acid oxidation

log2(FC)

-2 2

log2(FC)

-2 2

RNA-seq Proteomics RNA-seq Proteomics RNA-seq Proteomics

Fig. S6. Heat maps of RNA-seq and proteomic data for metabolism genes supporting the data presented in Fig. 4. (A) Heat map data from significantlyregulated targets (CTRL medium vs. MM) in RNA-seq or proteomics data for the GO term glycolysis. (B) Heat map data from significantly regulated targets(CTRL medium vs. MM) in RNA-seq or proteomics data for the GO term oxidation reduction. (C) Heat map data from significantly regulated targets (CTRLmedium vs. MM) in RNA-seq or proteomics data for the GO term fatty acid oxidation. Data are presented as log2 expression relative to mean for all conditions;n = 4 experiments for RNA-seq and n = 3 experiments for proteomics.



Fig. S7. Ki-67 intensity in hCO derived from different lines and force of contraction under different metabolic conditions in support of the data presented inFig. 5. (A) Ki-67 intensity in H9-derived hCOs; n = 10. (B) Ki-67 intensity in hiPSC-derived hCOs; n = 4. (C) Force of contraction in HES3-derived hCOs cultured indifferent metabolic conditions after 48 h; n = 11–15 from three experiments. Data are mean ± SEM. **P < 0.01 using t test (A and B). INS, insulin.



CTRL 5 μM CHIR

miR-199a miR-590 Ad-YAP1(S112A)

pH3

α-ac

tinin

DN

A

100 ng/ml NRG1

CTRL Cy3 RNA

-4 0 15 21Time (days)

Seeding 2D Cardiac Differentiation 3D Heart-DynoTreatments

23 pH323 qPCR23 Force

pH

3 α-

actin

in

pH

3 α-

actin

in D

NA

0.05 % DMSO 5 μM CHIR 0.05 % DMSO 5 μM CHIR

α-

actin

in G

FP D

NA

A B

D E

Neonatal Rat CardiomyocyteshCOC

F

G H I

J K

α-actinin GFPDNA

Fig. S8. Screening for the most potent mitogens in immature hCO. (A) Validation of proliferation induction in neonatal rat cardiomyocytes. Representativeimmunostaining of mitotic (pH3+) cardiomyocytes (α-actinin+) after all treatments after 48 h of culture. (B) Quantification of mitotic (pH3+) cardiomyocytes(α-actinin+) revealed that CHIR99021, miR-199a, miR-590, and Ad-YAP(S112A) were capable of inducing proliferation in neonatal rat cardiomyocytes; n =4 replicates per group. The 14,339 cardiomyocytes were manually counted. (C) Schematic outlining protocol for directed differentiation of hESCs into cardiaccells (15 d) and formation and exercise of hCO in the Heart-Dyno (6 d). The tissues were then stimulated with mitogens for 2 d before analysis. (D) Whole-tissueimaging after transfection of a Cy3-labeled siRNA shows efficient transfection of small RNAs throughout the hCO in the Heart-Dyno. (E) qPCR shows increasedexpression of miR-199a or miR-590 after transfection vs. a scramble control; n = 5–6 from two experiments. (F) Staining of GFP-infected hCOs after 48 h ofAAV6-GFP treatment. (Scale bar, 20 μm.) (G) Quantification of GFP+ hPSC-CMs (α-actinin+) after 48 h of AAV6-GFP treatment; n = 4. (H) Quantification ofmitotic (pH3+) hPSC-CMs (α-actinin+) after all treatments after 48 h of treatment; n = 8–21 from two to three experiments. The 35,690 hPSC-CMs were manuallycounted for this analysis. (I) Analysis of force of contraction reveals that CHIR99021 decreases force; however, constitutively active β-catenin does not; n = 11–29 from two to three experiments. (J) Representative immunostaining of mitotic (pH3+) hPSC-CMs (α-actinin+) after 48-h treatment with CHIR99021. (Scale bar,20 μm.) (K) Representative immunostaining of mitotic (pH3+) hPSC-CMs (α-actinin+) after 48-h treatment with CHIR99021, revealing that proliferating hPSC-CMs are located throughout the hCO. Data are mean ± SEM. (Scale bar, 200 μm.) *P < 0.05; **P < 0.01; and ***P < 0.001, using t test (E) or ANOVA with Tukey’sposttest (H and I). CHIR, CHIR99021.



log2(FC)

-2 2

GSK3A GSK3B MST1

CTRL MMA B

I J

-10 -8 -6 -4 -10 -8 -6 -4 -10 -8 -6 -4

020

100806040

Inhi

bitio

n (%

)Log (M)

C D E

F G H

K

Fig. S9. β-Catenin and YAP1 is synergistically required to induce hPSC-CM proliferation in hCO in support of the data presented in Fig. 7. (A) Heat map withgene names of YAP targets down-regulated hCOs in MM; n = 4 experiments from RNA-seq data. Log2 expression relative to mean for all conditions. (B) Deliveryof constitutively active β-catenin or YAP1 individually does not activate proliferation (Ki-67 intensity) in hCOs cultured in MM; n = 11–13 from three exper-iments. (C) Delivery of constitutively active β-catenin or YAP1 individually does not activate proliferation (Ki-67) of hPSC-CMs (α-actinin) in hCOs cultured inMM; n = 10 from three experiments. The 17,214 hPSC-CMs were manually counted. (D) Delivery of constitutively active β-catenin or YAP1 individually does notactivate mitosis (pH3) of hPSC-CMs (α-actinin) in hCOs cultured in MM; n = 6 from two experiments. The 10,243 hPSC-CMs were manually counted. (E) Deliveryof constitutively active β-catenin or YAP1 individually does not activate BIRC5 in hCOs cultured in MM; n = 7–8 from two experiments. (F) Delivery of con-stitutively active β-catenin and YAP1 cooperates to activate proliferation (Ki-67 intensity) in hCOs cultured in MM; n = 11–14 from three experiments. (G)β-Catenin and YAP1 cooperate in hCOs cultured in MM to induce expression of BIRC5; n = 6–7 from two experiments. (H) Force of contraction is not affected byoverexpression of constitutively active β-catenin and YAP1; n = 9–12. (I) Chemical structure of compound 6.28. (J) Dose–response curves for compound 6.28.(K) Volcano plot illustrating the differential analysis of the proteomics data for hCO treated with compound 6.28 for 2 d; n = 2 for DMSO control and n = 4 forcompound 6.28. Data are mean ± SEM. **P < 0.01, using t test (F and G). FC, fold change.



B

A

pATM MLC2V DNA

0.1% DMSO 10μM Compound 6.28

C

Fig. S10. Treatment of hCOs cultured in MMwith compound 6.28 results in a decrease in DDR. (A) hPSC-CMs (MLC2v) treated with compound 6.28 for 2 d havereduced DDR assessed using pATM. (Scale bars: 20 μm.) Inset is white-colored pATM alone. (B) hPSC-CM nuclear intensity of pATM decreased after treatmentwith compound 6.28, indicative of a reduced DDR; n = 120–241 hPSC-CM nuclei. (C) DDR genes PARP1 and RAD50 are reduced by treatment with compound6.28 for 2 d using qPCR quantification; n = 5–6. Data are mean ± SEM. *P < 0.05; and ****P < 0.0001 using t test (B and C).



Table S1. Antibodies used in this study

Antibody Species Company Catalog no. Dilution

α-Actinin (clone EA-53) Mouse IgG1 Sigma A7811 1:1,000Ki-67 (D3B5) Rabbit IgG Cell Signaling Technology 9129 1:400Antiphospho-Histone H3 (Ser10; pH3) Rabbit polyclonal Millipore 06–570 1:200Active β-catenin (PY489) Mouse IgM Developmental Studies

Hybridoma BankPY489-B-catenin 5 μg/mL

Titin Mouse IgM Developmental StudiesHybridoma Bank

9 D10 5 μg/mL

MLC2v Rabbit IgG Protein Tech Group 10906–1-AP 1:200CD31 Mouse IgG1 Dako M082329-2 1:200CD90 Mouse IgG2A RnD Systems MAB2067 1:200 (After reconstitution using

manufacturer’s guidelines)WT-1 Rabbit IgG Abcam AB89901 1:200Caveolin 3 Mouse IgG1 BD Transduction

Laboratories610421 1:200

pATM Mouse IgG1 Santa Cruz Biotechnology sc-47739 1:1008-OxoG Mouse IgM Abcam Ab206461 1:100Pancadherin Rabbit antiserum Sigma C3678 1:200Connexin 43 Rabbit IgG Abcam ab11370 1:200GFP Chicken polyclonal Abcam Ab13970 1:200Alexa Fluor 488 goat anti-rabbit IgG (H+L) NA Life Technologies A-11034 1:400Alexa Fluor 488 goat anti-mouse IgG (H+L) NA Life Technologies A-11029 1:400Alexa Fluor 488 goat anti-mouse IgM (μ chain) NA Life Technologies A-21042 1:400Alexa Fluor 555 goat anti-rabbit IgG (H+L) NA Life Technologies A-21428 1:400Alexa Fluor 555 goat anti-mouse IgG (H+L) NA Life Technologies A-21422 1:400Alexa Fluor 633 goat anti-rabbit IgG (H+L) NA Life Technologies A-21070 1:400Alexa Fluor 488 goat anti-chicken IgG (H+L) NA Life Technologies A-11039 1:400

NA, not applicable.

Table S2. qPCR primers used in this study

Gene Forward Reverse Size (bp) Accession no.

HPRT1 AACCTCTCGGCTTTCCCG TCACTAATCACGACGCCAGG 150 NM_000194.2RNA18S5 (genomic DNA) GCTGAGAAGACGGTCGAACT CGCAGGTTCACCTACGGAAA 74 NR_003286.2αMHC (MYH6) CTCCTCCTACGCAACTGCCG CGACACCGTCTGGAAGGATGA 85 NM_002471βMHC (MYH7) GACCAGATGAATGAGCACCG GGTGAGGTCGTTGACAGAACG 63 NM_000257MLC2a (MYL7) CAGCGGCAAAGGGGTGGTGAAC GGTCCATGGGTGTCAGGGCGAA 113 NM_021223.2MLC2v (MYL2) GGCGCCAACTCCAACGTGTT ACGTTCACTCGCCCAAGGGC 149 NM_000432.3TTN ALL (Ex49-50) GTAAAAAGAGCTGCCCCAGTGA GCTAGGTGGCCCAGTGCTACT 68 NM_001267550.1

NM_001256850.1NM_133437.3NM_133432.3NM_003319.4

TTN N2B (Ex50-219) CCAATGAGTATGGCAGTGTCA TACGTTCCGGAAGTAATTTGC 93 NM_133437.3NM_133432.3NM_003319.4

cTNNI (TNNI3) CCTCCAACTACCGCGCTTAT CTGCAATTTTCTCGAGGCGG 77 NM_000363.4ssTNNI (TNNI1) GCTCCACGAGGACTGAACAA CTTCAGCAAGAGTTTGCGGG 97 NM_003281.3ND1 (mtDNA) AACCTCAACCTAGGCCTCCT GAGTTTGATGCTCACCCTGA 86 NC_012920.1BIRC5 TTCTCAAGGACCACCGCATC CCAAGTCTGGCTCGTTCTCA 126 NM_001012271.1

NM_001168.2NM_001012270.1



Movie S1. hCO contracting against the PDMS elastomeric poles. The microscope is focused at the midway point of the pole on the hCO. The video was takenover a period of 10 s and is displayed in real time (50 frames per 1 s).

Movie S1

Movie S2. hCO contracting within the Heart-Dyno culture insert. Contractile properties can be approximated by tracking the movement of the PDMSelastomeric poles. The microscope is focused on the top of the elastomeric poles. The video was taken over a period of 10 s and is displayed in real time(50 frames per 1 s).

Movie S2


http://movie-usa.glencoesoftware.com/video/10.1073/pnas.1707316114/video-1

http://movie-usa.glencoesoftware.com/video/10.1073/pnas.1707316114/video-2


supporting information - pnas · supporting information ... was molded by soft lithography with...

Documents