surgical and molecular advances in osteonecrosis

SYMPOSIUM: MOLECULAR AND SURGICAL ADVANCES IN OSTEONECROSIS

Surgical and Molecular Advances in Osteonecrosis

Editorial Comment

Quanjun Cui MD, Khaled J. Saleh MD, MSc, FRCSC

Published online: 19 March 2008

� The Association of Bone and Joint Surgeons 2008

Osteonecrosis (ON) continues to be a considerable chal-

lenge to orthopaedic surgeons and researchers. There has

been no major breakthrough in research of this devastating

disease at the basic science and clinical level. However, the

recent explosion of molecular technology, advancement of

biomaterials, state-of-the-art computing and diagnostic

tools, and better defined surgical techniques has increased

our contemporary knowledge base. This symposium con-

tains peer reviewed scientific manuscripts selected from the

work of international experts across the globe, representing

current developments in etiology, pathogenesis, diagnosis

and treatment of ON.

The pathogenesis of ON still is unknown. To some

extent, this is because there is no ideal animal model that

can reproduce the human form of ON. Chemically induced

and traumatic bipedal animal models have shown promise

but need further study and validation. Quadruped animal

models only showed marrow and bone cell death but no

collapse consistent with early stage ON of the human.

Many hypotheses regarding pathogenesis of ON have been

proposed, including intravascular coagulation, fat emboli,

fat cell hypertrophy, intraosseous hypertension, micro-

fractures, and vasculitis, however none of these are

conclusive. Due to the lack of understanding of patho-

genesis of the disease, many therapeutic options including

electromagnetic field are developed and evaluated. Further

studies are needed for their effectiveness and validation.

Genetic factors may play an important role in the

development of ON. A large body of work on inherited

thrombophilia and hypofibrinolysis by Dr. Glueck and his

colleagues has indicated that patients’ genetic characteris-

tics do associate with ON. Similar findings were also

reported in the Korean population, although the genetic risk

profile of ON may differ among ethnic groups.

Adipogenesis by bone marrow stem cells also may be

critical for the development of ON. As reported by Wang

et al. and Yeh et al., both glucocorticoid steroids and

alcohol can enhance adipogenesis while inhibiting osteo-

genesis. In addition to changes in transcription factors,

Wnt/ß-catenin signaling pathway was also involved in this

process. Previous studies and reports by Wang et al. and

Nishida et al. in this symposium have demonstrated that

lipid lowering agents have therapeutic effects in the treat-

ment of ON in human and animal models.

Although many treatment options for ON are available,

total hip replacement (THA) is the most common for

postcollapse stages of the disease. Historically, THA had

poor outcomes in patients with ON when compared to

those with osteoarthritis (OA). However, recent studies

have demonstrated improved outcomes using the latest

surgical techniques and implant designs. Nevertheless,

there is still a subset of patients that have less than favor-

able results when compared to OA.

Dorr and colleagues reported their midterm outcome

study using a metal-on-metal bearing surface and found

that patients with ON (27 patients, 30 hips) or OA (80

patients, 82 hips) were similar in clinical and radiographic

performance at a mean followup of 5.5 years (range 2.2–

11.7 years). In another study by Koo et al., survivorship

analysis has revealed a survival rate of 93.3% in 36 patients

(46 hips) with a minimum followup of 10 years. However,

long term outcome studies in patients with ON regarding

prosthetic hip surgery, including hemi- and total hip

resurfacing arthroplasty, are still needed.

Q. Cui, K. J. Saleh (&)

Department of Orthopaedic Surgery, University of Virginia

School of Medicine, P.O. Box 800159, Charlottesville, VA

22908-0159, USA

e-mail: [email protected]

123

Clin Orthop Relat Res (2008) 466:1017–1019

DOI 10.1007/s11999-008-0220-9

Treatment of patients with early stage ON continues to

be controversial. Core decompression is the most com-

monly applied form of precollapse treatment, but the

results are not variable. Free fibular graft, rotational os-

teotomies, and nonsurgical managements are less

commonly used. Osteotomies are primarily used in Asian

countries and continue to produce favorable results. Dr.

Sugioka and his associate reported their long term results

of transtrochanteric posterior rotational osteotomy for

ARCO (Association Research Circulation Osseous) stage

III and IV ON; Dr. Yoon and colleagues of Korea used a

modified transtrochanteric rotational osteotomy for ARCO

stage II and III disease with a short term followup. Their

results indicate osteotomy is effective not only for early

stage but also for advanced stages of ON. Free fibular

transfer also has generated relatively good outcomes in a

skillful surgeon’s hands, but its indications are limited

due to technical difficulties. In a study by Yoo et al., 110

patients (124 hips) had received free vascularized fibular

graft and were followed for a minimum 10 years (range

10 to 23.7 years). Thirteen hips (10.5%) failed and con-

verted to total hip arthroplasty. The remaining patients

had a mean Harris Hip Score of 88 at final followup.

Aldridge and Urbaniak reviewed 154 patients of various

subgroups treated with free vascularized fibular graft with

a minimum followup one year (range 1 to 19 years) and

found it highly successful in treating athletic or pregnant

patients and patients with pyarthritis or slipped capital

femoral epiphysis. A high failure rate was noted in

patients with organ transplant. It is generally accepted

patient selection is the key for a successful joint pre-

serving procedure. The size of the lesion, extent of

femoral head depression, and involvement of the acetab-

ulum are important parameters dictating outcomes of the

treatments.

Modern core decompression techniques, including

multiple small diameter drilling, in conjunction with use of

bone marrow stem cells, growth factors such as bone

morphogenetic proteins, and nonvascularized bone grafts

have produced improved outcomes in limited studies with

short to midterm followups. The major limitations of the

procedure include incomplete removal of necrotic bone and

lack of a mechanism to prevent subchondral collapse.

Endoscope-aided core decompressions and sophisticated

grafting techniques may surmount these shortcomings.

However, data from randomized, double-blinded, pro-

spective clinical trials evaluating modern core

decompression techniques, different bone grafts, and graft

substitutes are needed.

Many classifications for ON of the femoral head have

been used in the past. Ficat and Arlet, Steinberg (the

University of Pennsylvania), ARCO and Japanese Ortho-

paedic Association classifications are the most commonly

used systems. Although there is no consensus supporting

the use of any one classification system, the Steinberg and

ARCO classification systems are comprehensive and

incorporate the most sensitive diagnostic techniques such

as magnetic resonance imaging and other important

parameters that allow for a uniform data collection and

cross-study comparison. We encourage use of these two

classification systems in reporting studies on ON of the

femoral head. Otherwise, the key parameters including size

of the lesion, presence or absence of collapse, amount of

depression of the femoral head, acetabular involvement,

and the location of the lesion should be collected and

reported. As further information becomes available, the

classification system will be further defined and one uni-

versal classification system should be used.

Magnetic resonance imaging (MRI) continues to be the

most sensitive and accurate diagnostic tool for ON of the

femoral head. Size and extent of the necrotic lesion, an

important prognostic parameter, can be better defined on

MRI than on radiographs. Measurement should be per-

formed on both coronal and sagittal planes. Min et al.

prospectively monitored 81 patients (81 hips) with

asymptomatic ON of the femoral head. The diagnosis

was established by MRI. Patients were followed for

8.3 years (range 5 to 16 years). Twenty-six hips (32%)

progressed to collapse. They found no correlation

between the collapse and patients’ age, gender, weight,

causes of the disease, and the length of followup. How-

ever, the size and location of the lesion were the factors

that predicted collapse. The concept also can be applied

to shoulder ON. Sakai and colleagues have found the

extent of the lesion measured as necrotic angle on mid-

oblique coronal and sagittal planes of the humeral head

can predict collapse of the humeral head. Newer tech-

nologies are evolving. As reported by Dasa et al., F-18

positron emission tomography (PET) seemed more sen-

sitive detecting early changes in the acetabulum than

traditional imaging systems but it is uncertain whether

and how these changes relate to the pathophysiology of

ON. But further studies are needed to validate the use of

newer diagnostic tools.

Challenges still lie ahead. We hope in the next few years

there will be more studies on the development of animal

models that can be used to evaluate various etiologies and

treatment options. Knowing the predisposition factors,

capability for early detection of the disease and available

effective therapeutic agents may prevent the disease pro-

cess in the future. With further defined surgical techniques

and availability of osteogenic and angiogenic growth fac-

tors, early stage ON will hopefully become treatable. This

approach can optimally decrease or eliminate the need for

total joint replacement for this young, productive patient

population.

1018 Cui and Saleh Clinical Orthopaedics and Related Research

123

We conclude by thanking all the authors for taking time

to contribute to this special symposium on Surgical and

Molecular Advances in ON. We also would like to express

our sincere appreciation to Dr. Richard A. Brand, Editor in

Chief of Clinical Orthopaedics and Related Research, and

his editorial staff for their support for this symposium.

Volume 466, Number 5, May 2008 Surgical and Molecular Advances in Osteonecrosis 1019

123


The Classic

Repair of Bone in the Presence of Aseptic Necrosis Resulting from Fractures,Transplantations, and Vascular Obstruction*

Dallas Burton Phemister MD


Dallas Burton Phemister was born in 1882 in Carbondale,

Illinois [5]. After beginning a secondary education at the

Normal School of Northern Indiana, he studied medicine at

the Rush Medical College of the University of Chicago.

(Rush Medical College was chartered in 1837, by Dr. Daniel

Brainard, originally from New York and educated in

Philadelphia [1]. When Brainard moved to the Midwest, he

named his new proprietary medical college after the famous

Philadelphia physician, Benjamin Rush, who is considered a

founding father of American medicine. At the turn of the

century the College became affiliated with the University of

Chicago, itself founded in 1890. That affiliation lasted until

WWII, at which time Rush Medical College affiliated with

the University of Illinois’ College of Medicine. Then in 1956

the College accepted the invitation to merge with St. Luke’s

Hospital at which time they were no longer affiliated with

the University of Illinois.) Phemister graduated from Rush in

1904 and interned at Cook County Hospital. Orthopaedic

surgery was not well developed in this country, and as did so

many of his peers at the time, he went abroad for advanced

training after five years of practice. He spent two years

traveling, mostly spending time in Paris, Berlin, and Vienna

[8]. In Vienna, one of the world’s leading centers of ortho-

paedics at the time [6], he encountered the famous

pathologist Jakob Erdheim and undoubtedly there devel-

oped his lifelong interest in bone pathology.

Phemister returned to Chicago in 1911 to resume a

teaching position at Rush Medical College. During WW I he

served with the Presbyterian Hospital Unit in France. (Many

individual hospitals in the US organized such units to support

the war effort since the medical support of the US military

was insufficient at the time.) He remained at Rush until the

University of Chicago established a new medical school in

1927, and asked him to organize a department of surgery.

During his very productive years at the University of

Chicago he published many dozens of paper. Perhaps more

importantly, his influence was felt through his training of

Dr. Howard Hatcher, who in turn trained a generation of

orthopaedic surgeons with a primary interest in bone tumors

and pathology: Drs. Wayne H. Akeson, Michael Bonfiglio,

Thomas D. Brower, Crawford J. Campbell, William K.

Enneking, H. Relton McCarroll, James S. Miles, Eugene R.

Mindell, John A. Siegling, Mary Sherman.

The paper we reproduce here described in detail the

repair of osteonecrotic bone. Axhausen was perhaps the

first to systematically examine the repair of dead bone [3],

Dr. Dallas Burton Phemister is shown. Figure is �1952 by the

Journal of Bone and Joint Surgery, Inc. and is reprinted with

permission from Dallas Burton Phemister 1882–1951. J Bone JointSurg Am. 1952;34:746–747.

123


DOI 10.1007/s11999-008-0206-7

and described the process of ‘‘simultaneous absorption of

dead bone and incomplete, irregular replacement by new

bone.’’ [7] Phemister extended those observations and

coined the term, ‘‘creeping substitution.’’ ‘‘By the process

of creeping substitution the old bone is gradually absorbed

and replaced by new bone, so that in the course of months

or occasionally years the necrotic area is more or less

completely transformed into living bone ... the amount of

new bone formed ... depends largely on the extent of the

living bone with which it (the dead bone) is in contact.’’ At

the time, necrosis was believed mostly related to fractures,

transplants, or infection (septic necrosis). Axhausen had

earlier described aseptic necrosis [2, 3] but the cause and

process was not well understood. Phemister commented,

‘‘Aseptic necrosis of bone, the result of proven thrombosis

or embolism, is a condition that has been rarely reported in

man.’ He did not mention what we would today consider

idiopathic aseptic necrosis or osteonecrosis. (The term,

‘‘avascular necrosis’’ first appears in PubMed in 1949 in

relation to fractures [4]. It has been commonly used, but as

with ‘‘aseptic necrosis’’ appears to be diminishing in use

compared to ‘‘osteonecrosis.’’ In the past ten years, aseptic

necrosis appears in titles in PubMed only 21 times, avas-

cular necrosis 378, and osteonecrosis 1110. We use

osteonecrosis in this symposium because it is general and

avoids implications regarding etiology, which remains

unclear.) At the time Phemister was writing, steroids were

unknown, as was necrosis related to deep sea diving or

other causes known today. Nonetheless, he well described

the histologic processes we know today.

Richard A. Brand MD

References

1. About Rush Medical College. Rush University Web site. Available

at: http://www.rushu.rush.edu/medcol/history.html. Accessed

February 14, 2008.2. Axhausen G. Uber einfache, aseptische Knochen-und

Knorpelnekrose, Chondritis dissecans und Arthritis deformans.

Arch Klin Chir. 1912.3. Axhausen G. Knochennekrose und Squesterbildung. Dtsch Med

Wochenschr. 1914;40:111–115.4. Compere EL. Avascular necrosis of large segmental fracture

fragments of the long bones. J Bone Joint Surg Am. 1949;31:47–

54.5. Dallas Burton Phemister, 1882–1951. J Bone Joint Surg Am.

1952;24:746–747.6. Kotz R, Engel A, Schiller C, ed. 100 Jahre Orthopadie an der

Universitat Wien. Vienna, Austria: Verlag der Wiener Medizi-

nischen Akademie; 1987.7. Phemister DB. Repair of bone in the presence of aseptic necrosis

resulting from fractures, transplantations, and vascular obstruc-

tion. J Bone Joint Surg Am. 1930;12:769–787.8. Phemister DB. Treatment of the necrotic head of the femur in

adults. Dallas Burton Phemister (1882–1951). Clin Orthop RelatRes. 2000;381:4–8.


This article is �1930 by the Journal of Bone and Joint Surgery, Inc.

and is reprinted with permission from Phemister DB. Repair of bone

in the presence of aseptic necrosis resulting from fractures,

transplantations, and vascular obstruction. J Bone Joint Surg Am.

1930;12:769–787.

*Read before the American Orthopaedic Association, Chatham,

Massachusetts, June 20, 1930.

Richard A. Brand MD &Clinical Orthopaedics and Related Research,

1600 Spruce Street, Philadelphia,

PA 19103, USA


Aseptic necrosis of bone may result from a number of

causes,—as vascular disturbances, injuries, the action

of chemicals, and the application of radium in the treatment

of malignant disease.

The process of repair of the damaged area differs with

the causative agent and with the amount of functional

stimulation to which the part is subjected during the

reparative period. It also differs from that seen in case of

necrosis produced by infection. Necrosis en masse produced

by severe infection is nearly always followed by a fibro-

blastic and fixed tissue phagocytic reaction which usually

results in complete absorption of the dead bone, if the area is

small, or in sequestration, if it is large. However, mild

inflammatory reactions, particularly when associated with

embolic or thrombotic processes and due to low grade

micro-organisms, may sometimes result in necrosis which

is followed by simultaneous absorption of dead bone and

incomplete, irregular replacement by new bone, as first

pointed out by Axhausen [1]. This same change may also be

observed in a bone graft when mild infection has occurred.

It is not uncommon to see a portion of a graft, which has

been exposed by opening of the wound with the escape of

exudate, heal in and subsequently undergo transformation

without sequestration. Epiphysitis may result in rather

extensive necrosis which is followed by absorption and a

certain amount of collapse and new bone formation with

eventual bony reconstruction of a deformed epiphysis.

The introduction of radium into or in contact with bone in

the treatment of malignant disease may lead to more or less

extensive bone necrosis without destruction of the peripheral

layer of the overlying soft parts, in which case the necrotic

bone remains free from infection. The necrotic bone produced

in this way may be sequestrated at a very slow rate or, if it

performs a supporting function, it may be very slowly

absorbed and replaced by new bone. If infection is present it is

always slowly sequestrated. The explanation of the slow

absorption is to be found in the fact that the tissues adjacent to

the dead bone are radium burnt and consequently bring about

123

Volume 466, Number 5, May 2008 Repair of Bone in Aseptic Necrosis 1021

http://www.rushu.rush.edu/medcol/history.html

repair very slowly. I implanted radium needles into an

undifferentiated round-cell sarcoma of the ischium, producing

aseptic bone necrosis, and after subsequent x-ray treatments

saw healing of the sarcoma with repair of the bony defect

without evidences of sequestration of the necrotic bone after

the lapse of seven years. On the other hand in a case of

undifferentiated round-cell sarcoma of the lower arm treated

by excision, radium implantation in contact with humerus, and

subsequent roentgen therapy, there was very slight infection in

the field. In this case a large portion of the cortex which was

killed by radium was very slowly sequestrated in the course of

six years and at the end of eight years was still present as a

loose piece which had worked out into the soft parts.

In experimental radium necrosis [2] the entire circum-

ference of the shaft of the femur of the dog was killed by the

insertion of radium into the medullary cavity downward

from the trochanter. The dead bone was very slowly

replaced but its fate was dependent to a considerable extent

on the amount of function which the limb performed. Some

animals walked on the limb for months without the occur-

rence of a fracture and without sequestration of the dead

bone. There was very slow creeping substitution of dead

bone by new bone from the two ends. After the lapse of

months fracture sometimes occurred through the dead bone.

If the fracture resulted in non-union so that the extremity

was no longer used, there was gradual sequestration of the

dead bone in the course of one to two years. If there was

overriding of fragments and if portions of the two fragments

that were undamaged by radium approximated each other,

new bone was formed and the fracture united. If a portion of

the necrotic bone was caught in the line of the new bone

formed by unburnt tissues, it was rapidly absorbed and

replaced by new bone. However, if the necrotic bone lay

outside the callus and the line of stress and strain, it was

very slowly absorbed without replacement by new bone.

Bancroft [3] produced chemical necrosis of bone

experimentally in dogs by the introduction of croton oil

into the medullary cavity. The inflammatory reaction set up

by the oil resulted in a marked absorptive and osteoplastic

process with sequestration and formation of an involucrum.

Owing to the rapid disappearance of the inflammatory

reaction, the reparative changes proceeded more rapidly

than in case of necrosis produced by infection and in the

course of a few weeks there was complete absorption of the

dead bone with reformation of a new shaft.

Interference with Circulation

The fate of bone which undergoes aseptic necrosis as a

result of circulatory disturbance varies considerably,

according to the environment of the necrotic area. If the

necrotic bone is attached to and directly continuous with

living bone, there is ingrowth of vessels and of fibrous and

osteogenic tissues from the living into the necrotic area.

There is usually survival of unossified osteogenic elements

about the periphery and ends of the area that has had its

circulation interrupted. By the process of creeping substi-

tution the old bone is gradually absorbed and replaced by

new bone, so that in the course of months or occasionally

years the necrotic area is more or less completely trans-

formed into a living one. Whether the amount of new bone

formed is as great as the amount of bone which died

depends largely on the extent of living bone with which it

is in contact and the amount of osteogenic elements sur-

viving about its periphery. When these are both extensive,

there may be complete replacement of the dead bone by

new bone; but when limited, bone absorption may be

greatly in excess of bone formation, so that incomplete

replacement results with the formation of bone that is less

dense than the original and that shows varying degrees of

cavitation. Functional stimulation also plays an important

role in the rate and degree of transformation. In general the

greater the degree of function, the greater the rate and

degree of transformation into new bone. If the necrotic

bone is largely or wholly intra-articular and extensively

bordered by articular cartilage, the attachment to the sur-

rounding soft parts will be markedly limited and chances

for revascularization and transformation will be greatly

reduced. Thus, injury to vessels may be the cause of some

of the cases of Kienbock’s malacia of the carpal lunatum

and of Legg-Perthes’ disease,—as when it follows reduc-

tion of congenital dislocation of the hip.

Operative Interference with the Blood Supply

Operations which involve severence of bone or extensive

separation of soft parts from bone may occasionally

interfere with blood supply sufficiently to cause massive

necrosis. An example of this is the necrosis of the head and

neck of the femur in the following case in which arthro-

plasty of the hip was performed.

CASE 1. Male, age twenty-eight, entered the Univer-

sity of Chicago Clinics May 7, 1929, because of bony

ankylosis of the left hip resulting from acute hematoge-

nous pyogenic arthritis two and one-half years previously

(Fig. 1). At operation on May 9, through a goblet inci-

sion the greater trochanter was reflected, the soft parts

reflected from the neck, and the head detached from the

acetabulum with a chisel. After roughly rounding it off

and deepening the acetabulum, a cap of free fascia lata

was placed over the head and tied about the neck with a

purse-string suture of chromic catgut. The head was then

restored to acetabulum, the muscles and greater tro-

chanter were sutured in place, the wound closed, and a

123

1022 Phemister Clinical Orthopaedics and Related Research

Fig. 1 Case 1. Bony ankylosis following pyogenic arthritis.

Fig. 2 Case 1. Twenty days after arthroplasty.

Fig. 3 Case 1. Thirty-six days after arthroplasty. Beginning reduction

in density in base of neck and shaft. No change in head.

Fig. 4 Case 1. One hundred and fifty-one days after operation.

Density of necrotic head unchanged but shaft and pelvis show atrophy

of disuse.

123


body and leg cast applied. There was slight postoperative

febrile reaction, but the temperature returned to normal at

the end of ten days and the wound healed with only a

slight superficial serous discharge. The cast was removed

after two weeks and weight extension applied for ten

days. A roentgenogram taken twenty days postoperatively

(Fig. 2) showed the reduced head of the femur with its

sharply outlined chisel cuts resting in the acetabulum.

Movement was begun and after five weeks the patient

was allowed to walk with crutches. In a roentgenogram

taken thirty-six days postoperatively (Fig. 3) the head and

neck showed their outline and density unchanged, but

there was a slight reduction in density in hone at the

junction of neck and shaft and slight atrophy of disuse of

the shaft. A fair range of mobility persisted in the hip but

it remained painful so that the patient continued to walk

on crutches. A roentgenogram taken 151 days postoper-

atively (Fig. 4) showed the head retaining its original

density and sharp outline of its cut surface. The adjacent

innominate bone and the trochanters and shaft of the

femur showed marked atrophy of disuse. The zone of

reduced density at the base of the neck had broadened to

include almost the entire neck of the femur. A diagnosis

was made of necrosis of the head and neck of the femur

with retention of the original density of the head and

atrophy of disuse of the surrounding living bone. The

extension of the rarefaction in the neck was interpreted

as evidence of beginning invasion of the necrotic portion

by tissue from the living portion with absorption of the

dead bone and replacement by a less dense living bone.

The hip improved slowly and the patient began to bear a

small amount of weight on it. A roentgenogram 250 days

postoperative (Fig. 5) showed persistence of the atrophy

of the shaft and innominate bone and a very marked

reduction in the density of the shadow cast by the head

as compared with the previous roentgenograms. The

cortex at the inferomesial and superolateral portions of

the base of the head retained its old density but the

cancellous bone of the interior and articular surfaces of

the head had been reduced to practically the same density

as the trochanters and upper end of the shaft. This was

interpreted as evidence of extensive invasion of the head

with absorption of the dead bone and a certain amount of

replacement by new bone. The patient then made greater

use of the limb in weight-bearing but continued to assist it

with a crutch. A roentgenogram taken 350 days after

operation showed slight increase in density of all of the

atrophic living bone in the region and slight further reduc-

tion in the dense areas of the head. The patient then walked

with the assistance of a cane, and a roentgenogram taken

404 days postoperatively (Fig. 6) showed little change

except for evidence of cavitation in the inferomesial part of

the head, indicating absorption of the necrotic bone with

failure of replacement by new bone.

Fig. 5 Case 1. Two hundred and fifty days after operation. Head

extensively reduced in density from invasion and replacement from

the living bone of base of neck.

123


The hip showed about forty degrees of flexion but

marked limitation of abduction and rotation. Its strength

had gradually improved and there was only slight dis-

comfort in walking unless it was prolonged.

The cause for this exceptional occurrence of necrosis of

head and neck without sequestration appeared to lie in the

traumatism of head and denudation of neck of its covering

of soft parts. However, it may have been due in part to

deep-seated mild infection in the region of the new joint,

despite the absence of discharge from that region. Failure

of the necrotic head to be sequestrated speaks decidedly in

favor of aseptic instead of septic necrosis although

sequestration may not occur in the presence of mild

infection of a necrotic area. In another case I observed

necrosis of the head and neck following an arthroplasty in

which there was infection of the wound with a purulent

discharge, but the dead bone was sequestrated in the course

of several weeks. In the case here reported functional

stimulation of the bones resulting from movement of the

joint, combined with protection of the necrotic head from

weight-bearing, was followed by creeping substitution of

the necrotic bone by new bone in the greater part of the

head without either erosion of dead bone or the develop-

ment of marked deformity.

Extensive separation of periosteum from bone, particu-

larly during the growing period, with resultant injury of

nutrient and metaphyseal vessels may result in extensive

aseptic necrosis of bone. Brunschwig of the University of

Chicago has produced areas of necrosis in the femur and

tibia of young dogs varying up to nearly the entire extent of

the shaft. There is absence of sequestration, and creeping

substitution of the necrotic bone takes place by new bone,

formed from the adjacent living bone and the surviving

osteogenic elements of the separated bone and periosteum

with only slight changes in size, shape, and density. Such

bone necrosis is no doubt occasionally produced by

extensively denuding operations, but it remains undetected

as the damaged area is repaired without appreciable alter-

ation in the clinical course of the disease.

Necrosis in Fractures

Fracture may cause necrosis by interference with the blood

supply of the bone in the immediate vicinity of the break or

by damage to larger vessels that furnish a large part or all

of the nutrition to one of the fragments.

Cornil and Coudray [5] found that in experimental

fractures there is necrosis of the cortex for a variable dis-

tance back from the fragment ends which is gradually

replaced by new bone ingrowing from the living cortex

with which it is continuous and to a less extent from the

Fig. 6 Case 1. Four hundred and four days

postoperative Cavitation at base of head and further

transformation.

123


adjacent callus. This occurrence does not interfere with the

process of healing. In fact, it has even been claimed that the

presence of the necrotic bone is a stimulus to bone repair.

Non-union and neck absorption in fractures of the femoral

neck have probably been wrongly attributed to the mar-

ginal necrosis of fragment ends. Clinically I have not seen

evidence of any appreciable amount of bone necrosis

extending back into the fragment ends from the fracture

line, either at operation or in roentgenograms. A narrow

strip of fragment end may be bare and white when a simple

fracture of some standing is exposed at operation; but I

have never seen the fragment ends appear appreciably

denser than the cortex some distance back from the fracture

as shown by roentgenograms of fractures, either united or

ununited, of several weeks’ standing, where the regional

bone had undergone atrophy of disuse. The indications are

that such bone as becomes necrotic at the ends of vascu-

larized fragments is rapidly revascularized by ingrowth

from the living bone and is absorbed and reduced in density

about as rapidly as is the adjacent living bone from atrophy

of disuse. In histological sections of resected ends of frag-

ments from cases of delayed union or nonunion, I have not

seen extensive amounts of dead bone and that which I have

found showed signs of creeping substitution by new bone.

In the case of fractures followed by bony union, mar-

ginal necrotic bone may rarely be absorbed more rapidly

than new bone is deposited, thereby creating a zone of

reduced density in the region of the fragment ends. It is

seen in pathological fractures of osteomalacia, osteogenesis

imperfecta, and in bone diseases associated with parathy-

roid adenoma and is known in the German literature as

Losser’s Umbauzone [6] (zone of transformation). I saw it

once in a patient who had no general bone disturbance but a

refracture of the ulna one year after the original fracture

had been successfully treated by an autogenous inlay bone

graft. Following the refracture a second bone graft was

inserted in the accompanying fractured radius which had

failed to unite following the first transplantation. Three and

onehalf months afterwards the radius was united, but a

zone of reduced density had developed along the oblique

fracture line in the ulna although no motion could be

elicited. Six and a half months later the zone was slightly

narrowed and increased in density and eleven months later

it had fully ossified. This zone apparently resulted from

absorption of marginal necrotic bone produced by the

fracture with marked delay in replacement by new bone for

some unexplained reason.

Bone Necrosis in Joint Fractures

Necrosis of bone may also occur in fractures bordering on

joints from injury to the blood vessels to a large part or all of

the joint fragment. It undergoes either partial or total

necrosis. The condition may be met with in intracapsular

fractures of the neck of the femur, of the capitellum humeri,

of the carpal navicular, of the head of the radius and of the

neck of the astragalus, and it always follows complete

detachment of small fragments in intra-articular fractures.

Necrosis of the proximal fragment in complete intra-

capsular fracture of the neck of the femur occurs in a not

inconsiderable percentage of the cases. Santos [7] has

recently completed a detailed study which has thrown light

on many aspects of the condition. A summary of his report

follows: Necrosis may occur in fractures at any age, and

although relatively more frequent in older persons, it is often

absent in them. This may sometimes be because of blood

reaching it by way of vessels in the untorn periosteum.

The vessels of the ligamentum teres may supply adequate

blood to keep the head alive even in the aged.

Death of the proximal fragment predisposes to non-

union, but union occurs in a considerable percentage of the

cases with a dead head in which there is impaction of

fragments or in which there is efficient reduction and fixa-

tion of fragments, the best results apparently being obtained

from the closed abduction method of Whitman. At the end

of the period of immobilization the distal living fragment

usually shows roentgen-ray signs of reduced density due to

atrophy of disuse, but the necrotic head which cannot

atrophy casts practically as even and heavy a shadow as at

the time of fracture. This usually makes it possible to

diagnose necrosis roentgenologically at this stage.

If bony union occurs the head is gradually invaded by

the ingrowth of tissue from the distal fragment and some-

times from the hypertrophied round ligament. The necrotic

marrow is replaced by vascular connective tissue and

eventually by bone marrow, but the necrotic bone is much

more slowly absorbed and replaced by a variable amount of

irregularly arranged living bone. The necrotic cartilage is

slowly absorbed and replaced by fibrous tissue, fibro-

cartilage, and to some extent eventually by new hyaline

cartilage. If too much weight is borne on the head before it

has been transformed into new bone, its weight-bearing

portion may collapse with a resultant deformity and a poor

functional result, but this may be averted by prolonged

avoidance of weight-bearing. The functional stimulation

which comes from motion of the limb without weight-

bearing is sufficient to hasten transformation of the head.

If non-union results, the neck fragments are gradually

more or less completely eroded and the remaining surfaces

usually become more or less adherent to the capsule and to

each other. The marrow spaces of the dead and non-func-

tioning head are gradually invaded by vascularized

connective tissue by way of the round ligament and in some

cases by way of the adhesions. Absorption of the invaded

old bone and partial replacement by new bone either does

123


not take place at all, at least for many months, or it goes on

very much slower than is the case when bony union takes

place and the head is subjected to functional stimulation.

The head casts a shadow for at least one to two years that is

denser than that of the neighboring living bone which is

atrophic from disuse. These points are illustrated by Fig. 7

showing a dense necrotic head in a case of ununited fracture

of the neck of the femur of sixteen months’ duration and by

Fig. 8 which is a roentgenogram of a slice of the excised

head. Although both bone and marrow were dead and about

one-half of the marrow space was reinvaded by connective

tissue from the round ligament, there was no absorption of

the dead bone except about the fovea, where there was also

a small amount of newly formed bone. Eventually absorp-

tion and partial replacement of the dead head by new bone is

brought about and the head may remain as a cavitous hull or

in rare cases it may be completely absorbed. The bearing of

these findings on prognosis and treatment are brought out in

Santos’s article.

Necrosis of Os Calcis

In fracture of the neck of the os calcis the body may rarely

have so much of its blood supply cut off that it undergoes

extensive necrosis. Its subsequent history is analagous to

that of a necrotic proximal fragment in intracapsular frac-

ture of the neck of the femur. If bony union between the

fragments follows, the necrotic body will be invaded

gradually by blood vessels, fibrous, osteogenic, and mye-

logenous tissue, and a gradual replacement of the necrotic

by living elements will be brought about. The replacement

may be incomplete and the necrotic portion located farthest

from the fracture may be broken down by weight-bearing

Fig. 7 Necrotic femoral head casting heavier

shadow than surrounding atrophied living bone.

Fig. 8 Roentgenogram of slice of

excised head in Fig. 7, showing old

necrotic bony trabeculae still

undisturbed.

123


before the ingrowing tissue reaches it, thereby leading to

deformity and permanent derangement of the bone.

The following cases are illustrative of this condition.

CASE 2. Male, aged twenty-six, sustained a fracture at

the junction of body and neck of the astragalus with

complete dorsal dislocation of the body, the posterior

capsule being the only remaining attachment. It was

reduced by open operation and a cast applied which was

worn for nine weeks. A roentgenogram taken seventy-four

days after injury (Fig. 9) revealed marked reduction in

density of the bones of the foot and the vicinity of the

ankle, except the body of the astragalus which cast a sha-

dow of normal density. The fracture appeared to he uniting,

but the fracture line on the body fragment was irregular and

worm-eaten, indicating invasion and absorption by tissue

from the distal fragment. The diagnosis was made of

aseptic necrosis of the body of the astragalus as indicated

by the preservation of its normal density while the sur-

rounding bone underwent atrophy of disuse. The patient

had stiffness and weakness in the ankle and walked with

crutches. A roentgenogram taken 160 days after injury

revealed appearance of further invasion and reduction in

density of the body of the astragalus with preservation of

its bony articular cortex (Fig. 10). The patient was then lost

sight of.

CASE 3 is that of a five-year old boy who fell twenty-

two feet, sustaining a fracture at the junction of the neck

and body of the left astragalus with little displacement of

fragments and a fracture of the posterior superior portion of

the os calcis (Fig. 11). A foot and leg cast was worn for six

weeks, after which the patient gradually began to walk on

the limb; but stiffness and pain persisted, causing a con-

siderable amount of disability. A roentgenogram taken 274

days after the injury (Fig. 12) showed union of the frac-

tures in both astragalus and os calcis but the body of the

os calcis had undergone extensive change. There was

irregular increase in density of the distal and inferior por-

tion of the proximal fragment, which was due to newly

formed bone, but the superior and posterior portions bor-

dering on the ankle joint were reduced in volume and

irregularly in density,’ and the shadow of articular surface

was lost in almost its entire extent. There was a small island

of bone in the posterior articular portion of the body. The

body had apparently become necrotic; its distal portion had

been invaded and replaced by new hone, but the articular

portion had broken down from weight-bearing, before being

invaded and partially absorbed by vascularized connective

tissue. Walking was continued with little improvement of

symptoms. A roentgenogram taken fourteen and a half

months after the injury showed still further irregularity and

Fig. 9 Case 2. Seventy-four days after fracture of

neck of astragalus, posterior dislocation of body, and

reduction by operation. Body necrotic and retained

normal density. Atrophy of disuse of other bones.

Bony union of fracture.

123


Fig. 10 Case 2. One hundred and sixty days after

fracture. Body slightly reduced in density near

fracture due to invasion from neck.

Fig. 11 Case 3. Fresh fracture of neck of astragalus and chip off

superior and posterior portion of os calcis.

Fig. 12 Case 3. Two hundred and seventy-four days after injury.

Fracture of astragalus united. Superior and posterior part of body

broken down and irregular while remaining portion dense and

transformed. Indicative of necrosis of body with secondary changes.

123


reduction in volume of the body of the os calcis. Eighteen

months after the injury (Fig. 13) there was little change in

appearance except that the island of bone posteriorly had

increased considerably in size. Another roentgenogram

twenty-three months after injury showed the changes in the

body had remained practically stationary, but the articular

surface was more regular in outline. The island of bone in

the posterior part of the body was interpreted as a trans-

formed necrotic portion that had become revascularized

with gradual growth of the bony center.

The blood supply of the astragalus is derived mainly

from a branch of the arteria dorsalis pedis which traverses

the sinus tarsi lateral to the neck and breaks up to enter the

bone near the junction of the neck and body along the

lateral and inferior surfaces. There are very small branches

entering the bone mesially and posteriorly at points of

ligamentous and capsular attachments. Apparently when

there is a fracture along the junction of body and neck the

important vessels to the body are interrupted and there may

be insufficient circulation through the remaining vessels, so

that aseptic necrosis of a large part or all of the fragment

follows. It is evident from the partial collapse which

occurred in Case 3 that when necrosis of the body is

diagnosed, the limb should be protected from weight-

bearing for at least several months,—until union, revas-

cularization, and transformation of necrotic area has been

largely brought about. It seems probable that some of the

bad results that have been reported in fracture of the neck

of the astragalus, either united or ununited, have been due

to overlooked aseptic necrosis of the body.

Bone Transplants

Nearly all of the more recent studies tend to confirm the

view that when bone is transplanted the bone cells within

the lacunae practically all become necrotic as a result of

cutting off of the circulation. The unossified osteogenic

elements along the periphery and in the vascular canals

may survive. The extent to which they proliferate and take

part in the transformation of the necrotic bone depends to a

considerable extent upon the location of the transplant and

the extent to which it is subjected to functional stimulation.

If the transplant is in the course of a bone, with the frag-

ments of which it should become united in order that the

continuity of the bone be restored, and as a part of which it

should function, the surviving osteogenic elements prolif-

erate and take an active part in osteosynthesis and

transformation of the necrotic portion of the graft. Osteo-

genic elements of adjacent bone also participate and more

recent studies as those of Baschkirzew and Petrow [8],

Leriche and Policard [9], and Kartaschew [10], indicate

that fibrous tissue invading aseptic bone may be gradually

transformed into bone. That this is not the source of any

considerable amount of new bone replacing the dead bone

is shown by the observations of Santos that a necrotic head

in ununited fracture of the femoral neck is very little

replaced by new bone by metaplasia of invading connec-

tive tissue from the round ligament. If the transplant is in

the soft parts, disconnected with the skeleton and serving

no supporting function, the surviving unossified osteogenic

elements about the ends may proliferate temporarily,—as

in the healing of a fracture of a bone graft as shown by

Haas, or in closing the open end of the medullary cavity of

the graft as shown by Phemister. But soon resorptive

activities are found to exceed proliferative activities and

the fragment begins to decrease in volume. It may even-

tually be entirely removed in the course of months or years,

depending on the size of the fragment, or the remnants of

the mass after years may consist largely if not entirely of

spongy new bone. Thus, a large splinter of cortex in a

fracture of the tibia displaced dorsally into the soft parts is

shown in a roentgenogram taken shortly after the injury

(Fig. 14). The fracture, united in malposition, was suc-

cessfully treated by open operation, but the fragment was

left undisturbed. Two years later its shadow was about one

third the original size. Seven years later it was reduced to a

small spongy oval mass (Fig. 15) which roentgenologically

has the appearance of living bone.

In case a bone graft of the whole thickness is trans-

planted into a defect in a bone and anchored by insertion of

one end into the medullary cavity, the subsequent changes

in the intramedullary and extramedullary portions are dif-

ferent, due to some extent to their differences in function.

After union occurs the extramedullary portion may

Fig. 13 Case 3. Eighteen months after injury, showing a defective

but gradually reforming articular portion of the body of the astragalus.

123


hypertrophy and gradually be completely transformed into

living bone which may approach the shape and size of the

missing portion. In adults the rate of transformation is

slower and the extent less than in children. A striking

finding is the relatively small amount of absorption which

goes on in the non-functioning portion of transplant which

lies within the medullary canal beyond the point of union

with the end of the cortex of the host. Such bone may

present practically the same roentgenological appearance

for many years. Figure 16, Case 5, shows a broad graft of

tibial cortex seen on edge, thirtynine days after transplan-

tation for replacement of the upper end of the humerus,

excised because of a small chondrosarcoma, in a man

twenty-two years old. Figure 17 shows the same ten years

and eight months later, there being no recurrence of tumor

in the meantime. The extramedullary portion of the graft

has become slightly enlarged and rounded off and pos-

sessed of a small medullary cavity in its upper third. New

lamellae have formed in its cortex. The intramedullary

portion below the level of union with the end of the hu-

merous is almost unchanged. However, I have examined a

specimen of fibula transplanted eighteen months previously

in precisely the same way to replace the upper end of the

Fig. 14 Case 4. Large splinter (a) displaced into soft parts from fresh

fracture of tibia.

Fig. 15 Case 4. The same (a) seven years later, showing reduction in

size of splinter and apparent replacement by very spongy new bone.

Fig. 16 Case 5. Tibial graft thirty-nine days after insertion in

humerus.

123


humerus excised for osteogenic sarcoma. Amputation was

performed because of recurrence of the tumor. The extra-

medullary portion which was largely surrounded by tumor

was about one third replaced by living bone. The intra-

medullary portion was porous and on histological

examination showed some absorption with very little

replacement by new bone, suggesting that eventually it

would have been transformed. In contrast with these slow

changes in non-functioning intramedullary grafts is the

rapid absorption which a non-functioning piece of bone in

soft parts undergoes, as shown by Case 4.

Embolism and Necrosis

The etiology of the lesions dealt with up to this point has

been clear. The role of embolism in the production of both

septic and aseptic bone necrosis is still imperfectly

understood. Ritter, Winkebauer and Axhausen [11] have

expressed the belief that in pyogenic osteomyelitis the

extensive necrosis of bone is the result of septic embolism

cutting off the blood supply of large areas at the onset of

the process with subsequent invasion and infection of the

infarcted area by bacteria from the embolus. This view is

inconsistent with our knowledge of the blood supply of the

cortex of the shaft of bones. The experiments of Johnson

[12] showed that the periosteal vessels supply approxi-

mately the external half, while the internal half is supplied

by the nutrient artery and metaphyseal vessels. Injury of

either set of vessels results in necrosis of much of the bone

which they supply. Now the dead bone in osteomyelitis is

not limited to the region supplied by one or the other of

these sets of vessels. While an embolus might account for

extensive necrosis in the region supplied by the nutrient

artery, this would be impossible in the regions supplied by

the periosteal vessels since they are numerous and small.

Usually the entire thickness of cortex of the involved

region becomes necrotic. Also in primary and especially in

recurrent osteomyelitis the infection may be observed,

starting at one limited point and spreading more or less

extensively to the rest of the bone.

Aseptic necrosis of bone, the result of proven throm-

bosis or embolism, is a condition that has been rarely

reported in man. Axhausen [11] reported a case which was

classed as multiple anaemic infarction of bones, but

streptococcus longus anhemolyticus was cultured from the

lesions. Consequently it is incorrect to speak of the con-

dition as aseptic necrosis of bone.

Aseptic necrosis has been produced experimentally by

injection of small aseptic emboli into the femoral artery.

The infarcts formed in the ends of the shafts and rarely

comprised a large part of the diaphysis, but epiphyseal

necrosis was not produced. A marked osteoblastic repara-

tive reaction developed about the necrotic bone which was

rapidly replaced by new bone by the process of creeping

substitution. The so called necrosing lesions of the center

of ossification of certain epiphyses in children and the os

lunatum in young adults have been variously attributed to

injury to the blood vessels, vascular obstruction from

embolism or thrombosis, and infection.

Thus Legg-Perthes’ disease sometimes follows reduc-

tion of congenital dislocation of the hip which points to

vascular injury and the experiments of Nussbaum [13]

show that cutting epiphyseal vessels results in necrosis

followed by reorganization and deformity of the bony

center. Phemister, Brunschwig, and Day [14] have cultured

biopsied specimens from two cases each of Kohler’s dis-

ease of the tarsal navicular bone, Legg-Perthes’ disease,

and Kienbock’s disease of the os lunatum. They found that

streptococci grew in cultures of four, and the indications

are strong that this organism is the etiological factor in

some cases. In one case of Kohler’s disease and in one of

Legg-Perthes’ disease the cultures remained sterile,

Fig. 17 Case 5. Ten years and eight months after operation. Shows

non-functioning portion of graft in medullary cavity practically

unchanged, but the functioning portion above hypertrophied and

transformed.

123


although the case of Kohler’s disease was associated with

multiple osseous and lymph glandular tuberculosis. Histo-

logically there was necrosis but no sign of tuberculosis in

the navicular; consequently the case supports the theory of

Axhausen that a caseous tuberculous embolus may be a

cause of the necrosing lesions.

Histologically the majority of these lesions appear to

have something more back of them than a simple bland

embolus or injury cutting off the circulation’and producing

aseptic necrosis. As previously stated, aseptic necrotic

bone in continuity with living bone is gradually invaded

and more or less completely replaced by new bone through

the process of creeping substitution, unless it is too inac-

cessible and is broken down by traumatism. In these

diseases there is a marked fibroblastic and fixed tissue

phagocytic reaction and, in rare cases, an infiltrative

reaction which result in absorption of necrotic bone with-

out bony replacement by creeping substitution except in

occasional instances. New bone formed from surviving

osteogenic elements replaces more or less completely the

absorptive tissues in the course of time.

Bibliography

1. AXHAUSEN, G.: Knochennekrose and Sequesterbildung. Deutsche

Med. Wchnschr., XL, 1, 111, 1914.

2. PHEMISTER, D. B.: Radium Necrosis of Bone. Am. J. Roentgenol.,

XVI, 340, 1926.

3. BANCROFT, F. W.: Bone Repair Following Injury and Infection.

Arch. Surg., V, 646, 1922.

4. BRUNSCHWIG, A.: Experimental Infarction of Bone Marrow. Proc.

Soc. Exper. Biol. and Med., XXVII, 1049, 1930.

5. CORNIL, V. AND COUDRAY, P.: Du Cal. Au Point de Vue Experi-

mental et Histologique. J. de l’Anatomie et de la Physiologie, XL,

113, 1904.

6. LOOSER, E.: Uber Spatrachitis and Osteomalacie. Klinische,

rontgenologische and pathologisch-anatomische Untersuchungen.

Deutsche Ztschr. f. Chir., CLII, 210, 1920.

7. SANTOS, J. V.: Changes in the Head of the Femur after Complete

Intracapsular Fracture of the Neck: Their Bearing on Non-union

and Treatment. Arch. Surg., XXI, 470, Sept. 1930.

8. BASCHKIRZEW, N. J., UND PETROW, N. N.: Beitrage zur freien

Knochenuberpflanzung. Deutsche Ztschr. f. Chir., CXIII, 490,

1911–1912.

9. LERICHE ET POLICARD. Les Problems de la Physiologie normale et

pathologique de l’Os. Paris, Masson et Cie, 1926.

10. KARTASCHEW, S. I.: Beitrage zur Frage der freien autoplastichen

Knochentransplantation. Experimentelle Untersuchungen mit beson-

derer Berucksichtigung der Transplantation feiner Knochenstuckchen

und -splitter. Arch. f. klin. Chir., CLVI, 758, 1930.

11. AXHAUSEN, G.: Uber anamische Infarkte am Knochensystem und

ihre Bedeutung fur die Lehre von den primaren Epiphyseonek-

rosen. Arch. f. klin. Chir., CLI, 72, 1928.

12. JOHNSON, R. W.: A Physiological Study of the Blood Supply of

the Diaphysis. J. Bone and Joint Surg., IX, 153, Jan. 1927.

13. NUSSBAUM, A.: Die arteriellen Gefasse der Epiphysen des

Oherschenkels und ihre Beziehungen zu normalen und patho-

logischen Vorgangen. Bruns’ Beitrage z. klin. Chir., CXXX, 495,

1923–1924.

14. PHEMISTER, D. B., BRUNSCHWIO, A., AND DAY, L.: Streptococcus

Infections of Epiphyses and Short Bones and their Relation to

Legg-Perthes’ Disease, Kienbocks Disease and Kohler’s Disease

of the Tarsal Navicular. J. Am. Med. Assn., XCV, 1930, (in press).

123



Heritable Thrombophilia-Hypofibrinolysis and Osteonecrosisof the Femoral Head

Charles J. Glueck MD, Richard A. Freiberg MD,

Ping Wang PhD



Abstract We hypothesized that inherited thrombophilia

and hypofibrinolysis were risk factors for osteonecrosis of

the femoral head. We compared measures of thrombophilia

and hypofibrinolysis in referred new adult patients with

idiopathic osteonecrosis (n = 71) or secondary osteonecro-

sis (n = 62) with the same measures in sex- and race-

matched healthy control subjects. Heritable thrombophilic

Factor VIII and hypofibrinolytic Lp(a) were more frequently

high in the 71 patients with idiopathic osteonecrosis than in

control subjects. High Factor VIII, Factor V Leiden hetero-

zygosity, and resistance to activated protein C, all heritable

thrombophilias, were more frequently present in the 62

patients with secondary osteonecrosis than in control sub-

jects. Our data suggest inherited thrombophilia and

hypofibrinolysis are risk factors for both idiopathic and

secondary osteonecrosis of the head of the femur.

Level of Evidence: Level IV, prognostic study. See the

Guidelines for Authors for a complete description of levels

of evidence.

Introduction

Osteonecrosis (ON) of the femoral head is either

secondary, associated with various factors such as corti-

costeroids, alcoholism, lupus erythematosus, hip trauma

(dislocation, fracture), chemotherapy, HIV-AIDS, dysba-

ria, and others, or considered idiopathic when there is no

known etiology or risk factors [3, 20, 58]. In 1993, we

reported two brothers with idiopathic bilateral hip ON

who were homozygous for the hypofibrinolytic 4G/4G

polymorphism of the plasminogen activator inhibitor-1

gene (PAI-1 gene) and had very high levels of the PAI-1

gene product, hypofibrinolytic plasminogen activator

inhibitor (PAI-Fx) [34]. This kindred [34] and four similar

patients reported by Van Veldhuisen in 1993 [76] led us

to speculate that some cases of ON of the hip are caused

by familial or acquired hypofibrinolysis-thrombophilia

with resultant pathoetiologic venous thrombosis in the

femoral head [5, 24, 32].

Initially we [31], and subsequently others [5, 12, 19, 41,

44, 46, 49, 51, 59, 65, 76, 79, 80], reported data suggesting

venous thrombosis in the femoral head, mediated in many

cases by thrombophilia and hypofibrinolysis, leads to

increased intraosseous venous pressure and thence to

impaired arterial flow, osseous hypoxia, and bone death.

Beyond hip ON, thrombophilia-hypofibrinolysis also

appears associated with some cases of Legg-Calve-Perthes

disease [5, 19, 23, 28, 33, 41, 72].

To confirm and extend previous data, we asked whether

thrombophilia and hypofibrinolysis were risk factors for

ON of the femoral head in patients with idiopathic ON or

ON associated with high-dose, long-term corticosteroids.

We further asked whether age, race, diabetes, hypertension,

and cigarette smoking influenced any association between

Factor VIII levels and ON.

One or more of the authors (CJG) has received funding from the

Jewish Hospital Medical Research Council.

Each author certifies that his or her institution has approved the

human protocol for this investigation, that all investigations were

conducted in conformity with ethical principles of research, and that

informed consent was obtained.

C. J. Glueck (&), P. Wang

Cholesterol Center, Jewish Hospital, ABC Building, 3200 Burnet

Avenue, Cincinnati, OH 45229, USA


R. A. Freiberg

Cincinnati Veteran’s Administration Hospital, Cincinnati, OH,

USA

123


DOI 10.1007/s11999-008-0148-0

Materials and Methods

We compared measures of thrombophilia and hypofibrin-

olysis in 133 previously unreported patients with idiopathic

and secondary (corticosteroid-acquired) ON of the head of

the femur with healthy race- and sex-matched normal

control subjects. Alcoholism, postchemotherapy, HIV-

AIDS, and/or a history of fracture or dislocation of the hip

excluded patients from the study. After excluding patients

for these reasons, we identified 133 previously unreported

patients who had measures of thrombophilia and hypofi-

brinolysis in the course of their evaluations. All patients

meeting these criteria were included in the study. The

research protocol was approved by the FDA and the

Institutional Review Board at the Jewish Hospital; signed


ON was documented by anteroposterior and frog-leg

lateral radiographs of both hips and by MRI evaluation

[31]. MRI was used to confirm the clinical diagnosis of ON

[31]. We made no attempt to quantify the extent of femoral

head involvement by MRI. A consensus diagnosis was

made from the imaging studies by a four-person committee

of radiologists-orthopaedists blinded to patients’ clinical

status, age, and hip symptoms [31]. No selection bias was

used beyond these exclusion criteria. This evaluation pro-

vided a new, previously unreported cohort (Table 1) of 71

patients with idiopathic ON and 62 with ON associated

with corticosteroids (approximately 3000–4000 mg pred-

nisone or its equivalent) [20, 58]. Seven of 25 women

(28%) with idiopathic ON and three of 30 (10%) women

with secondary ON developed ON while taking exogenous

estrogens.

We estimated sample size based on patient-control dif-

ferences in key measures of thrombophilia (Factor V

Leiden mutation [10], resistance to activated protein C

[22], Factor VIII [38]) and hypofibrinolysis (Lp[a]) [64].

Sample size analyses revealed that with alpha = 0.05 and

power 80%, based on patient-control differences in Factor

V Leiden [10], Factor VIII [38], resistance to activated

protein C [22], and Lp(a) [64], there should be 33 or more,

32 or more, 25 or more, and 32 or more subjects in both

patient and control groups, respectively. Our sample size

was adequate to ascertain patient-control differences in our

key measures of thrombophilia and hypofibrinolysis with

alpha = 0.05 and beta = 0.20, because there were 71

patients with idiopathic ON versus 69 control subjects and

62 patients with secondary ON versus 62 control subjects.

The 71 patients with idiopathic ON included 46 men (42

white, four black) and 25 women (23 white, two black).

The 62 patients with secondary ON included 32 men (26

white, six black) and 30 women (26 white, four black). As

control subjects, 44 adult men were available, including 17

previously described healthy male hospital personnel [5]

and 27 new healthy men from family studies (39 white, one

black, and four Asian). Fifty-seven healthy adult female

control subjects included 23 previously described healthy

female hospital personnel [5] and 34 new healthy women

from family studies (49 white, five black, and three Asian).

Subjects were excluded from the control groups if they

were pregnant or taking estrogens, raloxifene, tamoxifen,

corticosteroids, or anticoagulants, all of which might affect

serologic measures of thrombophilia-hypofibrinolysis [4,

30].

We compared thrombophilia and hypofibrinolysis in

patients with 1:1 race- and sex-matched healthy normal

control subjects. Mean age in the 46 men and 25 women

with idiopathic ON (48 ± 12 years and 49 ± 9 years,

respectively) was greater than the race- and sex-matched

Table 1. Differences between patients with idiopathic and secondary osteonecrosis and race- and sex-matched healthy normal control subjects

for heritable thrombophilia and hypofibrinolysis

Variable High factor VIII

(greater than 150%)

High Lp(a) (35 mg/dL or greater)

Idiopathic osteonecrosis

(n = 71; 46 men, 25 women)

19/71 (27%) 25/69 (36%)

Race- and sex-matched control subjects

(n = 69; 44 men, 25 women)

3/66 (5%) 12/67 (18%)

p 0.0004 0.016

Variable High factor VIII

(greater than 150%)

Factor V Leiden

heterozygosity

Resistance to activated

protein C

Secondary osteonecrosis

(n = 62; 32 men, 30 women)

16/62 (26%) 6/61 (10%) 8/51 (16%)

Race- and sex-matched control subjects

(n = 62; 32 men, 30 women)

5/60 (8%) 0/61 (0%) 2/59 (3%)

p 0.011 0.028 0.042

Volume 466, Number 5, May 2008 Thrombophilia, Hypofibrinolysis, and ON 1035

123

adult male and female control subjects (43 ± 12 years and

43 ± 9 years, respectively). Mean age in the 32 men and in

the 30 women with secondary ON was 46 ± 10 years and

44 ± 11 years, respectively, similar to the race- and sex-

matched male and female control subjects (41 ± 10 years

and 45 ± 14 years, respectively).

Of the 71 patients with idiopathic ON, 19 (27%)

smoked, similar to 11 of 69 (16%) race- and sex-matched

control subjects (p = 0.12). Of the 62 patients with sec-

ondary ON, 13 (21%) smoked, similar to eight of 62 (13%)

race- and sex-matched control subjects (p = 0.23).

As previously described [4, 5], blood was collected in

3.2% buffered sodium citrate (one part citrate:nine parts

blood). The samples were immediately transported and

centrifuged at 2600 9 g for 15 minutes to obtain platelet-

poor plasma. The samples were run in batches. The plasma

was frozen in aliquots and stored at -70� C. Blood for

polymerase chain reaction (PCR) analysis was drawn in

tubes containing the appropriate anticoagulant (ethylene

diamine tetra-acetic acid).

PCR analysis was used to study four heritable thromb-

ophilic gene mutations: heterohomozygosity for the

G1691A Factor V Leiden, G20210A prothrombin gene, the

platelet glycoprotein PL A1/A2 mutation, homozygosity

for the C677T MTHFR mutation [4, 5, 24, 30, 35], and the

heritable hypofibrinolytic 4G/4G mutation of the PAI-1

gene [4].

Serologic tests used to study thrombophilia were

anticardiolipin antibodies IgG and IgM, the lupus antico-

agulant, deficiency in proteins C and S (total and free),

antithrombin III, homocysteine, and Factors VIII and

XI [4, 5, 29, 30, 35]. Protein C, total and free protein S, and

antithrombin III levels below the fifth percentile for normal

control subjects were considered abnormal [30]. Homo-

cysteine, anticardiolipin antibodies IgG and IgM, Factor

VIII, and Factor XI equal to or over the ninety-fifth

percentile for normal control subjects were considered

abnormal [30, 35].

Hypofibrinolysis studied by serologic tests included

PAI-Fx and Lp(a) [4, 5, 29, 30, 35]. Plasma PAI-Fx and

Lp(a) levels equal to or over the ninety-fifth percentile for

normal control subjects were considered abnormal [30].

Differences in PCR and serologic measures of throm-

bophilia-hypofibrinolysis between patients with idiopathic

or secondary ON and control subjects were assessed using

chi square tests (Table 1). Wilcoxon tests were used to

compare age in patients versus control subjects. Because

Factor VIII might be influenced by age, race, diabetes,

hypertension, and cigarette smoking [17], stepwise logistic

regression analysis was used with the dependent variable

being Factor VIII (level high/normal) and explanatory

variables group, age, race, diabetes, hypertension, and

cigarette smoking. These models were run separately for

idiopathic and secondary ON. All statistical evaluations

were performed using SAS (SAS/STAT software, 9.1.3,

2002; SAS Institute, Cary, NC).

Results

Heritable thrombophilia and hypofibrinolysis were more

common in patients with ON than in control subjects

(Table 1). Patients with idiopathic ON were more likely

(p = 0.0004) than sex- and race-matched healthy control

subjects to have high (greater than 150%) levels of heri-

table thrombophilic Factor VIII and were also more likely

(p = 0.016) to have inherited high levels of hypofibrino-

lytic Lp(a) (Table 1). Patients with secondary ON were

more likely than sex- and race-matched healthy control

subjects to have high (greater than 150%) levels of Factor

VIII (p = 0.011), to be heterozygous for the Factor V

Leiden mutation (p = 0.028), and to have heritable

thrombophilic resistance to activated protein C (p = 0.042)

(Table 1).

Factor VIII levels in patients with idiopathic and sec-

ondary ON were higher than in control subjects

(p = 0.0017, p = 0.02, respectively) independent of age,

race, hypertension, diabetes, and cigarette smoking.

Discussion

We [31] and others [5, 12, 19, 41, 44, 46, 49, 51, 59, 65, 76,

79, 80] have suggested venous thrombosis in the femoral

head, mediated in many cases by thrombophilia and hyp-

ofibrinolysis, leads to increased intraosseous venous

pressure and subsequent impaired arterial flow, osseous

hypoxia, and bone death. To confirm these suggestions we

asked whether thrombophilia and hypofibrinolysis

increased the risk for ON of the femoral head in patients

with idiopathic ON or ON associated with high-dose, long-

term corticosteroids.

Our study had the following limitations. We did not

have a second control group who received comparable

doses of corticosteroids but who did not develop ON of the

femoral head on prospective followup. We did not measure

intraosseous pressure or do intramedullary venography [55,

73] to document reduction in venous return, venous stasis,

intraosseous hypertension, or decreased arterial inflow. To

optimally further explore the hypothesis that inherited or

acquired thrombophilia-hypofibrinolysis mediates osseous

venous thrombosis [24, 25, 27, 29–34, 39, 43, 44, 51, 59,

62, 65, 72, 76, 79, 80], a placebo-controlled, double-blind

clinical trial [31] would be needed.

We found heritable, thrombophilic high Factor VIII

was much more common in both idiopathic and

1036 Glueck et al. Clinical Orthopaedics and Related Research

123

secondary ON than in healthy control subjects. Heritable,

hypofibrinolytic high Lp(a) was more common in idio-

pathic ON than in control subjects. In addition,

heterozygosity for the thrombophilic Factor V Leiden

mutation and thrombophilic resistance to activated pro-

tein C were more common in ON associated with

corticosteroids than in normal control subjects. These

findings, congruent with the amelioration of idiopathic

ON with low-molecular-weight heparin therapy [31],

suggested to us and other authors [1, 5, 8, 11, 41, 49, 50,

62, 65, 76, 79, 80] that thrombophilia-hypofibrinolysis-

mediated thrombosis is a potentially reversible cause of

ON of the head of the femur. Experimental models of

ON [12, 13, 52, 63] and Legg-Calve-Perthes disease [57]

implicate venous occlusion as a precipitating event with

subsequent increased intraosseous pressure, reduced

arterial inflow, ischemia, and infarction. We believe

thrombophilia-hypofibrinolysis, promoting deep osseous

venous thrombosis, initiates this cascade [5, 12, 29, 31,

32, 44, 46, 57, 63].

There are many associations between genetic mutations-

polymorphisms and ON. Single nucleotide polymorphisms

in the multidrug resistance gene have been associated with

corticosteroid-induced ON [2]. Genetic variation in alcohol-

metabolizing enzyme genes is related to alcoholism-

induced ON [15]. In two families with autosomal-dominant

multigenerational idiopathic ON, Chen et al. [16] mapped a

candidate gene to a 15cM region between D12S1663 and

D12S1632 on chromosome 12q13. Another genetic mech-

anism for development of idiopathic ON appears to involve

mutations in the endothelial nitric oxide synthase gene that

controls nitric oxide release [26, 48]. Endothelial nitric

oxide synthase polymorphisms can act alone, synergisti-

cally with cigarette smoking as a genetic risk factor for

idiopathic ON, or in concert with thrombophilia-

hypofibrinolysis [26].

In the current report, high levels of thrombophilic Factor

VIII [6, 53, 54] were more common in patients with idio-

pathic ON or secondary ON than in control subjects (27%

versus 5%, 26% versus 8%). High Factor VIII can be

inherited [6, 53, 54, 69] or acquired related to smoking-

diabetes-hypertension-mediated inflammation [17]. In the

current study, the higher Factor VIII in patients with idi-

opathic and secondary ON versus control subjects could

not be attributed to race, age, smoking, diabetes, or

hypertension, suggesting high Factor VIII in subjects with

ON is not an acute phase reactant, but a contributor to

thrombosis [45]. Our finding of high Factor VIII associated

with idiopathic and secondary ON is congruent with

associations of familial thrombophilias (V Leiden, pro-

thrombin gene, low protein S) [39, 65] with idiopathic ON

in adults and with Legg-Calve-Perthes disease (V Leiden

[5], low protein S [23, 33]).

Familial hypofibrinolytic high Lp(a) was associated with

idiopathic ON in the current study and has previously been

reported as a risk factor for idiopathic ON [66]. High Lp(a)

has been associated with familial clustering of bone mar-

row edema of the hip in three sisters [7].

The G1691A Factor V Leiden mutation [75] was more

common in patients with secondary ON than in healthy

control subjects (10% versus 0%). Bjorkman et al. [10]

reported a higher prevalence of the V Leiden mutation in

patients with idiopathic (but not secondary) ON than in the

Swedish population. Zalavras et al. [80] reported that the V

Leiden mutation was present in 18% of 72 patients (23

idiopathic, 49 secondary ON) versus 4.6% of control sub-

jects. Bjorkman et al. [9] also reported that the V Leiden

mutation was associated with ON of the knee. Celik et al.

[14] did not find an excess of the V Leiden mutation in

patients who developed corticosteroid-associated second-

ary ON after renal transplant. The V Leiden mutation and/

or thrombophilic resistance to activated protein C are also

risk factors for Legg-Calve-Perthes disease [5, 19, 22, 41].

Resistance to activated protein C, a heritable risk factor

for venous thrombosis with and without the V Leiden

mutation [74], was more commonly present in patients in

the current report with secondary ON than in control sub-

jects (16% versus 3%). In secondary ON occurring after

corticosteroid-treated severe acute respiratory syndrome,

resistance to activated protein C was more common in

patients than in control subjects [71].

We found endogenous and exogenous hyperestrogen-

emia were common in female patients with ON (28%

idiopathic, 10% secondary) consistent with our previous

studies [27, 30, 37, 39] and those of Montella et al. [61]

When estrogen-induced thrombophilia [40] is superimposed

on familial thrombophilia-hypofibrinolysis, intraosseous

thrombosis is promoted, facilitating development of ON

[30, 32, 36, 37, 39].

Preservation of the femoral head is the ultimate goal of

treatment of ON, but, as summarized by Lieberman [56],

‘‘…development of successful strategies to treat this disease

has been difficult to do because ON is associated with

numerous different diseases and neither the etiology nor the

natural history have been delineated clearly.’’ Assouline-

Dayan et al. [3] concluded ‘‘…management of osteonecrosis

is primarily palliative and does not necessarily halt or retard

the progression of the disease. Treatment options focus on

repairing the secondary changes that develop in the femoral

head and not on reversing the idiopathic pathology.’’ Cur-

rently, strategies for treatment of ON are difficult to develop

[56], do not reverse ON pathologies [3], do not halt pro-

gression to segmental collapse [3], and all have certain

limitations [18, 21, 42, 47, 70, 71]. Having outlined the

strong association between thrombophilia-hypofibrinolysis

with ON of the hip here and elsewhere [24, 25, 27, 29–34, 39,


123

43, 44, 51, 72, 79, 80], we have studied the use of 3 months of

low-molecular-weight heparin in patients with Ficat Stage I

or II ON of the hip and one or more thrombophilias or hyp-

ofibrinolyses [31]. Anticoagulation [29, 31, 32] with low-

molecular-weight heparin [67] can stop the progression of

idiopathic hip ON [31] in patients with thrombophilia-

hypofibrinolysis, decreasing the frequency of THA [31].

The diagnosis of thrombophilia-hypofibrinolysis is also

important in patients with ON because of associations with

other venous thromboses, as a stimulus for coagulation

screening in first-degree relatives of affected probands, and

in identifying patients at high risk for deep venous

thrombosis- pulmonary emboli after hip-knee arthroplasty

for whom longer-term postoperative thromboprophylaxis

may be warranted [60, 68, 77, 78].

References

1. Aksoy MC, Aksoy DY, Haznedaroglu IC, Sayinalp N, Kirazli S,

Alpaslan M. Enhanced tissue factor pathway inhibitor response as

a defense mechanism against ongoing local microvascular events

of Legg-Calve-Perthes disease. Pediatr Hematol Oncol.2005;22:391–399.

2. Asano T, Takahashi KA, Fujioka M, Inoue S, Okamoto M,

Sugioka N, Nishino H, Tanaka T, Hirota Y, Kubo T. ABCB1

C3435T and G2677T/A polymorphism decreased the risk for

steroid-induced osteonecrosis of the femoral head after kidney

transplantation. Pharmacogenetics. 2003;13:675–682.

3. Assouline-Dayan Y, Chang C, Greenspan A, Shoenfeld Y,

Gershwin ME. Pathogenesis and natural history of osteonecrosis.

Semin Arthritis Rheum. 2002;32:94–124.

4. Balasa VV, Gruppo RA, Glueck CJ, Stroop D, Becker A, Pillow

A, Wang P. The relationship of mutations in the MTHFR, pro-

thrombin, and PAI-1 genes to plasma levels of homocysteine,

prothrombin, and PAI-1 in children and adults. Thromb Haemost.1999;81:739–744.

5. Balasa VV, Gruppo RA, Glueck CJ, Wang P, Roy DR, Wall EJ,

Mehlman CT, Crawford AH. Legg-Calve-Perthes disease and

thrombophilia. J Bone Joint Surg Am. 2004;86:2642–2647.

6. Bank I, Libourel EJ, Middeldorp S, Hamulyak K, van Pampus

EC, Koopman MM, Prins MH, van der Meer J, Buller HR. Ele-

vated levels of FVIII:C within families are associated with an

increased risk for venous and arterial thrombosis. J ThrombHaemost. 2005;3:79–84.

7. Berger CE, Kluger R, Urban M, Kowalski J, Haas OA, Engel A.

Elevated levels of lipoprotein(a) in familial bone marrow edema

syndrome of the hip. Clin Orthop Relat Res. 2000;377:126–131.

8. Berger CE, Kroner A, Stiegler H, Erdel M, Haas OA, Engel A.

Hypofibrinolysis, lipoprotein(a), and plasminogen activator

inhibitor. Clin Orthop Relat Res. 2002;397:342–349.

9. Bjorkman A, Burtscher IM, Svensson PJ, Hillarp A, Besjakov J,

Benoni G. Factor V Leiden and the prothrombin 20210A gene

mutation and osteonecrosis of the knee. Arch Orthop TraumaSurg. 2005;125:51–55.

10. Bjorkman A, Svensson PJ, Hillarp A, Burtscher IM, Runow A,

Benoni G. Factor V Leiden and prothrombin gene mutation: risk

factors for osteonecrosis of the femoral head in adults. ClinOrthop Relat Res. 2004;425:168–172.

11. Blanche P, Si-Larbi AG, Jouve P. Femoral head necrosis and

hyperhomocysteinemia. J Rheumatol. 2001;28:1469.

12. Boss JH, Misselevich I. Osteonecrosis of the femoral head of

laboratory animals: the lessons learned from a comparative study

of osteonecrosis in man and experimental animals. Vet Pathol.2003;40:345–354.

13. Boss JH, Misselevich I, Bejar J, Norman D, Zinman C, Reis DN.

Experimentally gained insight-based proposal apropos the treat-

ment of osteonecrosis of the femoral head. Med Hypotheses.

2004;62:958–965.

14. Celik A, Tekis D, Saglam F, Tunali S, Kabakci N, Ozaksoy D,

Manisali M, Ozcan MA, Meral M, Gulay H, Camsari T. Asso-

ciation of corticosteroids and Factor V, prothrombin, and

MTHFR gene mutations with avascular osteonecrosis in renal

allograft recipients. Transplant Proc. 2006;38:512–516.

15. Chao YC, Wang SJ, Chu HC, Chang WK, Hsieh TY. Investi-

gation of alcohol metabolizing enzyme genes in Chinese

alcoholics with avascular necrosis of hip joint, pancreatitis and

cirrhosis of the liver. Alcohol Alcohol. 2003;38:431–436.

16. Chen WM, Liu YF, Lin MW, Chen IC, Lin PY, Lin GL, Jou YS,

Lin YT, Fann CS, Wu JY, Hsiao KJ, Tsai SF. Autosomal dom-

inant avascular necrosis of femoral head in two Taiwanese

pedigrees and linkage to chromosome 12q13. Am J Hum Genet.2004;75:310–317.

17. Coca M, Cucuianu M, Hancu N. Effect of abdominal obesity on

prothrombotic tendency in type 2 diabetes. Behavior of clotting

Factors VII and VIII, fibrinogen and von Willebrand factor. RomJ Intern Med. 2005;43:115–126.

18. Coogan PG, Urbaniak JR. Multicenter experience with free vas-

cularized fibular grafts for osteonecrosis of the femoral head. In:

Urbaniak JR, Jones JP Jr, eds. Osteonecrosis: Etiology, Diag-nosis, and Treatment. Rosemont, IL: American Academy of

Orthopedic Surgeons; 1997:327–352.

19. Eldridge J, Dilley A, Austin H, El-Jamil M, Wolstein L, Doris J,

Hooper WC, Meehan PL, Evatt B. The role of protein C, protein

S, and resistance to activated protein C in Legg-Perthes disease.

Pediatrics. 2001;107:1329–1334.

20. Ficat P. Cortisone associated necrosis of bone. In: Hungerford D,

ed. Ischemia and Necrosis of Bone. Baltimore, MD: Williams &

Wilkins; 1980:171–176.

21. Garino JP, Steinberg ME. Total hip arthroplasty in patients with

avascular necrosis of the femoral head: a 2- to 10-year follow-up.

Clin Orthop Relat Res. 1997;334:108–115.

22. Glueck CJ, Brandt G, Gruppo R, Crawford A, Roy D, Tracy T,

Stroop D, Wang P, Becker A. Resistance to activated protein C

and Legg-Perthes disease. Clin Orthop Relat Res. 1997;338:

139–152.

23. Glueck CJ, Crawford A, Roy D, Freiberg R, Glueck H, Stroop D.

Association of antithrombotic factor deficiencies and hypofi-

brinolysis with Legg-Perthes disease. J Bone Joint Surg Am.

1996;78:3–13.

24. Glueck CJ, Fontaine RN, Gruppo R, Stroop D, Sieve-Smith L,

Tracy T, Wang P. The plasminogen activator inhibitor-1 gene,

hypofibrinolysis, and osteonecrosis. Clin Orthop Relat Res.

1999;366:133–146.

25. Glueck CJ, Freiberg R, Glueck HI, Tracy T, Stroop D, Wang Y.

Idiopathic osteonecrosis, hypofibrinolysis, high plasminogen

activator inhibitor, high lipoprotein(a), and therapy with Stano-

zolol. Am J Hematol. 1995;48:213–220.

26. Glueck CJ, Freiberg R, Oghene J, Fontaine RN, Wang P. Asso-

ciation between the T-786C eNOS polymorphism and idiopathic

osteonecrosis of the head of the femur. J Bone Joint Surg Am.

2007;89:1–26.

27. Glueck CJ, Freiberg R, Tracy T, Stroop D, Wang P. Thrombo-

philia and hypofibrinolysis: pathophysiologies of osteonecrosis.


28. Glueck CJ, Freiberg RA, Crawford A, Gruppo R, Roy D, Tracy

T, Sieve-Smith L, Wang P. Secondhand smoke, hypofibrinolysis,


123

and Legg-Perthes disease. Clin Orthop Relat Res. 1998;352:

159–167.

29. Glueck CJ, Freiberg RA, Fontaine RN, Sieve-Smith L, Wang P.

Anticoagulant therapy for osteonecrosis associated with heritable

hypofibrinolysis and thrombophilia. Exp Opin Investig Drugs.

2001;10:1309–1316.

30. Glueck CJ, Freiberg RA, Fontaine RN, Tracy T, Wang P. Hyp-

ofibrinolysis, thrombophilia, osteonecrosis. Clin Orthop RelatRes. 2001;386:19–33.

31. Glueck CJ, Freiberg RA, Sieve L, Wang P. Enoxaparin prevents

progression of stages I and II osteonecrosis of the hip. ClinOrthop Relat Res. 2005;435:164–170.

32. Glueck CJ, Freiberg RA, Wang P. Role of thrombosis in osteo-

necrosis. Curr Hematol Rep. 2003;2:417–422.

33. Glueck CJ, Glueck HI, Greenfield D, Freiberg R, Kahn A, Hamer

T, Stroop D, Tracy T. Protein C and S deficiency, thrombophilia,

and hypofibrinolysis: pathophysiologic causes of Legg-Perthes

disease. Pediatr Res. 1994;35:383–388.

34. Glueck CJ, Glueck HI, Mieczkowski L, Tracy T, Speirs J, Stroop

D. Familial high plasminogen activator inhibitor with hypofi-

brinolysis, a new pathophysiologic cause of osteonecrosis?

Thromb Haemost. 1993;69:460–465.

35. Glueck CJ, Iyengar S, Goldenberg N, Smith LS, Wang P. Idio-

pathic intracranial hypertension: associations with coagulation

disorders and polycystic-ovary syndrome. J Lab Clin Med.

2003;142:35–45.

36. Glueck CJ, McMahon RE, Bouquot JE, Triplett D. Exogenous

estrogen may exacerbate thrombophilia, impair bone healing and

contribute to development of chronic facial pain. Cranio.

1998;16:143–153.

37. Glueck CJ, McMahon RE, Bouquot JE, Triplett D, Gruppo R,

Wang P. Heterozygosity for the Leiden mutation of the Factor V

gene, a common pathoetiology for osteonecrosis of the jaw, with

thrombophilia augmented by exogenous estrogens. J Lab ClinMed. 1997;130:540–543.

38. Glueck CJ, Munjal J, Aregawi D, Agloria M, Winiarska M,

Khalil Q, Wang P. Thrombophilia-hypofibrinolysis and athero-

thrombotic cardiovascular disease \age 45. Transl Res. 2007;

150:93–100.

39. Glueck CJ, Phillips HG, Cameron D, Wang P. Estrogen

replacement in a protein S deficient patient leads to diarrhea,

hyperglucagonemia, and osteonecrosis. JOP. 2001;2:323–329.

40. Gomes MP, Deitcher SR. Risk of venous thromboembolic disease

associated with hormonal contraceptives and hormone replacement

therapy: a clinical review. Arch Intern Med. 2004;164:1965–1976.

41. Gruppo R, Glueck CJ, Wall E, Roy D, Wang P. Legg-Perthes

disease in three siblings, two heterozygous and one homozygous

for the Factor V Leiden mutation. J Pediatr. 1998;132:885–888.

42. Hofmann S, Mazieres B. Osteonecrosis: natural course and con-

servative therapy [in German]. Orthopade. 2000;29:403–410.

43. Jones JP. Risk factors potentially activating intravascular coag-

ulation and causing nontraumatic osteonecrosis. In: Urbaniak JR,

Jones JP Jr, eds. Osteonecrosis: Etiology, Diagnosis, and Treat-ment. Rosemont, IL: American Academy of Orthopedic

Surgeons; 1997:89–97.

44. Jones LC, Mont MA, Le TB, Petri M, Hungerford DS, Wang P,

Glueck CJ. Procoagulants and osteonecrosis. J Rheumatol.2003;30:783.

45. Kamphuisen PW, Eikenboom JC, Vos HL, Pablo R, Sturk A,

Bertina RM, Rosendaal FR. Increased levels of Factor VIII and

fibrinogen in patients with venous thrombosis are not caused by

acute phase reactions. Thromb Haemost. 1999;81:680–683.

46. Koo KH, Kim R, Cho SH, Song HR, Lee G, Ko GH. Angiog-

raphy, scintigraphy, intraosseous pressure, and histologic findings

in high-risk osteonecrotic femoral heads with negative magnetic

resonance images. Clin Orthop Relat Res. 1994;308:127–138.

47. Koo KH, Kim R, Ko GH, Song HR, Jeong ST, Cho SH.

Preventing collapse in early osteonecrosis of the femoral head. A

randomised clinical trial of core decompression. J Bone JointSurg Br. 1995;77:870–874.

48. Koo KH, Lee JS, Lee YJ, Kim KJ, Yoo JJ, Kim HJ. Endothelial

nitric oxide synthase gene polymorphisms in patients with non-

traumatic femoral head osteonecrosis. J Orthop Res. 2006;24:

1722–1728.

49. Korompilias AV, Gilkeson GS, Ortel TL, Seaber AV, Urbaniak

JR. Anticardiolipin antibodies and osteonecrosis of the femoral

head. Clin Orthop Relat Res. 1997;345:174–180.

50. Korompilias AV, Ortel TL, Urbaniak JR. Coagulation abnor-

malities in patients with hip osteonecrosis. Orthop Clin NorthAm. 2004;35:265–271, vii.

51. Kubo T, Tsuji H, Yamamoto T, Nakahara H, Nakagawa M,

Hirasawa Y. Antithrombin III deficiency in a patient with mul-

tifocal osteonecrosis. Clin Orthop Relat Res. 2000;378:306–311.

52. Laroche M. Intraosseous circulation from physiology to disease.

Joint Bone Spine. 2002;69:262–269.

53. Lavigne G, Mercier E, Quere I, Dauzat M, Gris JC. Thrombo-

philic families with inheritably associated high levels of

coagulation Factors VIII, IX and XI. J Thromb Haemost.2003;1:2134–2139.

54. Legnani C, Cini M, Cosmi B, Poggi M, Boggian O, Palareti G.

Risk of deep vein thrombosis: interaction between oral contra-

ceptives and high Factor VIII levels. Haematologica.

2004;89:1347–1351.

55. Li YZ, Yue T. Intraosseous pressure measurement and bone

marrow venography in idiopathic necrosis of femoral head [in

Chinese]. Zhongguo Yi Xue Ke Xue Yuan Xue Bao. 1989;11:

338–343.

56. Lieberman JR. Core decompression for osteonecrosis of the hip.


57. Liu SL, Ho TC. The role of venous hypertension in the patho-

genesis of Legg-Perthes disease. A clinical and experimental

study. J Bone Joint Surg Am. 1991;73:194–200.

58. McKee MD, Waddell JP, Kudo PA, Schemitsch EH, Richards

RR. Osteonecrosis of the femoral head in men following short-

course corticosteroid therapy: a report of 15 cases. CMAJ.

2001;164:205–206.

59. Mont MA, Glueck CJ, Pacheco IH, Wang P, Hungerford DS,

Petri M. Risk factors for osteonecrosis in systemic lupus eryth-

ematosus. J Rheumatol. 1997;24:654–662.

60. Mont MA, Jones LC, Rajadhyaksha AD, Shuler MS, Hungerford

DS, Sieve-Smith L, Wang P, Cordista AG, Glueck CJ. Risk

factors for pulmonary emboli after total hip or knee arthroplasty.


61. Montella BJ, Nunley JA, Urbaniak JR. Osteonecrosis of the

femoral head associated with pregnancy. A preliminary report.

J Bone Joint Surg Am. 1999;81:790–798.

62. Nilsson IM, Krook H, Sternby NH, Soderberg E, Soderstrom N.

Severe thrombotic disease in a young man with bone marrow and

skeletal changes and with a high content of an inhibitor in the

fibrinolytic system. Acta Med Scand. 1961;169:323–337.

63. Norman D, Miller Y, Sabo E, Misselevich I, Peskin B, Zinman C,

Levin D, Reis DN, Boss JH. The effects of enoxaparin on the

reparative processes in experimental osteonecrosis of the femoral

head of the rat. APMIS. 2002;110:221–228.

64. Petersen NH, Schmied AB, Zeller JA, Plendl H, Deuschl G,

Zunker P. Lp(a) lipoprotein and plasminogen activity in patients

with different etiology of ischemic stroke. Cerebrovasc Dis.

2007;23:188–193.

65. Pierre-Jacques H, Glueck CJ, Mont MA, Hungerford DS.

Familial heterozygous protein-S deficiency in a patient who had

multifocal osteonecrosis. A case report. J Bone Joint Surg Am.

1997;79:1079–1084.


123

66. Posan E, Szepesi K, Gaspar L, Csernatony Z, Harsfalvi J, Ajzner

E, Toth A, Udvardy M. Thrombotic and fibrinolytic alterations in

the aseptic necrosis of femoral head. Blood Coagul Fibrinolysis.

2003;14:243–248.

67. Research Committee of the British Thoracic Society. Optimum

duration of anticoagulation for deep-vein thrombosis and pul-

monary embolism. Lancet. 1992;340:873–876.

68. Salvati EA, Della Valle AG, Westrich GH, Rana AJ, Specht L,

Weksler BB, Wang P, Glueck CJ. The John Charnley Award: heri-

table thrombophilia and development of thromboembolic disease

after total hip arthroplasty. Clin Orthop Relat Res. 2005;441:40–55.

69. Schambeck CM, Hinney K, Haubitz I, Mansouri Taleghani B,

Wahler D, Keller F. Familial clustering of high Factor VIII levels

in patients with venous thromboembolism. Arterioscler ThrombVasc Biol. 2001;21:289–292.

70. Stulberg BN, Davis AW, Bauer TW, Levine M, Easley K.

Osteonecrosis of the femoral head. A prospective randomized

treatment protocol. Clin Orthop Relat Res. 1991;268:140–151.

71. Sun W, Li ZR, Shi ZC, Zhang NF, Zhang YC. Changes in

coagulation and fibrinolysis of post-SARS osteonecrosis in a

Chinese population. Int Orthop. 2006;30:143–146.

72. Szepesi K, Posan E, Harsfalvi J, Ajzner E, Szucs G, Gaspar L,

Csernatony Z, Udvardy M. The most severe forms of Perthes’

disease associated with the homozygous Factor V Leiden muta-

tion. J Bone Joint Surg Br. 2004;86:426–429.

73. Tao SN. Hemodynamics changes in proximal femur of patients

with femoral head necrosis [in Chinese]. Zhonghua Wai Ke ZaZhi. 1991;29:452–454, 464.

74. Tosetto A, Castaman G, Cappellari A, Rodeghiero F. The VITA

Project: heritability of resistance to activated protein C. Vincenza

Thrombophilia and Arteriosclerosis. Thromb Haemost. 2000;84:

811–814.

75. Tripodi A. Issues concerning the laboratory investigation of

inherited thrombophilia. Mol Diagn. 2005;9:181–186.

76. Van Veldhuizen PJ, Neff J, Murphey MD, Bodensteiner D,

Skikne BS. Decreased fibrinolytic potential in patients with idi-

opathic avascular necrosis and transient osteoporosis of the hip.

Am J Hematol. 1993;44:243–248.

77. Wahlander K, Larson G, Lindahl TL, Andersson C, Frison L,

Gustafsson D, Bylock A, Eriksson BI. Factor V Leiden

(G1691A) and prothrombin gene G20210A mutations as

potential risk factors for venous thromboembolism after total

hip or total knee replacement surgery. Thromb Haemost. 2002;

87:580–585.

78. Westrich GH, Weksler BB, Glueck CJ, Blumenthal BF, Salvati

EA. Correlation of thrombophilia and hypofibrinolysis with

pulmonary embolism following total hip arthroplasty: an anal-

ysis of genetic factors. J Bone Joint Surg Am. 2002;84:

2161–2167.

79. Zalavras C, Dailiana Z, Elisaf M, Bairaktari E, Vlachogiannop-

oulos P, Katsaraki A, Malizos KN. Potential aetiological factors

concerning the development of osteonecrosis of the femoral head.

Eur J Clin Invest. 2000;30:215–221.

80. Zalavras CG, Vartholomatos G, Dokou E, Malizos KN. Genetic

background of osteonecrosis: associated with thrombophilic

mutations? Clin Orthop Relat Res. 2004;422:251–255.


123


Genetic Background of Nontraumatic Osteonecrosisof the Femoral Head in the Korean Population

Jun-Dong Chang MD, PhD, Mina Hur MD, PhD,

Sang-Soo Lee MD, PhD, Je-Hyun Yoo MD,

Kyu Man Lee MD, PhD



Abstract Major thrombophilic mutations have been

identified as risk factors for nontraumatic osteonecrosis of

the femoral head (ONFH) in Caucasians. We asked

whether the genetic background of patients with ONFH

in the Korean population was similar. We analyzed factor

V G1691A mutation (factor V Leiden), prothrombin

G20210A mutation, and methylenetetrahydrofolate reduc-

tase C677T and A1298C polymorphisms in 71 patients (53

men, 18 women) with ONFH. We classified these patients

as 51 alcohol-induced, 18 idiopathic, one steroid-induced,

and one dysbaric. We recruited 200 normal control subjects

(128 men, 72 women). We used multiplex PCR/restriction

fragment length polymorphism for each genotyping. We

observed neither factor V Leiden nor prothrombin

G20210A mutation. Although methylenetetrahydrofolate

reductase A1298C genotypes were not associated with

osteonecrosis, methylenetetrahydrofolate reductase C677T

variant genotypes increased the risk of ONFH compared

with 677CC. Odds ratios of 677CT and 677CT+TT were

2.00 (95% confidence interval, 1.05–3.81) and 1.96 (95%

confidence interval, 1.07–3.59), respectively, compared

with 677CC. Our data suggest methylenetetrahydrofolate

reductase C677T polymorphism plays a role in the patho-

genesis of osteonecrosis in the Korean population. It also

implies the genetic risk profile of ONFH may differ among

ethnic populations.

Level of Evidence: Level II, diagnostic study. See the


of evidence.

Introduction

Osteonecrosis of the femoral head (ONFH) is an ischemic

injury, which results in necrosis of the subchondral bone,

collapse of the femoral head, and degeneration of the hip

[28]. The incidence of ONFH in Korea is relatively higher

compared with that in other countries [11, 17]. ONFH is

one of the most common diseases of the hip in Korea,

occupying more than a half of the underlying causes of

total hip arthroplasty, whereas it is relatively rare in the

United States. Furthermore, the incidence of alcohol-

induced ONFH is also higher in Korea [5].

Although ONFH can be caused by various conditions

such as trauma, glucocorticoid therapy, alcoholism, storage

diseases, and diseases resulting in vasculitis, except for

traumatic conditions, the pathogenesis of osseous ischemia

is not yet completely understood [3, 4, 28]. Recently, a

number of authors have proposed intravascular coagulation

as a pathogenetic mechanism of ONFH [10], with resulting

interruption of the fine osseous blood supply. Several

studies suggest a higher prevalence of coagulation abnor-

malities in patients with ONFH compared with control

subjects [10, 15, 25].

One or more of the authors (J-DC) have received funding from a

research grant at Hallym University Medical Center (01-2006-01).





J.-D. Chang, S.-S. Lee, J.-H. Yoo

Department of Orthopedic Surgery, Hallym University College

of Medicine, Seoul, Korea

M. Hur (&), K. M. Lee

Department of Laboratory Medicine, Hangang Sacred Heart

Hospital, Hallym University College of Medicine, 94-200,

Youngdeungpo-dong, Youngdeungpo-gu, Seoul 150-719, Korea


123


DOI 10.1007/s11999-008-0147-1

Major genetic mutations related to coagulation abnor-

malities are factor V G1691A mutation (factor V Leiden),

prothrombin G20210A mutation, and 5, 10-methylenetet-

rahydrofolate reductase (MTHFR) C677T and A1298C

polymorphisms [4, 9, 22]. The presence of these genetic

variations is associated with a hypercoagulable state, and

increases the risk of thromboembolic events. Such phe-

nomena, however, have been observed mainly in

Caucasians, and an association between genetic predispo-

sition and thrombotic tendency may differ between ethnic

groups [1, 13, 14, 16, 20]. Recent studies suggest these

genetic predispositions play a role in the risk of ONFH [26,

27], but it is unclear whether they apply to non-Caucasian

populations.

We therefore asked whether there was an association

between major thrombophilic mutations (factor V Leiden,

prothrombin G20210A mutation, and MTHFR C677T and

A1298C polymorphisms) and the risk of ONFH in the

Korean population, and whether the risk was related to the

presumed etiology.


We recruited 271 individuals (181 men, 90 women): 71

consecutive patients with nontraumatic ONFH (53 men, 18

women) and 200 normal control subjects (128 men, 72

women) between September 2005 and November 2006.

If the true change in the dependent variables is 0.20 stan-

dard deviations per one standard deviation change in the

independent variable, this sample size would have approxi-

mately 90% power (alpha = 0.05, two-tail). We enrolled

healthy individuals without any clinical disorders or history

of thrombosis as normal control subjects. Their health

status was decided by a physician by routine physical

checkup consisting of clinical, radiographic, and laboratory

evaluations. Alcohol or medication history was checked by

questionnaire and interview, and the presence of pelvic or

hip lesions by plain radiograph. The control group was

used for estimation of the frequency of factor V Leiden,

prothrombin G20210A mutation, and MTHFR C677T and

A1298C polymorphisms in the general population. The

median ages of patients with ONFH and normal control

subjects were 55 years (range, 18–80 years) and 34 years

(range, 21–63 years), respectively. We obtained prior

approval of our Institutional Review Board, and informed

consent on genetic analysis from the subjects at enrollment.

Each patient underwent complete clinical, radiographic

and laboratory evaluations. In all the 71 patients (102 hips),

the diagnosis of ONFH depended on the combination of

clinical symptoms and both plain radiographs and MRI.

According to the Association Research Circulation Osse-

ous (ARCO) classification [8], 23 hips were classified as

stage II, 34 hips as stage III, and 45 hips as stage IV. In the

clinical evaluation, we paid special attention to cortico-

steroid medication, alcohol abuse, and history of

thromboembolic events, and established a presumed etiol-

ogy for the osteonecrosis in each patient. To be considered

as having alcohol-induced osteonecrosis, patients had to

have had an estimated regular alcohol consumption of

more than 400 mL per week before developing symptoms

[5, 12]. To be considered as having corticosteroid-induced

osteonecrosis, patients had to have been taking continuous

corticosteroid medication of more than 20 mg prednisone

per day for a minimum of two months before developing

symptoms [9]. We considered patients with no obvious

underlying etiology as having idiopathic osteonecrosis.

Fifty-one patients had alcohol-induced osteonecrosis, one

had steroid-induced, one had dysbaric osteonecrosis, and

18 had idiopathic (Table 1).

Peripheral blood samples were used for molecular

analysis. DNA was extracted using proteinase K treatment

followed by phenol-chloroform extraction and ethanol

precipitation [21].

For factor V Leiden and prothrombin G20210A muta-

tions, the previously described multiplex polymerase chain

reaction (PCR) method was modified [23]. Primers for

factor V Leiden were FV1 (50-tgcccagtgcttaacaagacca-30)and FV2 (50-tgttatcacactggtgctaa-30), and those for pro-

thrombin G20210A mutation were PT1 (50-tctagaaacagtt

Table 1. Demographic data of patients with osteonecrosis of the femoral head

Cause Number of patients Age* (years, range) Gender Involvement

Male Female Unilateral Bilateral

Idiopathic 18 54 (18–76) 3 15 12 6

Alcohol-induced 51 55 (29–80) 49 2 28 23

Steroid-induced 1 41 0 1 0 1

Dysbarism 1 46 1 0 0 1

Total 71 55 (18–80) 53 18 40 31

*Age expressed in median value.

1042 Chang et al. Clinical Orthopaedics and Related Research

123

gcctggc-30) and PT2 (50-atagcactgggagcattgaagc-30). PCR

temperature cycling parameters were: 94� C for 15 minutes

followed by 40 cycles of 94� C for 30 seconds, 55� C for

30 seconds, and 72� C for 30 seconds. After final extension

at 72� C for 10 minutes, two amplification products (345-

bp band for factor V Leiden and 267-bp band for pro-

thrombin G20210A) were simultaneously digested with

Mnl I and Hind III restriction enzymes. Informative bands

for both factor V Leiden (wild type, 272-bp band; hetero-

zygote, 272- and 249-bp bands; mutant type, 249-bp band)

and prothrombin G20210A (wild type, 163-bp band; het-

erozygote, 200- and 163-bp bands; mutant type, 200-bp

band) were identified by electrophoresis on a 2.5% agarose

gel.

For simultaneous detection of MTHFR C677T and

A1298C polymorphisms, another multiplex PCR was per-

formed following the previously described method [24].

Primers for C677T genotyping were 677F (50-tgaagga

gaaggtgtctgcggga-30) and 677R (50-aggacggtgcggtgagag

tg-30), and those for A1298C were 1298F (50-caaggagga

gctgctgaaga-30) and 1298R (50-ccactccagcatcactcact-30).After 40 cycles of PCR, amplification products were indi-

vidually digested with Hinf I and Mbo II restriction

enzymes for C677T and A1298C genotypings, respec-

tively. Informative bands for both C677T genotyping (wild

type, single 198-bp band; heterozygote, 198- and 175-bp

bands; homozygote variant, single 175-bp band) and

A1298C genotyping (wild type, single 72-bp band; het-

erozygote, 72- and 100-bp bands; homozygote variant,

single 100-bp band) were identified by electrophoresis on a

4% NuSieve GTG agarose gel (Cambrex BioScience

Rockland, Rockland, ME) (Fig. 1).

Two sets of multiplex PCR were conducted in a Peltier

Thermal Cycler-200 (MJ Research, Inc, Waltham, MA),

and all restriction enzymes were purchased from Promega

(Madison, WI).

Odds ratio (OR) as an estimate of relative risk and 95%

confidence interval (CI) were calculated using MedCalc

software (MedCalc Software, version 9.30; Mariakerke,

Belgium). If the value 1 was not in the range of CI, we

determined there was an increased relative risk in one

group compared with the other.

Results

For MTHFR C677T polymorphism, MTHFR C677T vari-

ant genotypes increased the risk of ONFH compared with

677CC genotype. The presence of the 677CT genotype was

associated with twofold increase (95% CI, 1.05–3.81) in

risk of ONFH compared with the CC genotype. The pres-

ence of combined CT and TT genotypes also increased the

risk of ONFH (OR, 1.96; 95% CI, 1.07–3.59) compared

with the CC genotype. None of the 271 subjects (71

patients with ONFH, 200 normal control subjects) was a

carrier of factor V Leiden and prothrombin G20210A

mutations. For MTHFR A1298C, the presence of variant

genotypes, 1298AC, 1298CC, or both, showed no differ-

ence in the risk of ONFH when using 1298AA as a

reference (Table 2).

When patients were divided into idiopathic (n = 18)

and alcohol-induced groups (n = 51), only in the alcohol-

induced group was the presence of the 677CT genotype

related to the 2.15-fold increase (95% CI, 1.04–4.46) in the

risk of ONFH compared with the CC genotype (Table 2).

Discussion

Major thrombophilic mutations are apparent risk factors for

nontraumatic osteonecrosis of the femoral head (ONFH) in

Caucasians but these have not been confirmed in other

populations. We asked whether there was any association

between major thrombophilic mutations (Factor V Leiden,

prothrombin G20210A mutation and MTHFR polymor-

phisms) and the occurrence of ONFH in the Korean

population. Because current knowledge on the thrombo-

philic genetic background of ONFH was mainly obtained

from the Caucasian populations, we questioned whether

any difference exists in other ethnic groups. Our second

question was whether the risk was related to the presumed

etiology, considering the higher prevalence of an alcohol-

induced ONFH in Korea [5].

Our data are, however, limited in that they were

obtained from a relatively small study population. In

Fig. 1A–B Restriction fragment length polymorphism analysis of

MTHFR polymorphisms is shown. (A) Shown are gels for Hinf I

digestion for C677T genotyping. Informative bands were 175-bp and

198-bp bands. A, molecular marker; B, CC type; C, TT type; D, CT

type. (B) Shown are gels for Mbo II digestion for A1298C

genotyping. Informative bands were 72-bp and 100-bp bands. A,

molecular marker; B, AA type; C, CC type; D, AC type. MTHFR,

methylenetetrahydrofolate reductase.

Volume 466, Number 5, May 2008 Genetic Background of Nontraumatic ONFH in Koreans 1043

123

particular, the tendency of increased risk in the idiopathic

ONFH group (n = 18) might have been significant with a

larger sample size (Table 2). When allele frequencies were

analyzed in MTHFR C677T polymorphism, although the

presence of T allele tended to increase the risk of ONFH, it

did not reach a statistical significance (OR, 1.46; 95% CI,

0.99–2.14). Accordingly, the modest statistical significance

of MTHFR C677T variant genotypes with about twofold

increased risk of ONFH should be verified in the future

large-scale studies. The possibility of underestimation of

alcohol abuse in both patients and control subjects may be

another limitation, considering the difficulties in detecting

and confirming the degree of alcohol consumption.

Although the exact pathophysiology of nontraumatic

ONFH is still unclear, an increased tendency for intravas-

cular coagulation has been recently proposed as a

pathogenetic mechanism leading to the interruption of the

osseous blood supply and osteonecrosis. Several authors

propose that if thrombosis occurs, it is followed by a

sequential process of obstruction of the venous drainage,

progressive rise of venous pressure, impairment of arterial

perfusion, and osseous necrosis [9, 10, 28].

Factor V Leiden generates coagulation factor V, which

is less effectively degraded by activated protein C resulting

in a hypercoagulable state, and has been established as an

important and unequivocal risk factor for venous throm-

bosis [2, 7]. Prothrombin G20210A mutation leads to

higher levels of prothrombin, increased generation of

thrombin, and thrombophilia. Factor V Leiden and pro-

thrombin G20210A mutations are the most common

genetic risk factors predisposing to thrombosis in Cauca-

sians, and their role in the occurrence of ONFH has been

also identified in several studies. One study reported that

either mutation was present in 22.2% of patients and in

7.3% of control subjects, and their presence was related to

osteonecrosis with an OR of 3.6 [28]. Such a higher

prevalence of factor V Leiden and prothrombin G20210A

mutations in patients with ONFH than in control subjects,

however, was observed only in Caucasians, leaving room

for further investigation in the other ethnic groups.

We found neither factor V Leiden nor prothrombin

G20210A mutation occurred in the study population. This

implies factor V Leiden and prothrombin G20210A

mutations are not genetic risk factors for ONFH in Asians,

or at least in the Korean population. Our finding confirms

previous reports, demonstrating the absence of these

mutations in the Korean and Chinese populations [16, 18].

It provides more evidence that the genetic risk profile of

ONFH, likewise those of the other hypercoagulable dis-

eases including deep vein thrombosis or pulmonary

embolism, may be variable in different ethnic populations.

Hyperhomocysteinemia is an established risk factor for

thrombosis. MTHFR polymorphisms, C677T and A1298C,

decrease the enzyme activity regulating the intracellular

metabolism of homocysteine and thereby mildly elevate

the plasma homocysteine level [6, 22]. In the present study,

MTHFR A1298C genotypes were not associated with the

risk of ONFH. However, MTHFR C677T variant geno-

types increased the risk of ONFH compared with 677CC.

When patients were further divided into etiologic groups,

such a statistical significance was observed only in the

alcohol-induced group (Table 2). Most of our patients (51

of 71 patients, 71.8%) had alcohol-induced ONFH in

contrast to studies of Caucasians, in which most patients

had idiopathic or steroid-induced ONFH [4, 26–28]. Ours

may be the largest genetic study on alcohol-induced

Table 2. MTHFR polymorphisms and the risk of ONFH

Genotypes Number of patients with ONFH (%) Control subjects

(%) (N = 200)

Odds ratio (95% CI)

Total

(N = 71)

Idiopathic

(N = 18)

Alcohol-induced

(N = 51)

Total versus

control subjects

Idiopathic versus

control subjects

Alcohol-induced

versus control subjects

MTHFR C677T

CC 18 (25.4) 4 (22.2) 13 (25.5) 80 (40) 1* 1* 1*

CT 36 (50.7) 8 (44.4) 28 (54.9) 80 (40) 2.00 (1.05–3.81)� 2.00 (0.58– 6.91) 2.15 (1.04–4.46)�

TT 17 (23.9) 6 (33.3) 10 (19.6) 40 (20) 1.89 (0.88–4.05) 3.00 (0.80–11.24) 1.54 (0.62–3.81)

CT + TT 53 (74.6) 14 (77.8) 38 (74.5) 120 (60) 1.96 (1.07–3.59)� 2.33 (0.74–7.34) 1.95 (0.98–3.89)

MTHFR A1298C

AA 49 (69) 10 (55.6) 37 (72.5) 116 (58) 1* 1* 1*

AC 22 (31) 8 (44.4) 14 (27.5) 78 (39) 0.67 (0.37–1.19) 1.19 (0.45–3.15) 0.56 (0.29–1.11)

CC 0 (0) 0 (0) 0 (0) 6 (3) ND ND ND

AC + CC 22 (31) 8 (44.4) 14 (27.5) 84 (42) 0.62 (0.35–1.10) 1.10 (0.42–2.92) 0.53 (0.27–1.03)

Two patients with steroid therapy (n = 1) and dysbarism (n = 1) were included in total patients with ONFH; *reference category (odds ratio,

1.0); �statistically significant; MTHFR = methylenetetrahydrofolate reductase; ONFH = osteonecrosis of the femoral head; CI = confidence

interval; ND = not determined.


123

ONFH. Our data suggests alcohol-induced ONFH is also

related to coagulation abnormalities likewise the other

etiologic types of ONFH, although the genetic risk profile

may be different. Taken together, variable incidences and

causes of ONFH may be implicated with an ethnic differ-

ence or a sociocultural difference, which may affect the

pathogenesis of ONFH.

In one small case-control study of Korean subjects, sev-

eral thrombotic (protein C activity, protein S activity,

antithrombin, anticardiolipin antibody, and immunoglobu-

lins), and fibrinolytic factors (tissue plasminogen activator,

plasminogen activator inhibitor-1, lipoprotein[a], and plas-

minogen) were compared among 24 patients with

nontraumatic ONFH and their age- and gender-matched

control subjects [19]. There were no differences in the levels

of these factors, and data could not confirm an etiologic role

for thrombotic and fibrinolytic disorders in East Asian

patients with nontraumatic ONFH. However, homocysteine

levels were not measured in that study, and the role of

thrombophilia in the risk of ONFH cannot be exactly elu-

cidated with the measurement of coagulation profile alone,

which may be affected by a variety of acquired conditions.

We found neither factor V Leiden nor prothrombin

G20210A mutation in our Korean study population.

Although MTHFR A1298C genotypes were not associated

with the risk of ONFH, MTHFR C677T variant genotypes

increased the risk of ONFH compared with the 677CC wild

genotype. The data suggest the MTHFR C677T polymor-

phism may play a role in the pathogenesis of ONFH in the

Korean population, especially in that of alcohol-induced

ONFH. It also implies the genetic risk profile of ONFH

may be variable in different ethnic populations. Further

studies in various ethnic groups are awaited to support the

present findings.

Acknowledgments We thank Tae Young Kang, MT, for his

excellent technical assistance.

References

1. Angchaisuksiri P, Pingsuthiwong S, Aryuchai K, Busabaratana

M, Sura T, Atichartakarn V, Sritara P. Prevalence of the G1691A

mutation in the factor V gene (factor V Leiden) and the G21210A

prothrombin gene mutation in the Thai population. Am J Hema-tol. 2000;65:119–122.

2. Bertina RM, Koeleman BP, Koster T, Rosendaal FR, Dirven RJ,

de Ronde H, van der Velden PA, Reitsma PH. Mutation in blood

coagulation factor V associated with resistance to activated pro-

tein C. Nature. 1994;369:64–67.

3. Bjorkman A, Burtscher IM, Svensson PJ, Hillarp A, Besjakov J,

Benoni G. Factor V Leiden and the prothrombin 20210A gene

mutation and osteonecrosis of the knee. Arch Orthop TraumaSurg. 2005;125:51–55.

4. Bjorkman A, Svensson PJ, Hillarp A, Burtscher IM, Runow A,

Benoni G. Factor V Leiden and prothrombin gene mutation: risk

factors for osteonecrosis of the femoral head in adults. ClinOrthop Relat Res. 2004;425:168–172.

5. Chang JD, Lee SH, Oh SY, Wi YH, Lee JS. The risk factors

associated with alcohol-induced osteonecrosis of the femoral

head [in Korean]. J Korean Orthop Assoc. 2004;39:692–699.

6. den Heijer M, Koster T, Blom HJ, Bos GM, Briet E, Reitsma PH,

Vandenbroucke JP, Rosendaal FR. Hyperhomocysteinemia as a

risk factor for deep-vein thrombosis. N Engl J Med. 1996;334:

759–762.

7. De Stefano V, Chiusolo P, Paciaroni K, Leone G. Epidemiology

of factor V Leiden: clinical implications. Semin Thromb Hemost.1998;24:367–379.

8. Gardeniers JWM. A new international classification of osteone-

crosis of the ARCO Committee on terminology and classification.

J Jpn Orthop Assoc. 1992;66:18–20.

9. Glueck CJ, Freiberg RA, Fontaine RN, Tracy T, Wang P. Hyp-

ofibrinolysis, thrombophilia, osteonecrosis. Clin Orthop RelatRes. 2001;386:19–33.

10. Glueck CJ, Freiberg RA, Tracy T, Stroop D, Wang P. Throm-

bophilia and hypofibrinolysis: pathophysiologies of osteone-

crosis. Clin Orthop Relat Res. 1997;334:43–56.

11. Han CD, Choe WS, Yoo JH. Effect of polyethylene wear on

osteolysis in cementless primary total hip arthroplasty: minimal

5-year follow-up study. J Arthroplasty. 1999;14:714–723.

12. Hirota Y, Hotokebuchi T, Sugioka Y. Idiopathic osteonecrosis of

the femoral head: nationwide epidemiologic studies in Japan. In:

Urbiniak JR, Jones JP Jr, eds. Osteonecrosis: Etiology, Diagno-sis, Treatment. Rosemont IL: American Academy of Orthopaedic

Surgeons; 1997:51–58.

13. Hong SH, Song J, Kim JQ. Genetic variation of the methylene-

tetrahydrofolate reductase and cystathionine beta-synthase genes

in Korean patients with coronary artery disease and a new

polymorphism in intron 7. Mol Cell Probes. 2001;15:119–123.

14. Hsu LA, Ko YL, Wang SM, Chang CJ, Hsu TS, Chiang CW, Lee

YS. The C677T mutation of the methylenetetrahydrofolate

reductase gene is not associated with the risk of coronary artery

disease or venous thrombosis among Chinese in Taiwan. HumHered. 2001;51:41–45.

15. Jones LC, Mont MA, Le TB, Petri M, Hungerford DS, Wang P,

Glueck CJ. Procoagulants and osteonecrosis. J Rheumatol.2003;30:783–791.

16. Jun ZJ, Ping T, Lei Y, Li L, Ming SY, Jing W. Prevalence of

factor V Leiden and prothrombin G20210A mutations in Chinese

patients with deep vein thrombosis and pulmonary embolism.

Clin Lab Haematol. 2006;28:111–116.

17. Kim YH, Kim VE. Uncemented porous-coated anatomic total hip

replacement: results at six years in a consecutive series. J BoneJoint Surg Br. 1993;75:6–13.

18. Kim YW, Yoon KY, Park S, Shim YS, Cho HI, Park SS. Absence

of factor V Leiden mutation in Koreans. Thromb Res.

1997;86:181–182.

19. Lee JS, Koo KH, Ha YC, Koh KK, Kim SJ, Kim JR, Song HR,

Cho SH. Role of thrombotic and fibrinolytic disorders in osteo-

necrosis of the femoral head. Clin Orthop Relat Res.

2003;417:270–276.

20. Lu Y, Zhao Y, Liu G, Wang X, Liu Z, Chen B, Hui R. Factor V

gene G1691A mutation, prothrombin gene G20210A mutation,

and MTHFR gene C677T mutation are not risk factors for pul-

monary thromboembolism in Chinese population. Thromb Res.

2002;106:7–12.

21. Miller SA, Dykes DD, Polesky HF. A simple salting out proce-

dure for extracting DNA from human nucleated cells. NucleicAcids Res. 1988;16:1215–1218.

22. Salvati EA, Della Valle AG, Westrich GH, Rana AJ, Specht L,

Weksler BB, Wang P, Glueck CJ. The John Charnley Award:

heritable thrombophilia and development of thromboembolic

Volume 466, Number 5, May 2008 Genetic Background of Nontraumatic ONFH in Koreans 1045

123

disease after total hip arthroplasty. Clin Orthop Relat Res.

2005;441:40–55.

23. Wisotzkey JD, Bell T, Monk JS. Simultaneous polymerase chain

reaction restriction fragment length polymorphism identification

of the factor V Leiden allele and the prothrombin 20210A

mutation. Diagn Mol Pathol. 1998;7:180–183.

24. Yi P, Pogribny IP, James SJ. Multiplex PCR for simultaneous

detection of 677 C?T and 1298 A?C polymorphisms in

methylenetetrahydrofolate reductase gene for population studies

of cancer risk. Cancer Lett. 2002;181:209–213.

25. Zalavras C, Dailiana Z, Elisaf M, Bairaktari E, Vlachogiannopoulos

P, Katsaraki A, Malizos KN. Potential aetiological factors

concerning the development of osteonecrosis of the femoral head.

Eur J Clin Invest. 2000;30:215–221.

26. Zalavras CG, Malizos KN, Dokou E, Vartholomatos G. The

677C?T mutation of the methylene-tetrahydrofolate reductase

gene in the pathogenesis of osteonecrosis of the femoral head.

Haematologica. 2002;87:111–112.

27. Zalavras CG, Vartholomatos G, Dokou E, Malizos KN. Factor V

Leiden and prothrombin gene mutations in femoral head osteo-

necrosis. Thromb Haemost. 2002;87:1079–1080.

28. Zalavras CG, Vartholomatos G, Dokou E, Malizos KN. Genetic

background of osteonecrosis. Associated with thrombophilic

mutations? Clin Orthop Relat Res. 2004;422:251–255.


123


Ethanol May Suppress Wnt/b-catenin Signaling on Human BoneMarrow Stroma Cells

A Preliminary Study

Ching-Hua Yeh MS, Je-Ken Chang MD,

Yan-Hsiung Wang PhD, Mei-Ling Ho PhD,

Gwo-Jaw Wang MD

Published online: 21 February 2008


Abstract Ethanol and glucocorticoids are risk factors

associated with osteonecrosis. Previous reports suggest

ethanol and glucocorticoids induce adipogenesis, decrease

osteogenesis in bone marrow stroma cells, and produce

intracellular lipid deposits resulting in death of osteocytes.

The Wnt/b-catenin signal pathway is involved in the

regulation of homeostasis of bone and we presume gluco-

corticoids and ethanol may induce osteonecrosis in humans

through a similar mechanism as in rodents. We hypothe-

sized (1) ethanol, like glucocorticoids, decreases

osteogenesis and increases adipogenesis through the Wnt/

b-catenin signaling pathway in human bone marrow stro-

mal cells; and (2) ethanol decreases intranuclear

translocation of b-catenin. We found both dexamethasone

and ethanol decrease the gene and protein expression of

osteogenesis and increase that of adipogenesis through Wnt

signaling-related genes by semiquantitative and quantita-

tive polymerase chain reaction and Western blot. Ethanol

hampered intranuclear translocation of b-catenin by

immunofluorescence analysis. The data suggest the Wnt/b-

catenin signaling pathway may be associated with ethanol-

induced osteonecrosis.

Introduction

Osteonecrosis (ON) is a pathologic process resulting from

direct and indirect injury to the osteoblasts [23]. Numerous

risk factors associated with nontraumatic ON include

corticosteroid treatment, alcoholism, smoking, hyperlipid-

emia, and hyperviscosity [1, 11, 23, 28]. However, the

pathogenesis of nontraumatic ON remains controversial

and no clear connection between adipogenesis and ON has

been established as yet. In our previous studies, we dem-

onstrated chickens treated with steroids developed fat cell

hypertrophy and eventual ON in the femoral head [7, 8].

Ethanol, on the other hand, induces adipogenesis and also

produces intracellular lipid deposits resulting in the death

of osteocytes, which may be associated with the develop-

ment of ON, especially in patients with long-term and

excessive consumption of alcohol [28].

Ching-Hua Yeh and Je-Ken Chang contributed equally to this

manuscript.

One or more of the authors (GJW, JKC, MLH) have received funding

from the National Health Research Institute of Taiwan (NHRI-EX94-

9316EP and NHRI-EX96-9615EP), the Hip Society, Technology

Development Program for Academia in Taiwan (96-EC-17-A-17-S1-

041), and Zimmer, Inc.




informed consent for participation in the study was obtained.

C.-H. Yeh, Y.-H. Wang, M.-L. Ho

Department of Physiology, College of Medicine, Kaohsiung

Medical University, Kaohsiung, Taiwan

C.-H. Yeh, J.-K. Chang, Y.-H. Wang, M.-L. Ho, G.-J. Wang

Orthopaedic Research Center, Kaohsiung Medical University,

Kaohsiung, Taiwan

C.-H. Yeh, M.-L. Ho

Graduate Institute of Medicine, Kaohsiung Medical University,

Kaohsiung, Taiwan

J.-K. Chang, G.-J. Wang (&)

Department of Orthopaedics, College of Medicine, Kaohsiung

Medical University, No 100 Shi-Chuan 1st Road, San Ming

District, Kaohsiung City, Taiwan


J.-K. Chang, G.-J. Wang

Department of Orthopaedics, Kaohsiung Medical University

Hospital, Kaohsiung Medical University, Kaohsiung, Taiwan

123


DOI 10.1007/s11999-008-0171-1

Wnt signaling pathway and the various Wnt family

members are involved in morphogenesis, organogenesis,

oncogenesis, cell fate determination, regulation of cell

proliferation, and differentiation during embryogenesis [14,

22]. Recent studies suggest the Wnt signaling pathway is

involved in the regulation of homeostasis of bone mass.

The Wnt proteins activate two types of signaling pathways:

canonic and noncanonic. The canonic Wnt proteins bind to

a member of the Frizzled family receptor and its core-

ceptors, LRP5/LRP6, at the cell membrane leading to

glycogen synthase kinase-3b (GSK-3b) inactivation and

the nuclear accumulation of b-catenin by inhibiting phos-

phorylation of b-catenin [20]. Nuclear b-catenin acts as a

transcriptional coactivator by interacting with transcription

factors of the T-cell factor (Tcf)/lymphoid enhancer factor

(Lef) family to regulate gene expression [20]. Low-density-

lipoprotein receptor-related proteins 5 and 6 (LRP5/LRP6)

are indispensable transmembrane proteins for Wnt/b-cate-

nin signaling and are likely to act as Wnt coreceptors [14].

Knockout of LRP5 in mice leads to osteopenia [29].

Overexpression of LRP5 increases bone mass and reduces

osteoblast apoptosis [2]. Therefore, the Wnt signaling

pathway likely plays important roles in the development of

bone.

Glucocorticoids may affect the Wnt signaling pathway

and reduce bone formation by inhibiting the activity of b-

catenin and regulating the expression of Wnt signal-related

molecules in osteoblasts [27]. Because of the similar

pathologic changes between steroid-induced and alcohol-

induced ON [28], we proposed the mechanism between

these two situations might be similar. In previous experi-

ments, we demonstrated ethanol decreased the mRNA

expression of osteogenic genes and increased the mRNA

expression of adipogenic genes [28] similar to the effects

of dexamethasone in human bone marrow stroma cells

from the patients with ON [4]. Based on these previous

studies, we inferred glucocorticoids and ethanol may

induce ON in humans through a similar mechanism.

We therefore hypothesized (1) ethanol, similar to glu-

cocorticoids, decreases osteogenesis and increases

adipogenesis through the regulation of the Wnt signal

pathway on human marrow cells by mRNA and protein

expression; and (2) ethanol decreases intranuclear translo-

cation of b-catenin on human marrow cells.


We monitored the responses of multipotent human marrow

cells treated with dexamethasone and ethanol to evaluate

the pathologic change of ON by monitoring gene

expressions related to osteogenesis and adipogenesis

and that of Wnt signaling-related genes. To confirm the

posttranscriptional effects of ethanol on adipogenesis and

the Wnt signaling pathway, we analyzed the protein

expression of b-catenin and PPARc by Western blot

analysis. b-catenin, the pivotal protein in the Wnt signaling

pathway, was also observed by confocal microscopy for

intranuclear translocation.

We enrolled 13 patients with ethanol-induced ON of the

femoral head and nine patients without ON. Patients with

impaired renal or liver function, patients receiving hor-

mone therapy, and those with malignancy or diabetes

mellitus were excluded. Age, gender, and body mass index

were similar between groups. The non-ON group included

three patients who had THA for dysplastic arthritis of the

hip and six patients who had internal fixation for a fresh

fracture at the acetabulum, pelvis, or femoral shaft within

2 days after injury. Frequent alcohol consumption of more

than 400 mL ethanol per week was reported for all patients

with alcohol-induced ON.

We previously reported the detailed procedures of HMC

culture [4]. Cells from 22 patients were cultured and tested

separately. The cells were separated by a PercollTM gra-

dient (Amersham Pharmacia, Piscataway, NJ); the

nucleated stroma cells were then collected for primary cell

culture [13]. The third passage of culture was used for

experiments. Donor cells (104 cells/cm2) were seeded on a

plate and when they reached 80% confluence were treated

with either 10 or 30 mmol/L ethanol (Sigma, St Louis,

MO) or 100 nmol/L dexamethasone. For immunohisto-

chemistry assay, the cells were pretreated with 25 mmol/L

LiCl (Sigma) as provocative treatment and then further

treated with and without ethanol. Messenger RNA

expression of all target genes was evaluated by semi-

quantitative reverse transcriptase–polymerase chain

reaction (RT-PCR) and quantitative real-time PCR after

treatment for 3 days. Total protein was isolated for Wes-

tern blotting after treatment for 3 days. All independent

experiments containing at least three tests were repeated at

least twice (Table 1).

All 22 cell lines were tested for the surface markers and

the ability of osteogenic, adipogenic, and chondrogenic

differentiation. The surface markers in all cell lines are

compatible with those of mesenchymal stem cells. All cell

lines showed good osteogenic, chondrogenic, and adipo-

genic differentiation after proper induction as previously

reported [19, 30].

We examined the mRNA expression of the Wnt sig-

naling ligand, Wnt 3a; the Wnt protein antagonist, SFRP2;

membrane coreceptor, LRP5; and osteogenic-related genes,

including BMP2, Runx2, and osteocalcin. The adipogenic-

related genes, including PPARc and adipsin, were exam-

ined using RT-PCR and quantitative real-time PCR. For

each gene, the quantitative RT-PCR experiments were

performed with at least three independent batches of

1048 Yeh et al. Clinical Orthopaedics and Related Research

123

cDNAs. Changes (x-fold) in gene expression level were

calculated by the 2-DDct method [21]. Analysis of variance

was performed using Excel software (Microsoft Corp,

Cupertino, CA) as in previous studies [4, 5]. HMCs were

isolated from 22 patients (13 ON and nine non-ON cases;

non-ON cases included six trauma and three osteoarthritis

cases). In total, we have RT-PCR data from seven patients,

real-time PCR data from 22 patients, Western blot data

from eight patients, and b-catenin intranuclear transloca-

tion data from six patients. All independent experiments

containing at least three tests were repeated at least twice

(Table 1).

We performed Western blots on cell extracts in eight

different cell lines, including four patients with ON and

four patients without ON, separated on a 10% sodium

dodecyl sulfate-polyacrylamide gel and blotted onto Hy-

bond-C membrane (Amersham Pharmacia). The

membranes were blocked by 5% nonfat milk and probed

with b-catenin, PPARc, and b-actin. Blots were incubated

with a horseradish peroxidase-conjugated goat anti-mouse

or anti-rabbit IgG (Santa Cruz Biotechnology, Santa Cruz,

CA) and visualized by the enhanced chemiluminescence

system (Amersham Biosciences). The optical densities of

the resolved bands were then semiquantified using Image-

Pro Plus1 analysis software (Media Cybernetics, Bethesda,

MD). All independent experiments containing at least three

tests were repeated at least twice (Table 1).

To further understand whether ethanol suppresses the

canonic Wnt signaling pathway, human marrow cells from

six different cell lines, three from patients with ON and

three from patients without ON, were treated with LiCl, an

inhibitor of GSK-3b, to activate b-catenin. LiCl treatment

was used as a provocative treatment in the intranuclear

translocation of b-catenin by immunofluorescence analysis.

Human marrow cells were cultured on glass coverslips.

After drug treatments, the cells were fixed and permeated

with 0.2% Triton X-100 (Sigma) and then blocked. Cells

were incubated with anti-b catenin antibody for 1 hour and

goat anti-mouse IgG coupled to FITC for 40 minutes.

Meanwhile, the cells were counterstained with DAPI

(Sigma) to highlight the nuclei. All images were observed

with a Fluoview FV 500 (Olympus, Tokyo, Japan) confocal

microscope and processed by a Fluoview FV 500 analysis

system (Olympus). All independent experiments contain-

ing at least three tests were repeated at least twice

(Table 1).

Table 1. List of tests performed

Case ON

ON#1 ON#2 ON#3 ON#4 ON#5 ON#6 ON#7 ON#8 ON#9 ON#10 ON#11 ON#12 ON#13

PCR N = 3 N = 3 N = 3 N = 3

n = 3 n = 3 n = 3 n = 3

Real-time PCR N = 3 N = 3 N = 3 N = 3 N = 3 N = 3 N = 3 N = 3 N = 3 N = 3 N = 3 N = 3 N = 3

n = 3 n = 2 n = 2 n = 3 n = 2 n = 2 n = 2 n = 2 n = 3 n = 2 n = 2 n = 3 n = 2

Western blotting N = 3 N = 3 N = 3 N = 3

n = 3 n = 3 n = 3 n = 3

b-catenin intranuclear translocation N = 3 N = 3 N = 3

n = 3 n = 3 n = 3

Case Non-ON

TA#1 TA#2 TA#3 TA#4 TA#5 TA#6 OA#1 OA#2 OA#3

PCR N = 3 N = 3 N = 3

n = 3 n = 3 n = 3

Real-time PCR N = 3 N = 3 N = 3 N = 3 N = 3 N = 3 N = 3 N = 3 N = 3

n = 3 n = 3 n = 2 n = 2 n = 2 n = 3 n = 3 n = 3 n = 2

Western blotting N = 3 N = 3 N = 3 N = 3

n = 3 n = 3 n = 3 n = 3

b-catenin intranuclear

translocation

N = 3 N = 3 N = 3

n = 3 n = 3 n = 3

HMCs were isolated from 22 patients (13 ON and nine non-ON cases; non-ON cases include six trauma and three osteoarthritis cases); we have

RT-PCR data from seven patients, real-time PCR data from 22 patients, Western blotting data from eight patients, and b-catenin intranuclear

translocation data from six patients; all independent experiments contain at least three repeat tests (n); each individual experiment was tested at

least twice (N); ON = osteonecrosis; RT-PCR = reverse transcriptase–polymerase chain reaction; TA = Trauma; HMC = Human marrow cell.

Volume 466, Number 5, May 2008 Ethanol Inhibits Wnt Signal on HMCs 1049

123

In the first hypothesis, data from RT-PCR, real-time

PCR, and Western blotting were presented as

mean ± standard deviation and evaluated by one-way

analysis of variance (ANOVA) and Post Hoc test by

Scheffe’s method. The independent variables in the test of

RT-PCR, real-time PCR, and Western blotting are dexa-

methasone and ethanol. A p value less than 0.05 was

considered significant. In the second hypothesis, the

intranuclear translocation of b-catenin was not evaluated

statistically because of the difficulty in the quantitation of

b-catenin on the image. The variables in the test of intra-

nuclear translocation of b-catenin were LiCl and ethanol.

Results

Ethanol suppressed the mRNA expression of osteogenic

genes, including BMP2 (p = 0.005 and 0.009), Runx2

(p = 0.01 and 0.002), and osteocalcin (p = 0.003 and

0.002) (Fig. 1). On the other hand, mRNA expression of

PPARc (p = 0.005 and 0.03) and adipsin (p = 0.03 and

0.02) was upregulated after treatment with ethanol

(Fig. 1). Ethanol suppressed osteogenic gene expression

and induced adipogenic gene expression, similar to dexa-

methasone-treated cells. Like with dexamethasone

treatment, ethanol, 10 and 30 mmol/L, decreased mRNA

expression of LRP5 (p = 0.002 and \ 0.001) and Wnt3a

(p \ 0.001 and \ 0.001) genes. On the other hand, the

expression of Wnt3a was suppressed (p \ 0.001) in a

dose-dependent manner by ethanol treatment (Fig. 2). The

expression of SFRP2 was increased by ethanol treatment,

10 and 30 mmol/L, (p = 0.01 and 0.003) but suppressed

(p = 0.02) by dexamethasone treatment (Fig. 2). The

trends of gene expression were the same in RT-PCR and

real-time PCR. Both dexamethasone and ethanol increased

the mRNA expression of PPARc and decreased that of

BMP2, osteocalcin, Runx2, Wnt 3a, and LRP5 (Table 2).

The ethanol, 10 and 30 mmol/L, suppressed (p = 0.002

and 0.006) b-catenin expression and increased PPARc(p \ 0.001 and 0.01) expression in a dose-dependent

manner similar to mRNA expression by Western blot

analysis (Fig. 3).

Fig. 1 The human bone marrow cells were treated with dexameth-

asone and ethanol for 3 days and the expression of osteogenic and

adipogenic genes were evaluated by reverse transcriptase–polymerase

chain reaction. Ethanol, 10 and 30 mmol/L, and dexamethasone

inhibited the mRNA expression of osteogenic genes, including Runx2,

osteocalcin, and BMP2, in a dose-dependent manner and both increased

mRNA expression of adipogenic genes, including PPARc and adipsin,

in a dose-dependent manner. The data support our first hypothesis.

Fig. 2 Dexamethasone decreased

SFRP2 expression, but ethanol,

10 and 30 mmol/L, increased

SFRP2 gene expression in

a dose-dependent manner by

reverse transcriptase–polymer-

ase chain reaction. Dexameth-

asone and ethanol, 10 and 30

mmol/L, decreased LRP5 and

Wnt 3a gene expression. The

data are consistent with our first

hypothesis.


123

Addition of the GSK-3b inhibitor, LiCl, at 25 mmol/L

intensified the green light in the nucleus, which meant the

increase of b-catenin–FITC complexes in the nucleus.

After ethanol treatment, immunofluorescence staining

showed b-catenin–FITC complexes were reduced in the

nucleus (Fig. 4). Decrease of b-catenin in the nucleus may

hamper the transcriptional activity.

Discussion

Previous reports indicate an association of prolonged eth-

anol intake and ON [1, 9, 15–18, 24, 28]. Ethanol-induced

ON is associated with marrow cell changes on histologic

sections similar to those from prolonged glucocorticoid

administration [28]. Because of the similar pathologic

changes between glucocorticoid-induced and ethanol-

induced ON, we presumed the mechanism between these

two situations might also be similar. Thus, we presumed

glucocorticoids and ethanol induce ON in humans through

a similar mechanism such as that in the murine cells. We

proposed two hypotheses: (1) ethanol, like glucocorticoids,

decreases osteogenesis and increases adipogenesis through

the regulation of the Wnt signal pathway on human marrow

cells; (2) ethanol diminishes intranuclear translocation of

b-catenin.

There are some limitations to this study. First, the

number of patients enrolled in this study is not large

enough to provide a conclusive answer, but rather a pre-

liminary one. Second, although we demonstrated ethanol

suppresses Wnt/b-catenin signaling in mRNA expression,

protein expression, and intranuclear translocation of b-

catenin, we cannot clearly identify the protein expression

of GSK3b, especially the phosphorylated form. Third, the

activity of GSK3b is not confirmed in this study, although

we clearly observed the changes of intranuclear translo-

cation of b-catenin. The important role of GSK3b is not

clearly linked in this study. Fourth, the control osteoar-

thritis subjects in this study were not exposed to a

substantial amount of ethanol; we do not know whether

they will develop ON if they drink excessively. Further-

more, patients with osteoarthritis may have abnormal bone

remodeling, and therefore we cannot presume their data are

normal.

Gaur et al. [12] reported canonic Wnt signaling pro-

moted osteogenesis by directly stimulating Runx2 gene

expression. We found ethanol suppressed the mRNA

expression of BMP2, Runx2, and osteocalcin, whereas it

Table 2. Result of osteogenic, adipogenic, and Wnts signal pathway-specific mRNA expression after drug treatment by real-time polymerase

chain reaction measurement in 22 samples of human bone marrow stroma cells

Gene Control Dexamethasone 0.1 lM Ethanol 10 mM Ethanol 30 mM

Mean ± SD Mean ± SD P Mean ± SD P Mean ± SD P

BMP2 100 ± 10 22 ± 9 0.018 24 ± 12 0.012 22 ± 10 0.021

Osteocalcin 100 ± 10 27 ± 8 0.013 27 ± 6 0.036 17 ± 6 0.016

Runx2 100 ± 8 42 ± 13 0.022 34 ± 12 0.011 22 ± 11 0.0041

PPARc 100 ± 7 150 ± 6 0.049 186 ± 3 0.020 272 ± 5 0.031

SFRP2 100 ± 11 47 ± 9 0.022 134 ± 12 0.041 174 ± 12 0.021

Wnt 3a 100 ± 14 42 ± 12 0.035 59 ± 12 0.036 44 ± 13 0.045

LRP5 100 ± 6 60 ± 10 0.038 64.7 ± 8 0.006 59 ± 7 0.014

p \ 0.05 was considered significant; SD = standard deviation.

Fig. 3 Cell extracts were sub-

jected to immunoblotting using

antibodies against b-catenin and

PPARc The amounts of loading

control were determined by b-

actin. Dexamethasone and etha-

nol, 10 and 30 mmol/L, decreased

b-catenin protein expression but

increased PPARc protein expres-

sion in a dose-dependent pattern.

The results support our first

hypothesis.


123

activated the mRNA expression of adipogenic genes,

including PPARc and adipsin. Therefore, ethanol causes

human marrow cells toward adipogenic differentiation

rather than osteogenic differentiation. This may be one of

the possible mechanisms of ethanol-induced ON.

Wang et al. reported death of osteocytes in alcohol-

induced ON [28]. Calder et al. [3] reported steroid-induced

and alcohol-induced ON was accompanied by widespread

apoptosis of osteoblasts and osteocytes. b-catenin was

reported to modulate cell proliferation and survival [29] We

found ethanol decreased the quantity of b-catenin and

hampered the intranuclear translocation of b-catenin in

human marrow cells. It is worthwhile to delineate the rela-

tionship between b-catenin and alcohol-induced apoptosis.

Wang et al. [27] suggested dexamethasone increases the

mRNA expression of SFRP1 in primary mesenchymal cells

from male Sprague-Dawley rats. Our data suggest dexa-

methasone decreases the mRNA expression of SFRP2,

whereas ethanol increases that of SFPR2. Ethanol and

glucocorticoids may act on different SFRPs to modulate

Wnt signaling.

Bone morphogenetic proteins (BMPs) have emerged as

key regulators of stem cell fate commitment [26]. Wnts and

TGF-b superfamily members interact to regulate the tran-

scription of a number of genes [6]. BMPs and Wnt are

important signals determining the fate of immature cells

into cells of the osteoblastic lineage [10]. However,

Nakashima et al. [25] reported BMP-2 did not induce

canonic Wnt expression and Tcf/Lef1-dependent tran-

scriptional activation in C2C12 cells. Our data suggest

ethanol decreases the gene expression of BMP2 and oste-

ocalcin. Meanwhile, it also decreased gene expression of

LRP5 and Wnt 3a and enhanced the gene expression of

SFRP2 and diminished b-catenin protein level. Crosstalk

between BMP and the Wnt signal pathway may coregulate

osteogenic gene expression, but the relation between Wnt

and the BMP signal pathway requires further investigation.

Acknowledgments We thank Yi-Jen Chen for helping in the

experimental process and Dr Chung-Hwan Chen for the preparation

of the manuscript. We also thank Chihuei Wang, PhD, for help with

the experiment and discussion.

References

1. Arlet J. Nontraumatic avascular necrosis of the femoral head.

Past, present, and future. Clin Orthop Relat Res. 1992;277:12–21.

2. Babij P, Zhao W, Small C, Kharode Y, Yaworsky PJ, Bouxsein

ML, Reddy PS, Bodine PV, Robinson JA, Bhat B, Marzolf J,

Moran RA, Bex F. High bone mass in mice expressing a mutant

LRP5 gene. J Bone Miner Res. 2003;18:960–974.

3. Calder JD, Buttery L, Revell PA, Pearse M, Polak JM. Apopto-

sis—a significant cause of bone cell death in osteonecrosis of the

femoral head. J Bone Joint Surg Br. 2004;86:1209–1213.

4. Chang JK, Ho ML, Yeh CH, Chen CH, Wang GJ. Osteogenic

gene expression decreases in stromal cells of patients with oste-

onecrosis. Clin Orthop Relat Res. 2006;453:286–292.

5. Chen CH, Ho ML, Chang JK, Hung SH, Wang GJ. Green tea

catechin enhances osteogenesis in a bone marrow mesenchymal

stem cell line. Osteoporos Int. 2005;16:2039–2045.

6. Crease DJ, Dyson S, Gurdon JB. Cooperation between the activin

and Wnt pathways in the spatial control of organizer gene

expression. Proc Natl Acad Sci USA. 1998;95:4398–4403.

Fig. 4 Human bone marrow cells

were stained with b-catenin anti-

body (green) and the cells were

costained with DAPI to make the

cell nuclei (blue). Immunofluo-

rescent images were observed

with a confocal microscope. After

the treatments with ethanol,

immunofluorescence staining

showed b-catenin–FITC com-

plexes decreased in the nucleus.

The results support our second

hypothesis.


123

7. Cui Q, Wang GJ, Balian G. Steroid-induced adipogenesis in a

pluripotential cell line from bone marrow. J Bone Joint Surg Am.1997;79:1054–1063.

8. Cui Q, Wang GJ, Su CC, Balian G. The Otto Aufranc Award.

Lovastatin prevents steroid induced adipogenesis and osteone-


9. Cui Q, Wang Y, Saleh KJ, Wang GJ, Balian G. Alcohol-induced

adipogenesis in a cloned bone-marrow stem cell. J Bone JointSurg Am. 2006;88(Suppl 3):148–154.

10. Deregowski V, Gazzerro E, Priest L, Rydziel S, Canalis E. Notch

1 overexpression inhibits osteoblastogenesis by suppressing Wnt/

beta-catenin but not bone morphogenetic protein signaling. J BiolChem. 2006;281:6203–6210.

11. Felson DT, Anderson JJ. Across-study evaluation of association

between steroid dose and bolus steroids and avascular necrosis of

bone. Lancet. 1987;1:902–906.

12. Gaur T, Lengner CJ, Hovhannisyan H, Bhat RA, Bodine PV, Komm

BS, Javed A, van Wijnen AJ, Stein JL, Stein GS, Lian JB. Canonical

WNT signaling promotes osteogenesis by directly stimulating

Runx2 gene expression. J Biol Chem. 2005;280:33132–33140.

13. Haynesworth SE, Baber MA, Caplan AI. Cell surface antigens on

human marrow-derived mesenchymal cells are detected by

monoclonal antibodies. Bone. 1992;13:69–80.

14. He X, Semenov M, Tamai K, Zeng X. LDL receptor-related

proteins 5 and 6 in Wnt/beta-catenin signaling: arrows point the

way. Development. 2004;131:1663–1677.

15. Hirota Y, Hirohata T, Fukuda K, Mori M, Yanagawa H, Ohno Y,

Sugioka Y. Association of alcohol intake, cigarette smoking, and

occupational status with the risk of idiopathic osteonecrosis of the

femoral head. Am J Epidemiol. 1993;137:530–538.

16. Hungerford DS, Lennox DW. The importance of increased

intraosseous pressure in the development of osteonecrosis of the

femoral head: implications for treatment. Orthop Clin North Am.1985;16:635–654.

17. Hungerford DS, Zizic TM. Alcoholism associated ischemic

necrosis of the femoral head. Early diagnosis and treatment. ClinOrthop Relat Res. 1978;130:144–153.

18. Jacobs B. Epidemiology of traumatic and nontraumatic osteone-


19. Jaiswal N, Haynesworth SE, Caplan AI, Bruder SP. Osteogenic

differentiation of purified, culture-expanded human mesenchymal

stem cells in vitro. J Cell Biochem. 1997;64:295–312.

20. Kengaku M, Capdevila J, Rodriguez-Esteban C, De La Pena J,

Johnson RL, Belmonte JC, Tabin CJ. Distinct WNT pathways

regulating AER formation and dorsoventral polarity in the chick

limb bud. Science. 1998;280:1274–1277.

21. Livak KJ, Schmittgen TD. Analysis of relative gene expression

data using real-time quantitative PCR and the 2(-Delta Delta

C[T]) method. Methods. 2001;25:402–408.

22. Logan CY, Nusse R. The Wnt signaling pathway in development

and disease. Annu Rev Cell Dev Biol. 2004;20:781–810.

23. Mankin HJ. Nontraumatic necrosis of bone (osteonecrosis).

N Engl J Med. 1992;326:1473–1479.

24. Mont MA, Hungerford DS. Non-traumatic avascular necrosis of

the femoral head. J Bone Joint Surg Am. 1995;77:459–474.

25. Nakashima A, Katagiri T, Tamura M. Cross-talk between Wnt

and bone morphogenetic protein 2 (BMP-2) signaling in differ-

entiation pathway of C2C12 myoblasts. J Biol Chem.2005;280:37660–37668.

26. Varga AC, Wrana JL. The disparate role of BMP in stem cell

biology. Oncogene. 2005;24:5713–5721.

27. Wang FS, Lin CL, Chen YJ, Wang CJ, Yang KD, Huang YT, Sun

YC, Huang HC. Secreted frizzled-related protein 1 modulates

glucocorticoid attenuation of osteogenic activities and bone mass.

Endocrinology. 2005;146:2415–2423.

28. Wang Y, Li Y, Mao K, Li J, Cui Q, Wang GJ. Alcohol-induced

adipogenesis in bone and marrow: a possible mechanism for

osteonecrosis. Clin Orthop Relat Res. 2003;410:213–224.

29. Westendorf JJ, Kahler RA, Schroeder TM. Wnt signaling in

osteoblasts and bone diseases. Gene. 2004;341:19–39.

30. Zuk PA, Zhu M, Mizuno H, Huang J, Futrell JW, Katz AJ,

Benhaim P, Lorenz HP, Hedrick MH. Multilineage cells from

human adipose tissue: implications for cell-based therapies.

Tissue Eng. 2001;7:211–228.


123


Pitavastatin may Reduce Risk of Steroid-induced Osteonecrosisin Rabbits

A Preliminary Histological Study

Kenjiro Nishida MD, Takuaki Yamamoto MD, PhD,

Goro Motomura MD, PhD, Seiya Jingushi MD, PhD,

Yukihide Iwamoto MD, PhD



Abstract Several animal and human studies suggest

pharmacological approaches may prevent steroid-induced

osteonecrosis (ON). We asked whether the newly

developed 3-hydroxymethyl-3-glutaryl-CoA (HMG-CoA)

reductase inhibitor, pitavastatin, could prevent steroid-

induced ON in rabbits. We injected 65 adult male Japanese

white rabbits once with 20 mg/kg of methylprednisolone

acetate into the right gluteus medius muscle. The rabbits

were divided into two groups; one group of 35 rabbits

received pitavastatins (PS), and the other group of 30

rabbits received no prophylaxis (CTR). Hematological

examinations were performed just before the steroid

injection (0 weeks) and at 1 and 2 weeks after steroid

injection; both the femora and the humeri were histologi-

cally examined 2 weeks postinjection. The incidence of

histologic changes consistent with early ON in the PS

group (13 of 35; 37%) was lower in comparison to the CTR

group (21 of 30; 70%). The size of the bone marrow fat

cells in the PS group (56.6 ± 10 lm) was smaller than

those in the CTR group (60 ± 4 lm). The data suggest

pitavastatin has the potential to lower the incidence of

steroid-induced ON in rabbits.

Introduction

Osteonecrosis (ON) of the femoral head frequently occurs

(3% to 40%) in patients who receive corticosteroids as a

treatment for underlying diseases such as systemic

erythematosus (SLE), nephrotic syndrome, and renal

transplantation [1, 13, 14, 19]. Once ON collapses the

femoral head, most patients undergo surgery [13, 22, 27].

Therefore, preventing ON would be an ideal strategy for

the treatment of this disease.

Several possible factors in the pathogenesis of ON have

been suggested based on both human and animal studies,

including coagulation abnormalities [11], hyperlipidemia

[4, 10, 17, 18, 20, 31–33], and oxidative stress [8, 9].

Human studies suggest vascular occlusion may occur

because of mechanical interruption by the thrombi or lipid

emboli in the nutrient vessels [4, 31]. In the rabbit ON

model, hyperlipidemia with associated abnormal thromb-

ophilic coagulopathy has been linked to the development of

ON [32, 33]. Based on these findings, several recent clin-

ical and experimental studies have explored the effects of

lipid-lowering agents on preventing ON [20, 23, 30]. Wang

et al. [30] reported lovastatin prevented steroid-induced

osteonecrosis in a chicken model.

3-hydroxymethyl-3-glutaryl-CoA (HMG-CoA) reduc-

tase inhibitors (statins) are potent inhibitors of cholesterol

biosynthesis in the liver by blocking the conversion of

HMG-CoA to mevalonate [6]. They have been widely used

for the treatment of hyperlipidemia as well as preventing

coronary artery diseases [25, 26]. Pitavastatin, a newly

developed statin, is apparently a potent and prolonged

inhibitor of sterol synthesis, lowering total cholesterol

(TC), and affecting triglycerides (TG) by enhancing the

hepatic low-density lipoprotein (LDL) receptor and sup-

pressing very-low-density lipoprotein (VLDL) secretion.

One of more of the authors (TY) received funding from a Grant-in-

Aid in Scientific Research (No.18591665) from the Japan Society for

the Promotion of Science.


animal protocol for this investigation and that all investigations were

conducted in conformity with ethical principles of research.

K. Nishida, T. Yamamoto (&), G. Motomura, S. Jingushi,

Y. Iwamoto

Department of Orthopaedic Surgery, Graduate School of

Medical Sciences, Kyushu University, 3-1-1 Maidashi,

Higashi-ku, Fukuoka 812-8582, Japan


123


DOI 10.1007/s11999-008-0189-4

The cholesterol-reducing effect of pitavastatin is greater

than that of the other statins [7].

We asked whether pitavastatin could reduce the risk of

early histologic changes (bone marrow fat cell size) and the

associated hyperlipidemia of steroid-induced ON in

rabbits.


We compared the incidence of early histological changes

of ON and the average sizes of the bone marrow fat cells in

two groups, a steroid-only group (control group) and a

group also treated with pitavastatin. The rabbit model of

steroid-induced ON has been previously reported [33]. We

studied 65 adult (with closed growth plates) male Japanese

white rabbits (Kyudo, Tosu, Japan) ranging in age from 28

to 32 weeks. The rabbits were injected once with 20 mg/kg

body weight of methylprednisolone acetate (MPSL,

Upjohn, Tokyo, Japan) intramuscularly into the right glu-

teus medius muscle before the start of the investigation

(week 0) [33]. The rabbits were divided into two groups,

consisting of a pitavastatin group (PS group, n = 35), and

a control group (CTR group, n = 30). Pitavastatin (Kowa

Pharmaceutical, Nagoya, Japan) at a dose of 0.7 mg/kg

body weight per day was intravenously administered in the

PS group once daily for 4 weeks, starting from 2 weeks

before the MPSL injection until 2 weeks after the injection.

In the previous study we reported the incidence of ON in

the rabbits which were injected once with 20 mg/kg body

weight of MPSL was 70% and the incidence of ON in those

with both MPSL injection and probucol treatment was 37%

[20]. In order to detect whether probucol reduced the

incidence of steroid-induced ON in rabbits, with a signifi-

cance level (alpha) of 5% and a power of 80%, sample

sizes of 31 were required for both groups. Because we

expected pitavastatin would be more effective on the pre-

vention of ON than probucol, we decided the sample size is

over 30. The animals were housed at the Animal Center of

Kyushu University. All of the experiments were conducted

in accordance with the Guidelines for Animal Experiments

of Kyushu University, the Law (no. 105), and the notifi-

cation (no. 6) of the government and the Committee on

Ethics in Japan.

The body weight of each rabbit was measured before the

experiment and at 1 and 2 weeks after the MPSL injection.

Two weeks after the MPSL injection, both the femora and

humeri were histologically examined for the presence of

ON and the sizes of the bone marrow fat cells were

examined morphologically. We used a camera that sent

electronic images of the sections to an image processor.

The diameter of bone marrow fat cells displayed on the

video monitor was measured using an interactive

mousepad-tracing instrument (NIH image software pro-

gram) [18]. We (KN, TY, GM) determined the size of the

bone marrow fat cells as the average of the greatest

diameters of 100 fat cells in four randomly selected fields

(1 field = 4 9 10-8 m2) from the viable areas. Based on

previous reports, the diagnosis of ON was histologically

confirmed 2 weeks after the steroid administration [9, 20].

Whole areas of the proximal third and distal condyles of

both the femora and humeri (eight regions) were examined

histologically for the presence of ON. A diagnosis of ON

was made blindly and independently by three authors (KN,

TY, GM). Based on the previously published criteria of

ON, a diagnosis of ON was determined based on the

presence of the accumulation of bone marrow cell debris,

and the bone trabeculae with empty lacunae or pyknotic

nuclei of osteocytes within the bone trabeculae, accompa-

nied by surrounding bone marrow cell necrosis. The

presence of repair tissue, comprising granulation tissue,

infiltration of inflammatory cells and appositional bone

formation, was also examined [32, 33]. If the diagnoses

differed among the three examiners, a consensus was

reached by discussing the histologic findings without

knowledge of the group from which the sample was

obtained. Rabbits with at least one osteonecrotic lesion

among the eight areas examined were considered to have

ON.

To evaluate the effect of pitavastatin as a lipid-lowering

agent, we examined plasma lipid levels and the plasma

LDL:HDL cholesterol ratio which is considered a potential

risk factor for corticosteroid-induced ON in rabbits [17].

We collected blood samples from the auricular arteries

while the animals were in a fasting state. The samples were

obtained in the early morning just before the MPSL

injection (week 0) and at weeks 1 and 2 after the MPSL

injection. We measured total cholesterol, low-density

lipoprotein, very-low-density lipoprotein, and triglyceride.

Data were expressed as the mean ± standard deviation.

The size of the bone marrow fat cells in the two groups was

compared using one-way analysis of variance (ANOVA)

with Scheffe’s post hoc test. The hematologic data were

compared by repeated-measures ANOVA with Scheffe’s

post hoc test. Statistical analyses were performed using the

Stat View j-0.5 software program (SAS Institute, Cary,

NC).

Results

The incidence of early histological changes of ON in the

PS group was lower (p = 0.008) in comparison to the CTR

group: 21 of 30 (70%) rabbits in the control and 13 of 35

(37%) in the PS group (Fig. 1). We observed yellowish

areas in the metaphysis and diaphysis. Histologically, the

Volume 466, Number 5, May 2008 Prevention of Osteonecrosis in Rabbits 1055

123

study rabbits demonstrated an accumulation of bone mar-

row cell debris, and the bone trabeculae had empty lacunae

(Fig. 2A–B). These findings were consistent for all of the

ON-positive rabbits.

The average sizes of the bone marrow fat cells were

smaller (p = 0.002) in the PS group (56.6 ± 10 lm) than

in the CTR group (60 ± 4 lm). In the CTR group, the

average size of bone marrow fat cells was larger

(p = 0.0001) in rabbits with early histological alterations

(61.2 ± 2.7 lm) than in those (56.5 ± 2.5 lm).

The levels of TC in the PS group were lower

(p = 0.001) than those in the CTR group throughout the

experimental period (Fig. 3A). The LDL cholesterol levels

in the PS group remained at lower levels (p \ 0.0001) than

those in the CTR group throughout the experimental period

(Fig. 3B). The average of the plasma LDL:HDL choles-

terol ratio across the experimental period was lower

(p \ 0.0001) in the PS group than in the CTR group,

although the plasma LDL:HDL cholesterol ratio was lower

(p = 0.0002) in the CTR group than in the PS group at

week 0 when the steroid had just been injected (Fig. 3C).

However, the plasma lipid levels (VLDL, TG) did not

differ between the two groups.

Discussion

Several animal and human studies suggest pharmacological

approaches may prevent steroid-induced osteonecrosis

(ON). We therefore tested the hypothesis that pitavastatin

would prevent the development of steroid-induced ON in

rabbits.

The major limitation of this study is that the duration of

steroid treatment may be too short to confirm a diagnosis

of ON. Previous studies suggest histopathologic occur

2–20 weeks after steroid administration [5, 8–12, 17, 18,

20, 31, 32, 33]. In this study, we examined the histological

changes at 2 weeks, before any collapse and confirmation

of ON could be observed. We presume our therefore

represent the early changes of ON.

We measured only serum markers of adipogenesis, total

cholesterol, low-density lipoprotein, very-low-density

lipoprotein, and triglyceride, but we were not able to detect

the direct mechanism of pitavastatin for the prevention of

steroid-induced ON. It has been reported statins have

favorable effects on the progression of atherosclerosis and

plaque instability, independent of their lipid-lowering

activity [16]. These pleiotropic effects of statins also

include improvement of the endothelial function, anti-

thrombotic actions, plaque stabilization, reduction of the

vascular inflammatory process, and antioxidant function

Fig. 1 The pitavastatin group had a lower (p = 0.008) incidence of

ON (37%) than the control group (70%).

Fig. 2A–B Histology suggesting early osteonecrotic lesions in the

pitavastatin group is shown. (A) A lower magnified view exhibits an

eosinophilic ON lesion (arrows) as compared with the normal area

2 weeks after the steroid injection (stain, hematoxylin and eosin;

original magnification, 940). (B) A higher magnified view demon-

strates an accumulation of bone marrow cell debris and the bone

trabeculae showing empty lacunae (stain, hematoxylin and eosin;

original magnification, 9100).

1056 Nishida et al. Clinical Orthopaedics and Related Research

123

[28, 29]. Furthermore, in a recent study, statin was reported

to inhibit both adipogenic and stimulated osteogenic dif-

ferentiation [15]. These various effects of statin seem to

have play an important role in the prevention of steroid-

induced ON.

3-hydroxymethyl-3-glutaryl-CoA (HMG-CoA) reduc-

tase inhibitors (statins) are widely used for the treatment of

hyperlipidemia as well as for the prevention of coronary

artery disease [25, 26]. We selected pitavastatin among the

various statins because pitavastatin has a stronger effect on

LDL-cholesterol reduction than any of the other new stat-

ins, such as pravastatin, simvastatin, or atorvastatin [7, 24].

Another reason why pitavastatin was selected in this study

is that the metabolism of pitavastatin by the cytochrome

P450 (CYP) system is minimal, principally through

CYP2C9, with little involvement of the CYP3A4 isoen-

zyme. Other new statins, simvastatin, lovastatin,

atorvastatin, and cerivastatin are inhibitors of the CYP3A4

isoenzyme [21]. Therefore, the risk of a drug-drug inter-

action between statin and a steroid that is metabolized by

the CYP 3A4 could be reduced by using pitavastatin.

Wang et al. [30] suggested lovastatin prevented steroid-

induced osteonecrosis using a chicken model. We used a

single high dose (20 mg/kg) which was higher than that

used in several previous studies [4, 9, 30]. Abeles et al. [1]

reported the high initial corticosteroid dosage in patients

with systemic lupus erythematosus might induce ON of the

femoral head.

Dexamethasone reportedly stimulates the differentiation

of bone marrow stromal cells into adipocytes as well as the

accumulation of fat in the marrow at the expense of

expression of Type-1 collagen and osteocalcin mRNA [2].

This mechanism may explain steroid-induced hypertrophy

and hyperplasia of fat cells in the bone marrow. On the

other hand, a high LDL:HDL cholesterol ratio apparently

reflects prominent lipid transport to the peripheral tissue, a

potential risk factor for corticosteroid-induced osteone-

crosis in rabbits [3, 17]. We observed a decrease in the

LDL:HDL cholesterol ratio. In addition, pitavastatin

reduced the size of the bone marrow fat cells. We therefore

speculate the inhibitory effects of pitavastatin on the

development of ON may be partly explained by the

decrease in lipid deposition in the bone marrow fat cells.

Recent animal experimental studies suggest a combi-

nation treatment with warfarin plus probucol prevents the

development of ON in steroid-treated rabbits [20]. In

addition, Ichiseki et al. [9] reported oxidative stress

plays a crucial role in the development of steroid-induced

ON. These studies suggested steroid-induced ON has a

multifactorial pathogenesis including hyperlipidemia,

coagulation abnormalities, and oxidative stress. In a recent

study, statins preserve endothelial integrity, reduce ische-

mia/reperfusion injury, and depress the interdependent

inflammatory and coagulation cascades via pleiotropic

properties [28]. We thus suppose that not only the LDL-

lowering effects of pitavastatin but also these nonlipid

effects contributed to the prevention of ON by reducing the

formation of the thrombi and lipid emboli in the blood

vessels.

Our preliminary data in this rabbit model suggest pita-

vastatin, a new HMG-CoA reductase inhibitor, may be

useful to prevent steroid-induced ON.

Fig. 3A–C Levels of total cholesterol (TC) and LDL and the ratio of

LDL cholesterol to HDL cholesterol in the control and pitavastatin

groups are shown. The timing just before the MPSL injection is indicated

as 0-week. (A) The TC levels in the pitavastatin group were lower

(p = 0.001) than those in the control group throughout the experimental

period. (B) The levels of LDL cholesterol in the pitavastatin group

remained lower (p \ 0.0001) than those in the control group throughout

the experimental period. (C) The pitavastatin group exhibited a lower

(p\ 0.0001) than average plasma LDL:HDL cholesterol ratio across the

experimental period in comparison to the control group.

Volume 466, Number 5, May 2008 Prevention of Osteonecrosis in Rabbits 1057

123

Acknowledgments We thank Naoko Kinukawa, Department of

Medical Informatics, Kyushu University, Fukuoka, Japan, for her help

and advice on the statistical analysis.

References

1. Abeles M, Urman JD, Rothfield NF. Aseptic necrosis of bone in

systemic lupus erythematosus. Relationship to corticosteroid

therapy. Arch Intern Med. 1978;138:750–754.


pluripotential cell line from bone marrow. J Bone Joint Surg Am.

1997;79:1054–1063.

3. Dobiasova M, Frohlich J. Understanding the mechanism of

LCAT reaction may help to explain the high predictive value of

LDL/HDL cholesterol ratio. Physiol Res. 1998;47:387–397.

4. Fisher DE. The role of fat embolism in the etiology of cortico-

steroid-induced avascular necrosis: clinical and experimental

results. Clin Orthop Relat Res. 1978;130:68–80.

5. Gold EW, Fox OD, Weissfeld S, Curtiss PH. Corticosteroid-

induced avascular necrosis: an experimental study in rabbits. ClinOrthop Relat Res. 1978;135:272–280.

6. Goldstein JL, Brown MS. Regulation of the mevalonate pathway.

Nature. 1990;343:425–430.

7. Hayashi T, Rani P JA, Fukatsu A, Matsui-Hirai H, Osawa M,

Miyazaki A, Tsunekawa T, Kano-Hayashi H, Iguchi A, Sumi D,

Ignarro LJ. A new HMG-CoA reductase inhibitor, pitavastatin

remarkably retards the progression of high cholesterol induced

atherosclerosis in rabbits. Atherosclerosis. 2004;176:255–263.

8. Ichiseki T, Kaneuji A, Katsuda S, Ueda Y, Sugimori T,

Matsumoto T. DNA oxidation injury in bone early after steroid

administration is involved in the pathogenesis of steroid-induced

osteonecrosis. Rheumatology (Oxford). 2005;44:456–460.

9. Ichiseki T, Matsumoto T, Nishino M, Kaneuji A, Katsuda S.

Oxidative stress and vascular permeability in steroid-induced

osteonecrosis model. J Orthop Sci. 2004;9:509–515.

10. Irisa T, Yamamoto T, Miyanishi K, Yamashita A, Iwamoto Y,

Sugioka Y, Sueishi K. Osteonecrosis induced by a single

administration of low-dose lipopolysaccharide in rabbits. Bone.

2001;28:641–649.

11. Jones JP Jr. Intravascular coagulation and osteonecrosis. ClinOrthop Relat Res. 1992;277:41–53.

12. Kawai K, Tamaki A, Hirohata K. Steroid-induced accumulation

of lipid in the osteocytes of the rabbit femoral head. A histo-

chemical and electron microscopic study. J Bone Joint Surg Am.

1985 Jun;67:755–763.

13. Koo KH, Kim R. Quantifying the extent of osteonecrosis of the

femoral head. A new method using MRI. J Bone Joint Surg Br.

1995;77:875–880.

14. Landmann J, Renner N, Gachter A, Thiel G, Harder F. Cyclo-

sporin A and osteonecrosis of the femoral head. J Bone Joint SurgAm. 1987;69:1226–1228.

15. Li X, Cui Q, Kao C, Wang GJ, Balian G. Lovastatin inhibits adi-

pogenic and stimulates osteogenic differentiation by suppressing

PPARgamma2 and increasing Cbfa1/Runx2 expression in bone

marrow mesenchymal cell cultures. Bone. 2003;33:652–659.

16. Liao JK. Isoprenoids as mediators of the biological effects of

statins. J Clin Invest. 2002;110:285–288.

17. Miyanishi K, Yamamoto T, Irisa T, Yamashita A, Jingushi S,

Noguchi Y, Iwamoto Y. A high low-density lipoprotein

cholesterol to high-density lipoprotein cholesterol ratio as a

potential risk factor for corticosteroid-induced osteonecrosis in

rabbits. Rheumatology (Oxford). 2001;40:196–201.


Noguchi Y, Iwamoto Y. Bone marrow fat cell enlargement and a

rise in intraosseous pressure in steroid-treated rabbits with oste-

onecrosis. Bone. 2002;30:185–190.



20. Motomura G, Yamamoto T, Miyanishi K, Jingushi S, Iwamoto Y.

Combined effects of an anticoagulant and a lipid-lowering agent

on the prevention of steroid-induced osteonecrosis in rabbits.

Arthritis Rheum. 2004;50:3387–3391.

21. Mukhtar RY, Reid J, Reckless JP. Pitavastatin. Int J Clin Pract.2005;59:239–252.

22. Ohzono K, Saito M, Takaoka K, Ono K, Saito S, Nishina T,

Kadowaki T. Natural history of nontraumatic avascular necrosis

of the femoral head. J Bone Joint Surg Br. 1991;73:68–72.

23. Pritchett JW. Statin therapy decreases the risk of osteonecrosis in

patients receiving steroids. Clin Orthop Relat Res. 2001;386:173–

178.

24. Saito Y, Yamada N, Teramoto T, Itakura H, Hata Y, Nakaya N,

Mabuchi H, Tushima M, Sasaki J, Goto Y, Ogawa N. Clinical

efficacy of pitavastatin, a new 3-hydroxy-3-methylglutaryl

coenzyme A reductase inhibitor, in patients with hyperlipidemia.

Dose-finding study using the double-blind, three-group parallel

comparison. Arzneimittelforschung. 2002;52:251–255.

25. Scandinavian Simvastatin Survival Study Group. Randomised

trial of cholesterol lowering in 4444 patients with coronary heart

disease: the Scandinavian Simvastatin Survival Study (4S).

Lancet. 1994;344:1383–1389.

26. Shepherd J, Cobbe SM, Ford I, Isles CG, Lorimer AR, Macfarlane

PW, McKillop JH, Packard CJ. Prevention of coronary heart dis-

ease with pravastatin in men with hypercholesterolemia. West of

Scotland Coronary Prevention Study Group. N Engl J Med.

1995;333:1301–1307.

27. Shimizu K, Moriya H, Akita T, Sakamoto M, Suguro T. Pre-

diction of collapse with magnetic resonance imaging of avascular

necrosis of the femoral head. J Bone Joint Surg Am.

1994;76:215–223.

28. Sowers J. Effects of statins on the vasculature: implications for

aggressive lipid management in the cardiovascular metabolic

syndrome. Am J Cardiol. 2003;91:14–22.

29. Takemoto M, Liao JK. Pleiotropic effects of 3-hydroxy-3-meth-

ylglutaryl coenzyme a reductase inhibitors. Atheroscler ThrombVasc Biol. 2001;21:1712–1719.

30. Wang GJ, Cui Q, Balian G. The pathogenesis and prevention of

steroid-induced osteonecrosis. Clin Orthop Relat Res.

2000;370:295–310.

31. Wang GJ, Sweet DE, Reger SI, Thompson RC. Fat-cell changes

as a mechanism of avascular necrosis of the femoral head in

cortisone-treated rabbits. J Bone Joint Surg Am. 1977;59:729–

735.

32. Yamamoto T, Hirano K, Tsutsui H, Sugioka Y, Sueishi K. Cor-

ticosteroid enhances the experimental induction of osteonecrosis

in rabbits with Shwartzman reaction. Clin Orthop Relat Res.

1995;316:235–243.

33. Yamamoto T, Irisa T, Sugioka Y, Sueishi K. Effects of pulse

methylprednisolone on bone and marrow tissues: corticosteroid-

induced osteonecrosis in rabbits. Arthritis Rheum. 1997;40:2055–

2064.

1058 Nishida et al. Clinical Orthopaedics and Related Research

123


Preventive Effects of Puerarin on Alcohol-induced Osteonecrosis

Yisheng Wang MD, Li Yin MD, Yuebai Li PhD,

Peilin Liu MD, Quanjun Cui MD



Abstract Alcohol can induce adipogenesis by bone

marrow stromal cells and may cause osteonecrosis of the

femoral head. Currently, there are no medications available

to prevent alcohol-induced osteonecrosis. We hypothesized

puerarin, a Chinese herbal medicine with antioxidative and

antithrombotic effects, can prevent alcohol-induced adi-

pogenesis and osteonecrosis. Both bone marrow stromal

cells (in vitro) and mice (in vivo) were treated either with

ethanol or with ethanol and puerarin, with an untreated

group serving as a control. In the in vitro study, the number

of adipocytes, contents of triglycerides, and levels of

PPARc mRNA expression were decreased and alkaline

phosphatase activity, contents of osteocalcin, and levels of

osteocalcin mRNA expression were increased in cells

treated with both alcohol and puerarin, compared with cells

treated with alcohol only. In the in vivo study, marrow

necrosis, fat cell hypertrophy and proliferation, thinner and

sparse trabeculae, diminished hematopoiesis, and increased

empty osteocyte lacunae in the subchondral region of the

femoral head were observed in mice treated with alcohol.

However, no such changes were seen in femoral heads of

mice treated with alcohol and puerarin. The data suggest

puerarin can inhibit adipogenic differentiation by bone

marrow stromal cells both in vitro and in vivo and prevents

alcohol-induced osteonecrosis in this model.

Introduction

Approximately one-third of patients with nontraumatic

osteonecrosis (ON) have associated alcohol abuse [1, 5,

16–19, 36, 45]. Animal studies suggest alcohol can cause

hypertrophy and proliferation of fat cells, fatty degenera-

tion of osteocytes, and thinner and sparse trabeculae [20].

Several reports suggest primary marrow mesenchymal

stromal cells (MSCs) and cloned bone marrow stem cells

treated with alcohol resulted in adipogenic differentiation

and decreased levels of alkaline phosphatase (ALP) and

osteocalcin [10, 20, 28]. Adipose-specific gene 422(aP2)

expression is enhanced and osteogenic gene Type I colla-

gen expression decreased in MSCs exposed to alcohol [28].

These findings suggest the mechanism of alcohol-induced

ON may be related to alcohol directly inducing adipogen-

esis and inhibiting osteogenesis in MSCs.

For thousands of years the traditional Chinese herbal

medicine pueraria has been used to treat alcoholism [2, 25,

26, 32, 38, 41]. Recently, it was found puerarin, extracted

from pueraria, is antioxidative, antithrombotic, and

decreases cell injuries secondary to lipid peroxidation by

Investigation performed at Orthopaedic Institute of Zhengzhou

University, Zhengzhou, Henan, China.

Each author certifies that he or she has no commercial associations

(eg, consultancies, stock ownership, equity interest, patent/licensing

arrangements, etc) that might pose a conflict of interest in connection

with the submitted article.




Y. Wang, L. Yin, P. Liu

Department of Orthopaedic Surgery, 1st Affiliated Hospital,

Zhengzhou University, Zhengzhou, China

Y. Li

Department of Biochemistry and Molecular Biology, Basic

Medical College, Zhengzhou University, Zhengzhou, China

Q. Cui (&)

Department of Orthopaedic Surgery, University of Virginia

School of Medicine, P.O. Box 800159, Charlottesville,

VA 22908-0159, USA


123


DOI 10.1007/s11999-008-0178-7

protecting the stability of the cell membrane [4, 6, 7, 11,

12, 53, 55]. The findings indicate puerarin may have the

potential to prevent alcohol-induced ON.

We therefore hypothesized puerarin inhibits alcohol-

induced adipocytic differentiation of MSCs and fatty

degeneration of osteocytes and may be able to prevent

alcohol-induced osteonecrosis. We further hypothesized

puerarin would reduce expression of PPARc, a transcrip-

tion factor important in adipogenesis.


In order to test our hypotheses, we conducted both in vitro

and in vivo studies. Bone marrow stromal cells and mice

were treated either with alcohol only or with both alcohol

and puerarin, or received no treatment to serve as control.

Preventive effects of puerarin on alcohol-induced adipo-

genesis and osteonecrosis were analyzed by examining the

morphologic changes, specific gene expression, serology,

and histology.

We obtained bone marrow cells from the midshafts of

6- to 8-week-old male and female mice femurs and plated

at a density of 1.5 9 106 cells/cm2. The cells were main-

tained in Dulbecco’s modified Eagle medium (Gibco BRL,

Gaithersburg, MD) containing 10% fetal bovine serum

(Hyclone Laboratories, Logan, UT), 50 mg/mL sodium

ascorbate, and antibiotics (100 U/mL penicillin G and

100 mg/mL streptomycin) in a humidified atmosphere of

5% CO2 at 37� C. Medium was added to the wells at the

same time as the cells were seeded, and was first changed

after 72 hours, then every 48 hours thereafter. At the same

time when cells were seeded, we established three groups:

(1) cells treated with 0.09 mol/L ethanol, (2) cells treated

with 0.09 mol/L ethanol and 0.01 mg/mL puerarin, and (3)

cells without treatment as controls. Four replicates of each

group were obtained.

After 21 days of culture, cells of each group were fixed

in 75% ethanol for 8 minutes and stained with Sudan III for

30 minutes at 60� C and counterstained with hematoxylin.

The number of adipocytes in 100-mm2 on each well in 24-

well plates was counted under a microscope (Leitz, Al-

lendale, NJ, USA) equipped with a color video camera and

frame grabber. The average number of adipocytes in 24-

well plates was calculated.

We assayed triglycerides using a kit (Sino-America,

Luoyang, China). Confluent cells cultured for 21 days in

each group were removed mechanically into 2 mL phos-

phate-buffered saline. The cells were lysed by freezing and

thawing repeatedly and centrifuged at 700 9 g for

10 minutes by Sorvall RMC 14 (Kendro, Newtown, CT,

USA). The supernatants were used for the assay. A solution

of chloroform and methanol (2:1, volume per volume) was

mixed with the supernatants, placed at 37� C for 5 minutes,

and then the chloroform-methanol phase was removed.

Using the kit, the levels of the triglycerides were deter-

mined with a Hitachi 7150 Biochemistry analyzer (Hitachi,

Tokyo, Japan).

Alkaline phosphatase activity was determined using a

kit for ALP (Changzheng Technological Inc, Shanghai,

China). Confluent cells cultured for 12 days in each group

were suspended mechanically in 1 mL phosphate-buffered

saline for each well. The cells were lysed by freezing and

thawing repeatedly and centrifuged at 700 9 g for

10 minutes by Sorvall RMC 14 (Kendro, Newtown, CT).

The supernatants were used for the assay. Absorption was

measured at 410 nm on a spectrophotometer (Spectronic

Instruments, Rochester, NY). The values were standardized

by determining the total protein in the cell layers with the

use of a Coomassie brilliant blue method. Culture media

from cells cultured for 14 days in each group were col-

lected and used to determine the levels of osteocalcin by

radioimmunoassay.

We randomly divided 216 4-week-old Kunming mice

(experimental animal center, Henan Province) into three

groups: (1) model group: mice received spirits (20 mL/kg

body weight) containing 46% ethanol intragastrically and

normal saline (10 mL/kg) by intramuscular injection; (2)

experimental group: received spirits (20 mL/kg body

weight) containing 46% ethanol intragastrically and puera-

rin (0.5 g/kg body weight) by intramuscular injection; and

(3) control group: received water (20 mL/kg) intragastri-

cally and normal saline (10 mL/kg) by intramuscular

injection daily. In addition, the animals were free to receive

food and water at all times. Fifteen animals from each group

were sacrificed using overdose anesthesia 4, 6, 8, and

10 months after treatment and specimens were processed for

histology, and additional 12 animals were used at 10 months

to detect gene expression. The study protocol was approved

by the Animal Review Board of the University.

We collected blood samples after a 12-hour fasting

period 4, 6, 8, and 10 months after treatment. Serum levels

of total cholesterol (CHO), triglyceride (TG), and alkaline

phosphatase activity (ALP) were determined by a method

of biochemical assay using kits (Sino-America, Luoyang,

China).

Liver specimens harvested from the right lobe each

measuring about 5 9 5 9 3 mm were processed for frozen

sectioning, and 5-lm sections were cut, stained with

hematoxylin and eosin (HE) or Sudan III (Sigma Chemical,

St. Louis, MO), and examined by light microscopy. Fem-

oral head specimens were cut symmetrically along the

coronal plane into two parts. Half of the specimens were

fixed in 10% formalin for 24 hours and then decalcified in

10% ethylenediaminetetraacetic acid (EDTA) in Tris-HCl

buffer. The tissues were embedded in paraffin. Five-lm

1060 Wang et al. Clinical Orthopaedics and Related Research

123

sections were cut and stained with hematoxylin and eosin.

The remaining specimens were sent for frozen section and

stained with Sudan III. We examined five sections from

each animal using a modification of the method described

by Warner et al. [51]. Briefly, five fields within the zone of

the subchondral area of the femoral head on each section

were chosen. The first field was located at the approximate

center of the subchondral bone at the weight-bearing area,

and the remaining four fields were located at both sides of

the first field with two fields at each side. The mean of the

five fields from each section was determined to represent

that section. The mean of the five sections from each ani-

mal was taken as the value for that animal. The following

parameters were assessed: (1) 200 osteocyte lacunae in

each established field were counted under a light micro-

scope at 9200 magnification, and then the percentage of

the empty osteocyte lacunae was determined; and (2) the

average diameter of the largest fat cell was measured in

each field using an ocular micrometer under the light

microscope at 9200 magnification [49], and the average

diameter for fat cells in each animal was determined.

After MSCs of each group were treated 6 days in vitro

or animals of each group for 6 months in vivo, using

b-actin as endocontrol, the expression levels of PPARcmRNA and osteocalcin mRNA were analyzed by reverse

transcription polymerase chain reaction. Bone marrow cells

from all three groups were maintained in media for

10 days, treated 6 days with 0.09 mol/L ethanol, 0.09 mol/

L ethanol and 0.01 mg/ml puerarin, or neither. The cells

were digested with solution of 0.05% trypsin/0.02%

EDTA, transferred into a centrifuge tube, and centrifuged

at 1000 rpm for 10 minutes. The supernatants were

removed. The remaining cells were lysed. Total RNA was

isolated from cells using a Flash UNIQ-10 Spin Column

Total RNA isolation kit (Sino-America, Luoyang, China).

Animals from each group were sacrificed at 6 months after

treatment. The femoral head specimens were placed into

1 mL TRIzol solution, ground completely, and rested for

5 minutes. Total RNA was isolated from ground femoral

head using TRIzol methods. The expression levels of adi-

pogenic transcription factor PPARc (peroxisome

proliferator-activated receptor-c) mRNA and osteocalcin

mRNA in cells and in animals were examined by reverse

transcription polymerase chain reaction. The PPARc and

osteocalcin primer were designed by the biomolecular

research center of University of Virginia. The b-actin pri-

mer was designed by Jikang Biotechnology Ltd. Co. of

Shanghai. All primers were synthesized by Dingan Bio-

technology Ltd. Co. of Shanghai. The sequences were:

PPARc:

Forward primer-50CTGGCCTCCCTGATGAATAA30

Reverse primer-50GGCGGTCTCCACTGAGAATA30

Osteocalcin:

Forward primer-50GAGCAGAGCTCCCTGAACTG30

Reverse primer-50GGTCGCCCTAGAGACAAGAA30

b-actin:

Lower-50CGACCAGAGGCATACAGG30

Upper-50GGTGTGATGGTGGGAATG30

Products of b-actin, PPARc and osteocalcin were

408 bp, 205 bp, and 200 bp oligonucleotides respectively.

Reverse transcription of extracted RNA was performed to

synthesize cDNA. The synthesized cDNA was subse-

quently amplified by the polymerase chain reaction (PCR)

with specific primers. PCR reaction products were obtained

by electrophoresis using 1.2% agarose gel. Semiquantita-

tive analysis of PCR products was performed using a gel

imaging scanning system. The ratios of osteocalcin or

PPARc absorbance value to b-actin absorbance value were

viewed as absolute value of osteocalcin or PPARc product

respectively.

The estimate of sample size was based on being able to

detect at Month 10 a significant increase in largest fat cell

size, number of empty osteocyte lacunae, and serum

chemistry parameters in animals treated with alcohol only

compared to mice that received both alcohol and puerarin

and to mice that received no treatments. In computing

sample size we assumed that each outcome represented a

continuous random variable, taking on a value between 0

and 100%. We assumed the outcomes of study groups were

distributed normally with means, and had a common

standard deviation (r) of 9.49. In our computations we also

assumed a Type I error rate (a) of 0.05, and power (1-b) of

0.80 to detect a 30% change in the parameters. Based on

these specifications we estimated that a total of 216 mice

were required with an estimated drop of rate of 10%, with

mice being randomly assigned in equal number to the three

study groups. Data are presented as mean ± standard

deviation (SD). Means of cholesterol, triglyceride, ALP,

largest fat cell size, and gene expression were compared

using one-way ANOVA, followed by the SNK multiple

comparison procedure. Rates of empty osteocyte lacunae

were compared using the multisample Kruskal-Wallis test.

Results

In Vitro Study

Puerarin inhibited adipogenesis while maintaining osteo-

genesis. In MSCs treated with alcohol for 2 weeks,

cytoplasmic lipid droplets were observed under the inver-

ted phase-contrast microscope. The size and number of

fatty droplets increased with longer duration of culture.

Volume 466, Number 5, May 2008 Alcohol-induced Osteonecrosis Prevention 1061

123

Few fatty drops were observed in the experimental and

control group. At Day 21, staining with Sudan III showed a

number of adipocytes in the MSCs of the model group

were filled with reddish-orange lipid droplets (Fig. 1A),

while fewer triglyceride vesicles appeared in the MSCs of

the experimental group (Fig. 1B) and the control group

(Fig. 1C). Adipocytes in the model group were 8.9-times

(p \ 0.001) and 15.6-times (p \ 0.001) of that in the

experimental group and control group respectively. The

levels of triglycerides in the experimental group were

decreased (p \ 0.001) compared to the model group. As

compared to the model group, the levels of ALP in the

experimental group and control group were increased

(p \ 0.001). The levels of osteocalcin in the experimental

group and control group were 2.2- and 5.29- times of that

in the model group respectively (p \ 0.001). No differ-

ences (p [ 0.05) were seen between the experimental and

control groups (Table 1).

In Vivo Study

Similar to the in vitro results, puerarin inhibited adipo-

genesis while maintaining a relative normal level of lipid

metabolism and osteogenesis, and thus prevented osteo-

necrosis. After 6 months of treatment, levels of total

cholesterol in serum in mice treated with alcohol was

increased (p \ 0.01) as well as the triglyceride level

(p \ 0.001) compared to the experimental and control

groups. In contrast, ALP values were decreased (p \ 0.01)

(Table 2). Fatty livers were found in animals that were

treated with alcohol but not seen in the experimental or

control group mice. Marrow and bone necrosis, diminished

hematopoiesis, increased fat, and an increased percentage

of empty osteocyte lacunae occurred in the subchondral

region of the femoral head 6 months after treatment with

alcohol (Fig. 2A–C). But no such changes were observed

in the experimental group. While the percentage of empty

Fig. 1A–C A number of red-

dish-orange triglyceride vesicles

in the bone marrow stromal cells

of (A) the model group treated

with alcohol only for 21 days,

while fewer triglyceride vesicles

appear in the MSCs of (B) the

experimental group treated with

both alcohol and puerarin and in

(C) the control group (Sudan III

stain, original magnification,

9250).

Table 1. Changes of triglyceride, ALP activity, and osteocalcin in MSCs of mice

Groups Adipocytes Triglyceride

(lg/well)

ALP activity

(U/100 mg protein)

Osteocalcin

(U/100 mg protein)

Model 319.17 ± 19.92 11.55 ± 4.42 29.02 ± 13.37 4.95 ± 2.31

Experimental 335.92 ± 23.77 4.15 ± 1.92 57.06 ± 17.73 11.11 ± 4.57

Control 20.42 ± 12.15 3.42 ± 1.60 67.08 ± 18.64 13.43 ± 5.29

MSCs = marrow mesenchymal stromal cells. Analysis of variance: p \ 0.001, model versus experimental or control; p [ 0.05, experimental

versus control. Model: cells treated with alcohol only. Experimental: cells treated with both alcohol and puerarin. Control: no treatment.


123

osteocyte lacunae increased (p \ 0.05) in animals treated

with alcohol, the percentage of empty osteocyte lacunae in

animals treated with both alcohol and puerarin did not

increase (p [ 0.05) compared to the control group

(Table 3). The average diameter of the largest fat cells in

the model group was increased (p \ 0.05) compared to the

other two groups (Table 4).

Gene Expression

The expression of PPARc mRNA in the cells or animals of

both the experimental group and control group was lower

(p \ 0.05) than that in the cells or animals of model group,

and there was no difference (p [ 0.05) between the

experimental and control groups. The expression of

osteocalcin mRNA in the cells or animals of both the

experimental group and control group was higher

(p \ 0.01) than that in the cells or animals of the model

groups, and there were no differences (p [ 0.05) between

the experimental and control groups (Figs. 3, 4, 5).

Table 2. Changes of cholesterol, triglyceride, and ALP activity

levels in serum of mice 6 months after treatment

Groups Cholesterol

(mmol/L)

Triglyceride

(mmol/L)

ALP activity

(International Units)

Model 6.39 ± 0.49c 1.01 ± 0.15c 161.6 ± 32.44b

Experimental 3.19 ± 0.11a 0.71 ± 0.13a 196.5 ± 31.52a

Control 2.83 ± 0.36 0.68 ± 0.22 203.4 ± 22.83

ALP = alkaline phosphatase. Analysis of variance = a: p [ 0.05, b:

p \ 0.05, c: p \ 0.01. Model: animals treated with alcohol only.

Experimental: animals treated with both alcohol and puerarin. Con-

trol: no treatment.

Fig. 2A–C Fat cell hypertrophy, empty osteocyte lacunae, bone and

marrow necrosis in subchondral area of the femoral head noticed in

(A) the model group treated with alcohol only, while less adipocytes

and no marrow necrosis were found in (B) the experimental group

treated with both alcohol and puerarin, compared to normal in (C) the

control group (original magnification 9100).

Table 3. Changes of empty osteocyte lacuna in the femoral heads of

mice

Time

(months)

Empty osteocyte lacuna (%)

Model group Experimental group Control group

4 11.2 ± 3.2a 10.5 ± 1.8a 10.8 ± 2.3

6 13.5 ± 1.6b 9.8 ± 2.2a 10.3 ± 2.7

8 15.8 ± 3.4c 10.7 ± 3.1a 11.1 ± 2.9

10 19.5 ± 4.1c 11.6 ± 3.1a 12.0 ± 3.1

Analysis of variance = a: p [ 0.05, b: p \ 0.05, c: p \ 0.01.

Table 4. Changes of largest fat cell diameter in the femoral heads of

mice

Time

(months)

Largest fat cell diameter (lm)

Model group Experimental group Control group

4 38.69 ± 4.14a 38.89 ± 2.25a 38.65 ± 3.26

6 40.02 ± 3.25b 39.15 ± 3.67a 38.51 ± 3.09

8 42.67 ± 2.66c 38.76 ± 3.41a 39.12 ± 2.85

10 45.38 ± 3.02c 39.61 ± 3.94a 40.13 ± 2.63

Analysis of variance = a: p [ 0.05, b: p \ 0.05, c: p \ 0.01.


123

Discussion

Although a number of studies document alcoholism in 10%

to 74% of patients with nontraumatic ON of the femoral

head, the mechanisms of alcohol-induced ON remain

unknown and presently there is no effective treatment for

the disease [1, 5, 16–19, 21, 23, 36, 45, 47]. Hypertrophy

and proliferation of fat cells, diminished hematopoiesis,

lipid deposition in osteocytes, fatty degeneration of

osteocytes, marrow necrosis, and thinner and sparse tra-

beculae are histopathologic changes occurring in the early

stages of steroid- and alcohol-induced ON of the femoral

head [9, 19, 22, 23, 36, 47, 50, 57]. Several hypotheses

have been proposed in the literature, including the

increased size and number of fatty cells, increased

intraosseous pressure, fatty degeneration of osteocytes, fat

embolism, and extraosseous arterial occlusion due to

abnormal changes in histologic features, hemodynamics,

metabolism, and biochemical features within the femoral

head [1, 10, 17, 23, 24, 35, 39, 48]. Studies on primary and

cloned MSCs have demonstrated differentiation into a

large number of adipocytes increased while levels of ALP

activity and osteocalcin decreased with longer durations of

exposure and with higher concentrations of steroid or

ethanol [8, 10, 28, 56]. These findings indicated steroids or

alcohol can directly induce adipogenesis and reduce

osteogenesis in bone marrow stroma, and produce intra-

cellular lipid deposits leading to death of osteocytes, which

may be associated with the development of ON [20, 23, 27,

44], especially in patients with long-term and excessive use

of steroids or alcohol. Puerarin, a Chinese herbal medicine,

has antioxidative and antithrombotic effects. We therefore

hypothesized puerarin inhibits alcohol-induced adipocytic

differentiation of MSCs and fatty degeneration of osteo-

cytes and may be able to prevent alcohol-induced

osteonecrosis. We further hypothesized puerarin would

reduce expression of PPARc, a transcription factor

important in adipogenesis.

A major limitation of the study is that while marrow

adipocyte proliferation and necrosis were observed, no

femoral head collapse was noted during the study. These

pathologic changes simulate early stage human form of ON

but do not reflect the late stage of ON. Therefore, even if

the treatment is effective in this animal model, it may not

be useful in humans.

At present, there are no effective treatments for early-

stage ON. To some extent, this is because the pathogenesis

of ON is unknown. However, recent advances in cell and

molecular biology have enabled researchers to identify

some of the key factors contributing to the development of

ON. It is now well known MSCs can differentiate into

osteoblasts, adipocytes, chondrocytes, and even myoblasts

[3, 40]. There is evidence for a considerable degree of

plasticity in the differentiation of these stromal cell lines

[14, 52]. Most MSCs can differentiate into osteoblasts and

osteocytes, and a few into adipocytes, under normal culture

conditions in vitro [8, 20, 56]. Alcohol can induce the

differentiation of MSCs into adipocytes and inhibit their

osteogenic differentiation, which may be a triggering step

causing the onset of ON and the pathogenesis of alcohol-

induced ON [10, 20, 28, 50]. Because the differentiation of

MSCs into adipocytes might be one of the most important

reasons leading to steroid- or alcohol-induced ON, the

proper therapy should be directed at inhibiting the differ-

entiation of MSCs into fat cells. Lovastatin prevents

steroid-induced adipogenesis and onset of ON [9, 29, 30].

However, few studies are associated with treatment of

alcohol-induced ON.

Fig. 3 Expression of PPARc mRNA in the cells of both the

experimental group and control group was lower than that in the

cells of the model group, and there was no difference between

the experimental and control group.

Fig. 4 Expression of osteocalcin mRNA in the cells of both

experimental group and control group was higher (p \ 0.01) than

of the model group, and there was no difference (p [ 0.05) between

the experimental and control group.


123

Consistent with previous observations [10, 20, 24, 28,

46, 50], our data suggest alcohol can induce adipogenesis

both in vitro and in vivo, a change found in early stage

ON. Adipogenic differentiation is a complex process

regulated by many factors. PPARc is closely involved in

the induction of fatty differention [29, 33]. It is an

adipogenic regulator and belongs to the nucleus hormone

receptor subgroup. Its activity is regulated by ligands

like most members of nucleus receptor families [33].

PPARc mRNA appears before activation of many other

adipocyte genes in adipogenic differentiation of 3T3-L1

and 3T3-F442A cells [43]. Our study suggests the high

level of expression of PPARc occurred only in model

groups treated with alcohol, indicating alcohol may be a

factor for these bone marrow cells to change from a

primarily osteogenic nature to adipogenic phenotype.

Although the regulation of adipogenesis may involve

complex mechanisms, the data suggest fat cell hyper-

trophy and hyperplasia in bone marrow may be a direct

result of treatment with alcohol. Other mechanisms may

also be involved in the development of alcohol-induced

ON. Consumption of alcohol can elevate serum lipid

peroxides and reduce superoxide dismutase activity [25,

26]. Lipid peroxidation may cause cytomembrane injury

and induce degeneration of arterioles and arterioloscle-

rosis, which eventually leads to ischemia in the target

organ, including the femoral head. Furthermore, the

direct cytotoxicity of lipid peroxidation, caused by

alcohol and its metabolites, might further insult ischemic

osteocytes, resulting in an irreversible state of injury

leading to cell death and finally ON. In addition, alcohol

consumption produces a fatty liver and alcoholic liver

injury [17, 31, 37]. Serum triglyceride and cholesterol

levels increase, fat degeneration is induced, and liver

cells are injured. These changes, as our data indicate,

may produce fatty vesicles in the circulation, leading to

embolism and ischemia in the subchondral region of the

femoral head.

Puerarin inhibited alcohol-induced osteonecrosis in our

preliminary studies. The traditional Chinese medicine

pueraria has been used to treat alcoholism for thousands of

years. Recently, many observations demonstrate puerarin

extracted from pueraria is antioxidative, can prevent inju-

ries to cells due to lipid peroxidation, and can maintain the

stability of the cell membrane structure by removing the

oxyradicals from tissues and cells [4, 6, 12, 13]. The pro-

tective effects of puerarin on cells are also related to

calcium ion rivalry and b-receptor blockage [54]. In

addition, puerarin can decompose acetaldehyde, suppress

alcohol absorption, accelerate metabolism and excretion of

alcohol in blood, decrease blood viscosity, and inhibit

blood platelet aggregation [7, 15, 34, 42]. Thus, these

effects of puerarin can prevent the development of a fatty

liver, hyperlipidemia, and capillary vessel wall injuries,

and hypercoagulation. Most importantly, the data suggest

puerarin can decrease alcohol-induced adipogenic gene

expression and thus diminish fat marrow changes, while

maintaining the cell’s osteogenic differentiation. The

inhibitive effects of puerarin on bone-marrow adipogenesis

and its concomitant enhancement of osteogenesis may

provide a novel approach to the prevention and treatment

of alcohol-induced ON.

Fig. 5 Electrophoresis of

PPARc and osteocalcin mRNA

in the femoral head of mice

shows expression of PPARcmRNA in the tissue of both

(B) the experimental group and

(C) the control group was lower

(p \ 0.05) than that in the tissue

of (A) the model group. Expres-

sion of osteocalcin mRNA in

the tissue of both the experi-

mental group and control group

was higher (p \ 0.01) than the

model group, and there was no

difference (p [ 0.05) between

the experimental and control

group.


123

References

1. Arlet J. Nontraumatic avascular necrosis of the femoral head.

Past, present, and future. Clin Orthop Relat Res. 1992;277:12–21.

2. Benlhabib E, Baker JI, Keyler DE, Singh AK. Effects of purified

puerarin on voluntary alcohol intake and alcohol withdrawal

symptoms in P rats receiving free access to water and alcohol.

J Med Food. 2004;7:180–186.

3. Bianco P, Gehron Robey P. Marrow stromal stem cells. J ClinInvest. 2000;105:1663–1668.

4. Cervellati R, Renzulli C, Guerra MC, Speroni E. Evaluation of

antioxidant activity of some natural polyphenolic compounds

using the Briggs-Rauscher reaction method. J Agric Food Chem.

2002;50:7504–7509.

5. Chakkalakal DA. Alcohol-induced bone loss and deficient bone

repair. Alcohol Clin Exp Res. 2005;29:2077–2090.

6. Cherdshewasart W, Sutjit W. Correlation of antioxidant activity

and major isoflavonoid contents of the phytoestrogen-rich Pue-

raria mirifica and Pueraria lobata tubers. Phytomedicine. 2007

Sept 21; [Epub ahead of print].

7. Choo MK, Park EK, Yoon HK, Kim DH. Antithrombotic and

antiallergic activities of daidzein, a metabolite of puerarin and

daidzin produced by human intestinal microflora. Biol PharmBull. 2002;25:1328–1332.


pluripotential cell line from bone marrow. J Bone Joint Surg Am.

1997;79:1054–1063.

9. Cui Q, Wang GJ, Su CC, Balian G. The Otto Aufranc Award.



10. Cui Q, Wang Y, Saleh KJ, Wang GJ, Balian G. Alcohol-induced

adipogenesis in a cloned bone-marrow stem cell. J Bone JointSurg Am. 2006;88 Suppl 3:148–154.

11. Fan LL, Sun LH, Li J, Yue XH, Yu HX, Wang SY. The pro-

tective effect of puerarin against myocardial reperfusion injury.

Study on cardiac function. Chin Med J (Engl). 1992;105:11–17.

12. Guerra MC, Speroni E, Broccoli M, Cangini M, Pasini P,

Minghett A, Crespi-Perellino N, Mirasoli M, Cantelli-Forti G,

Paolini M. Comparison between chinese medical herb Pueraria

lobata crude extract and its main isoflavone puerarin antioxidant

properties and effects on rat liver CYP-catalysed drug metabo-

lism. Life Sci. 2000;67:2997–3006.

13. Han RM, Tian YX, Becker EM, Andersen ML, Zhang JP,

Skibsted LH. Puerarin and conjugate bases as radical scavengers

and antioxidants: molecular mechanism and synergism with beta-

carotene. J Agric Food Chem. 2007;55:2384–2391.

14. Herzog EL, Chai L, Krause DS. Plasticity of marrow-derived

stem cells. Blood. 2003;102:3483–3493.

15. Heyman GM, Keung WM, Vallee BL. Daidzin decreases ethanol

consumption in rats. Alcohol Clin Exp Res. 1996;20:1083–1087.

16. Hirota Y, Hirohata T, Fukuda K, Mori M, Yanagawa H, Ohno Y,




17. Hungerford DS, Lennox DW. The importance of increased

intraosseous pressure in the development of osteonecrosis of the

femoral head: implications for treatment. Orthop Clin North Am.

1985;16:635–654.


necrosis of the femoral head. Early diagnosis and treatment. ClinOrthop Relat Res. 1978:144–153.

19. Jacobs B. Epidemiology of traumatic and nontraumatic osteone-


20. Jin WS, Tan YY, Chen YG, Wang Y. Determination of puerarin,

daidzin and daidzein in root of Pueraria lobata of different origin

by HPLC [in Chinese]. Zhongguo Zhong Yao Za Zhi.2003;28:49–51.

21. Jones JP Jr. Intravascular coagulation and osteonecrosis. ClinOrthop Relat Res. 1992;277:41–53.

22. Jones JP Jr. Fat embolism, intravascular coagulation, and osteo-

necrosis. Clin Orthop Relat Res. 1993;292:294–308.

23. Jones JP Jr. Alcoholism, hypercortisonism, fat embolism and

osseous avascular necrosis. 1971. Clin Orthop Relat Res.

2001;393:4–12.

24. Kawai K, Tamaki A, Hirohata K. Steroid-induced accumulation

of lipid in the osteocytes of the rabbit femoral head. A histo-

chemical and electron microscopic study. J Bone Joint Surg Am.

1985;67:755–763.

25. Keung WM. Biochemical studies of a new class of alcohol

dehydrogenase inhibitors from Radix puerariae. Alcohol Clin ExpRes. 1993;17:1254–1260.

26. Keung WM, Vallee BL. Daidzin and its antidipsotropic analogs

inhibit serotonin and dopamine metabolism in isolated mito-

chondria. Proc Natl Acad Sci U S A. 1998;95:2198–2203.

27. Leach RE, Baskies A. Alcoholism and its effect on the human

hip. Clin Orthop Relat Res. 1973;90:95–99.

28. Li J, Wang Y, Li Y, Xu J, Xiong T. Alcohol induced regulation of

adipogenic and osteogenic gene expression of marrow stromal

cells. Chin J Orthop. 2003;23:493–495.

29. Li X, Cui Q, Kao C, Wang GJ, Balian G. Lovastatin inhibits adi-

pogenic and stimulates osteogenic differentiation by suppressing

PPARgamma2 and increasing Cbfa1/Runx2 expression in bone

marrow mesenchymal cell cultures. Bone. 2003;33:652–659.

30. Li X, Jin L, Cui Q, Wang GJ, Balian G. Steroid effects on

osteogenesis through mesenchymal cell gene expression. Osteo-poros Int. 2005;16:101–108.

31. Lieber CS, Savolainen M. Ethanol and lipids. Alcohol Clin ExpRes. 1984;8:409–423.

32. Lin RC, Li TK. Effects of isoflavones on alcohol pharmacoki-

netics and alcohol-drinking behavior in rats. Am J Clin Nutr.

1998;68:1512S–1515S.

33. Lowell BB. PPARgamma: an essential regulator of adipogenesis

and modulator of fat cell function. Cell. 1999;99:239–242.

34. Luo ZR, Zheng B. Effect of Puerarin on platelet activating factors

CD63 and CD62P, plasminogen activator inhibitor and C-reac-

tive protein in patients with unstable angia pectoris [in Chinese].

Zhongguo Zhong Xi Yi Jie He Za Zhi. 2001;21:31–33.

35. Mankin HJ. Nontraumatic necrosis of bone (osteonecrosis).

N Engl J Med. 1992;326:1473–1479.

36. Mont MA, Jones LC, Hungerford DS. Nontraumatic osteone-

crosis of the femoral head: ten years later. J Bone Joint Surg Am.

2006;88:1117–1132.

37. Niemela O, Parkkila S, Pasanen M, Iimuro Y, Bradford B,

Thurman RG. Early alcoholic liver injury: formation of protein

adducts with acetaldehyde and lipid peroxidation products, and

expression of CYP2E1 and CYP3A. Alcohol Clin Exp Res.

1998;22:2118–2124.

38. Overstreet DH, Lee YW, Rezvani AH, Pei YH, Criswell HE,

Janowsky DS. Suppression of alcohol intake after administration

of the Chinese herbal medicine, NPI-028, and its derivatives.

Alcohol Clin Exp Res. 1996;20:221–227.

39. Prasain JK, Jones K, Brissie N, Moore R, Wyss JM, Barnes S.

Identification of puerarin and its metabolites in rats by liquid

chromatography-tandem mass spectrometry. J Agric Food Chem.

2004;52:3708–3712.

40. Prockop DJ. Marrow stromal cells as stem cells for nonhemato-

poietic tissues. Science. 1997;276:71–74.

41. Rezvani AH, Overstreet DH, Perfumi M, Massi M. Plant deriv-

atives in the treatment of alcohol dependency. PharmacolBiochem Behav. 2003;75:593–606.


123

42. Shi RL, Zhang JJ. Protective effect of puerarin on vascular

endothelial cell apoptosis induced by chemical hypoxia in vitro

[in Chinese]. Yao Xue Xue Bao. 2003;38:103–107.

43. Smas CM, Sul HS. Control of adipocyte differentiation. BiochemJ. 1995;309 (Pt 3):697–710.

44. Solomon L. Drug-induced arthropathy and necrosis of the fem-

oral head. J Bone Joint Surg Br. 1973;55:246–261.

45. Solomon L. Mechanisms of idiopathic osteonecrosis. Orthop ClinNorth Am. 1985;16:655–667.

46. Suh KT, Kim SW, Roh HL, Youn MS, Jung JS. Decreased

osteogenic differentiation of mesenchymal stem cells in alcohol-

induced osteonecrosis. Clin Orthop Relat Res. 2005;431:220–

225.

47. Turner RT, Evans GL, Zhang M, Sibonga JD. Effects of

parathyroid hormone on bone formation in a rat model

for chronic alcohol abuse. Alcohol Clin Exp Res. 2001;25:

667–671.

48. Wang GJ, Dughman SS, Reger SI, Stamp WG. The effect of core

decompression on femoral head blood flow in steroid-induced

avascular necrosis of the femoral head. J Bone Joint Surg Am.

1985;67:121–124.

49. Wang GJ, Sweet DE, Reger SI, Thompson RC. Fat-cell changes

as a mechanism of avascular necrosis of the femoral head in

cortisone-treated rabbits. J Bone Joint Surg Am. 1977;59:729–

735.

50. Wang Y, Mao K, Li Y, Xu Z. Alcohol induced animal model

of osteonecrosis of the femoral head. Chin Exper Surg. 1998;

15:182–183.

51. Warner JJ, Philip JH, Brodsky GL, Thornhill TS. Studies of

nontraumatic osteonecrosis. Manometric and histologic studies of

the femoral head after chronic steroid treatment: an experimental

study in rabbits. Clin Orthop Relat Res. 1987;225:128–140.

52. Wolf NS, Penn PE, Rao D, McKee MD. Intraclonal plasticity for

bone, smooth muscle, and adipocyte lineages in bone marrow

stroma fibroblastoid cells. Exp Cell Res. 2003;290:346–357.

53. Wu L, Qiao H, Li Y, Li L. Protective roles of puerarin and

Danshensu on acute ischemic myocardial injury in rats. Phyto-medicine. 2007;14:652–658.

54. Xiao L, Luo W, Su H, Cheng X, Wu Q, Ye C. The influence of

puerarin on the NO and ACE activity secreted by blood vessel

endothelial cells cultured under hyperpressure condition. New JTraditional Chin Med. 2002;42:31–33.

55. Xu X, Zhang S, Zhang L, Yan W, Zheng X. The Neuroprotection

of puerarin against cerebral ischemia is associated with the pre-

vention of apoptosis in rats. Planta Med. 2005;71:585–591.

56. Yin L, Li YB, Wang YS. Dexamethasone-induced adipogenesis

in primary marrow stromal cell cultures: mechanism of steroid-

induced osteonecrosis. Chin Med J (Engl). 2006;119:581–588.

57. Zhang W, Yu S, Zheng L. Experimental study on IL-1 regulating

differentiation of osteoblast. Chin J Stomatol. 1996;31:288–291.


123


Electromagnetic Fields

A Novel Prophylaxis for Steroid-induced Osteonecrosis

Masashi Ishida MD, Mikihiro Fujioka MD, PhD,

Kenji A. Takahashi MD, PhD, Yuji Arai MD, PhD,

Toshikazu Kubo MD, PhD



Abstract Establishing a means to prevent osteonecrosis

after corticosteroid administration is an important theme.

We asked whether pulsed electromagnetic field stimulation,

a noninvasive treatment, could prevent osteonecrosis.

Ninety rabbits were divided into four treatment groups: (1)

exposure of 10 hours per day to electromagnetic stimulation

for 1 week, followed by injection of methylprednisolone

(20 mg/kg), and exposure of 10 hours per day to electro-

magnetism for a further 4 weeks (n = 40); (2) methyl-

prednisolone injection only (n = 40); (3) no treatment

(n = 5); and (4) exposure of 10 hours per day to electro-

magnetism for 5 weeks (n = 5). After 5 weeks, we

harvested and histologically examined femurs bilaterally.

The frequency of osteonecrosis was lower in the steroid-

electromagnetism group (15/40) than in the steroid-only

group (26/40). No necrotic lesions were found in the two

control groups. We observed no clear effects of electro-

magnetism on the number, location, extent, and repair of

necrotic lesions and intramedullary fat cell size in affected

rabbits. Pulsed electromagnetic field stimulation reportedly

augments angiogenesis factors and dilates blood vessels;

these effects may lower the frequency of osteonecrosis.

Exposure to pulsed electromagnetic field stimulation before

corticosteroid administration could be an effective means to

reduce the risk of osteonecrosis.

Introduction

Osteonecrosis (ON) has been recognized as a complication

of high-dose corticosteroid administration. If the necrotic

area is large, spontaneous healing is unlikely, and surgery is

usually necessary if the necrotic area collapses. Arthroplasty

effectively improves quality of life for patients, but the costs

and risks of surgery are not insignificant; furthermore, an

acceptably durable prosthesis is not yet available for the

relatively young population in which this complication

typically occurs [4, 5, 20, 21]. Therefore, ON must be pre-

vented in patients who require high-dose corticosteroid

therapy, but there is no established prophylactic measure.

Ischemia in the bone has long been believed one of the

causes of ON after corticosteroid administration [7, 8, 28].

The pathogenesis of the ischemic necrosis remains elusive

but is thought to involve hypercoagulable conditions [8],

vasoconstriction [7], and disorders of lipid metabolism [28]

after corticosteroid administration. Therefore, prevention

of bone ischemia might also prevent steroid-induced ON.

We considered pulsed electromagnetic field stimulation

could be a preventive therapy because it promotes angio-

genesis [11, 19, 27] and dilates blood vessels [23]. We

speculated it might also influence the enlargement of

intramedullary fat cells since that is reportedly a potential

mechanism in bone necrosis [14, 15, 28].

Each author certifies that he has no commercial associations




One or more of the authors (MF, TK) received funding from the

Japanese Investigation Committee for Osteonecrosis of the Femoral

Head, under the auspices of the Ministry of Health, Labor and

Welfare of Japan; and one of the authors (MF) from the Hip Joint

Foundation of Japan, Inc.

Each author certifies that his institution has approved the animal

protocol for this investigation and that all investigations were


M. Ishida, M. Fujioka (&), K. A. Takahashi, Y. Arai, T. Kubo

Department of Orthopaedics, Graduate School of Medical

Science, Kyoto Prefectural University of Medicine,

465 Kawaramachi-Hirokoji, Kamigyo-ku, Kyoto 602-8566,

Japan


123


DOI 10.1007/s11999-008-0182-y

We first asked whether electromagnetism would reduce

the frequency of ON. We then asked whether electro-

magnetism reduces the severity (number of lesions) of ON.

Finally, we asked whether electromagnetism influenced the

enlargement of intramedullary fat cells.


We divided 90 male Japanese white rabbits (Kitayama

Labes Co, Ltd, Nagano, Japan) (body weight, 3.2–4.3 kg;

age, 28–32 weeks) into four groups: (1) a steroid-electro-

magnetism group (n = 40), which received 1 week of

exposure to pulsed electromagnetic field stimulation

(10 hours/day) over the gluteofemoral area, followed by

methylprednisolone (20 mg/kg body weight) intramuscu-

larly into the gluteus medius muscle, and 4 subsequent

weeks of exposure to electromagnetism (10 hours/day;

total exposure period, 5 weeks); (2) a steroid-only group

(n = 40), which received an injection of methylpredniso-

lone (20 mg/kg body weight) intramuscularly into the

gluteus medius muscle after 1 week; (3) an untreated group

(n = 5); and (4) an electromagnetism-only group (n = 5),

which received 5 weeks of electromagnetic exposure

(10 hours/day). Steroid-induced ON was produced by an

intramuscular injection of methylprednisolone (20 mg/kg

body weight). This experimental model induces ON in the

humeral and femoral bones of approximately 70% of

treated rabbits [13–16]. The animals were housed at the

Animal Center of Kyoto Prefectural University of Medi-

cine, fed nutritionally adequate food daily, and had free

access to clean drinking water. This study followed the

guidelines of the Kyoto Prefectural University of Medicine

Animal Care and Use Committee fully.

A study using the same rabbit model reported a reduc-

tion in the frequency of ON to 30% to 40% with an

anticoagulant drug (warfarin) or a lipid-lowering agent

(probucol) [16]. The sample size calculation was based on

an estimated effect size of 42% for electromagnetism with

steroid administration and 70% for steroid administration

alone. With an alpha level of 0.05 and a test power of 0.8,

the calculated sample size (ie, the minimum number of

rabbits required) was 39 for each group.

The protocol of pulsed electromagnetic field stimulation

in this study was chosen according to that reported effec-

tive for bone fracture healing [2]. One study reported

acceleration of angiogenesis within 1 week of commencing

electromagnetic therapy [27]. Another study reported

ischemia in the bone occurs within 5 to 6 days after cor-

ticosteroid administration [10]. Therefore, we began pulsed

electromagnetic field stimulation 1 week before the

administration of corticosteroid. The pulsed electromag-

netic fields were generated by an EBI Bone Healing

System1 (Biomet Osteobiologics, Parsippany, NJ), which

delivered uniform time-varying fields consisting of asym-

metric 4.5-ms pulses repeated at 15 Hz (Fig. 1). A coil was

installed in each cage to generate an electromagnetic field

on the gluteofemoral area of the rabbit. During the elec-

tromagnetic treatment, the rabbits had free access to water

and food.

All rabbits were euthanized after 5 weeks via intrave-

nous injection of a large dose of pentobarbital sodium. We

excised bilateral femurs of all rabbits and obtained a tissue

section at the proximal third and distal third of the femur in

the coronal plane (total four sections). The specimens were

stained with hematoxylin and eosin.

Osteonecrosis and all other histologic measures were

assessed blindly by two independent authors (MI, MF). A

positive diagnosis was based on the presence of empty

lacunae or pyknotic nuclei of osteocytes in the bone tra-

beculae, accompanied by surrounding bone marrow cell

necrosis. Only bone marrow cell necrosis showing tissue

debris consisting of both hematopoietic cell necrosis and

fat cell necrosis and included no bone trabeculae qualified

as ON. Lesions consisting of only empty lacunae in normal

bone trabeculae and/or fat cell necrosis without bone

marrow cell necrosis were excluded from the assessment of

ON in this study. If the diagnoses of the two examiners

differed, consensus was reached after discussing the his-

tologic findings without unblinding of the group. Rabbits

with at least one osteonecrotic lesion in the four areas

examined were considered to have ON [29]. The effect of

electromagnetic treatment on the prevention of steroid-

induced ON was evaluated as the difference between the

proportions of rabbits that acquired ON in the steroid-only

group and the steroid-electromagnetism group.

Fig. 1 The pulsed electromagnetic field was generated using the EBI

Bone Healing System1. It consists of a portable pulse-shaping circuit

(right) and a coil that is affixed to the cast surface (left).

Volume 466, Number 5, May 2008 Electromagnetic Fields and Osteonecrosis 1069

123

In this rabbit model, ON does not occur later than

4 weeks after the methylprednisolone injection [9], and the

repair process of necrosis is incomplete at 4 weeks [29].

Therefore, histopathologic evidence of ON is obtainable

4 weeks after the methylprednisolone injection. We histo-

logically evaluated the effects of methylprednisolone

administration and pulsed electromagnetic field stimulation

on steroid-induced ON 4 weeks after the injection. To

determine whether electromagnetism could suppress mul-

tiple occurrences of ON, the necrotic lesions in the

proximal third and distal third of the femurs of affected

rabbits were counted in each group, and the average

number was compared among the groups. The effects of

electromagnetism on the location of ON were assessed by

counting and comparing the number of lesions in the

epiphyseal area, proximal third of the femur, and distal

third of the femur. The influence of electromagnetic field

stimulation on the size of osteonecrotic lesions was

examined by measuring the affected area. The ON-affected

area was expressed as the ratio of the affected area to the

total area in the proximal third of the femur. The area was

calculated from computerized microscope images using

NIH image software (US National Institutes of Health,

Bethesda, MD). The osteonecrotic area was defined as the

area containing necrosis of osteocytes or bone marrow

cells. Areas undergoing any repair process were not

regarded as necrotic [29]. To determine the influence of

pulsed electromagnetic field stimulation on the repair

process, we examined the bone samples for the presence of

histologic features of repair, including granulation tissue,

fibrosis, and/or appositional bone formation against

necrotic tissue, and findings in the steroid-only and steroid-

electromagnetism groups were compared.

To evaluate bone marrow fat cell enlargement caused by

corticosteroid administration, the size of the fat cells was

calculated and compared between the steroid-only group

and the untreated group. The effect of pulsed electromag-

netic field stimulation on corticosteroid-induced bone

marrow fat cell enlargement was assessed by comparing fat

cell size in the steroid-electromagnetism group and the

steroid-only group. Bone marrow fat cell size was calcu-

lated as the average of the largest diameters of 25 fat cells

in each of four randomly selected fields (one field = 25 9

10-8 m2) in nonnecrotic regions in the proximal third of

the right femur using NIH imaging software [22, 28].

All values were expressed as the mean ± standard

deviation. Each variable was compared using parametric or

nonparametric methods with or without the normality of

distribution of data. The proportions of rabbits in the

steroid-only and steroid-electromagnetism groups that

acquired ON were compared nonparametrically using

the chi-square test. The number of necrotic lesions per

rabbit that acquired lesions was compared between the

steroid-only and steroid-electromagnetism groups. The

difference between groups was evaluated with the Mann-

Whitney U test. The unpaired t test was used to test for a

difference between the mean area of lesions in the proximal

femur in the steroid-only group and the steroid-electro-

magnetism group. The mean diameter of 100 fat cells from

each of five rabbits from each group was compared among

the four groups. One-way analysis of variance was used to

determine the overall difference among the groups. If the

difference was significant at p \ 0.05, Scheffe’s post hoc

tests were performed to test the significance of individual

comparisons. Values with p \ 0.05 were considered

significant.

Results

Electromagnetism reduced (p = 0.01) the frequency of ON

in the steroid-electromagnetism rabbits compared to the

steroid-only rabbits (15 of 40, or 37.5% versus 26 of 40, or

65%, respectively) (Figs. 2A–C, 3A–B). None of the rab-

bits in the untreated group and the electromagnetism-only

group had features of ON.

Rabbits treated without and with electromagnetism had

similar severities of steroid-induced ON (Table 1). The

number of osteonecrotic lesions per affected rabbit was

1.1 ± 0.3 and 1.2 ± 0.4, respectively. Lesions in the

proximal third of the femur occurred in 15 of 26 and 10 of

15 affected rabbits in the steroid-only and steroid-electro-

magnetism groups, respectively; lesions occurred in the

distal third of the femur in 14 of 26 and eight of 15 affected

rabbits in each group, respectively. The epiphysis did not

display bone necrosis. The extent of ON was similar in the

two groups (2.8 ± 1.9% in the treated and 2.7 ± 1.8% in

the untreated). In the steroid-only group and the steroid-

electromagnetism group, we observed similar amounts of

fibrous and cellular-rich granulation tissue (reparative tis-

sues) and they were found on the margins of osteonecrotic

lesions. There was no appositional bone formation.

Mean bone marrow fat cell size in the steroid-only group

was larger (p \ 0.01) than that in the untreated group. We

observed no difference in fat cell size after corticosteroid

administration with or without electromagnetism (p =

0.43), ie, 61 ± 4.5 lm in the steroid-only group,

56.9 ± 5.4 lm in the steroid-electromagnetism group,

47.6 ± 3 lm in the untreated group, and 46.1 ± 3.4 lm in

the electromagnetism-only group.

Discussion

Pulsed electromagnetic field stimulation induces angio-

genesis [11, 19, 27] and vasodilatation [23], but its clinical

1070 Ishida et al. Clinical Orthopaedics and Related Research

123

Fig. 2A–C (A) The osteonecrotic

lesions (arrows) in this rabbit from

the steroid-only group showed

pyknosis (stain, hematoxylin and

eosin; original magnification,

9100). (B) Bone marrow cells

had necrosis and stained acido-

philic (arrowheads). The nuclei of

bone marrow cells display pykno-

sis and karyorrhexis. Some cells

went through karyolysis and

uniformly stained acidophilic

(arrows). The cellular structure of

fat cells also collapsed (stain,

hematoxylin and eosin; original

magnification, 9200). (C) Bone

cells in the bone trabeculae

showed pyknosis and empty lacu-

nae (arrows) that were associated

with necrotic changes of the sur-

rounding bone marrow cells (stain,

hematoxylin and eosin; original

magnification, 9200).

Fig. 3A–B (A) The osteonecrotic lesions (arrows) in this rabbit from

the steroid-electromagnetism group stained less intensively (stain,

hematoxylin and eosin; original magnification, 9100). (B) Bone

marrow cells showed cytolysis and pyknosis, and there was bone

marrow cell necrosis (stain, hematoxylin and eosin; original magnifi-

cation, 9200). Nec = necrotic zone; Liv = living bone marrow tissue.

Table 1. Number, location, and extent of osteonecrosis in affected rabbits of the steroid only and steroid-electromagnetism groups

Group Number with

osteonecrosis*

Proximal third

of femur

Distal third

of femur

Ratio of osteonecrosis

area (%)*

Steroid only (n = 26) 1.1 ± 0.3 15 (58%) 14 (54%) 2.8 ± 1.9

Steroid-electromagnetism (n = 15) 1.2 ± 0.4 10 (67%) 8 (53%) 2.7 ± 1.8

* Values are expressed as mean ± standard deviation.


123

effects on ON have not been clarified [3, 12, 24–26]. We

therefore asked whether electromagnetism would influence

the risk and severity of ON and if so whether it would

influence the size of fat cells since enlargement has been

proposed as a mechanism to induce ischemia.

The major limitation of the current study is that osteo-

necrosis in the rabbit model is different from steroid-

induced bone necrosis in humans [29]. The rabbit model is

different from human ON in that (1) bone necrosis in

rabbits frequently occurs in the metaphysis, not in the

epiphysis, and (2) the model does not lead to collapse and

the lesions resolve spontaneously. However, the patho-

physiology of ON in the rabbit model is characterized by

empty lacunae accompanied by surrounding bone marrow

cell necrosis, and that of reparative changes as granulation

tissue and appositional bone formation are thought to be

closer to steroid-induced ON in humans [29]. Therefore,

the rabbit model has been widely used in various studies [9,

10, 13–16].

Histopathologic evidence of ON is obtainable 4 weeks

after the steroid injection as described in Materials and

Methods. We examined bone necrosis at one time point,

and did not evaluate chronological effects of electromag-

netism on steroid-induced ON, therefore bone necrosis

should be examined in earlier and later stages of the

experiment in another study. We used a protocol (dosage

and frequency) for electromagnetic field stimulation used

to treat adult bone nonunion (ie, exposure to 15-Hz elec-

tromagnetic stimuli for 10 hours/day) [2], but the optimal

electrical stimulation for the augmentation of growth fac-

tors varies according to cell type [11]. Thus, the optimal

protocol of pulsed electromagnetic stimulation for the

prevention of ON should be investigated in another study.

Our data suggest the number of rabbits with ON

4 weeks after steroid administration was lower in the group

that received pulsed electromagnetic field stimulation than

the group that did not. We did not determine the mecha-

nism of the pulsed electromagnetic field benefit, but we

speculate acceleration of angiogenesis and vasodilatation

caused by the electromagnetic waves could suppress

ischemia in the bone after corticosteroid administration.

Fat cells were not affected by electromagnetism, so we

presume that is not the mechanism.

We found no influence of electromagnetism on histo-

logic factors relating to the severity of necrosis (ie, number

of osteonecrotic lesions per rabbit), size, location, and

repair level of bone necrosis. This suggests this treatment

can help prevent ON, but if it occurs, the treatment does not

reduce its severity. This same conclusion has been reached

for the prevention of steroid-induced ON with chemicals

[16].

Several researchers have shown steroid-induced ON can

be prevented by medications [6, 17, 18], and a study that

used the same rabbit model as ours reported a reduction in

ON frequency to 30% to 40% [16]. Our study showed

similar suppressive effects, and no rabbits developed tissue

damage due to electromagnetism. This point also indicates

electromagnetism could be a useful prophylactic therapy

for steroid-induced ON.

Miyanishi et al. [15] reported a larger bone marrow fat

cell size in rabbits that developed ON than in those without

ON after corticosteroid administration. They hypothesized

corticosteroids become a cause of ON through enlargement

of bone marrow fat cells and an increase in intraosseous

pressure, resulting in a disturbance of intraosseous circu-

lation. Another study proposed prevention of fat cell

enlargement could also prevent steroid-induced ON [16].

We found bone marrow fat cell size was larger in rabbits

that received corticosteroids than in those that did not, but

electromagnetism did not affect bone marrow fat cell size.

Therefore, we assumed its preventative effect on steroid-

induced ON occurs via a mechanism independent of lipid

metabolism.

Our preliminary data suggest electromagnetic fields

could be a preventative method, particularly since it is

noninvasive [1, 2]. Further studies are necessary to clarify

the optimal protocol of pulsed electromagnetic fields for

the prevention of ON and to apply this treatment in clinical

trials.

Acknowledgments We thank Drs. Takuaki Yamamoto and Kenjiro

Nishida for their valuable advice and kind help on the evaluation of

histologic features.

References

1. Akai M, Hayashi K. Effect of electrical stimulation on muscu-

loskeletal systems: a meta-analysis of controlled clinical trials.

Bioelectromagnetics. 2002;23:132–143.

2. Bassett CA. Fundamental and practical aspects of therapeutic

uses of pulsed electromagnetic fields (PEMFs). Crit Rev BiomedEng. 1989;17:451–529.

3. Bassett CA, Schink-Ascani M, Lewis SM. Effects of pulsed

electromagnetic fields on Steinberg ratings of femoral head

osteonecrosis. Clin Orthop Relat Res. 1989;246:172–185.

4. Brinker MR, Rosenberg AG, Kull L, Galante JO. Primary total

hip arthroplasty using noncemented porous-coated femoral

components in patients with osteonecrosis of the femoral head.

J Arthroplasty. 1994;9:457–468.

5. Chiu KH, Shen WY, Ko CK, Chan KM. Osteonecrosis of

the femoral head treated with cementless total hip arthroplasty:

a comparison with other diagnoses. J Arthroplasty. 1997;12:

683–688.

6. Cui Q, Wang GJ, Su CC, Balian G. The Otto Aufranc Award:



7. Drescher W, Bunger MH, Weigert K, Bunger C, Hansen ES.

Methylprednisolone enhances contraction of porcine femoral

head epiphyseal arteries. Clin Orthop Relat Res. 2004;423:112–

117.

1072 Ishida et al. Clinical Orthopaedics and Related Research

123

8. Drescher W, Weigert KP, Bunger MH, Ingerslev J, Bunger C,

Hansen ES. Femoral head blood flow reduction and hypercoag-

ulability under 24 h megadose steroid treatment in pigs. J OrthopRes. 2004;22:501–508.

9. Kabata T, Kubo T, Matsumoto T, Hirata T, Fujioka M, Takahashi

KA, Yagishita S, Kobayashi M, Tomita K. Onset of steroid-

induced osteonecrosis in rabbits and its relationship to hyperli-

paemia and increased free fatty acids. Rheumatology (Oxford).2005;44:1233–1237.

10. Kabata T, Kubo T, Matsumoto T, Nishino M, Tomita K, Katsuda

S, Horii T, Uto N, Kitajima I. Apoptotic cell death in ste-

roid induced osteonecrosis: an experimental study in rabbits.

J Rheumatol. 2000;27:2166–2171.

11. Kanno S, Oda N, Abe M, Saito S, Hori K, Handa Y, Tabayashi K,

Sato Y. Establishment of a simple and practical procedure applicable

to therapeutic angiogenesis. Circulation. 1999;99:2682–2687.

12. Massari L, Fini M, Cadossi R, Setti S, Traina GC. Biophysical

stimulation with pulsed electromagnetic fields in osteonecrosis of


13. Miyanishi K, Yamamoto T, Irisa T, Motomura G, Jingushi S,

Sueishi K, Iwamoto Y. Effects of different corticosteroids on the

development of osteonecrosis in rabbits. Rheumatology (Oxford).2005;44:332–336.


Noguchi Y, Iwamoto Y. A high low-density lipoprotein choles-

terol to high-density lipoprotein cholesterol ratio as a potential

risk factor for corticosteroid-induced osteonecrosis in rabbits.

Rheumatology (Oxford). 2001;40:196–201.


Noguchi Y, Iwamoto Y. Bone marrow fat cell enlargement and a

rise in intraosseous pressure in steroid-treated rabbits with oste-

onecrosis. Bone. 2002;30:185–190.

16. Motomura G, Yamamoto T, Miyanishi K, Jingushi S, Iwamoto Y.

Combined effects of an anticoagulant and a lipid-lowering agent

on the prevention of steroid-induced osteonecrosis in rabbits.

Arthritis Rheum. 2004;50:3387–3391.

17. Nagasawa K, Tada Y, Koarada S, Tsukamoto H, Horiuchi T,

Yoshizawa S, Murai K, Ueda A, Haruta Y, Ohta A. Prevention of

steroid-induced osteonecrosis of femoral head in systemic lupus

erythematosus by anti-coagulant. Lupus. 2006;15:354–357.


patients receiving steroids. Clin Orthop Relat Res. 2001;386:173–178.

19. Roland D, Ferder M, Kothuru R, Faierman T, Strauch B. Effects

of pulsed magnetic energy on a microsurgically transferred ves-

sel. Plast Reconstr Surg. 2000;105:1371–1374.

20. Saito S, Saito M, Nishina T, Ohzono K, Ono K. Long-term results

of total hip arthroplasty for osteonecrosis of the femoral head: a

comparison with osteoarthritis. Clin Orthop Relat Res. 1989;244:

198–207.

21. Sarmiento A, Ebramzadeh E, Gogan WJ, McKellop HA. Total

hip arthroplasty with cement: a long-term radiographic analysis

in patients who are older than fifty and younger than fifty years.


22. Shaw SL, Salmon ED, Quatrano RS. Digital photography for the

light microscope: results with a gated, video-rate CCD camera

and NIH-image software. Biotechniques. 1995;19:946–955.

23. Smith TL, Wong-Gibbons D, Maultsby J. Microcirculatory

effects of pulsed electromagnetic fields. J Orthop Res. 2004;22:

80–84.

24. Steinberg ME, Brighton CT, Bands RE, Hartman KM. Capacitive

coupling as an adjunctive treatment for avascular necrosis. ClinOrthop Relat Res. 1990;261:11–18.

25. Steinberg ME, Brighton CT, Corces A, Hayken GD, Steinberg

DR, Strafford B, Tooze SE, Fallon M. Osteonecrosis of the

femoral head: results of core decompression and grafting with

and without electrical stimulation. Clin Orthop Relat Res.

1989;249:199–208.

26. Steinberg ME, Brighton CT, Steinberg DR, Tooze SE, Hayken

GD. Treatment of avascular necrosis of the femoral head by a

combination of bone grafting, decompression, and electrical

stimulation. Clin Orthop Relat Res. 1984;186:137–153.

27. Tepper OM, Callaghan MJ, Chang EI, Galiano RD, Bhatt KA,

Baharestani S, Gan J, Simon B, Hopper RA, Levine JP,

Gurtner GC. Electromagnetic fields increase in vitro and in vivo

angiogenesis through endothelial release of FGF-2. FASEB J.

2004;18:1231–1233.28. Wang GJ, Sweet DE, Reger SI, Thompson RC. Fat-cell

changes as a mechanism of avascular necrosis of the femoral

head in cortisone-treated rabbits. J Bone Joint Surg Am. 1977;

59:729–735.

29. Yamamoto T, Irisa T, Sugioka Y, Sueishi K. Effects of pulse

methylprednisolone on bone and marrow tissues: corticosteroid-

induced osteonecrosis in rabbits. Arthritis Rheum. 1997;40:

2055–2064.


123


Extent of Osteonecrosis on MRI Predicts Humeral Head Collapse

Takashi Sakai MD, PhD, Nobuhiko Sugano MD, PhD,

Takashi Nishii MD, PhD, Takehito Hananouchi MD,

Hideki Yoshikawa MD, PhD



Abstract Although MRI is useful for predicting pro-

gression of osteonecrosis (ON) of the femoral head or

femoral condyle, predicting outcome of atraumatic osteo-

necrosis of the humeral head using MRI has not been

previously examined. We asked whether the prognosis was

related to the extent and location of necrotic lesions on

MRI. We investigated 46 radiographically noncollapsed

humeral heads in 27 patients, 24 steroid-related and three

alcohol-related, using MRI and serial radiographs. The

minimum followup was 24 months (mean, 84.9 months;

range, 24–166 months). The necrotic lesion was typically

located at the medial and superior aspect of the humeral

head. The necrotic angle, which expressed the extent of the

necrotic lesion, was measured on midoblique-coronal plane

(range; 0�–134.7�) and on midoblique-sagittal plane

(range; 0�–150.6�). Of the 46 lesions, 34 were less than 90�and did not collapse, whereas 11 of the other 12 lesions of

more than 90� (92%) collapsed within 4 years. Of these 11

collapsed lesions, four of less than 100� did not progress,

followed by reparative reaction on plain radiographs,

whereas the other seven of more than 100� progressed to

osteoarthritis. The extent of a necrotic lesion on MRI is

useful to predict collapse of the humeral head.



of evidence.

Introduction

Atraumatic osteonecrosis of the humeral head (ONHH)

generally develops in the subchondral region [1, 2, 4–7, 12,

13, 15–17]. In some patients, osteonecrosis (ON) can lead

to collapse of the necrotic subchondral bone, development

of an irregular joint surface, and subsequent joint degen-

eration requiring nonoperative [1, 2] or operative treatment

[1–7, 12, 13, 15–17]. The rate of patients with ONHH

undergoing surgery varies from 22% to 78% [1, 15, 17] in

part because the natural history of corticosteroid- or alco-

hol-related ONHH is still not well understood. Although

one study [5] suggests replacement surgery is related to the

radiographic stage of humeral head involvement we did not

know which cases would collapse and which would not.

Several studies suggest the extent of a necrotic lesion on

radiographs correlates with the prognosis and to the results

of surgical treatment in patients with corticosteroid-related

ONHH or traumatic ONHH [5, 15]. These two studies

reported large lesions in ONHH and patients with collapse

on plain radiographs tend to have poor prognoses. How-

ever, accurate evaluation of a lesion on radiographs is

difficult at best, and impossible in Stage 1 disease, which

is not visualized by plain radiograph or CT scan [24]. MRI

is superior to radiographs in the early detection of necrotic

lesions as well as in evaluating the extent and location of

lesions in hip and knee ON [22, 25]. Early diagnosis and

understanding of the natural history are important for

treatment planning including core decompression [12],

statin therapy [20], and alendronate therapy [18].

The institution of one of the authors (NS) has received funding from a

grant from the Japanese Investigation Committee under the auspices

of the Ministry of Health and Welfare.


human protocol for this investigation and that all investigations were


T. Sakai (&), N. Sugano, T. Nishii, T. Hananouchi,

H. Yoshikawa

Department of Orthopedic Surgery, Osaka University Medical

School, 2-2, Yamadaoka, 565-0871 Suita, Osaka, Japan


123


DOI 10.1007/s11999-008-0179-6

Given MRI is a more sensitive tool, we asked whether

the likelihood of collapse of corticosteroid-related or

alcohol-related ONHH is related to the extent and location

of necrotic lesions on MRI. We also asked whether pro-

gression or cessation of collapse in ONHH depends on the

extent of necrotic lesion visible on MRI.


Between April 1993 and May 2004, we diagnosed 220

patients with osteonecrosis of the femoral head by MRI. In

these patients, we performed MRI screening of both

shoulders, knees, and ankles to identify multiple regions of

ON. Atraumatic ONHH was diagnosed by MRI in 29 of

220 patients (13.2%). We reviewed the MRIs of 50

shoulders of these 29 patients with atraumatic ONHH. We

included symptomatic and asymptomatic patients. We

diagnosed ON as an area of normal fat intensity surrounded

by a low-intensity band, band pattern, on spoiled gradient-

recalled echo pulse sequence (SPGR) [21, 25]. We used

MRI as the gold standard since we could not obtain a

histologic diagnosis in asymptomatic patients or those for

whom surgery was not indicated. We excluded two patients

(four shoulders) because both humeral heads of one patient

had already collapsed and the other patient was lost to

followup prior to 2 years. Therefore, we included 46

shoulders of 27 patients with noncollapsed, atraumatic

ONHH in this study. Thirty four of the 46 shoulders were

initially asymptomatic and 12 were symptomatic. Nineteen

of the 27 (70%) patients also had knee ON in addition to

that of the hip. There were nine men and 18 women. The

mean age at diagnosis was 39 years (range, 17–64 years).

The minimum followup was 24 months (mean,

84.9 months; range, 24–166 months). The followup period

was defined as the period from the day of initial exami-

nation to the day of the latest examination or to the day of

surgical treatment. Of the 27 patients, 24 had a history of

corticosteroid therapy and the remaining three patients had

a history of alcohol abuse without any history of trauma

around the shoulder. The history of alcohol abuse was

defined as more than 400 mL ethanol intake per week [8].

Of the 24 corticosteroid-related patients, 15 also had a

history of pulse corticosteroid administration. The under-

lying diseases in the corticosteroid-related patients were

systemic lupus erythematosus in 12 patients and nephritic

syndrome in two patients. Four patients underwent bone

marrow transplantation with subsequent graft versus host

disease. The reasons for corticosteroid administration in the

other six patients were Cushing syndrome, pure red cell

aplasia, sudden deafness, sarcoidosis, pemphoid, and idi-

opathic sclerotic pruritis. The mean total dose of

prednisolone before the diagnosis of ON was 15.6 g (range,

1.4–35 g). The mean maximum daily dose of prednisolone

was 51.4 mg (range, 20–100 mg). Nineteen patients had

affected bilateral shoulders.

We (TS and NS) evaluated clinical status at diagnosis

and at the latest followup using the UCLA shoulder rating

system [9]. Patients were followed every six months.

We examined all shoulders by anteroposterior radio-

graphs at each visit with the arm in external rotation and

internal rotation. We (TS and NS) radiographically staged

the disease using the Association Research Circulation

Osseous international classification staging system [24].

This staging system has been used for the femoral head

ON, and we applied it to ONHH. Stage 1 is not apparent on

plain radiographs or CT, but is detectable on MRI, bone

scintigraphy, and biopsy. Stage 2 disease is apparent on

radiographs but without collapse; typically radiographs

reveal cysts or areas of increased density in the humeral

head. Stage 3 exhibits collapse. Stage 4 has flattening of the

humeral head with joint space narrowing (osteoarthritis). In

order to investigate the intraobserver reproducibility and

the interobserver reliability, we staged the disease based on

plain radiographs of the initial examination and the latest

followup, and then reviewed them again at 6-month

intervals. The kappa intraobserver reproducibility coeffi-

cient was 0.90 (TS) and 0.90 (NS), whereas the

interobserver reliability coefficient was 0.90 for the initial

examination and 0.89 for the latest followup [23].

We performed imaging on patients within 4 months of

the diagnosis of femoral head ON using a 1.0-Tesla

superconducting magnet (Magnetom Impact; Siemens,

Erlangen, Germany, or Signa; General Electric, Milwau-

kee, WI). To eliminate misdiagnosis, we performed not

only SPGR images, but also T2-weighted or fat-saturation

SPGR images. T2-weighted spin-echo images (TR/TE =

3600/105 msec), SPGR (TR/TE = 14/2.3 msec), and fat-

suppression SPGR were obtained with 1.5-mm slice

thickness. The image matrix was 256 9 256. The SPGR

and fat-suppression SPGR image data were reconstructed

using the Virtual Place-M software (Medical Imaging

Laboratory, Tokyo, Japan). We resliced the humeral head

on the axial view that included the humeral head center,

parallel to the scapula body, and produced a midoblique-

coronal image (Fig. 1) because an oblique-coronal image is

common for shoulder disease [14]. Then, we also sliced the

humeral head on the axial view that included the humeral

head center, perpendicular to the scapular body, and pro-

duced a midoblique-sagittal image (Fig. 1). MRI images

were reviewed for diagnosis by one of the authors (TN)

without benefit of clinical or radiographic data.

We (TS, TH) independently estimated the extent of

ONHH lesions on midoblique-coronal and on midoblique-

sagittal images of the humeral head on SPGR by the

necrotic angle (\ AOB) of the lesion using modified

Volume 466, Number 5, May 2008 Humeral Head Osteonecrosis on MRI 1075

123

Kerboul’s estimation [10] (Fig. 1). In order to estimate the

extent of ONHH lesions in two cross-sectional directions,

the necrotic angle was not a sum of angles measured on

the midoblique-coronal plane and midoblique-sagittal

plane as in Kerboul’s original definition. These two angles

were recorded independently. The center of the humeral

head was defined as point O, and two end points of the

necrotic lesion on the joint surface were defined as points

A and B. Even if ONHH was present in the humeral head,

we estimated the necrotic angle as 0� when a necrotic

lesion was not detected on the midoblique-coronal image

or on the midoblique-sagittal image. The location of

ONHH lesions on midoblique-coronal and on midoblique-

sagittal SPGR images was expressed by the median point

of each necrotic lesion using the median angle (\ COD)

(Fig. 1), because the range of angle of the necrotic lesion

was so complicated as the location analysis. One medial

basal point on a midoblique-coronal image or one anterior

basal point on a midoblique-sagittal image was defined as

Point C. The median point of the necrotic lesion was

defined as Point D. The necrotic angle and the median

angle were calculated on a computer using the Virtual

Place-M software. The intraobserver error (r = 0.97) and

the interobserver error (r = 0.80) were calculated using

Spearman’s rank test.

We compared the necrotic angle and the median angle

among the four latest radiographic stages (stage 1, 2, 3, and

4 disease) using the Kruskal-Wallis test. We used SPSS for

Windows 13.0 (SPSS Incorporated, Chicago, IL).

Results

The lesions with initial necrotic angles of more than 90� on

midoblique-coronal SPGR images and on midoblique-

sagittal SPGR images more often (p \ 0.0001) progressed

to collapsed radiographic stages than those with smaller

angles (Table 1). Higher latest stages had greater necrotic

angles (Fig. 2). Analysis of the necrotic angle on mid-

oblique-coronal SPGR images revealed 11 of 12 lesions

(92%) with more than 90� collapsed within 4 years

(Fig. 3A-G), whereas 34 of 34 (100%) lesions of less than

90� did not collapse. In other words, of 46 shoulders with

ONHH lesions, including 31 shoulders in Stage 1 and 15 in

Stage 2 at the initial examination, 11 humeral heads col-

lapsed (24%) within 4 years (Table 2). The range of the

necrotic angle was 0� to 134.7� on the midoblique-coronal

plane, and 0�–150.6� on the midoblique-sagittal plane.

The median angle did not predict progression of ONHH

since there were no differences in the median angle among

the latest radiographic stages (Table 1). The mean median

angle was 51.5� (range, 13.2�–110�) on the midoblique-

coronal plane and 100.7� (range, 69.1�–131.9�) on the

midoblique-sagittal plane. The necrotic lesion was typically

Fig. 1A–D (A, B) The necrotic angle (\ AOB) and the median angle (\COD) on midoblique-coronal spoiled gradient-recalled echo (SPGR)

images and (C, D) on midoblique-sagittal SPGR images of the humeral head were evaluated as the extent and location of the necrotic lesion.

1076 Sakai et al. Clinical Orthopaedics and Related Research

123

located at the medial and superior aspect of the humeral

head. In all cases, the necrotic lesion was located within the

proximal half of the humeral head on both the midoblique-

coronal and midoblique-sagittal SPGR images.

All seven shoulders with a necrotic angle of more than

100� progressed to osteoarthritis. The four shoulders with

initially collapsed lesions of less than 100� did not pro-

gress, but rather developed a reparative reaction reflected

by increased density at the demarcation area on plain

radiographs (Fig. 4A-B). Two Stage 4 shoulders underwent

hemiarthroplasty at 38 months and at 65 months,

respectively.

We treated all 12 initially symptomatic shoulders with

nonsteroidal antiinflammatory drugs and the avoidance of

overhead shoulder motions. Twenty nine shoulders were

asymptomatic at the latest followup (Table 3). Four

shoulders of the three patients with alcohol-related ONHH

remained in Stage 1.

Discussion

Several studies suggest the extent of a necrotic lesion on

radiographs correlates with the prognosis and to the results

of surgical treatment in patients with corticosteroid-related

ONHH or traumatic ONHH [5, 15] but these studies were

based on plain radiographs. Given MRI is a more sensitive

tool, we asked whether the likelihood of collapse of corti-

costeroid-related or alcohol-related ONHH is related to the

extent and location of necrotic lesions on MRI. We also

asked whether progression or cessation of collapse in ONHH

depends on the extent of necrotic lesion visible on MRI.

Our study has several limitations. First, the number of

patients was small. To estimate the extent and location of

necrotic lesions accurately, we excluded patients with

ONHH who were not examined by SPGR MRI and patients

whose humeral head had already collapsed because we

could not estimate the lesion size and location on MRI

exactly as in the noncollapsed humeral heads. Although the

sample size was small, this limitation is compensated for

by including only one diagnosis and by ensuring accurate

digital measurements of the necrotic lesion. Second, this

was not a prospective study. The shoulder SPGR MRI was

not always examined at initial examination because we

performed shoulder MRI as screening for multiple ON after

femoral head ON was diagnosed. However, the present

results were not likely influenced by the timing of MRI

because all patients were examined on SPGR MRI before

the necrotic lesion had collapsed.

The likelihood of collapse of corticosteroid-related

ONHH was related to the extent of necrotic lesion on MRI.

The lesion with a necrotic angle of more than 90� on

midoblique-coronal SPGR images and on midoblique-

sagittal SPGR images more often progressed to the

Table 1. Relationship between the MRI angles at initial examination and latest radiographic stage

Angles at initial examination Stage 1* (22 shoulders) Stage 2*(13 shoulders) Stage 3*(4 shoulders) Stage 4* (7 shoulders) p Value

Necrotic angle (degrees)

On midoblique-coronal plane 25.3 (0–94.7) 54.4 (13.6–85.4) 94.7 (90.8–99.2) 113.9 (96.6–134.7) \ 0.0001�

On midoblique-sagittal plane 12.3 (0–102.1) 35.8 (0–72.3) 85.4 (64.5–98.2) 121.8 (100–150.6) \ 0.0001�

Median angle (degrees)

On midoblique-coronal plane 54.7 (13.2–110) 49.4 (32.6–77.7) 50.8 (39.2–57) 50.1 (22.3–61.8) NS�

On midoblique-sagittal plane 95.5 (86.3–105.1) 106.4 (69.1–131.9) 103.6 (92.8–113.3) 95.6 (76.2–113.7) NS�

*Association Research Circulation Osseous (ARCO) international classification staging system; Stage 1 = not apparent on plain radiographs or

CT but are detectable on MRI, bone scintigraphy, and biopsy; Stage 2 = abnormal radiograph with cystic or sclerotic changes in the humeral

head without joint collapse; Stage 3 = collapsed stage; Stage 4 = flattening of the humeral head with joint space narrowing; �Kruskal-Wallis

test; NS = not significant.

Fig. 2 Scattergram of the necrotic angle on spoiled gradient-recalled

echo (SPGR) image showed 11 of 12 necrotic lesions (92%) with

more than 90� on the midoblique-coronal plane collapsed. Higher

latest stages had greater necrotic angles.


123

collapsed stage. Collapsed lesions of less than 100� did not

progress to osteoarthritis, followed by reparative reaction

on plain radiographs. The median angle, which expressed

location of the lesion, was not useful to prognosticate

ONHH.

Large lesions in ONHH and collapsed-stage cases on

plain radiographs tend to have poor prognoses [5, 15].

However, predicting outcome of atraumatic ONHH using

MRI has not been previously reported, and we did not

know which cases would collapse. We found a necrotic

angle of more than 90� on midoblique-coronal SPGR

images and on midoblique-sagittal SPGR images, whereas

the location of ONHH on MRI was not related to the

radiographic stage progression.

Fig. 3A–G (A, B) A midoblique-coronal spoiled gradient-recalled

echo (SPGR) image of a 33-year-old woman with steroid-related ON

of the left humeral head showed the necrotic angle was 107.3� and the

median angle was 51.5�. (C, D) A midoblique-sagittal SPGR image

showed the necrotic angle was 103.6� and the median angle was

82.4�. (E) An initial anteroposterior radiograph showed no demarca-

tion (Stage 1), (F) Stage 3 at 27 months, and (G) Stage 4 at

42 months after the initial examination.

Table 2. Radiographic stage change (shoulders)

Initial examination Latest followup

Stage 1* 31 Stage 1* 22

Stage 2* 2

Stage 3* 1

Stage 4* 6

Stage 2* 15 Stage 2* 11

Stage 3* 3

Stage 4* 1

*Association Research Circulation Osseous (ARCO) international

classification staging system; Stage 1 = not apparent on plain

radiographs or CT but are detectable on MRI, bone scintigraphy, and

biopsy; Stage 2 = abnormal radiograph with cystic or sclerotic

changes in the humeral head without joint collapse; Stage 3 = col-

lapsed stage; Stage 4 = flattening of the humeral head with joint

space narrowing.

Fig. 4A–B (A) An anteroposterior radiograph of a 17-year-old

woman with corticosteroid-related ON of the left humeral head

showed Stage 3 at 6 months after the initial examination, and (B)

extensive reparative reaction at 1 year.


123

The necrotic lesion was typically located at the medial

and superior aspect of the humeral head, namely the site of

glenohumeral contact in approximately 90� of shoulder

abduction, like in previous reports [1, 13, 15]. With respect

to the anteroposterior location on MRI, the necrotic lesion

affected the middle posterior portion to a greater extent

than the anterior portion. These findings may be related to

the distribution of vessels supplying nutrition. In the

humeral head, the blood supply is derived from the anterior

and posterior circumflex arteries [3, 11]. The anterolateral

ascending branch of the anterior circumflex artery supplies

almost all of the area of the humeral head, whereas the

posterior circumflex artery vascularizes only the posterior

portion of the greater tuberosity and a small posteroinferior

part of the head [3].

The goal of treatment for ONHH should be to prevent

both collapse of the humeral head and osteoarthritic

change. Although most patients were using steroids, the

incidence of collapse was relatively low (24%) compared

with an incidence of ON of the femoral head of 77% in

one study [25]. The lower collapse rate may be related to

the locations of the lesions or distribution of stresses in the

humeral head. Thus, the course of most patients with

corticosteroid-related or alcohol-related ONHH may be

better than ON of the femoral head [25]. Nonoperative

treatment may be sufficient for small necrotic lesions of

less than 90� on the midoblique-coronal images because

they will not collapse. Necrotic lesions of more than 90�and less than 100� showed cessation of collapse and

extensive reparative reaction. In femoral head ON, even if

a necrotic lesion begins to collapse, some cases stabilize

without further collapse [19]. In these patients, aggressive

surgery may not be necessary. On the other hand, surgery

may be inevitable for large necrotic lesions of more than

100� on the midoblique-coronal images. Because patients

with atraumatic ONHH are relatively young [1, 17], total

shoulder arthroplasty [1, 2, 6] should be avoided if pos-

sible. For young patients, arthroscopic debridement [4, 7]

or core decompression [12, 16, 17] may be indicated. The

efficacy of these treatment modalities should be assessed

after evaluating the extent of necrotic lesions on MRI in

the future.

Acknowledgments We thank Kazuomi Sugamoto, MD, PhD, Akira

Goto, MD, PhD, and Masaki Takao, MD,PhD, for technical support.

References

1. Cruess RL. Steroid-induced avascular necrosis of the head of the

humerus. Natural history and management. J Bone Joint Surg Br.

1976;58:313–317.

2. Cruess RL. Experience with steroid-induced avascular necrosis of

the shoulder and etiologic considerations regarding osteonecrosis

of the hip. Clin Orthop Relat Res. 1978;130:86–93.

3. Gerber C, Schneeberger AG, Vinh T. The arterial vascularization

of the humeral head. An anatomical study. J Bone Joint Surg Am.

1990;72:1486–1494.

4. Hardy P, Decrette E, Jeanrot C, Colom A, Lortat-Jacob A, Benoit

J. Arthroscopic treatment of bilateral humeral head osteonecrosis.

A case report. Arthroscopy. 2000;16:332–335.

5. Hattrup SJ, Cofield RH. Osteonecrosis of the humeral head:

relationship of disease stage, extent, and cause to natural history.

J Shoulder Elbow Surg. 1999;8:559–564.

6. Hattrup SJ, Cofield RH. Osteonecrosis of the humeral head:

results of replacement. J Shoulder Elbow Surg. 2000;9:177–182.

7. Hayes JM. Arthroscopic treatment of steroid-induced osteone-

crosis of the humeral head. A case report. Arthroscopy.

1989;5:218–221.

8. Hirota Y, Hirohata Y, Fukuda K, Mori M, Yanagawa H, Ohno Y,




9. Kay SP, Amstutz HC. Shoulder hemiarthroplasty at UCLA. ClinOrthop Relat Res. 1988;228:42–48.

10. Kerboul M, Thomine J, Postel M, Merle d’Aubigne R. The

conservative surgical treatment of idiopathic aseptic necrosis of

the femoral head. J Bone Joint Surg Br. 1974;56:291–296.

11. Laing PG. The arterial supply of the adult humerus. J Bone JointSurg Am. 1956;38:1105–1116.

12. LaPorte DM, Mont MA, Mohan V, Pierre-Jacques H, Jones LC,

Hungerford DS. Osteonecrosis of the humeral head treated by

core decompression. Clin Orthop Relat Res. 1998;355:254–260.

13. Lee JA, Farooki S, Ashman CJ, Yu JS. MR patterns of

involvement of human head osteonecrosis. J Comput AssistTomogr. 2002;26:839–842.

14. Lee SY, Lee JK. Horizontal component of partial-thickness tears

of rotator cuff: imaging characteristics and comparison of ABER

view with oblique coronal view at MR arthrography – initial

results. Radiology. 2002;224:470–476.

15. L’Insalata JC, Pagnani MJ, Warren RF, Dines DM. Humeral head

osteonecrosis: clinical course and radiographic predictors of

outcome. J Shoulder Elbow Surg. 1996;5:355–361.

16. Mont MA, Maar DC, Urquhart MW, Lennox D, Hungerford DS.

Avascular necrosis of the humeral head treated by core decom-

pression. A retrospective review. J Bone Joint Surg Br.

1993;75:785–788.

Table 3. Clinical status change

Parameters Initial

examination

Latest

followup

Pain UCLA score (points) 9.4 (5–10) 8.7 (2–10)

Total UCLA score (points) 28.9 (21–30) 27.3 (10–30)

Number of symptomatic shoulders 12* 17*

Number of patients

with pain on motion

10 15

Number of patients

with limited range of motion

3 10

Number of patients

with muscle weakness

8 8

Number of asymptomatic shoulders 34 29

*Total number of symptomatic shoulders does not equal the sum of

the numbers of patients with each symptom since some patients had

more than one symptom.


123

17. Mont MA, Payman RK, LaPorte DM, Petri M, Jones LC,

Hungerford DS. Atraumatic osteonecrosis of the humeral head.

J Rheumatol. 2000;27:1766–1773.

18. Nishii T, Sugano N, Miki H, Hashimoto J, Yoshikawa H. Does

Alendronate prevent collapse in osteonecrosis of the femoral

head? Clin Orthop Relat Res. 2006;443:273–279.

19. Nishii T, Sugano N, Ohzono K, Sakai T, Haraguchi K,

Yoshikawa H. Progression and cessation of collapse in osteo-

necrosis of the femoral head. Clin Orthop Relat Res. 2002;

400:149–157.


patients receiving steroids. Clin Orthop Relat Res. 2001;386:173–

178.

21. Sakai T, Sugano N, Nishii T, Haraguchi K, Ochi T, Ohzono K.

MR findings of necrotic lesions and the extralesional area of

osteonecrosis of the femoral head. Skeletal Radiol. 2000;29:

133–141.

22. Sakai T, Sugano N, Ohzono K, Matsui M, Hiroshima K, Ochi T.

MRI evaluation of steroid- or alcohol-related osteonecrosis of the

femoral condyle. Acta Orthop Scand. 1998;69:598–602.

23. Smith SW, Meyer RA, Connor PM, Smith SE, Hanley EN.

Interobserver reliability and intraobserver reproducibility of the

modified Ficat classification system of osteonecrosis of the

femoral head. J Bone Joint Surg Am. 1996;78:1702–1706.

24. Stulberg BN. Editorial comment. Clin Orthop Relat Res.

1997;334:2–5.

25. Sugano N, Ohzono K, Masuhara K, Takaoka K, Ono K. Prog-

nostication of osteonecrosis of the femoral head in patients with

systemic lupus erythematosus by MRI. Clin Orthop Relat Res.

1994;305:190–199.


123


F-18 Fluoride Positron Emission Tomography of the Hip forOsteonecrosis

Vinod Dasa MD, Hani Adbel-Nabi MD, PhD,

Mark J. Anders MD, William M. Mihalko MD, PhD



Abstract Osteonecrosis (ON) of the femoral head con-

tinues to be a devastating disorder for young patients. We

evaluated the F-18 fluoride positron emission tomography

(PET) imaging modality for use in detection of the bone

involved in ON of the hip. We retrospectively reviewed the

records of 60 consecutive patients diagnosed with ON and

interviewed all by phone. Eleven patients (17 hips) of those

interviewed agreed to participate in the study. We

classified the ON using the University of Pennsylvania

classification system and compared each patient’s plain AP

bone scan, single photon emission 3-D computed tomog-

raphy, and MRI. ON was associated with HIV, alcohol,

steroid use, and polycythemia vera in this group. Nine of

17 hips (8 patients) had acetabular increased uptake when

using the F-18 fluoride PET scans that were not seen on

MRI, single photon emission computed tomography, or

bone scans. These data suggest earlier acetabular changes

in osteonecrosis may exist that traditional imaging

modalities do not reveal.

Level of Evidence: Level III, diagnostic study. See the


of evidence.

Introduction

Osteonecrosis (ON) of the hip can be a devastating prob-

lem, especially in young patients, and may result in

irreversible changes of the hip [6, 8, 12]. Once collapse and

substantial degenerative changes occur, the patient usually

undergoes reconstruction of the hip with an arthroplasty

[10, 15, 17, 18]. In young patients, this can lead to con-

siderable future difficulties, including multiple revision

arthroplasties and loss of income or considerable career

changes, which can have a major socioeconomic impact

throughout the patient’s life [10, 15].

The pathogenesis and etiology of ON remain unclear.

Known associated factors include traumatic dislocation or

injury, steroid use, and alcohol abuse; some patients have

no identifiable risk factors. Most data point to a micro-

vascular insult or hyperlipidemia in nontraumatic cases

[10, 13, 15, 18]. Even though there is evidence that dis-

tinguishes a specific cause-and-effect relationship between

certain risk factors (steroid use, hyperlipidemia and sickle

cell disease) and ON, standard diagnostic techniques (MRI

or technetium bone scan) do not always provide prognostic

information. Given the array of potential risk factors, from

steroid use and alcohol abuse to HIV, an analysis which

reflected the metabolic activity of the bone might be useful.

In cases of osteonecrosis, an infarct region on the femoral

head may have a proprioceptive impact on the joint that

William M. Mihalko MD PhD is a consultant for Stryker Inc, Smith &

Nephew Inc., Ethicon and Aesculap. He also receives research

support from Stryker and Aesculap. No research or consulting is

related to this study.





V. Dasa, M. J. Anders

Department of Orthopaedic Surgery, University of Buffalo,

Buffalo, NY, USA

H. Adbel-Nabi

Department of Nuclear Medicine, University of Buffalo,

Buffalo, NY, USA

W. M. Mihalko (&)

Department of Orthopaedic Surgery, University of Virginia,

PO Box 800159, Charlottesville, VA 22908-0159, USA


123


DOI 10.1007/s11999-008-0219-2

may start to overload the acetabular side of the joint. If this

finding is discovered on an image modality then it aids in

predicting which patients may go on to progression of

disease.

Positron emission tomography (PET) scans provide a

real-time image of physiology based on the type of radio-

labeled marker used. Traditionally, PET scans, in addition

to MRI and SPECT scans, have been utilized to determine

vascularity and uptake changes in patients with tumor

progression; however, PET scan may be more sensitive in

detecting early changes compared to MRI and these

changes might predict subsequent progression. PET imag-

ing has been utilized extensively in orthopaedic skeletal

disease assessment as well as in cases where interference

from implants inhibits the use of other imaging modalities

[2, 4]. F-18 FDG accumulates in cancer cells due an

increased glucose metabolism. The process, however, is

not specific to tumors. FDG-18 also accumulates in

inflammatory cells, such as lymphocytes, neutrophils, and

macrophages which have elevated glucose requirements,

and therefore the process may be useful in ON [3, 5, 11,

14–17]. As suggested above, it is possible PET scans will

detect ON earlier than MRI and single-photon emission

computed tomography (SPECT) scans or that some early

uptake or vascular changes might predict the lesions that

are going to progress to changes on both sides of the joint

and eventual arthroplasty. PET scan is a powerful tool in

oncology and it may also play a role in diagnosing ON

[17]. In a pilot study, Schiepers et al. [17] determined a

flow ratio could be established and used to predict a suc-

cessful outcome with a conservative regimen in patients

with ON of the femoral head. The authors suggested this

type of image modality could be used in clinical practice

and would permit prediction of the outcome depending

upon regional skeletal flow measurements [17].

We hypothesized F-18 fluoride PET scan imaging would

match the traditional ‘‘gold standard’’ imaging studies of

MRI and SPECT modalities but would also provide further

information not seen with standard imaging modalities. If

PET scan imaging can be determined to give further

information concerning areas of activity in the hip itself,

then it may potentially be utilized as a prognostic study in

the future.


Utilizing the ICD-9 code for osteonecrosis of the femoral

head and neck in a county-based hospital clinic in April

2003, a list of active patients with this diagnosis were

identified and recruited until December 2003 for inclusion

in this pilot study. Inclusion criterion was simply a diag-

nosis of ON of the femoral head without a history of

trauma and without surgical intervention in at least one hip

if bilateral disease was present. Sixty patients were iden-

tified with the diagnosis of ON of the femoral head at this

time.

The study was designed to identify hips with atraumatic

etiologies of ON to determine if any differences between

F-18 fluoride PET scan imaging and the traditional MRI

and SPECT scan imaging were found. Sixty patients were

identified with the diagnosis of ON of the femoral head. All

of the patients were then contacted by phone for inclusion

in the study. Out of the original 60 patients 11 (18%) with

aseptic and atraumatic ON of one or both femoral heads

agreed to participate. Each patient underwent staging by

the University of Pennsylvania classification system

(Table 1) [19]. In this study group two hips were excluded

due to previous unilateral core decompression (these two

hips were in patients with bilateral ON, leaving them in the

study for the untreated side) and three hips in three patients

Table 1. Comparison of the University of Pennsylvania osteone-

crosis classification system to Ficat

Stage Ficat University of Pennsylvania

I No changes on

radiograph

Normal radiograph

Clinical symptoms

suspicious

Abnormal MR or bone scan

A = mild, \ 15% of femoral

head affected;

B = moderate, 15–30%

affected;

C = severe, [ 30% affected

II Bone remodeling Cystic and sclerotic change

in femoral head

No changes in the shape

of the femoral head


head affected;

Subchondral sclerosis B = moderate, 15–30%

affected;

Cysts C = severe, [ 30% affected

III Crescent sign Crescent sign without flattening


head affected;

B = moderate, 15–30% affected

C = severe, [ 30% affected

IV Joint space narrowing Flattening of the femoral head

Degenerative changes on

both sides of the joint


head affected and \ 2 mm

of depression;

Femoral head deformation B = moderate, 15–30% affected

and 2–4 mm of depression;

C = severe, [ 30% affected)

V — Joint narrowing or acetabular

changes (can be graded

according to severity)

VI — Advanced degenerative changes

1082 Dasa et al. Clinical Orthopaedics and Related Research

123

for the presence of a total hip arthroplasty opposite an

active case of ON of the femoral head (Table 2). This left

11 patients with 17 osteonecrotic hips for inclusion. Oste-

onecrosis was associated with steroid use (five patients,

eight hips), alcohol abuse (four patients, six hips), and with

HIV (one patient, two hips), polycythemia vera (one

patient, one hip). All patients underwent PET scanning,

SPECT and bone scans, and MRI imaging over 2 days.

Patients received no financial incentive other than free

transportation to the imaging center provided by the

nuclear medicine department. This study was approved by

the Investigational Review Board at our institution.

For MRI, we obtained both T1- and T2-weighted images

without contrast during one of the imaging days. Images of

each hip and pelvis were in the axial, coronal, and sagittal

planes. No patients had contraindications to obtaining an

MRI. Three-phase bone and SPECT scans were obtained

on a dual head Vertex camera (ADAC Laboratories, Mil-

pitas, CA). For three-phase bone and SPECT scans,

approximately 20 to 25 mCi of Tc-99m MDP was injected

intravenously while the subject was lying in the SPECT

camera gantry. Twenty-five-second dynamic acquisition

frames were acquired over the hip regions followed by a

blood pool image. Approximately 2 hours later, anterior

and posterior planar views of the hips were obtained in a

static mode (256 9 256 matrix) with high-resolution col-

limators. Next, SPECT of the pelvic region was acquired

and the images reconstructed in 3-D mode.

For F-18 fluoride PET scans, on a separate day, a

transmission scan of the pelvis overlapping the full axial

field of view covered by the dynamic emission data was

acquired. Next, 2.5 to 3.5 mCi of F-18 fluoride was

injected intravenously. For the dynamic study, 12 frames,

each for 5 seconds, were acquired during the first minute

using the Minimize Wait Program (ADAC C-PET PLUS

250, Philips Medical Systems, Netherlands), with NaI

scintillation crystal transmission imaging of Cs-137 trans-

mission scan 45 sec/rotation (2 rotations = 1.5 min) and

small sinograms (2-mm slice thickness). Then, a 1-minute

frame was acquired for the next 4 minutes followed by

2-minute frames 10 times. Static images, 5 minutes per

frame, were acquired over the next 15 minutes. Total

acquisition time, including transmission, was approxi-

mately 55 minutes.

One board-certified nuclear medicine physician (HN)

evaluated PET scans and bone scans and provided descrip-

tive results. The scan area of the bone in the ilium was

utilized as a baseline normal for each PET scan and the

difference in the femoral head and surrounding bone of the

hip was then determined to have more uptake in each PET

scan image window. This provided an objective means of

determining differences in each of the image windows

analyzed for the PET scans. Two attending physicians (WM,

MA) and one resident (VD) in the orthopaedic department

reviewed all MRI images and staged all hips using the

University of Pennsylvania classification system [10].

The data were organized by presence of changes on each

imaging modality and compared utilizing a Kappa score to

determine agreement between the PET scan findings and

each of the traditional imaging modalities. Any differences

where PET scan images revealed changes not recorded on

the traditional imaging modalities were recorded as well

for analysis. Confidence intervals were also calculated and

reported to reveal the effects of the small sample size. All

data were calculated using SPSS software (Chicago, IL).

Results

In general, all patients had MRI findings of the femoral

head consistent with ON. The patient with HIV (Stage IV)

showed consistent findings between the PET scan and bone

scans. Both showed increased uptake of the acetabulum;

however, the left femoral head showed no changes on PET

but did show increased uptake in the neck and greater

trochanter. The second patient with steroid-induced ON

who underwent decompression of a Stage II lesion which

was excluded from the study showed no evidence of

increased uptake on PET but still showed MRI changes

consistent with Stage II disease.

All patients had MRI findings of ON in the femoral

head. (Table 3). Bone scans did not reveal ON in either

femoral head in five of six hips when compared with the

MRI. The findings were comparable to (Kappa = 0.88) the

PET imaging findings. When the PET and MRI scans for

Table 2. Demographics of patients who met the inclusion criteria

and agreed to participate in the study

Patient Age Gender Etiology U of Penn. Stage

Right Left

1 58 M steroids IB IB

2 36 F steroids IA NA*

3 78 M ETOH VA VI

4 31 F HIV NA� IVB

5 58 M ETOH NA* IIIB

6 51 F polycythemia IIB IIA

7 34 F steroids IVA IA

8 54 M ETOH IA VB

9 48 M steroids IB IVC

10 53 M steroids IA NA�

11 41 M ETOH IIIA NA*

* = not applicable due to a previous THA; � = not applicable due to

a previous core decompression; ETOH = alcohol abuse.

Volume 466, Number 5, May 2008 F-18 Fluoride PET Scan Analysis of ON 1083

123

right-sided ON of the femoral head were compared, an

agreement of 88.9% (95% CI = 51.8 to 99.7) was deter-

mined. PET versus MRI for the left side of the femoral

head revealed an agreement of 87.5% (95% CI = 47.4 to

99.7).

PET F-18 fluoride imaging studies in 9 hips (8 patients)

revealed signal changes in the region of the acetabulum not

detected on MRI (Figs. 1 and 2, Table 3). Comparison of

these findings resulted in poor agreement with a Kappa of

0.36.

Discussion

In this study we sought to determine if agreement between

more traditional imaging modalities and PET F-18 fluoride

scans existed in patient with atraumatic ON of the femoral

head and also whether the PET scan modality provided any

further areas about the hip joint where activity was recorded

that MRI and SPECT scan did not detect. Standard diag-

nostic techniques (MRI or technetium bone scan) for ON do

not always provide prognostic information. Traditionally,

PET scans, in addition to MRI and SPECT scans, have been

utilized to determine vascularity and uptake changes in

patients with tumor progression; however, PET scans may be

more sensitive in detecting early changes compared to MRI

and these changes might predict subsequent progression. We

hypothesized F-18 fluoride PET scan imaging would match

the traditional ‘‘gold standard’’ imaging studies of MRI and

SPECT modalities but would also provide further informa-

tion not seen with standard imaging modalities.

Our study is limited by the sample size and the possible

bias in the sample population. We did record good agree-

ment of the PET scan with MRI findings in the femoral

head and also identified increased activity in the acetabu-

lum of several patients with the PET scan modality which

was not apparent in the MRI or bone scan. This resulted in

poor agreement on the acetabular side of the joint and a

low Kappa score. In this small pilot study it may be diffi-

cult to determine the implication of the acetabular findings.

With a large number of patients identified who met the

inclusion criteria (60), but a small fraction (11) agreeing to

participate, we experienced a major limitation that is

Table 3. Presence of imaging findings in femoral head and acetab-

ulum in MRI and PET scan*

Patient MRI femoral

head right/left

PET scan

femoral head

right/Left

MRI

acetabulum

right/left

PET scan

acetabulum

right/left

1 1/1 0/0 0/0 0/0

2 1/NA 1/NA 0/NA 0/NA

3 1/1 1/1 0/0 1/0

4 NA/1 NA/1 NA/0 NA/1

5 NA/1 NA/1 NA/0 NA/1

6 1/1 1/1 0/0 1/1

7 1/1 1/1 0/0 0/1

8 1/1 1/1 0/0 1/0

9 1/1 1/1 0/0 1/0

10 1/NA 1/NA 0/NA 1/NA

11 1/NA 1/NA 0/NA 0/NA

*Presence is indicated by a 1 and absence by a 0.

NA = Not Applicable due to previous surgery.

Fig. 1A–E (A) A female patient with polycythemia vera remains

asymptomatic with early-onset ON visible in this radiograph. (B)

MRI reveals changes in the femoral head with no acetabular

involvement. Positron emission tomography scan results at (C) 5 to

10 minutes, (D) 15 to 20 minutes, and (E) 35 to 40 minutes reveal

increased acetabular uptake outlined by arrows.


123

difficult to overcome. Because the PET scan image read-

ings were performed by a single reader, this may be viewed

as a limitation as well, despite utilizing an objective cri-

terion. The ilium of each patient acted as a normal baseline,

allowing the different timelines to be more objectively

reported. It is difficult to rate the sensitivity and specificity

of our findings due to the fact it is uncertain if they indicate

a pathological process or adaptation.

Osteonecrosis of the femoral head is a disease process for

which progression is difficult to predict. Given the various

etiologies this should not be surprising. However, despite

the various causes the end result is often the same [14, 18].

In our limited series we found a portion of patients with

good agreement of findings compared to MR imaging, but a

subset of patients having acetabular changes in early stages

of ON was identified only by PET imaging. These findings

had no correlation to findings in this region on MRI or

SPECT. In the later stages, degenerative arthritis confounds

the accuracy of all the imaging modalities, especially at the

articular surface [3, 9, 10]. However, in early disease, the

presence of changes on both sides of the joint may lead to

greater acceleration of degenerative changes. The acetab-

ular blood supply comes primarily from the superior

gluteal, inferior gluteal, and obturator arteries. The blood

supply for the femoral head arises from branches of the

profunda femoris [1]. These vessels are clearly from dif-

ferent sources, but the changes seen on PET were still

recorded in both in the femoral head and acetabulum.

Fink et al. [3] described acetabular findings on MRI in

9.5% of patients with femoral head ON. We observed

acetabular changes on PET scans in patients with ON

without corresponding MRI changes. All bone scans

showed increased uptake of both the acetabulum and

femur, but we were unable to distinguish between the two

given the poor resolution of the images. Interestingly, the

patient with HIV who had undergone core decompression

3 weeks previously had no improvement in flow relative to

the nonoperative side included in the study, whereas the

patient who underwent core decompression 2 years previ-

ously did not show PET evidence of ON but continues to

have MRI changes on the hip that was excluded from the

study due to previous surgery.

Further study is needed to ascertain whether acetabular

ON predicts progression of the disease. Furthermore, if the

early presence of acetabular metabolic changes as indicated

on F-18 fluoride PET can predict outcome in nonoperative

treatments, then it may serve as an important role in the

future [7, 11]. With the advent of PET computed tomog-

raphy combined with labels such as fluorodeoxyglucose,

we may gain considerable insight into the pathophysiology

of ON as well. Drawing conclusions from this small sample

size is difficult, and our observations have raised more

questions. However, the results serve as a starting point for

future investigation to determine if the presence of a

positive signal on the acetabular side of the joint is a

prognostic indicator for success or failure of progression of

the disease. The results, however, may suggest an expan-

ded vascular and anatomic role of ON extending into the

acetabulum than previously believed.

Acknowledgments We thank Wendy Novicoff, PhD, for her

assistance on statistical analysis of this study.

References

1. Beck M, Leunig M, Ellis T, Sledge JB, Ganz R. The acetabular

blood supply: implications for periacetabular osteotomies. SurgRadiol Anat. 2003;25:361–367.

Fig. 2A–D A female patient

with ON secondary to steroid

use had undergone left THA. She

remains (A) asymptomatic on the

right side as shown in this radio-

graph. (B) MRI reveals changes

in the femoral head with no

acetabular involvement. Positron

emission tomography scan

results at (C) 25 to 30 minutes

and (D) 35 to 40 minutes reveal

increased acetabular uptake out-

lined by the arrow.

Volume 466, Number 5, May 2008 F-18 Fluoride PET Scan Analysis of ON 1085

123

2. Cook GJ, Fogelman I. The role of positron emission tomography

in skeletal disease. Semin Nucl Med. 2001;31:50–61.

3. Fink B, Assheuer J, Enderle A, Schneider T, Ruther W. Avas-

cular osteonecrosis of the acetabulum. Skeletal Radiol.1997;26:509–516.

4. Forrest N, Welch A, Murray AD, Schweiger L, Hutchison J,

Ashcroft GP. Femoral head viability after Birmingham resur-

facing hip arthroplasty: assessment with use of [18F] fluoride

positron emission tomography. J Bone Joint Surg Am. 2006;

88(Suppl 3):84–89.

5. Grigolon MV, Delbeke D. F-18 FDG uptake in a bone infarct: a

case report. Clin Nucl Med. 2001;26:613–614.

6. Hernigou P, Habibi A, Bachir D, Galacteros F. The natural

history of asymptomatic osteonecrosis of the femoral head in

adults with sickle cell disease. J Bone Joint Surg Am.

2006;88:2565–2572.

7. Hung GU, Tsai SC, Lin WY. Extraordinarily high F-18 FDG

uptake caused by radiation necrosis in a patient with nasopha-

ryngeal carcinoma. Clin Nucl Med. 2005;30:558–559.

8. Hungerford DS, Mont MA. The natural history of untreated

asymptomatic hips in patients who have non-traumatic osteone-

crosis. J Bone Joint Surg Am. 1998;80(5):765–6.

9. Lee MJ, Corrigan J, Stack JP, Ennis JT. A comparison of modern

imaging modalities in osteonecrosis of the femoral head. ClinRadiol. 1990;42:427–432.

10. Lieberman JR, Berry DJ, Mont MA, Aaron RK, Callaghan JJ,

Rajadhyaksha AD, Urbaniak JR. Osteonecrosis of the hip: man-

agement in the 21st century. Instr Course Lect. 2003;52:337–355.

11. Liu SH, Chang JT, Ng SH, Chan SC, Yen TC. False positive

fluorine-18 fluorodeoxy-D glucose positron emission tomography

finding caused by osteoradionecrosis in a nasopharyngeal carci-

noma patient. Br J Radiol. 2004;77:257–260.

12. Malizos KN, Karantanas AH, Varitimidis SE, Dailiana ZH,

Bargiotas K, Maris T. Osteonecrosis of the femoral head: etiol-

ogy, imaging and treatment. Eur J Radiol. 2007;63:16–28.

13. Matsui M, Saito S, Ohzono K, Sugano N, Saito M, Takaoka K,

Ono K. Experimental steroid-induced osteonecrosis in adult

rabbits with hypersensitivity vasculitis. Clin Orthop Relat Res.

1992;277:61–72.

14. Mont MA, Carbone JJ, Fairbank AC. Core decompression versus

nonoperative management for osteonecrosis of the hip. ClinOrthop Relat Res. 1996;324:169–178.

15. Mont MA, Jones LC, Sotereanos DG, Amstutz HC, Hungerford

DS. Understanding and treating osteonecrosis of the femoral

head. Instr Course Lect. 2000;49:169–185.

16. Nguyen BD, Roarke MC. F-18 FDG PET/CT incidental finding

of large ischiogluteal bursitis. Clin Nucl Med. 2007;32:

535–537.

17. Schiepers C, Broos P, Miserez M, Bormans G, De Roo M.

Measurement of skeletal flow with positron emission tomography

and 18F-fluoride in femoral head osteonecrosis. Arch OrthopTrauma Surg. 1998;118:131–135.



femoral head. Results of core decompression and grafting with


1989;249:199–208.

19. Steinberg ME, Hayken GD, Steinberg DR. A quantitative system

for staging avascular necrosis. J Bone Joint Surg Br. 1995;77:

34–41.


123


Untreated Asymptomatic Hips in Patients With Osteonecrosisof the Femoral Head

Byung-Woo Min MD, Kwang-Soon Song MD,

Chul-Hyun Cho MD, Sung-Moon Lee MD,

Kyung-Jae Lee MD



Abstract Because there is no consensus regarding the

factors predicting femoral head collapse in asymptomatic

osteonecrosis of the hip, we studied the risk factors for

collapse. Between 1990 and 2000, we used MRI to confirm

asymptomatic osteonecrosis of the femoral head in 81

patients (81 hips) whose other hip had nontraumatic

symptomatic osteonecrosis and we monitored them pro-

spectively. The minimum followup was 5 years (mean,

8.3 years; range, 5–16 years). At the latest followup, 31

hips (38%) were symptomatic and 26 hips (32%) had

collapsed. The mean interval between diagnosis and col-

lapse was 4.1 years. We observed no correlation between

femoral head collapse and patients’ age, gender, weight,

presumed cause of osteonecrosis, or length of followup.

With combined factors, only extent of large necrotic lesion

(hazard ratio, 4.06; 95% confidence interval, 1.29–12.77)

and location of Type C2 necrotic lesion (hazard ratio, 6.35;

95% confidence interval, 1.18–34.11) predicted collapse.

Level of Evidence: Level I, prognostic study. See the


of evidence.

Introduction

In patients with symptomatic osteonecrosis (ON) of the

femoral head, the natural history has been well documented

to progress to collapse and painful degenerative arthritis in

almost all patients [1, 2, 4–6, 9, 11, 13, 14, 18, 21, 23, 26,

28, 29]. However, there is no consensus regarding the

natural history in patients with asymptomatic ON of the

femoral head. The reported rates of progression in these

hips have ranged from as low as 17% to as high as 100%

[4, 5, 7, 9, 11, 14, 18, 29].

Historically, investigators had difficulty evaluating the

fate of asymptomatic ON because the disease could not be

clearly detected in asymptomatic hips by simple radio-

graphs. However, with the advent of MRI, it became easier

to diagnose asymptomatic disease and to more accurately

ascertain the extent, location, and stage of the necrotic

lesion [2, 17, 28].

We asked whether the radiographic stage, extent of the

necrotic lesion, and lesion location influenced the rate of

collapse of the asymptomatic ON of the femoral head and

if so, how long after symptom onset and initial diagnosis of

ON. We then asked whether a number of potential demo-

graphic risk factors would predict collapse.


We identified 152 consecutive patients with established

symptomatic atraumatic ON of the femoral head in one hip

treated with THA or other surgical interventions such as

osteotomy or core decompression between 1990 and 2000.

Because of the high probability of bilateral involvement,

both hips were evaluated with radiographs and MRI even

when the contralateral hip was asymptomatic. Among the


(eg, consultancies, stock ownership, equity interest, patient/

licensing arrangements, etc) that might pose a conflict of interest

in connection with the submitted article.

Each author certifies that his institution has approved the human



B.-W. Min (&), K.-S. Song, C.-H. Cho, S.-M. Lee, K.-J. Lee

Department of Orthopaedic Surgery, Keimyung University,

School of Medicine, Dongsan Medical Center,

194 Dongsan-dong, Joong-gu, Daegu 700-712, Korea


123


DOI 10.1007/s11999-008-0191-x

152 patients, we identified 91 (59.9%) with asymptomatic

ON of the femoral head in the contralateral hip. We

monitored these 91 patients prospectively to detect col-

lapse. We recorded the following potential risk factors:

age, length of followup, weight, gender, presumed cause of

necrosis, stage, extent of involvement, and location of the

necrotic segment. We followed all patients a minimum of

5 years. All patients gave informed consent for participa-

tion, and our Institutional Review Board approved the

protocol.

The necrotic lesions were confirmed by the band-like

homogeneous and nonhomogeneous patterns shown on

MRI [2]. Four patients (four hips) died from causes unre-

lated to surgery, and six patients (six hips) were lost to

followup before the end of the minimum 5-year followup

period; this left 81 patients (81 hips) as the subjects of our

study. None of the 10 patients (12.3%) who died or were

lost to followup monitoring showed collapse of the femoral

head by the time of their final evaluation. There were 68

men and 13 women with a mean age of 50.5 years (range,

22–77 years). The left hip was studied in 36 patients and

the right hip in 45. The presumed cause of ON was alcohol

in 39 patients (48.1%), idiopathic in 30 (37%), and steroids

in 12 (14.9%). Cases of posttraumatic ON were excluded.

The minimum followup was 5 years (mean, 8.3 years;

range, 5–16 years).

All patients underwent clinical and radiographic fol-

lowup evaluation at 3-month intervals for the first 2 years

and at yearly intervals thereafter until the time of collapse

or for a minimum of 5 years. The initial examination

included clinical evaluation, radiographs, and MRI images.

Clinical information was obtained by means of an inter-

view and physical examination conducted by two of the

authors (BWM, KSS). Patients were asked to indicate the

grade of hip pain as none, slight, mild, moderate, or severe

using the same criteria as for the pain categories in the

Harris hip score [8].

Radiographs and MRI images of all patients were ana-

lyzed by two independent readers (CHC, SML) who did

not know the patients’ clinical and radiographic histories. If

there was a disagreement, a third observer (KJL)

interpreted the films and a unanimous decision was reached

regarding the parameter. The coefficient of variations of

estimation between the observers was 4.2%. Our analysis

included various parameters, including Steinberg stage,

extent of involvement, and location of the necrotic seg-

ment. Radiographic stage was assessed according to the

classification system of Steinberg et al. [25]. Stage II was

subdivided as Stage II sclerotic type and Stage II cystic

type according to the method of Bozic et al. [3] (Table 1).

The extent of the necrotic lesion was quantified using

the method of Steinberg et al. [25] in which hips were

evaluated by simple visual estimate of lesion size. Hips

evaluated by visual estimate were grouped by lesion size:

small (less than 15% of head involvement); medium (15%

to 30% involvement); and large (greater than 30%).

The location of necrosis on T1-weighted midcoronal

images was classified as Type A, B, C1, or C2 using the

criteria described by Sugano et al. [27]. Type A lesions

occupy the medial third or less of the weightbearing area of

the femoral head; Type B lesions the medial two-thirds or

less; Type C1 lesions more than the medial two-thirds but

not extending laterally to the acetabular edge; and Type C2

lesions more than the medial two-thirds and extending

laterally to the acetabular edge.

We determined differences in clinical data between hips

in which collapse developed and those in which it did not

using the Kruskal-Wallis test (age, length of followup,

weight) and chi square test (gender, presumed cause of

necrosis). Clinical failure was defined as the occurrence

of pain, and radiographic failure was defined as occurrence

of segmental collapse. With the collapse of the femoral

head as seen on a radiograph as the end point, survival for

all enrolled patients was calculated using the Kaplan-Meier

method and plotted. The differences in the survival distri-

butions were tested with the log-rank test. We performed

multivariate regression analysis using the Cox proportional

hazards model to identify the independent factors with

regard to the collapse of the head. We used SPSS software

(version 12.0; SPSS Inc, Chicago, IL).

Table 1. Modified classification system of Steinberg et al. [25]

Stage Radiographic findings MRI findings

Stage I Normal Abnormal

Stage II* Abnormal Abnormal

Sclerotic type Sclerotic change in necrotic segments Low signal intensity in necrotic segment

in T1-weighted and T2-weighted images

Cystic type Cystic change in necrotic segments Low signal intensity in necrotic segment

in T1 and high signal intensity in necrotic

segment in T2

* Stage II was subdivided as Stage II sclerotic type and Stage II cystic type according to a method of Bozic et al. [3].

1088 Min et al. Clinical Orthopaedics and Related Research

123

Results

At the latest followup examination, 31 of 81 hips (38%)

became symptomatic and 26 hips (32%) demonstrated

collapse. With occurrence of collapse as the end point, the

cumulative rates of survival (with 95% confidence inter-

vals) were 91.4% at 5 years, 76.5% at 8 years, and 70% at

10 years (Fig. 1A). Five hips that were symptomatic had

only slight pain and did not collapse. The mean interval

between diagnosis and collapse was 4.1 years (range, 1.2–

11.9 years). The mean interval between diagnosis and pain

onset was 3.4 years (range, 0.7–8.9 years). Twelve of the

26 hips (46%) demonstrated collapse after 4 years; the

longest delay between diagnosis and collapse was

11.9 years. When collapse occurred, it was always

preceded by pain of an average 8 months’ duration (range,

1–36 months).

We observed no differences in survival (p = 0.060, log-

rank test) among hips classified as Steinberg stages

(Fig. 1B). The survival rate for Stage I hips was 21.9%

(95% confidence interval [CI], 10%–54%). The survival

rate for Stage II cystic-type hips was 17% (95% CI, 13%–

47%). Only eight hips (10%) were classified as Stage II

sclerotic type and neither had pain nor demonstrated col-

lapse. The survival rate for those hips was 100% (Table 2).

Lesion size predicted survival likelihood and duration.

The survival rate for hips with small lesions was 100%.

The survival rate for hips with medium lesions was 36.4%

(95% CI, 0%–73%). However, the survival rate for hips

with large lesions was 0% (Table 3). The log-rank test

showed longer durations (p = 0.000) of survival for hips

with small or medium lesions than for hips with large

lesions (Fig. 1C).

Fig. 1A–D The Kaplan-Meier sur-

vivorship curve. (A) The cumulative

rates of survival (with 95% confi-

dence intervals) are 91.4% at

5 years, 76.5% at 8 years, and 70%

at 10 years with collapse of the

femoral head as the end point. Error

bars show the 95% confidence inter-

val. (B) Survival rates according to

initial Steinberg stages of osteone-

crosis. There were no differences

(p = 0.060, log-rank test) in sur-

vival among hips classified as

Steinberg stages. Error bars show

the 95% confidence interval. (C)

Survival rates according to initial

extent of the osteonecrosis by MRI

using the method of Steinberg et al.

[25]. The times to collapse were

different (p = 0.000, log-rank test)

among the three groups. Error bars

show the 95% confidence interval.

(D) Survival rates according to

the location of osteonecrosis. The

times to collapse were different

(p = 0.000, log-rank test) among

the three groups. Error bars show the

95% confidence interval.

Table 2. Fate of asymptomatic hips according to Steinberg stage

[25]

Stage Hips Pain Collapse

Stage I 58 (68%) 23 (42%) 20 (36%)

Stage II*

Cystic type 18 (22%) 8 (44%) 6 (33%)

Sclerotic type 8 (10%) 0 (0%) 0 (0%)

* Stage II was subdivided as Stage II sclerotic type and Stage II cystic

type according to a method of Bozic et al. [3].

Volume 466, Number 5, May 2008 The Fate of Asymptomatic Osteonecrosis 1089

123

The log-rank test showed longer durations (p = 0.000)

of survival for the hips with Type A, B, or C1 necrotic

lesions than for those with Type C2 lesion (Fig. 1D). The

survival rate for hips with Type A or B (lesions occupying

less than the medial two-thirds) was 100%. The survival

rate for hips with Type C1 (lesions occupying more than

the medial two-thirds but not extending laterally to the

acetabular edge) was 77.8% (95% CI, 48%–100%). The

extent of necrosis in these two hips was classified as large.

The survival rate for Type C2 lesions (lesions occupying

more than the medial two-thirds and extending laterally to

the acetabular edge) was 4.2% (95% CI, 0%–12%)

(Table 4).

We observed no correlation between femoral head col-

lapse and patients’ age, gender, weight, presumed cause of

ON, or length of followup (Table 5). When all possible

factors were analyzed together using a Cox model, the

extent of large necrotic lesions (hazard ratio, 4.06; 95% CI,

1.29–12.77; p = 0.016) and location of Type C2 necrotic

lesions (hazard ratio, 6.35; 95% CI, 1.18–34.11;

p = 0.031) were risk factors for collapse.

Discussion

There is no consensus regarding the factors predicting

femoral head collapse in asymptomatic ON of the hip,

although considerable evidence relates predictive factors

(eg, size and location of lesion) to outcomes in symptom-

atic ON. We therefore asked whether the radiographic

stage, extent of the necrotic lesion, and lesion location

influenced the rate of collapse of the asymptomatic ON of

the femoral head and if so, how long after symptom onset

and initial diagnosis of ON. Because of the potential

influence of demographic factors on collapse, we then

asked whether these would predict collapse.

Our study had certain limitations, including the small

size of certain radiographic subgroups and the heteroge-

neity of patient demographics other than presumed causes

of ON. We also did not use quantitative volumetric mea-

surements to determine lesion size by digital image

analysis, a method that has been proven more accurate than

angular measurement [15, 24, 25]. In addition, we exclu-

sively included patients with asymptomatic hips on one

side and symptomatic hips on the other side. The outcome

of patients with both hips asymptomatic might be different

from what we observed. Asymptomatic hips will more

likely have progressive collapse or symptoms when there

the have symptoms in the contralateral hip [10].

We found 31 of 81 (38%) hips became symptomatic and

26 hips (32%) demonstrated collapse. The collapse was

related to the extent and location of the necrotic lesion on

MRI. The mean interval between diagnosis of the asymp-

tomatic ON and collapse was 4.1 years. The clinical and

radiographic failure rates in our study are lower than those

of previous reports (Table 6). Discrepancies in disease

prognosis between previous studies and our study arise

from several sources such as differences in study popula-

tions, in length of followup periods, and in techniques for

measuring the extent or location of necrotic lesions.

Jergessen and Khan [14] reported 14 of 19 asymptomatic

hips with Steinberg Stage II disease had progression of the

disease and collapse. However, they did not use MRI

images for diagnosis and measuring the extent of necrotic

lesions and may have excluded hips that in fact had ON

Table 3. Fate of asymptomatic hips according to extent of the

necrotic lesion*

Extent Hips Pain Collapse

Small (greater than 15%) 30 (37%) 0 (0%) 0 (0%)

Medium (15% to 30%) 29 (36%) 9 (31%) 6 (21%)

Large (greater than 30%) 22 (27%) 22 (100%) 20 (91%)

* The extent of the necrotic lesion was quantified with using the

method of Steinberg et al. [25] in which hips were evaluated by

simple visual estimate of lesion size.

Table 4. Fate of asymptomatic hips according to location of the

necrotic lesion*

Location Hips Pain Collapse

Type A 3 (3%) 0 (0%) 0 (0%)

Type B 35 (43%) 1 (3%) 0 (0%)

Type C1 15 (19%) 2 (13%) 2 (13%)

Type C2 28 (35%) 28 (100%) 24 (86%)

* The location of the necrosis on T1-weighted midcoronal images was

classified as Type A, B, C1, or C2 using the criteria described by

Sugano et al. [27].

Table 5. Relationship between the final status of femoral head and

various clinical and radiographic parameters for patients with

asymptomatic osteonecrosis of the femoral head

Patient characteristics No collapse Collapse p Value

Number of hips: 81 55 hips (68%) 26 hips (32%)

Age at surgery (years) 49.2 ± 12.3 53.2 ± 10.2 0.154

Gender 0.592

Male 47 21

Female 8 5

Length of followup (years) 8.4 ± 3.0 8.3 ± 3.6 0.167

Weight (kg) 63.5 ± 6.7 60.4 ± 8.8 0.086

Presumed cause of necrosis 0.146

Alcohol 24 15

Idiopathic 20 10

Steroid 11 1

All values are presented as the mean ± standard deviation.


123

that subsequently did not collapse, thus biasing their group.

This throws into question the older literature using only

radiographs. Bradway and Morrey [4] also reported all 15

hips in their study of asymptomatic hips eventually col-

lapsed. In a prospective study of 40 asymptomatic hips

with very small osteonecrotic lesions, Hernigou et al. [11]

reported 88% became symptomatic and 73% showed

collapse. Recently, Hernigou et al. [9] reported pain

developed in 91% and collapse had occurred in 77% in

asymptomatic ON associated with sickle cell disease.

However, several investigators [5, 17, 21] have shown

using MRI certain small lesions spontaneously heal and

decrease in size over time.

A number of factors may influence the rate of progres-

sion of ON of the femoral head [11, 13, 14–17, 19, 23–26].

The extent of the necrotic lesion is generally considered the

principal factor in determining the risk of collapse [11, 16,

29]. Takatori et al. [29] reported a close relationship

between the size of the necrotic lesion and collapse. Koo

and Kim [16] reported collapse in 97% of the medium and

large lesions but in only 12.5% of smaller lesions. Our

findings support the finding that the more extensive the

necrotic lesion, the higher the risk of collapse.

Surprisingly, we found a higher survival rate for Stage II

sclerotic hips than for Stage I and Stage II cystic hips. Most

researchers have reported ON of the femoral head gener-

ally has a progressive course of collapse once changes are

apparent radiographically [1, 12, 24]. However, asymp-

tomatic hips in the early stage of ON have variable paths of

disease progression [13, 14, 17, 22, 24, 29]. Ito et al. [13]

observed there was no difference in occurrence of pro-

gression between hips with Steinberg Stage I disease and

hips with Stage II disease. Shimizu et al. [23] reported

survival rates for the asymptomatic hips with normal

radiographic findings were better than for hips with

abnormal radiographic findings. When we classified

hips by radiographic stage, there was no difference in

occurrence of collapse between Stage I and Stage II (36%

and 23%, respectively). However, six of 18 hips with Stage

II cystic type demonstrated collapse, and none of eight hips

with Stage II sclerotic type showed collapse when we

subdivided Stage II. This finding is consistent with the

observations of a previous report [3]. Bozic et al. [3]

reported cystic changes in the femoral head as seen on

plain radiographs were associated with a more than four-

fold increase in the rate of failure after core decompression.

Previous studies demonstrate hips with large necrotic

lesions have a high possibility of collapse [13, 16, 23, 24,

29]. In our series large necrotic lesions were not observed

in eight hips with Stage II sclerotic disease but were in five

of 18 hips with Stage II cystic disease. Some investigators

have suggested sclerotic changes in necrotic lesions indi-

cate a repair process that inhibits bone resorption

mechanism and provides structural integrity in the femoral

head [13, 18]. On the other hand, cystic changes within

necrotic lesions may represent poor trabeculae and exten-

sive bone resorption by osteoclastic resorption with greater

potential for subsequent collapse [7, 13].

The location of the necrotic lesion also influences the

rate of collapse [22, 24–29]. Sugano et al. [28] originally

proposed an MRI classification system that includes Types

A, B, and C lesions; they reported Type A lesions are

medial and rarely progress, Type B lesions are central and

have intermediate progression, and Type C lesions have

lateral involvement of the head and the worst prognosis.

However, Ito et al. [13] reported the location of the

necrotic lesion was not a major factor. In 2001, Japanese

investigators [27] revised the classification system of

location and subdivided Type C lesions into Subtypes C1

and C2 because the incidence of progressive collapse of the

femoral head varies considerably between them [20, 27].

Our data also suggest the risk of collapse is higher in Type

C2 lesions (86%) than in Type C1 lesions (14%). We

believe this explains the lack of observed difference in the

risk of collapse between Type B and Type C lesions in

previous reports [13, 21] that do not differentiate C1 and

C2 lesions.

Our study confirmed two important prognostic factors

for collapse: extent and location of the necrotic lesion.

Although it was more likely to occur in hips with large

lesions, collapse also occurred in medium-sized lesions if

they were localized to the lateral area of the femoral head.

Six of eight hips with medium-sized lesions but with C2

location (lateral area of the femoral head) developed

collapse.

A question frequently asked by our patients with ON of

the femoral head is how long the surgery on their symp-

tomatic hip will last until they need a second operation

for the asymptomatic contralateral hip. We found it took

an average of 4.1 years (but with a wide range of

Table 6. Review of the literature regarding outcomes in patients

with untreated asymptomatic osteonecrosis of the femoral head

Authors Number

of hips

Length of

followup

(years)*

Symptomatic

progression

(%)

Collapse

(%)

Hernigou et al. [9] 121 14 91 77

Kopecky et al. [17] 25 1.3 28 28

Takatori et al. [29] 32 1.7 Not

available

43.8

Jergessen and

Khan [14]

19 [ 5 73.7 71.4

Hernigou et al. [11] 40 11 88 73

Bradway and

Morrey [4]

15 Not

available

100 100

* All values are presented as the mean.

Volume 466, Number 5, May 2008 The Fate of Asymptomatic Osteonecrosis 1091

123

1.2–11.9 years) from MRI diagnosis to collapse with

nearly 50% of the collapse occurring as soon as 4 years

after diagnosis.

The occurrence of pain in the asymptomatic hip was a

good predictor of collapse in our study. We recommend

evaluating these patients immediately after pain onset

because pain usually precedes collapse by an average of

8 months.

References

1. Aaron RK, Lennox D, Bunce GE, Ebert T. The conservative

treatment of osteonecrosis of the femoral head. A comparison of

core decompression and pulsing electromagnetic fields. ClinOrthop Relat Res. 1989;249:209–218.

2. Bassett LW, Gold RH, Reicher M, Bennett LR, Tooke SM.

Magnetic resonance imaging in the early diagnosis of ischemic

necrosis of the femoral head. Clin Orthop Relat Res. 1987;214:

237–248.

3. Bozic KJ, Zurakowski D, Thornhill TS. Survivorship analysis of hips

treated with core decompression for nontraumatic osteonecrosis of


4. Bradway JK, Morrey BF. The natural history of the silent hip in

bilateral atraumatic osteonecrosis. J Arthroplasty. 1993;8:383–387.

5. Cheng EY, Thongtrangan I, Laorr A, Saleh KJ. Spontaneous

resolution of osteonecrosis of the femoral head. J Bone Joint SurgAm. 2004;86:2594–2599.

6. Ficat RP. Idiopathic bone necrosis of the femoral head. Early

diagnosis and treatment. J Bone Joint Surg Br. 1985;67:3–9.

7. Glimcher MJ, Kenzora JE. The biology of osteonecrosis of the

human femoral head and its clinical implications: II. The path-

ologic changes in the femoral head as an organ and in the hip

joint. Clin Orthop Relat Res. 1979;139:283–312.

8. Harris WH. Traumatic arthritis of the hip after dislocation and

acetabular fractures: treatment by mold arthroplasty. An end-

result study using a new method of result evaluation. J Bone JointSurg Am. 1969;51:737–755.

9. Hernigou P, Habibi A, Bachir D, Galacteros F. The natural history

of asymptomatic osteonecrosis of the femoral head in adults with

sickle cell disease. J Bone Joint Surg Am. 2006;88:2565–2572.

10. Hernigou P, Lambotte JC. Bilateral hip osteonecrosis: influence

of hip size on outcome. Ann Rheum Dis. 2000;59:817–821.

11. Hernigou P, Poigrand A, Nogier A, Manicom O. Fate of very

small asymptomatic stage-I osteonecrotic lesions of the hip.


12. Hungerford DS, Zizic TM. The treatment of ischemic necrosis of

bone in systemic lupus erythematosus. Medicine. 1980;59:143–148.

13. Ito H, Matsuno T, Kaneda K. Prognosis of early stage avascular

necrosis of the femoral head. Clin Orthop Relat Res.1999;358:149–157.

14. Jergessen HE, Khan AS. The natural history of untreated

asymptomatic hips in patients who have non-traumatic osteone-

crosis. J Bone Joint Surg Am. 1997;79:359–363.




16. Koo KH, Kim R. Quantifying the extent of osteonecrosis of the

femoral head. A new methods using MRI. J Bone Joint Surg Br.1995;77:875–880.

17. Kopecky KK, Braunstein EM, Brandt KD, Filo RS, Leapman SB,

Capello WN, Klatte EC. Apparent avascular necrosis of the hip:

appearance and spontaneous resolution of MR findings in renal

allograft recipients. Radiology. 1991;179:523–527.

18. Lee CK, Hansen HT, Weiss AB. The ‘silent hip’ of idiopathic

ischemic necrosis of the femoral head in adults. J Bone Joint SurgAm. 1980;62:795–800.

19. Mont MA, Jones LC, Pacheo I, Hungerford DS. Radiographic

predictors of outcome of core decompression for hips with

osteonecrosis stage III. Clin Orthop Relat Res. 1998;354:159–

168.

20. Nishi T, Sugano N, Miki H, Hashimoto J, Yoshiokawa H. Does

alendronate prevent collapse in osteonecrosis of the femoral

head? Clin Orthop Relat Res. 2006;443:273–279.

21. Nishi T, Sugano N, Ohzono K, Sakai T, Haraguchi K, Yoshikawa

H. Progression and cessation of collapse in osteonecrosis of the

femoral head. Clin Orthop Relat Res. 2002;400:149–157.

22. Ohzono K, Saito M, Takaoka K, Ono K, Saito S, Nishina T,Kadowaki T. Natural history of nontraumatic avascular necrosis


23. Shimizu K, Moriya H, Sakamoto M, Suguro T. Prediction of

collapse with magnetic resonance imaging of avascular necrosis.


24. Steinberg DR, Steinberg ME, Garino JP, Dalinka M, Udupa JK.

Determining lesion size in osteonecrosis of the femoral head.

J Bone Joint Surg Am. 2006;88(Suppl 3):27–34.



34–41.




27. Sugano N, Atsumi T, Ohzono K, Kubo T, Hotokebuchi T,

Takaoka K. The 2001 revised criteria for diagnosis, classification,

and staging of idiopathic osteonecrosis of the femoral head.

J Orthop Sci. 2002;7:601–605.

28. Sugano N, Ohzono K, Masuhara K, Takaoka K, Ono K. Prog-

nostication of osteonecrosis of the femoral head with systemic

lupus erythematosus by magnetic resonance imaging. Clin Ort-hop Relat Res. 1994;305:190–199.

29. Takatori Y, Kokubo T, Hinomiya S, Nakamura S, Morimoto S,

Kusaba I. Avascular necrosis of the femoral head. Natural history

and magnetic resonance imaging. J Bone Joint Surg Br.1993;75:217–221.


123


Do Modern Techniques Improve Core Decompression Outcomesfor Hip Osteonecrosis?

David R. Marker BS, Thorsten M. Seyler MD,

Slif D. Ulrich MD, Siddharth Srivastava BA,

Michael A. Mont MD


Abstract Core decompression procedures have been used

in osteonecrosis of the femoral head to attempt to delay the

joint destruction that may necessitate hip arthroplasty. The

efficacy of core decompressions has been variable with

many variations of technique described. To determine

whether the efficacy of this procedure has improved during

the last 15 years using modern techniques, we compared

recently reported radiographic and clinical success rates to

results of surgeries performed before 1992. Additionally,

we evaluated the outcomes of our cohort of 52 patients

(79 hips) who were treated with multiple small-diameter

drillings. There was a decrease in the proportion of patients

undergoing additional surgeries and an increase in radio-

graphic success when comparing pre-1992 results to

patients treated in the last 15 years. However, there were

fewer Stage III hips in the more recent reports, suggesting

that patient selection was an important reason for this

improvement. The results of the small-diameter drilling

cohort were similar to other recent reports. Patients who had

small lesions and were Ficat Stage I had the best results with

79% showing no radiographic progression. Our study

confirms core decompression is a safe and effective pro-

cedure for treating early stage femoral head osteonecrosis.

Level of Evidence: Level IV, therapeutic study (see the


of evidence).

Introduction

Various techniques for performing core decompression

have been used to save the osteonecrotic femoral head.

There is also considerable disagreement as to the degree of

efficacy of this procedure, how it might help, and the level

of influence of various patient factors (such as a history of

alcohol abuse or smoking, corticosteroid use, as well as

underlying diagnoses such as systemic lupus erythematosus

or sickle cell anemia) and radiographic lesion character-

izations (such as presence or degree of collapse, lesion size

or location).

The technique of performing core decompression has

varied in terms of surgical approaches, number of drillings,

and the diameter of the trephines. A number of authors

have advocated the use of small-diameter percutaneous

drilling and believe that it as effective as large-diameter

core decompression procedures [56, 73, 95]. Some authors

have supplemented core decompression with electrical

stimulation [79] or growth and differentiation factors [19,

24, 82]. Other studies have reported adjunctive vascular-

ized [96] and/or nonvascularized bone grafting [35, 63].

Vascularized fibular grafting is essentially a large core

decompression procedure with the introduction of a vas-

cularized fibula, ilium, or trochanteric bone on a more local

pedicle. While vascularized and nonvascularized long

cortical strut bone grafting approaches could be considered

variations of core decompression procedures, we believe








D. R. Marker, T. M. Seyler, S. D. Ulrich, S. Srivastava,

M. A. Mont (&)

Rubin Institute of Advanced Orthopedics, Center for Joint

Preservation and Reconstruction, Sinai Hospital of Baltimore,

2401 West Belvedere Avenue, Baltimore, MD 21215, USA

e-mail: [email protected]; [email protected]

123


DOI 10.1007/s11999-008-0184-9

these procedures are sufficiently different that they should

be considered as alternate approaches, rather than varia-

tions of core decompression and will not be considered in

this study.

The primary question we asked was whether the efficacy

of core decompression, measured in terms of decreased

proportion of patients having additional surgeries or

showing radiographic progression to collapse, has

improved during the last 15 years using modern tech-

niques. Using these same measures of efficacy, we also

asked whether modern core decompression techniques

provide better outcomes than those reported in studies

using non-operative treatment. Secondary questions were:

(1) whether the clinical and radiographic outcomes of hip

osteonecrosis patients who were treated using a recently

developed small-diameter drilling core decompression

technique were similar to other modern studies; and (2)

whether patients who had less radiographic progression and

smaller lesion sizes at the time of treatment using small-

diameter drilling would be less likely to have poor out-

comes with subsequent collapse and the need for additional

more invasive surgeries.


We systematically reviewed the literature on the Medline

and EMBASE bibliographic databases that were related to

core decompression and osteonecrosis of the hip. The ini-

tial search parameters used to identify potentially relevant

articles were ‘‘necrosis and hip and decompression.’’ We

then searched bibliographies of review articles for any

additional relevant studies. Two of us (DRM, TMS)

screened all articles according to a previously defined

protocol [94]. The following inclusion/exclusion criteria

were used: (1) The report provided radiographic outcomes

and/or indicated whether patients underwent additional

surgeries following an initial core decompression for the

treatment of osteonecrosis of the hip; (2) We excluded

reports that did not provide sufficient data to analyze out-

comes or involved fewer than 10 patients, for example a

report of a single patient treated with a powered core

decompression [50]; (3) Only the most recent studies were

included for patient cohorts reported at multiple times at

different followups; (4) Although some reports included

patients who were younger than 18 years old, we excluded

studies that focused only on adolescent patients [84]; (5)

We did not include reports that used long cortical strut

bone grafting or vascularized bone grafting. We did include

studies that reported the use of ancillary cancellous bone

grafting such as the technique reported by Steinberg et al.

[82]; (6) Studies with a mean followup of less than

18 months were excluded (see below for this exclusion

rationale) [10, 40, 44, 65, 91]; (7) We also included the

previously unpublished results of patients at our institution

that were treated using a small-diameter drilling technique.

The criteria, which required a minimum mean 18-month

followup for study inclusion, were used because it was

believed unreasonable to consider shorter term followups

when trying to assess efficacy and ‘‘failure’’ of these pro-

cedures. Eighteen months was utilized as approximately

one standard deviation above the mean time to collapse of

multiple studies (11 months). It can be difficult to deter-

mine the exact time to femoral head collapse, which may

predict when a patient needs a hip replacement. This could

occur fairly soon or months after head collapse when the

patients’ hips become more symptomatic. An example of a

study with data for mean time to collapse was from our

patients who had percutaneous drilling. In this study

patients had a mean time to detected femoral head collapse

of 11 months which led to needing a total hip replacement

at a mean of 14 months. For the purpose of this report, we

used the mean of 11 months plus one standard deviation

(6.9 months) to determine the previously noted minimum

mean followup of 18 months for the studies in our litera-

ture review.

We made an attempt to stratify all studies that met our

inclusion/exclusion criteria into two groups according to

when the reported procedures were performed: before

1992, and from 1992 to 2007. When the dates of surgery

were not specifically noted in the study, the followup and

year the study was published were used to estimate the

period in which the surgeries were performed. Some

studies reported procedures both before and after 1992. For

these studies, attempts were made to subgroup each patient

according to when the procedure was performed. However,

because it was impossible to stratify the patients for some

reports, we categorized these studies by when the majority

of the patients were treated. There were five studies clas-

sified as pre-1992 based on these criteria [7, 52, 54, 70, 82].

For each report included in this study, the level of evi-

dence was determined using the Clinical Orthopaedics and

Related Research guidelines [14]. The demographic data

fields analyzed included: etiology/associated risk factors,

age, followup, and preoperative stage of the disease as

defined by Ficat [18]. The outcome parameters collected

for each report were the number and percentage of addi-

tional surgeries and radiographic failures. Additional

surgeries were only included if they were directly related to

progression of the osteonecrosis. For example, if a patient

had an evacuation of a hematoma it would not have been

included as a case that underwent additional surgery. Due

to the variability in the modalities used in the studies to

assess radiographic outcomes (Fig. 1), progression to col-

lapse or advancement after collapse was defined as

radiographic failure for this study (Table 1). Radiographic

1094 Marker et al. Clinical Orthopaedics and Related Research

123

outcomes were excluded for studies that did not indicate

whether radiographic progression was to collapse [15, 41,

42, 70, 71] or if success was defined only in terms of a

combination of radiographic and clinical failure without

stratification [88, 97]. An attempt was made to also

compare reported clinical outcomes. However, it was

determined that the question of whether there were any

differences was unanswerable using the literature given the

variability and the inconsistency in clinical evaluation

criteria used by the studies (Fig. 2).

We identified 47 studies that reported on the outcome of

core decompression in hip osteonecrosis and met our

inclusion criteria. Approximately half (25 of 47, 53%) of

these reports were Level of Evidence IV, and 6% (n = 3)

were conducted at Level I (Fig. 3). Alcohol abuse and

corticosteroid usage were the most frequently cited risk

factors (Fig. 4). Overall, there were 2,605 hips treated with

core decompression. From studies reporting relevant

demographic data, the mean age for patients was 39 years

(range, 12–83 years), and the minimum followup was

1 month (mean, 64 months; range, 1–216 months).

While we do not consider withholding surgery an

appropriate option based on previous studies showing

outcomes that are less efficacious than interventional pro-

cedures used at our institution [51], we recognize that some

physicians continue to utilize nonoperative treatment

methods. To compare the results of core decompression to

a baseline of natural progression, we conducted a separate

literature search using the same criteria to identify a group

of patients who were treated by nonoperative measures.

Because the purpose of this review was to assess natural

Fig. 1 The Ficat and Arlet system [18] has historically been the most

frequently used staging modality. However, as noted in this graph, a

large percentage of recent core decompression studies have reported

using various other radiographic staging systems such as the

Pennsylvania [81], ARCO [55], and Ohzono classifications [60].

Fig. 2 This figure provides the percentage of studies that used

various clinical assessment modalities. The Harris hip score [22] and

the Merle d’Aubigne-Postel scale [49] were the two most common

evaluation methods used to assess clinical outcomes.

Fig. 3 The studies reviewed in our meta-analysis were grouped

according to their levels of evidence [14], and the proportion of

studies for each level is presented in this chart. There have been

relatively few randomized, prospective studies concerning osteone-

crosis of the hip, and the majority of the reports have been level of

evidence IV.

Table 1. Criteria for assessing effectiveness of core decompressions

Measure Inclusion/exclusion criteria Examples

Additional surgery 1. Include additional surgeries associated with

progression of osteonecrosis.

Total hip arthroplasty, vascularized bone

grafting, osteotomy

2. Exclude surgeries not directly related to long-term

failure of core decompression.

Evacuation of a hematoma

Radiographic failure 1. Include progression to collapse. Progression from Ficat II to III.

2. Include progression from collapse to further

stage of degeneration.

Progression from Steinberg IV to V.

3. Exclude progression without collapse.� Progression from ARCO I to II.

� Studies that only indicated ‘‘progression’’ in stage without indicating whether the progression was to collapse were excluded from our analysis.

Volume 466, Number 5, May 2008 Modern Core Decompression Techniques 1095

123

progression, we excluded nonoperative treatment modali-

ties using external electrical therapy, ultrasound therapy, or

pharmacological agents [39, 78, 90]. The mean age for

these studies was 38 years (range, 13–79 years) and the

minimum followup was 3 months (mean, 54 months;

range, 3–240 months). The same outcome data was col-

lected for these studies as for the review of core

decompression reports.

From our institution, we identified 52 consecutive

patients (79 hips) who had a core decompression utilizing a

multiple small-diameter drilling (3.2–3.4 mm) technique

with a minimum followup of 36 months (mean, 65 months;

range, 36–81 months). The surgical technique used for

these patients and the initial short-term followup of the first

45 hips was previously reported [56]. The most common

risk factors in this cohort of patients were corticosteroids

(n = 47 hips), tobacco abuse (n = 26 hips), and systemic

lupus erythematosus (n = 20 hips) with some hips having

multiple risk factors. Patients were assessed preoperatively

and at final followup using the Harris hip score [22] and the

Ficat and Arlet staging system [18] for clinical and radio-

graphic evaluations, respectively. Additionally, lesion size

was measured using the combined necrotic angle as

described by Kerboul et al. [34]. For Stage I hips or patients

in whom the lesion was not seen on radiographs, magnetic

resonance imaging was used to determine the lesion size.

Patients with collapse (Ficat Stage III or greater) were not

candidates for this procedure. The radiographic evaluations

were conducted by two of the authors (TMS, SDU). We

evaluated the overall effectiveness of the small-diameter

core decompression technique by combining the results of

our study with those of a previously published small-

diameter drilling study by Song et al. [73] and compared the

proportions of patients who had radiographic failures or

underwent additional surgeries to the outcomes of the other

modern studies published since 1992.

To address the specific questions asked in this study, we

compared the following groups: (1) procedures before

1992; (2) procedures from 1992 forward; (3) reports of

nonoperative treatment; and (4) reports using the multiple

small-diameter drilling technique. The number and per-

centage of additional surgeries and radiographic failures

were stratified by Ficat stage when possible. For our per-

cutaneous multiple small-diameter drilling cohort we also

stratified the results by lesion size. A chi-square analysis

was used to compare the differences in outcomes for all the

groups that were evaluated. The key variable used for the

power analysis was the difference in proportions of patients

who underwent additional surgery in the pre-1992 studies

compared to the studies from 1992 to 2007. A power

analysis was conducted to ensure the comparison of failure

rates was sufficiently powered (p \ 0.05; power: 80%) to

reveal the p values necessary to answer the primary

research questions in this study. Prior studies that reported

on comparisons of core decompression techniques were

assessed to determine a clinically justifiable and appropri-

ate effect size [1, 20]. Based on these studies and the

success rates of core decompression that we have seen at

our institution, we determined that we would need a min-

imum proportions sample size of 186 hips to identify an

improvement from 60 percent to 45 percent of patients

undergoing additional surgery. All comparisons were

conducted using 95% confidence intervals where a p value

of less than 0.05 was considered significant. We used SPSS

version 13.0 software (SPSS Inc, Chicago, IL) for all

analyses.

Results

Overall, the success rates were higher for the studies that

reported core decompressions performed during the last

15 years (Table 2) compared to procedures performed

before 1992 (Table 3). From these reports, there were 1337

hips treated before 1992 and 1268 hips since 1992. The

proportion of patients surviving without additional surgery

increased (p \ 0.001) from 59% (range, 29%–85%) in the

earlier studies to 70% (range, 39%–100%) in the more

recent reports. Similarly, the radiographic success also

increased (p = 0.027) from 56% (range, 0–94%) for the

pre-1992 cohort to 63% (range, 22%–90%). Stratification

by Ficat stage (Table 4) showed there were fewer

(p \ 0.001) patients who were Ficat Stage III after 1992.

The reports of nonoperative treatment (Table 5) had

higher proportions of failures compared to the core

decompression studies from 1992 to 2007. There were 791

hips in 18 studies between 1960 and 2007. In the studies

that reported relevant data, the proportion of patients who

underwent surgery by final followup at a mean of 67%

Fig. 4 The most frequently reported etiology/risk factors are listed

and the number of studies in our meta-analysis that reported the

outcomes of patients who were diagnosed with each of these factors is

noted.


123

(range, 14% to 91%) was statistically higher than the

modern reports (p \ 0.001). Similarly, the mean reported

radiographic failure rates at 72% (range, 41% to 100%)

were considerably higher (p \ 0.001). Only 164 natural

history patients were reported between 1992 and 2007,

although the clinical and radiographic failure rates were

similar between this group of patients and those evaluated

before 1992.

The results using the small-diameter drilling technique

at our institution combined with those reported by Song

et al. [73] were similar to other studies of the last 15 years

(Table 6). At our institution, there were 21 patients (27

hips, 34%) who underwent additional surgery. The distri-

bution of Harris hip scores by number of hips were: 25 (90

points or greater), 24 (80–89 points), seven (70–79 points),

and 23 (less than 70 points). Excluding the patients who

underwent additional surgery, the mean Harris hip score

was 89 points (range, 72–100 points). Two patients (three

hips) both had scores of 72 points but did not receive

additional treatment. The patient who had bilateral osteo-

necrosis reported moderate pain in both hips. The other

patient progressed from Ficat stage I to Ficat Stage II and

his reported pain scores increased from mild (30 points)

preoperatively to moderate (20 points) at final followup.

There were 27 hips (34%) that showed radiographic

progression of the disease to collapse following core

decompression.

Patients in our small-diameter drilling cohort with

higher Ficat stages and larger lesion sizes had increased

failure rates. The proportion of hips (n = 13, 59%) with a

large lesion (combined necrotic angle C 200�) that

underwent additional surgery was greater (p = 0.008) than

the proportion of hips (n = 14, 25%) that had small lesions

(a combined necrotic angle \ 200�) and underwent addi-

tional surgery. Similarly, the rate of additional surgery was

higher (p = 0.044) for hips that were Ficat Stage II (52%)

Table 2. Literature review of core decompression outcomes for 1992 to 2007 patient cohort studies

Author/Year Number of hips Months followup (range) Additional surgery (%) Radiographic failure (%)

Kane et al./1996 [33] 19 (24–60) 11 (58) 11 (58)

Markel et al./1996 [47] 54 (2–53) 26 (48) –

Chang et al./1997 [11] 84 57 (24 to 165) 22 (26) 59 (70)

Mazieres et al./1997 [48] 20 24 9 (45) 9 (45)

Powell et al./1997 [64] 34 48 9 (26) –

Iorio et al./1998 [30] 33 64 (24–120) 11 (33) 18 (55)

Scully et al./1998 [68] 98 (21–50) 52 (53) –

Chen et al./2000 [12] 27 28 (12–128) – 10 (37)

Lavernia and Sierra/2000 [41] 67 41 16 (24) –

Maniwa et al./2000 [46] 26 94 (53–164) 8 (31) –

Specchiulli et al./2000 [74] 20 67 4 (20) 4 (20)

Piperkovski/2001 [62] 39 48 4 (10) –

Yoon et al./2001 [97] 39 61 (24–118) 19 (49) –

Aigner et al./2002 [2] 45 69 (31–120) 7 (16) 12 (27)

Hernigou et al./2003a [23] 189 84 (60–132) 34 (18) 39 (21)

Wirtz et al./2003� [93] 51 (36–132) 18 (35) –

Gangji et al./2004a [20] 10 24 0 (0) 1 (10)

Gangji et al./2004 [20] 8 24 2 (25) 5 (63)

Lieberman et al./2004a [45] 17 53 (26–94) 3 (18) 3 (18)

Bellot et al./2005 [4] 31 (1–176) 19 (61) 19 (61)

Ha et al./2006 [21] 18 (50–96) – 14 (78)

Neumayr et al./2006 [59] 17 36 3 (18) –

Veillette et al./2006c [89] 58 24 (6–52) 9 (16) 16 (28)

Marker et al./2007b, �� 79 24 (20–39) 27 (34) 27 (34)

Shuler et al./2007c [69] 22 39 (27–59) 3 (14) 3 (14)

Song et al./2007b [73] 163 87 (60–134) 50 (31) –

Total 1268 63 (1–176)� 366 (30)�� 250 (37)¥

� Previous study not listed includes Wirtz et al. [92]; �� Results of the present study. Previous study not listed includes Mont et al. [56];� Weighted average follow-up; �� Data for total of 1223 hips; ¥ Data for total of 680 hips; a biologics; b multiple small diameter drilling;c tantalum; – = Data meeting our definition of additional surgery or radiographic failure was not available.


123

preoperatively, compared to Ficat Stage I (26%). The best

results were seen in patients who had small lesions and

Ficat Stage I prior to treatment with 79% of these hips

showing no radiographic stage progression.

Discussion

While core decompression is relatively commonly per-

formed for ON of the femoral head, the variations in

reported techniques and drilling procedures make it diffi-

cult to interpret the efficacy of these procedures. Some

recent reports using innovative techniques such as growth

and differentiation factors to fill the core decompression

tract suggest excellent results, although the literature con-

tains a wide variety of results. Because of the relatively

small number of procedures reported for each of these

studies reporting on varied techniques, we analyzed recent

techniques by comparing studies that reported procedures

that were performed before 1992 to reports that had

procedures between 1992 and 2007. The primary question

of our study was whether the outcomes reported in the

recent studies were better than those prior to 1992 in terms

of reduced proportions of patients having additional sur-

geries and/or showing radiographic signs of femoral head

collapse. Additionally, using these same measures, we

asked whether modern core decompression techniques

provided better outcomes than non-operative treatment.

One of the limitations of this study was the small

numbers of patients in many of the reports reviewed.

Another limitation was that in some cases it was difficult to

determine when the core decompressions were performed

in order to stratify the study as pre-1992 or 1992 to 2007.

However, we believe our approach of using the publication

date and the mean followup to estimate when procedures

were performed would correctly stratify the majority of the

studies that were close to our 1992 cutoff. In addition, there

were only midterm mean followups (range, 18 months to

144 months) for many studies, and the long-term outcome

of core decompression is unclear. Another limitation was

Table 3. Literature review of core decompression outcomes for pre-1992 patient cohort studies

Author/Year Number of hips Months follow-up (range) Additional surgery (%) Radiographic failure (%)

Solomon/1981 [72] 22 24 (6–48) 5 (23) –

Ficat/1985 [18] 133 114 (60–204) – 28 (21)

Camp and Colwell/1986 [9] 40 18 (3–40) 6 (15) 8 (20)

Hopson and Siverhus/1988 [28] 20 39 (12–78) 12 (57) –

Saito et al./1988 [67] 17 48 (24–168) – 9 (53)

Tooke et al./1988 [86] 45 36 (12–84) 16 (36) 16 (36)

Aaron et al./1989 [1] 50 26 28 (56) 32 (64)

Aaron et al./1989a [1] 56 27 18 (32) 22 (39)

Beltran et al./1990 [5] 34 23 (11–47) – 16 (47)

Trancik et al./1990a [87] 11 45 (24–60) 5 (45) 11 (100)

Kristensen et al./1991 [37] 18 39 (12–60) – 3 (17)

Stulberg et al./1991 [83] 28 27 8 (29) 21 (75)

Robinson and Springer/1993 [66] 19 48 3 (16) 4 (21)

Lafforgue et al./1993 [38] 27 46 – 17 (63)

Leder and Knahr/1993 [43] 47 44 (24–100) 9 (19) 11 (23)

Holman et al./1995 [27] 31 (18–67) 14 (45) 8 (40)*

Koo et al./1995 [36] 18 (minimum 24) – 14 (78)

Smith et al./1995 [71] 114 40 (24–78) 64 (56) –

Mont et al./1997� [52] 79 144 (48–216) 37 (47) –

Mont et al./1998 [53] 68 144 (48–216) 48 (71) 48 (71)

Bozic et al./1999 [7] 54 120 (24–196) 28 (52) 34 (62)

Simank et al./1999 [70] 94 72 (18–180) 32 (34) –

Steinberg et al./2001��,a [82] 312 48 (3–155) 113 (36) –

Total 1337 65 (3–216)� 446 (41)�� 302 (44)¥

* Radiographic outcomes were only provided for 20 hips; � Previous studies not listed include Hungerford and Zizic [29] and Fairbank et al. [17];�� Other studies not listed include Steinberg et al. [75, 77–80] and Israelite et al. [31]; � Weighted average follow-up; �� Data for total of 1090

hips; ¥ Data for total of 685 hips; a core decompression combined with electrical stimulation; – = Data meeting our definition of additional

surgery or radiographic failure was not available.


123

the level of evidence for the scientific literature reviewed.

As previously noted, most of the studies were Level IV and

there were few Level I studies. There is a need for more

prospective randomized multicenter studies that further

analyze some of these newer techniques which will need

longer followup and larger patient numbers in the future.

Additionally, if standardized clinical and radiographic

evaluation criteria were adopted, future meta-analyses

could provide more valid comparisons across studies. The

limitations of our assessment of the percutaneous multiple

small-diameter drilling technique were similar to those of

other studies: a limited number of patients from a single

center, no long-term followup, and lack of a randomized

control group. Nevertheless, we do not believe these lim-

itations detract from the overall results of the present study,

as in general, the results of all of the different techniques

were somewhat comparable and appear better than the

natural history.

The meta-analysis and our cohort of multiple small-

diameter drilling patients suggest that core decompression

provides fewer treatment failures than nonoperative treat-

ment. Although there are improvements in overall success

rates for the procedures performed from 1992 to present,

the stratification of the meta-analysis data by Ficat stage

suggests that patient selection may have been the primary

reason for this gain as there were fewer Ficat Stage III

patients in the later studies. However, based on the

improvements in clinical outcomes for Ficat Stage II hips,

it appears that modern core decompression techniques did

provide improved outcomes for some subsets of patients.

The literature review (Table 2) suggests patients who

have hips with Ficat Stage III disease are more likely to

have radiographic progression, clinical failure, and have

additional surgeries, suggesting these patients may not be

appropriate candidates for this procedure. Although there

appears to have been increased patient selectivity in the

past 15 years in terms of fewer Ficat Stage III hips being

treated with core decompressions, a number of surgeons

continue to use this procedure. Based on the literature

review, there were 132 patients (18% of all patients in

studies after 1992 that stratified hips by Ficat stage) who

were Stage III and treated using core decompression. These

patients were included in 9 of the 35 studies (26%) after

1992. A recent study by Tingart et al. [85] reported similar

results. They reported 11% of surgeons they surveyed used

core decompression for patients who were Ficat Stage III

or IV. While some surgeons may be using core decom-

pression only as a pain-relieving procedure or assessing the

potential efficacy of modern techniques in Stage III hips,

we continue to recommend that other treatment options

such as total hip arthroplasty or resurfacing be used for

these difficult to treat patients.

Our own data from patients in whom we used small-

diameter multiple drilling also confirms that the prognosis

is influenced by the extent of the lesion size (Table 3).

These results are similar to a prospective study of 73 hips

by Steinberg et al. [76] which evaluated the effect of lesion

size on the outcome of core decompression. They defined

three groups based on lesion size: small, less than 15% of

femoral head involvement; medium, 15% to 30%; and

large, greater than 30%. The difference between the per-

centage of patients who had small lesions and later

underwent total hip arthroplasty (7%) was lower than

patients with large lesions (33%) who received a total hip

arthroplasty.

The overall success rate of our cohort of small-diameter

multiple drilling patients was similar to two other recent

studies that used a similar technique. In one of these

studies, Yan et al. [95] reported an improvement in Harris

hip score from a mean of 58 points (range, 46–89 points)

preoperatively to a mean of 86 points (range, 70–94 points)

at a minimum 2-year followup. In the other study by Song

et al. [73], 79% of patients who had Ficat Stage I disease

had no additional surgery at a minimum 5-year followup.

The rationale and advantages for the small-diameter dril-

ling presented in these prior studies were that: (1) the small

diameter drill can more easily reach the anterior portion of

Table 4. Comparison of historical and modern core decompression

studies

Data* Studies prior

to 1992

Studies from

1992 to 2007

p-Value

Demographic variables

Mean age (range) 39 (15–83)

years

39 (13–72)

years

–

Mean followup (range) 65 (3–216)

months

63 (1–176)

months

–

Preoperative ficat stage

Ficat Stage I 32% 29% 0.302

Ficat Stage II 42% 52% \ 0.001�

Ficat Stage III 27% 19% \ 0.001�

Outcomes

Additional surgery

Overall 41% 30% \ 0.001�


Ficat Stage II 44% 35% 0.056

Ficat Stage III 67% 66% 0.939

Radiographic failure

Overall 44% 37% \ 0.001�


Ficat Stage II 47% 48% 0.887

Ficat Stage III 66% 50% 0.708

* Some studies did not stratify by Ficat stage and/or report both

outcome measures.� Values were statistically significant.


123

the femoral head, an area frequently involved in osteone-

crosis; (2) there is minimal morbidity; (3) the risk of

weakening or penetrating the femoral head and injuring the

articular cartilage when using a large-diameter trephine for

multiple drillings is potentially reduced; and (4) the risk of

stress risers that can lead to a subtrochanteric fracture is

also reduced.

The literature review and our data suggest recent

techniques provide better clinical scores or radiographic

outcomes than pre-1992 studies of core decompression.

However, it is unclear whether this improvement is due

to improved patient selection or surgical technique. At a

minimum, the additional accumulation of successful

reports in the last decade confirms that core decompression

is a safe and effective procedure for the treatment of early

stages of osteonecrosis of the femoral head. Based on the

results of our experience as well as other studies, we will

use core decompression to treat patients who have early

small- and medium-sized lesions and are Ficat Stage I or II.

Additionally, the midterm followup of the multiple small-

diameter core decompression patients at our institution

was longer than most studies, and had a success rate similar

to or higher than other reports, which makes this technique

the authors’ preferred modality. However, prospective,

randomized studies are recommended to verify these

observations before this technique can be recommended as

a standard for practicing surgeons.

References

1. Aaron RK, Lennox D, Bunce GE, Ebert T. The conservative

treatment of osteonecrosis of the femoral head. A comparison of

core decompression and pulsing electromagnetic fields. ClinOrthop Relat Res. 1989;249:209–218.

2. Aigner N, Schneider W, Eberl V, Knahr K. Core decompression

in early stages of femoral head osteonecrosis–an MRI-controlled

study. Int Orthop. 2002;26:31–35.

3. Bassett CA, Schink MM, Mitchell SN. Treatment of osteone-

crosis of the hip with specific, pulsed electromagnetic fields

(PEMFs): a preliminary clinical report. In: Arlet J, Ficat RP,

Table 6. Multiple small-diameter drilling compared to other modern

studies

Data Small-diameter

technique

Other 1992–2007

studies

p Value

Demographics

Number of hips 242 1026 –

Mean age (range) 39 (18–72) 39 (12–71) –

Mean followup (range) 80 (36–134) 58 (1–176) –

Outcomes

Additional surgery 32% 29% 0.520

Radiographic failure 34% 37% 0.437

Table 5. Literature review of nonoperative treatment outcomes

Author/Year Number of hips Months followup (range) Additional surgery (%) Radiographic failure (%)

Coste et al./1965 [16] 100 24 – 73 (73)

Merle d’Aubigne et al./1965 [49] 90 36 (12–48) – 61 (68)

Boettcher et al./1970 [6] 5 (minimum 24) – 4 (80)

Zizic and Hungerford/1985 [98] 15 44 – 13 (87)

Musso et al./1986� [58] 50 30 34 (68) 41 (82)

Steinberg et al./1989 [79] 55 21 (6–120) 46 (84) –

Churchill and Spencer/1991 [13] 18 60 9 (50) 8 (44)

Ohzono et al./1991 [61] 115 63 – 78 (68)

Stulberg et al./1991 [83] 22 27 20 (91) 11 (50)

Robinson and Springer/1993 [66] 16 39 (24–61) 7 (44) 9 (56)

Bradway and Morrey/1993 [8] 15 23 (3–66) 13 (87) 15 (100)

Koo et al./1995 [36] 19 (minimum 24) – 15 (79)

Jergesen et al./1997 [32] 19 111 (51–81) 11 (58) 7 (41)*

Lai et al./2005 [39] 25 24 17 (68) 19 (76)

Ha et al./2006 [21] 19 (50–96) – 15 (79)

Hernigou et al./2006�� [26] 121 168 (120–240) 91 (75) 93 (77)

Neumayr et al./2006 [59] 21 36 3 (14) –

Morse et al./2007 [57] 67 23 (17–31) 20 (30) –

Total 792 53 (3–240)� 271 (63)�� 455 (72)¥

* Radiographs were only available for 17 patients; � Previous study not listed includes Bassett et al. [3]; �� Previous studies not listed include

Hernigou et al. [23, 25]; � Weighted average follow-up; �� Data for total of 429 hips; ¥ Data for total of 630 hips; – = Data meeting our definition

of additional surgery or radiographic failure was not available.


123

Hungerford DS (eds). Bone Circulation. Baltimore, MD: William

and Wilkins; 1984:343–354.

4. Bellot F, Havet E, Gabrion A, Meunier W, Mertl P, de Lestang

M. Core decompression of the femoral head for avascular

necrosis [in French]. Rev Chir Orthop Reparatrice Appar Mot.2005;91:114–123.

5. Beltran J, Knight CT, Zuelzer WA, Morgan JP, Shwendeman LJ,

Chandnani VP, Mosure JC, Shaffer PB. Core decompression for

avascular necrosis of the femoral head: correlation between long-

term results and preoperative MR staging. Radiology.

1990;175:533–536.

6. Boettcher WG, Bonfiglio M, Smith K. Non-traumatic necrosis of

the femoral head. II. Experiences in treatment. J Bone Joint SurgAm. 1970;52:322–329.

7. Bozic KJ, Zurakowski D, Thornhill TS. Survivorship analysis of

hips treated with core decompression for nontraumatic osteone-

crosis of the femoral head. J Bone Joint Surg Am. 1999;81:200–209.

8. Bradway JK, Morrey BF. The natural history of the silent hip

in bilateral atraumatic osteonecrosis. J Arthroplasty. 1993;8:

383–387.

9. Camp JF, Colwell CW Jr. Core decompression of the femoral head

for osteonecrosis. J Bone Joint Surg Am. 1986;68:1313–1319.

10. Chan TW, Dalinka MK, Steinberg ME, Kressel HY. MRI

appearance of femoral head osteonecrosis following core decom-

pression and bone grafting. Skeletal Radiol. 1991;20:103–107.

11. Chang MC, Chen TH, Lo WH. Core decompression in treating

ischemic necrosis of the femoral head. Zhonghua Yi Xue Za Zhi(Taipei). 1997;60:130–136.

12. Chen CH, Chang JK, Huang KY, Hung SH, Lin GT, Lin SY.

Core decompression for osteonecrosis of the femoral head at pre-

collapse stage. Kaohsiung J Med Sci. 2000;16:76–82.

13. Churchill MA, Spencer JD. End-stage avascular necrosis of bone

in renal transplant patients. The natural history. J Bone Joint SurgBr. 1991;73:618–620.

14. Clinical Orthopaedics and Related Research. Author Resources.

Available at: http://edmgr.ovid.com/corr/accounts/ifauth.htm.

Accessed April 1, 2007.

15. Coleman BG, Kressel HY, Dalinka MK, Scheibler ML, Burk DL,

Cohen EK. Radiographically negative avascular necrosis: detec-

tion with MR imaging. Radiology. 1988;168:525–528.

16. Coste F, Merle DAR, Postel M, Massias P, Gueguen J, Grellat P.

Course of primary osteonecrosis of the femoral head (pon) and

therapeutic prospects [in French]. Presse Med. 1965;73:263–267.

17. Fairbank AC, Bhatia D, Jinnah RH, Hungerford DS. Long-term

results of core decompression for ischaemic necrosis of the




19. Gangji V, Hauzeur JP. Treatment of osteonecrosis of the femoral

head with implantation of autologous bone-marrow cells. Surgi-

cal technique. J Bone Joint Surg Am. 2005;87 Suppl 1:106–112.

20. Gangji V, Hauzeur JP, Matos C, De Maertelaer V, Toungouz M,

Lambermont M. Treatment of osteonecrosis of the femoral head

with implantation of autologous bone-marrow cells. A pilot


21. Ha YC, Jung WH, Kim JR, Seong NH, Kim SY, Koo KH. Pre-

diction of collapse in femoral head osteonecrosis: a modified

Kerboul method with use of magnetic resonance images. J BoneJoint Surg Am. 2006;88 Suppl 3:35–40.




23. Hernigou P, Bachir D, Galacteros F. The natural history of

symptomatic osteonecrosis in adults with sickle-cell disease.


24. Hernigou P, Beaujean F. Treatment of osteonecrosis with autol-

ogous bone marrow grafting. Clin Orthop Relat Res. 2002;405:

14–23.

25. Hernigou P, Galacteros F, Bachir D, Goutallier D. Deformities of

the hip in adults who have sickle-cell disease and had avascular

necrosis in childhood. A natural history of fifty-two patients.





27. Holman AJ, Gardner GC, Richardson ML, Simkin PA. Quanti-

tative magnetic resonance imaging predicts clinical outcome of

core decompression for osteonecrosis of the femoral head.

J Rheumatol. 1995;22:1929–1933.

28. Hopson CN, Siverhus SW. Ischemic necrosis of the femoral head.

Treatment by core decompression. J Bone Joint Surg Am. 1988;

70:1048–1051.


necrosis of the femoral head. Early diagnosis and treatment. ClinOrthop Relat Res. 1978;130:144–153.

30. Iorio R, Healy WL, Abramowitz AJ, Pfeifer BA. Clinical outcome

and survivorship analysis of core decompression for early osteo-

necrosis of the femoral head. J Arthroplasty. 1998;13:34–41.

31. Israelite C, Nelson CL, Ziarani CF, Abboud JA, Landa J, Stein-

berg ME. Bilateral core decompression for osteonecrosis of the


32. Jergesen HE, Khan AS. The natural history of untreated asymp-

tomatic hips in patients who have non-traumatic osteonecrosis.


33. Kane SM, Ward WA, Jordan LC, Guilford WB, Hanley EN Jr.

Vascularized fibular grafting compared with core decompression

in the treatment of femoral head osteonecrosis. Orthopedics.

1996;19:869–872.




35. Kim SY, Kim YG, Kim PT, Ihn JC, Cho BC, Koo KH. Vascu-

larized compared with nonvascularized fibular grafts for large

osteonecrotic lesions of the femoral head. J Bone Joint Surg Am.

2005;87:2012–2018.

36. Koo KH, Kim R, Ko GH, Song HR, Jeong ST, Cho SH. Pre-

venting collapse in early osteonecrosis of the femoral head. A

randomised clinical trial of core decompression. J Bone JointSurg Br. 1995;77:870–874.

37. Kristensen KD, Pedersen NW, Kiaer T, Starklint H. Core

decompression in femoral head osteonecrosis. 18 Stage I hips

followed up for 1–5 years. Acta Orthop Scand. 1991;62:113–114.

38. Lafforgue P, Dahan E, Chagnaud C, Schiano A, Kasbarian M,

Acquaviva PC. Early-stage avascular necrosis of the femoral

head: MR imaging for prognosis in 31 cases with at least 2 years

of followup. Radiology. 1993;187:199–204.

39. Lai KA, Shen WJ, Yang CY, Shao CJ, Hsu JT, Lin RM. The use

of alendronate to prevent early collapse of the femoral head in

patients with nontraumatic osteonecrosis. A randomized clinical


40. Lausten GS, Mathiesen B. Core decompression for femoral head

necrosis. Prospective study of 28 patients. Acta Orthop Scand.

1990;61:507–511.

41. Lavernia CJ, Sierra RJ. Core decompression in atraumatic oste-

onecrosis of the hip. J Arthroplasty. 2000;15:171–178.

42. Learmonth ID, Maloon S, Dall G. Core decompression for early

atraumatic osteonecrosis of the femoral head. J Bone Joint SurgBr. 1990;72:387–390.

43. Leder K, Knahr K. Results of medullary space decompression in

the early stage of so-called idiopathic femur head necrosis [in

German]. Z Orthop Ihre Grenzgeb. 1993;131:113–119.


123

http://edmgr.ovid.com/corr/accounts/ifauth.htm

44. Li YZ, Yue T. Diagnosis and treatment of idiopathic necrosis of

the femoral head. Proc Chin Acad Med Sci Peking Union MedColl. 1990;5:88–92.

45. Lieberman JR, Conduah A, Urist MR. Treatment of osteonecrosis

of the femoral head with core decompression and human bone

morphogenetic protein. Clin Orthop Relat Res. 2004;429:139–145.

46. Maniwa S, Nishikori T, Furukawa S, Kajitani K, Iwata A,

Nishikawa U, Ochi M. Evaluation of core decompression for

early osteonecrosis of the femoral head. Arch Orthop TraumaSurg. 2000;120:241–244.

47. Markel DC, Miskovsky C, Sculco TP, Pellicci PM, Salvati EA.

Core decompression for osteonecrosis of the femoral head. ClinOrthop Relat Res. 1996;323:226–233.

48. Mazieres B, Marin F, Chiron P, Moulinier L, Amigues JM,

Laroche M, Cantagrel A. Influence of the volume of osteone-

crosis on the outcome of core decompression of the femoral head.

Ann Rheum Dis. 1997;56:747–750.

49. Merle D’Aubigne R, Postel M, Mazabraud A, Massias P,

Gueguen J, France P. Idiopathic necrosis of the femoral head in

adults. J Bone Joint Surg Br. 1965;47:612–633.

50. Mihalko WM, Balos L, Santilli M, Mindell ER. Osteonecrosis

after powered core decompression. Clin Orthop Relat Res.

2003;412:77–83.

51. Mont MA, Carbone JJ, Fairbank AC. Core decompression versus

nonoperative management for osteonecrosis of the hip. ClinOrthop Relat Res. 1996;324:169–178.

52. Mont MA, Fairbank AC, Petri M, Hungerford DS. Core

decompression for osteonecrosis of the femoral head in systemic

lupus erythematosus. Clin Orthop Relat Res. 1997;334:91–97.

53. Mont MA, Jones LC, Einhorn TA, Hungerford DS, Reddi AH.

Osteonecrosis of the femoral head. Potential treatment with

growth and differentiation factors. Clin Orthop Relat Res.1998;355 Suppl:S314–335.

54. Mont MA, Jones LC, Pacheco I, Hungerford DS. Radiographic

predictors of outcome of core decompression for hips with oste-

onecrosis stage III. Clin Orthop Relat Res. 1998;354:159–168.

55. Mont MA, Marulanda GA, Jones LC, Saleh KJ, Gordon N,

Hungerford DS, Steinberg ME. Systematic analysis of classifi-

cation systems for osteonecrosis of the femoral head. J Bone JointSurg Am. 2006;88 Suppl 3:16–26.

56. Mont MA, Ragland PS, Etienne G. Core decompression of the

femoral head for osteonecrosis using percutaneous multiple

small-diameter drilling. Clin Orthop Relat Res. 2004;429:131–

138.

57. Morse CG, Mican JM, Jones EC, Joe GO, Rick ME, Formentini

E, Kovacs JA. The incidence and natural history of osteonecrosis

in HIV-infected adults. Clin Infect Dis. 2007;44:739–748.

58. Musso ES, Mitchell SN, Schink-Ascani M, Bassett CA. Results

of conservative management of osteonecrosis of the femoral

head. A retrospective review. Clin Orthop Relat Res.

1986;207:209–215.

59. Neumayr LD, Aguilar C, Earles AN, Jergesen HE, Haberkern

CM, Kammen BF, Nancarrow PA, Padua E, Milet M, Stulberg

BN, Williams RA, Orringer EP, Graber N, Robertson SM,

Vichinsky EP. Physical therapy alone compared with core

decompression and physical therapy for femoral head osteone-

crosis in sickle cell disease. Results of a multicenter study at a

mean of three years after treatment. J Bone Joint Surg Am.

2006;88:2573–2582.

60. Ohzono K, Saito M, Sugano N, Takaoka K, Ono K. The fate of

nontraumatic avascular necrosis of the femoral head. A radiologic

classification to formulate prognosis. Clin Orthop Relat Res.

1992:73–78.




62. Piperkovski T. Results of treatment in patients with nontraumatic

avascular necrosis of the femoral head by monitor assisted core

decompression. Rentgenol. Radiol. 2001;40:281–284.

63. Plakseychuk AY, Kim SY, Park BC, Varitimidis SE, Rubash HE,

Sotereanos DG. Vascularized compared with nonvascularized

fibular grafting for the treatment of osteonecrosis of the femoral

head. J Bone Joint Surg Am. 2003;85:589–596.

64. Powell ET, Lanzer WL, Mankey MG. Core decompression for

early osteonecrosis of the hip in high risk patients. Clin OrthopRelat Res. 1997;335:181–189.

65. Radke S, Kirschner S, Seipel V, Rader C, Eulert J. Treatment of

transient bone marrow oedema of the hip–a comparative study.

Int Orthop. 2003;27:149–152.

66. Robinson Jr. HJ, Springer JA. Success of core decompression in

the management of early stages of avascular necrosis: A four year

prospective study. Orthop Trans. 1993;16:707.

67. Saito S, Ohzono K, Ono K. Joint-preserving operations for idi-

opathic avascular necrosis of the femoral head. Results of core

decompression, grafting and osteotomy. J Bone Joint Surg Br.

1988;70:78–84.

68. Scully SP, Aaron RK, Urbaniak JR. Survival analysis of hips

treated with core decompression or vascularized fibular grafting

because of avascular necrosis. J Bone Joint Surg Am.

1998;80:1270–1275.

69. Shuler MS, Rooks MD, Roberson JR. Porous tantalum implant in

early osteonecrosis of the hip: preliminary report on operative,

survival, and outcomes results. J Arthroplasty. 2007;22:26–31.

70. Simank HG, Brocai DR, Strauch K, Lukoschek M. Core

decompression in osteonecrosis of the femoral head: risk-factor-

dependent outcome evaluation using survivorship analysis. IntOrthop. 1999;23:154–159.

71. Smith SW, Fehring TK, Griffin WL, Beaver WB. Core decom-

pression of the osteonecrotic femoral head. J Bone Joint Surg Am.

1995;77:674–680.

72. Solomon L. Idiopathic necrosis of the femoral head: pathogenesis

and treatment. Can J Surg. 1981;24:573–578.

73. Song WS, Yoo JJ, Kim YM, Kim HJ. Results of multiple drilling

compared with those of conventional methods of core decom-

pression. Clin Orthop Relat Res. 2007;454:139–146.

74. Specchiulli F. Core decompression in the treatment of necrosis of

the femoral head. Long-term results. Chir Organi Mov.

2000;85:395–402.

75. Steinberg ME. Core decompression of the femoral head for

avascular necrosis: indications and results. Can J Surg. 1995;38

Suppl 1:S18–24.

76. Steinberg ME, Bands RE, Parry S, Hoffman E, Chan T, Hartman

KM. Does lesion size affect the outcome in avascular necrosis?


77. Steinberg ME, Belmar CJ. Role of core decompression in the

treatment of avascular necrosis of the femoral head. CurrentOrthopaedics. 1997;11:173–178.

78. Steinberg ME, Brighton CT, Bands RE, Hartman KM. Capacitive

coupling as an adjunctive treatment for avascular necrosis. ClinOrthop Relat Res. 1990;261:11–18.





1989;249:199–208.







34–41.


123

82. Steinberg ME, Larcom PG, Strafford B, Hosick WB, Corces A,

Bands RE, Hartman KE. Core decompression with bone grafting

for osteonecrosis of the femoral head. Clin Orthop Relat Res.

2001;386:71–78.




84. Styles LA, Vichinsky EP. Core decompression in avascular

necrosis of the hip in sickle-cell disease. Am J Hematol.1996;52:103–107.

85. Tingart M, Bathis H, Perlick L, Lerch K, Luring C, Grifka J.

Therapy of femoral head osteonecrosis: results of a national

survey [in German]. Z Orthop Ihre Grenzgeb. 2004;142:553–558.

86. Tooke SM, Nugent PJ, Bassett LW, Nottingham P, Mirra J,

Jinnah R. Results of core decompression for femoral head oste-

onecrosis. Clin Orthop Relat Res. 1988;228:99–104.

87. Trancik T, Lunceford E, Strum D. The effect of electrical stim-

ulation on osteonecrosis of the femoral head. Clin Orthop RelatRes. 1990;256:120–124.

88. Van Laere C, Mulier M, Simon JP, Stuyck J, Fabry G. Core

decompression for avascular necrosis of the femoral head. ActaOrthop Belg. 1998;64:269–272.

89. Veillette CJ, Mehdian H, Schemitsch EH, McKee MD. Survi-

vorship analysis and radiographic outcome following tantalum

rod insertion for osteonecrosis of the femoral head. J Bone JointSurg Am. 2006;88 Suppl 3:48–55.

90. Wang CJ, Wang FS, Huang CC, Yang KD, Weng LH, Huang

HY. Treatment for osteonecrosis of the femoral head: comparison

of extracorporeal shock waves with core decompression and

bone-grafting. J Bone Joint Surg Am. 2005;87:2380–2387.

91. Warner JJ, Philip JH, Brodsky GL, Thornhill TS. Studies of

nontraumatic osteonecrosis. The role of core decompression in

the treatment of nontraumatic osteonecrosis of the femoral head.


92. Wirtz C, Zilkens KW, Adam G, Niethard FU. MRI-controlled

outcome after core decompression of the femur head in aseptic

osteonecrosis and transient bone marrow edema [in German].

Z Orthop Ihre Grenzgeb. 1998;136:138–146.

93. Wirtz DC, Rohrig H, Neuss M. Core decompression for avascular

necrosis of the femoral head. Oper Orthop Traumatol. 2003;15:

288–303.

94. Wright RW, Brand RA, Dunn W, Spindler KP. How to write a

systematic review. Clin Orthop Relat Res. 2007;455:23–29.

95. Yan ZQ, Chen YS, Li WJ, Yang Y, Huo JZ, Chen ZR, Shi JH, Ge

JB. Treatment of osteonecrosis of the femoral head by percuta-

neous decompression and autologous bone marrow mononuclear

cell infusion. Chin J Traumatol. 2006;9:3–7.

96. Yoo MC, Chung DW, Hahn CS. Free vascularized fibula grafting

for the treatment of osteonecrosis of the femoral head. ClinOrthop Relat Res. 1992;277:128–138.

97. Yoon TR, Song EK, Rowe SM, Park CH. Failure after core

decompression in osteonecrosis of the femoral head. Int Orthop.

2001;24:316–318.

98. Zizic TM, Hungerford DS. Avascular necrosis of bone. In: Kelley

WN, Harris ED, Ruddy S, Sledge CB (eds). Textbook of Rheuma-tology. Ed 2. Philadelphia, PA: WB Saunders Co; 1985:1689–1710.


123


Transtrochanteric Posterior Rotational Osteotomyfor Osteonecrosis

Yoichi Sugioka MD, PhD, Takuaki Yamamoto MD, PhD



Abstract When osteonecrosis is located in the mid- to

posterior region, we generally perform a transtrochanteric

posterior rotational osteotomy. We retrospectively

reviewed the clinical and radiographic results in 47 con-

secutive patients (51 hips) in whom we performed posterior

rotational osteotomies. The average age was 37 years at the

time of surgery. There were 30 male and 17 female patients.

Thirty-six hips were ARCO Stage III, and 15 were Stage IV.

Conversion to THA was defined as the failure end point.

Three patients died and one was lost to followup. We were

therefore able to follow 43 patients (46 of the 51 hips, or

90%) a minimum of 1.2 years (average, 12 years; range,

1.2–21 years). We used the Harris hip score for preopera-

tive and most recent followup. The average preoperative

Harris hip score of 52 points improved to an average of 84 at

the latest followup. Radiographically, the osteonecrosis in

30 hips (65%) had no progressive collapse, and 13 (28%)

showed osteoarthritic changes, but no patients underwent

THA. A posterior rotational osteotomy appears useful for

patients with extensive necrosis and advanced collapse.

Level of Evidence: Level IV, therapeutic study. See


of evidence.

Introduction

Once subchondral collapse occurs in osteonecrosis (ON) of

the femoral head, osteoarthritis subsequently develops [8,

14, 15]. ON occurs predominantly in the middle-aged

population. A higher risk of mechanical failure is reported

following THA in patients with osteonecrosis who are

younger than 50 years old than in age-matched osteoar-

thritis patients [11]. The best surgical treatment for

osteonecrosis thus remains to be determined in these

patients with collapse.

The natural history of ON depends on the location and

extent of the necrotic region [6, 10]. If the necrotic region

is located in the nonweightbearing middle part of the

femoral head, it will not collapse [6, 10]. Therefore, we

believe the principles of the treatment of ON are (1) to

eliminate the shear stress from the necrotic region and to

prevent a progression of collapse, and (2) to obtain joint

realignment of the femoral head subluxated due to col-

lapse. To satisfy these principles, transtrochanteric

rotational osteotomy was developed to transpose the

necrotic area to the nonweightbearing portion [15].

ON of the femoral head is generally located in the

anterosuperior aspect of the femoral head, in which the

posterior aspect of the femoral head is normal and has

smooth healthy articular cartilage. In these patients, several

authors recommend an anterior rotational osteotomy.

Clinical followup studies from several institutions suggest

this procedure has merit to preserve the joint [2, 3, 13, 15].

On the other hand, when ON is located in the mid- to

Each author certifies that he has no commercial associations (e.g.,

consultancies, stock ownership, equity interest, patent/licensing

arrangements, etc.) that might pose a conflict of interest in connection


Each author certifies that his or her institution has approved or waived

approval for the human protocol for this investigation and that all

investigations were conducted in conformity with ethical principles of

research.

Y. Sugioka (&), T. Yamamoto

Department of Orthopaedic Surgery, Graduate School of

Medical Sciences, Kyushu University, 3-1-1 Maidashi,

Higashi-ku, Fukuoka 812-8582, Japan


123


DOI 10.1007/s11999-008-0192-9

posterior portion, in which the intact area is located in the

anterior portion of the femoral head, a transtrochanteric

posterior rotational osteotomy is logical because this pro-

cedure transposes the necrotic area to the posterior

nonweightbearing portion [1, 13, 14].

We therefore asked whether posterior rotational osteot-

omy would preserve the joint as reflected in survival (with

conversion to THA as an endpoint), Harris hip scores, and

radiographic collapse or osteoarthritis. We further asked

whether the ARCO staging system would predict pro-

gressive osteoarthritis.


We retrospectively reviewed 47 consecutive patients (51

hips) with clinical and radiographic evidence of ON of the

femoral head treated by a posterior rotational osteotomy

from 1981 to 1996. We used a posterior rotational osteot-

omy in patients with: (1) the necrotic area in the posterior

portion of the femoral head; (2) an intact healthy area in the

anterior portion; and (3) a postoperative intact area ratio

over 34% after the posterior rotational osteotomy (Fig. 1)

[1, 8, 13]. During this same period we treated a total of 581

patients with ON with either other osteotomies (412) or

THA/hemiarthroplasty (169). Thirty patients were male

and 17 were female. Nine hips were ARCO Stage III-A, 13

Stage III-B, 14 Stage III-C, and 15 Stage IV [9]. One hip

was categorized as Type B, 15 Type C1 and 35 Type C2

[12]. The average age was 37 years at the time of surgery

(range, 9 to 58 years). The etiology of ON was idiopathic

in four hips, alcohol abuse in 12, trauma in 14, and corti-

costeroids in 21. Four patients (four hips) had bilateral

disease and underwent bilateral posterior rotational oste-

otomy. Three patients died and one was lost to followup.

This left 43 patients (46 hips) in the study. The minimum

followup was 1.2 years (mean, 12 years; range, 1.2 to

21 years).

The basic surgical procedure has remained unchanged

since it was described by one of the authors (YS) [13–15]

and all operations were performed by that surgeon. Briefly,

this procedure contains three osteotomies: (1) an osteotomy

of the greater trochanter; (2) an intertrochanteric osteotomy

which passes from superolateral to inferomedial on the AP

view; and (3) an osteotomy which passes from the proxi-

mal flare of the lesser trochanter inferolaterally towards the

inferomedial extent of the primary osteotomy. During these

osteotomies, preservation of the nutrient artery located in

the adipose tissue just beneath the quadratus femoris is

important. The degree of posterior rotation ranged from 90�to 180�, with an average of 105�, which was determined to

obtain a sufficient postoperative intact area (more than

34%). In three cases, 180� of posterior rotation was per-

formed because the intact area was very small and 180� of

posterior rotation was necessary to obtain a sufficient intact

area. In these three cases the postoperative scintigram

showed no uptake indicating insufficiency of blood supply

of the femoral head and these three were converted to THA

secondary to subcapital fracture (not osteoarthritic chan-

ges) within 1.6 years of posterior rotational osteotomy. We

therefore excluded these three cases from further analysis.

Postoperatively, the patients were nonweightbearing for

5 weeks, after which gradual weightbearing was permitted.

Full weightbearing was permitted after 6 months.

Followup radiographic and clinical examinations are

performed at 3 months, 6 months, and yearly thereafter. A

bone scintigram was routinely performed 5 weeks post-

operatively to confirm the blood supply to the rotated

femoral head. At each exam we (YS, TY) determined the

Harris hip score [4] including prior to the posterior rota-

tional osteotomy, before conversion to THA, and at the

most recent followup examination.

We (YS, TY) reviewed the preoperative and postoper-

ative radiographs to establish the size and location of the

necrotic lesion [12] and evidence of the progression of

collapse and/or development of osteoarthritis. Osteoar-

thritic changes were diagnosed based on the presence of

Fig. 1 Postoperative intact area ratio is the most important factor

influencing the results of a rotational osteotomy. This ratio is

expressed as C-D/A-B and should be over 34% after the rotational

osteotomy. Point A is an edge of the acetabulum and Point E is the

lowest point of the teardrop. Point B is determined by drawing a

perpendicular line from the midpoint of line of AE. Point C is the

lateral edge of the loaded portion and point D represents the medial

edge of the intact articular surface of the femoral head.

Volume 466, Number 5, May 2008 Rotational Osteotomy for Osteonecrosis 1105

123

joint space narrowing, osteophyte formation, and/or scle-

rotic changes in both the femoral head and acetabulum.

We defined conversion to THA as the end point of

failure of the posterior rotational osteotomy in the survival

analysis including the patients who died or were lost to

followup. We compared the preoperative Harris hip scores

with the last postoperative scores using a paired t-test. The

correlation between the preoperative ARCO stage and a

progression of osteoarthritis was assessed using the Mann-

Whitney U test. Among the etiologies of ON (steroids,

alcohol, trauma and idiopathic), both the postoperative

Harris hip score and a progression of osteoarthritis were

compared using one-way ANOVA and Fisher’s exact

probability test, respectively. Statistical analyses were

performed using the Stat View J-5.0 software package

(SAS Institute Inc, Cary, NC, USA).

Results

The overall rate of survival was 93%. Three patients

underwent THA, all for subcapital fracture in patients

having an osteotomy with 180 degrees rotation.

The average preoperative Harris hip score of 52.4 points

increased (p \ 0.0001) to an average of 83.7 points at the

latest followup. The average preoperative Harris hip score

for range of motion was 4.5 points, which was unchanged

at the latest followup. However, the other two factors of

pain and function improved after posterior rotational

osteotomy: pain from 15 to 36 points (p \ 0.0001) and

function from 29 to 39 points (p \ 0.0001).

We observed no progressive radiographic collapse in 30

hips (69.8%) (Fig. 2A–D). Thirteen hips (30.2%) developed

osteoarthritic changes. However, no patient underwent

THA due to progressive osteoarthritic changes.

The progression of osteoarthritis correlated (p = 0.0004)

with the preoperative ARCO stage. In the six early ARCO

Stage III-A cases there was no progression of osteoarthritis,

while in the advanced ARCO Stage IV cases, eight of the 12

cases progressed to osteoarthritis (Table 1). We observed

progression of osteoarthritis in three of 16 cases with ste-

roid-induced ON, three of 10 cases with alcohol-related

disease, six of 13 with traumatic ON, and one of four with

idiopathic ON. There was no difference in the rate among

etiologies (Table 2). We observed no differences in post-

operative Harris hip scores based on etiology or location of

ON (Type of ON).

Discussion

ON of the femoral head is generally located in the anter-

osuperior aspect of the femoral head, in which the posterior

Fig. 2A–D Posterior rotational osteotomy. (A) The preoperative

anteroposterior radiograph of a thirty-six-year-old man with preop-

erative ARCO Stage III-A is shown. The osteosclerotic line is seen in

the femoral head. (B) The preoperative lateral view indicates the

intact area in the anterior portion is wider than that in the posterior

portion. The arrows indicate the margin of the necrotic area. (C) A

radiograph obtained 1 year after the 90� posterior rotational osteot-

omy is shown. The postoperative intact area ratio is about 70%. (D) A

radiograph obtained 13 years after the operation shows no evidence of

a progression of collapse or the development of osteoarthritis. The

size of the necrotic area, which is surrounded by a sclerotic line, has

decreased (arrows), thus indicating a sufficient repair was obtained by

the rotational osteotomy.

Table 1. Summary of data according to the ARCO stage

ARCO

stage(pre-operation)

No. of hips Progression of osteoarthritis**

- +

III-A 6 6 0 (0%)

III-B 13 12 1 (8%)

III-C 12 8 4 (33%)

IV 12 4 8 (67%)

Total 43* 30 (70%) 13 (30%)

* Three cases in which 180� posterior rotation was performed are not

included, because all of them underwent a subcapital fracture within

1.6 years.

** Based on the Mann-Whitney U test, a significant correlation was

seen between the preoperative ARCO stage and the progression of

osteoarthritis.

1106 Sugioka and Yamamoto Clinical Orthopaedics and Related Research

123

aspect of the femoral head is relatively normal. In these

patients, some authors recommend an anterior rotational

osteotomy. On the other hand when ON is located in the

mid- to posterior portion, in which the intact area is located

in the anterior portion of the femoral head, a transtro-

chanteric posterior rotational osteotomy is logical. We

therefore asked whether posterior rotational osteotomy

would preserve the joint as reflected in survival (with

conversion to THA as an endpoint), Harris hip scores, and

radiographic collapse or osteoarthritis. We further asked

whether the ARCO staging system would predict pro-

gressive osteoarthritis.

The major limitation of this study is the small number of

patients, since most ON lesions are located in the anterior

portion of the femoral head, in which anterior rotational

osteotomy is considered. The large number of confounding

variables (e.g., stages, etiologies) and relatively small

numbers of patients preclude more complete analysis of

predictive variables and thus more clear indications. The

followup was limited to a minimum of 1.2 years but the

mean was 12 years with a range of 1.2–21 years. Many

patients who collapse and develop progressive osteoar-

thritis will not do so for a number of years and not by

1.2 years. However, the mean followup was 12 years, at

which time most patients with collapse would have been

detected.

Serial studies of patients administered corticosteroids

suggest ON can be asymptomatic (silent hip) and can heal

spontaneously if the lesion is located in the nonweight-

bearing area and if the articular surface is prevented from

collapsing [6, 7]. In addition, healing of ON has been

demonstrated in histopathologic investigations of femoral

heads removed from patients who have undergone rota-

tional osteotomy which transposed the necrotic area into

the nonweightbearing portion [13]. On the other hand,

if the osteonecrotic lesion is located in the major

weightbearing area, it will eventually undergo collapse,

and a collapsed femoral head tends to be subluxated an-

terolaterally, thus resulting in a further collapse. Once

collapse progresses, the reparative tissue is exposed to

greater mechanical stress which we suspect impairs the

reparative process [6, 10, 13].

Based on our experience we derive two important

principles in the treatment of ON of the femoral head. First

is to eliminate the shear forces from the necrotic focus,

which leads reduces the risk of progressive collapse and

enhances the repair process. The second is to realign the

femoral head subluxation that occurs due to the collapse of

the articular surface. A transtrochanteric rotational osteot-

omy, which transposes the necrotic area into a

nonweightbearing area, appears an effective method for

preventing collapse by diverting mechanical stress from the

lesion [8, 13, 14].

We have previously reported the outcomes of anterior

rotational osteotomy in 136 hips [5]. In that study, patients in

the early stages such as ARCO Stage II or III-A had a low

rate of conversion to THA (6.8%) over the long-term. On the

other hand, patients with ARCO Stage III-C and IV had

conversion rates of 21% and 24%, respectively. Thus, to

prevent long-term osteoarthritis, we believe an anterior

rotational osteotomy should be performed in the early stages

with minimum collapse such as ARCO Stage II or III-A.

In our current study, 30 hips (70%) had no progressive

collapse after posterior rotational osteotomy. Thirteen

(30%) had osteoarthritic changes but the preoperative

stages were advanced ARCO Stage III-C and IV in 12 of

these 13 hips. Nevertheless, no patient had conversion to

THA due to the progression of osteoarthritic changes even

in such advanced preoperative stages. These results seem

better than those after an anterior rotational osteotomy. An

anterior rotational osteotomy transposes the necrotic area

to the anterior portion. After the anterior rotation, the

Table 2. Summary of data according to the etiology of osteonecrosis

Etiology No. of hips Progression of

osteoarthritis**

Harris hip score (points) ARCO stage

Preop. Postop.*** III-A III-B III-C IV

Steroids 16 3 (19%) 50.8 80.8 3 6 3 4

Alcohol 10 3 (30%) 55.6 84.5 3 3 1 3

Trauma 13 6 (46%) 49.5 85.1 0 2 7 4

Idiopathic 4 1 (25%) 60.9 88.8 0 2 1 1

Total 43* 13 (30%) 52.4 83.7 6 13 12 12

* Three cases in which 180� posterior rotation was performed are not included, because all of them underwent a subcapital fracture within

1.6 years.

** Based on the Fisher’s exact probability test, no significant difference was seen in the progression of osteoarthritis among the etiologies of

osteonecrosis.

*** Based on the one-way analysis of variance, no significant difference was seen in the postoperative Harris hip score among the etiologies of

osteonecrosis.


123

collapsed lesion still exists in the anterior portion of the

joint. Therefore, hip instability, especially anterior to pos-

terior direction, cannot be solved, especially in patients

with advanced collapse. In addition, this collapsed lesion

may cause crepitus to the anterior edge of the acetabulum

when taking a flexion position. However, with a posterior

rotational osteotomy the collapsed joint surface is trans-

posed into the acetabulum, joint stability can be restored

(Fig. 3). The original anterior acetabular coverage, which

is generally difficult to ascertain on the AP view, can

enhance the weightbearing area, especially in patients with

posterior rotation (Fig. 4).

The most important factor affecting the results of a

rotational osteotomy is the postoperative intact area ratio,

which should be over 34% [8]. In order to evaluate the

exact intact area preoperatively, it is important to take a

precise lateral view of the femoral head with 90� of flexion

and 45� of abduction. The more flexion of the hip, the more

the inferior part of the femoral head can be seen on this

lateral view. By taking a lateral view over 90� of flexion,

one can identify the intact area located in the anteroinferior

part of the femoral head which will be transposed to the

weightbearing portion after a posterior rotational osteot-

omy over 90�.

We believe the indications for posterior rotational

osteotomy can be derived from our data. In every ARCO

stage, if the intact area is located in either the anterior

portion or located equally in the anterior or posterior por-

tion (Fig. 2B), then we consider a posterior rotational

osteotomy. In advanced ARCO stages, the indications for

posterior rotational osteotomy can be expanded. If the

intact area is located primarily in the posterior portion at

90� of hip flexion, then an anterior rotational osteotomy

may be considered. However, if the anterior intact area is

much wider with 120� of flexion, then we recommend a

120� posterior rotational osteotomy rather than a 90�anterior rotational osteotomy, in order to prevent osteoar-

thritic changes after the osteotomy.

Because the tension to the nutrient vessels decreases

after posterior rotation, the femoral head can be rotated

more than 100� (Fig. 3). However, the upper limit is

around 140� to 150�, because patients with 180� of pos-

terior rotation had cold lesions on postoperative scintigram

indicating insufficient blood supply to the femoral head,

and all later had a subcapital fracture necessitating THA. In

the posterior rotational osteotomy an anteversion angle

yields a valgus position after the osteotomy if the osteot-

omy line was determined without reducing the anteversion

angle. In addition, postoperative treatment should be

approached carefully because the posterior part of the bone,

not originally strong, is transposed to the calcar. Since this

procedure needs to obtain such bone remodeling at the

weight bearing portion as well as bone union at the oste-

otomy site, full weightbearing should not be started until at

least 6 months after the operation. This may cause an

extension of the hospitalization period. Atsumi et al. [1]

reported similarly encouraging results for posterior rota-

tional osteotomy in ON patients, in which the survival rate

was 78% at an average of 5 years.

Fig. 3 Posterior rotational osteotomy for the treatment of ON of the

femoral head. When ON is located mainly in the mid- to posterior

portion, a transtrochanteric posterior rotational osteotomy, which

transposes the necrotic area to the posterior nonweightbearing

portion, is considered. In this procedure, the collapsed joint surface

of the femoral head was transposed to the acetabulum, and thus joint

stability was obtained. In addition, because the tension to the nutrient

vessels decreases after the posterior rotation, the femoral head can be

rotated by more than 100�. The upper limit is around 140� to 150�.

Fig. 4 The sagittal CT image shows original anterior acetabular

coverage (arrow line), which is not generally visible on the AP

radiograph. This original anterior acetabular coverage can enhance

the intact weightbearing area, especially in patients with posterior

rotation.

1108 Sugioka and Yamamoto Clinical Orthopaedics and Related Research

123

In summary, when ON is located in the mid- to posterior

portion and the intact area is located in the anterior portion

of the femoral head a transtrochanteric rotational osteot-

omy appears to delay the need for THA in the majority of

patients.

References

1. Atsumi T, Muraki M, Yoshihara S, Kajihara T. Posterior rota-

tional osteotomy for the treatment of femoral head osteonecrosis.

Arch Orthop Trauma Surg. 1999;119:388–393.

2. Dean MT, Cabanela ME. Transtrochanteric anterior rotational

osteotomy for avascular necrosis of the femoral head. Long-term

results. J Bone Joint Surg Br. 1993;75:597–601.




4. Hasegawa Y, Sakano S, Iwase S, Iwasada S, Torii H, Iwata H.

Pedicle bone grafting versus transtrochanteric rotational osteot-

omy for avascular necrosis of the femoral head. J Bone Joint SurgBr. 2003;85:191–198.

5. Hosokawa A, Mohtai M, Hotokebuchi T, Jingushi S, Sugioka Y.

Transtrochanteric rotational osteotomy for idiopathic and steroid-

induced osteonecrosis of the femoral head: Indications and long-

term follow-up. In: Urbaniak JR, Jones JP, eds. Osteonecrosis:Etiology, Diagnosis, and Treatment. Rosemont, IL: American

Academy of Orthopaedic Surgeons; 1998:309–314.

6. Kokubo T, Takatori Y, Ninomiya S, Nakamura T, Kamogawa M.

Magnetic resonance imaging and scintigraphy of avascular

necrosis of the femoral head. Prediction of subsequent segmental

collapse. Clin Orthop Relat Res. 1992;277:54–60.

7. Kubo T, Yamazoe N, Sugano N, Fujioka M, Naruse S,

Yoshimura N, Oka T, Hirasawa Y. Initial MRI findings of non-

traumatic osteonecrosis of the femoral head in renal allograft

recipients. Magn Reson Imag. 1997;15:1017–1023.

8. Miyanishi K, Noguchi Y, Yamamoto T, Irisa T, Suenaga E,

Jingushi S, Sugioka Y, Iwamoto Y. Prediction of the outcome of

transtrochanteric rotational osteotomy for osteonecrosis based on

the postoperative intact ratio. J Bone Joint Surg Br. 2000;82:512–

516.






11. Ortiguera CJ, Pulliam IT, Cabanela ME. Total hip arthroplasty

for osteonecrosis: matched-pair analysis of 188 hips with long-

term follow-up. J Arthroplasty. 1999;14:21–28.




J Orthop Sci. 2002;7:601–605.

13. Sugioka Y. Transtrochanteric anterior rotational osteotomy of the

femoral head in the treatment of osteonecrosis affecting the hip; a

new osteotomy operation. Clin Orthop Relat Res. 1978;130:191–

201.

14. Sugioka Y. Transtrochanteric rotational osteotomy of the femoral

head. In: Macnicol MF, ed. Color Atlas, Text of Osteotomy of theHip. London, UK: Mosby-Wolfe; 1996:145–156.

15. Sugioka Y, Hotokebuchi T, Tsutsui H. Transtrochanteric anterior

osteotomy for idiopathic and steroid-induced necrosis of the



123


Modified Transtrochanteric Rotational Osteotomy for FemoralHead Osteonecrosis

Taek Rim Yoon MD, Azlina Amir Abbas MD,

Chang Ich Hur MD, Sang Gwon Cho MD,

Jin Ho Lee MD



Abstract Osteonecrosis of the femoral head is a disabling

condition affecting young patients and treatment of the

disease in these patients is variable. We retrospectively

reviewed 39 patients (43 hips) in whom a modified tran-

strochanteric rotational osteotomy was performed for

osteonecrosis. The minimum followup was 24 months

(mean, 36.6 months; range, 24–52 months). The mean

patient age was 34.3 years (range, 20–51 years). Based on

the ARCO classification, 17 hips were classified as Stage II

and 26 as Stage III. We performed rotational osteotomy

alone in 15 cases, in combination with simple bone grafting

in three, and in combination with muscle-pedicle-bone

grafting in 25. Sixteen of 17 ARCO Stage II cases and 24

of 26 ARCO Stage III cases had no progression of collapse

or lesion size; three hips progressively collapsed. Of the 40

hips without progression the Harris hip score improved

from a mean 70 to 92 points at final followup, as did the

range of motion of the hip. Modified transtrochanteric

rotational osteotomy is an effective method for delaying

the progression of collapse in the treatment of selected

cases of osteonecrosis of the femoral head.

Level of Evidence: Level IV, therapeutic study. See the


of evidence.

Introduction

Osteonecrosis of the femoral head is a disabling disease

involving the hips of young people [6]. Despite many

efforts, the etiology of osteonecrosis still has not been

identified and the pathogenesis is not fully understood.

Therefore, treatment methods are various and are often

chosen according to stage, location, and size of the necrotic

area. Surgery usually involves head-preserving procedures

or total hip arthroplasty (THA). In general, the head-

preserving treatments are used in Ficat-Arlet stage I or II

and THA is used in Ficat-Arlet stage III or IV [25]. How-

ever, when performing THA in young patients, high rates of

failure have been reported despite continuous improvement

in the design and technique [4, 6, 15, 23, 24]. The etiology is

unknown but the disease is characterized by the death of

bone. Although in some cases the disease is static or pro-

gresses very slowly [20], in others it typically progresses to

collapse of the subchondral bone and articular cartilage of

the joint, ultimately leading to secondary degenerative

change causing pain and limitation of joint motion.

Various head preservation procedures have been repor-

ted, such as core decompression which reduces bone-

marrow pressure [8, 21], proximal femoral osteotomy [9],

nonvascularized or vascularized bone graft [3, 5], and

trochanteric or transtrochanteric rotational osteotomy [20,

27]. Sugioka’s transtrochanteric rotational osteotomy [27]

especially is known as an effective head preservation

procedure in younger patients. Despite some reports of

good results, not all have reported success with this





T. R. Yoon, C. I. Hur, S. G. Cho, J. H. Lee

Department of Orthopedics, Chonnam National University

School of Medicine, Gwangju, Korea

T. R. Yoon (&), A. A. Abbas

Center for Joint Disease, Chonnam National University Hwasun

Hospital, 160 Ilsimri, Hwasuneup, Hwasungun, 519-809

Jeonnam, Korea


123


DOI 10.1007/s11999-008-0188-5

procedure [7, 26, 29]. Most complications and failure of

this procedure are related to its technically demanding

nature and the poor fixation stability provided by the

screws, causing delayed union and increased varus [7, 14,

22]. This led several authors to recommend fixation with

side plates and blade plates rather than with screws as

originally described by Sugioka [2, 14, 26].

We modified Sugioka’s osteotomy technique so the

greater trochanter was not detached, presuming our modi-

fication of the transtrochanteric rotational osteotomy

(TRO) produces less tissue trauma, and provides better hip

function. This method of TRO allows muscle-pedicle-bone

grafting to be performed at the same time. We believe

subsequent total hip arthroplasty would be easier in the

event of failure of this procedure.

We asked whether: (1) this modified technique of TRO

could prevent further collapse of most hips with ARCO II

and III osteonecrosis; (2) blood flow to the femoral head

would be restored following this procedure; (3) patients

would have improved functional abilities postoperatively;

and (4) there would be no increase in complication rates.


We retrospectively reviewed 39 patients (43 hips) with

osteonecrosis of the femoral head treated by a modified

TRO, and in whom followup was possible for at least

2 years. Association Research Circulation Osseous

(ARCO) stages [1] were used for classification of osteo-

necrosis (Table 1). The study population included 33 men

and six women, and the average patient age was 34.3 years

(range, 20–51 years). The causes of osteonecrosis were

excessive alcohol consumption in 15, steroid use in 11,

idiopathic in 12, and posttraumatic in five. The indications

for this surgery were (1) ARCO Stage II and ARCO Stage

III with less than 50% involvement, and (2) intact area of

the posterior or anterior femoral head greater than a third of

the total articular surface. We performed MTRO alone in

15 cases, a combination of MTRO and simple bone

grafting in three, and a combination of MTRO and muscle-

pedicle-bone grafting in 25. Anterior rotation was per-

formed in 40 cases and posterior rotation in three cases.

Bilateral surgery was performed in four patients. The

minimum followup duration was 24 months (average,

36.6 months; range, 24–52 months). No patients were lost

to followup.

Preoperative assessment of the patients included anter-

oposterior and lateral radiographs of the affected hip, MRI,

and bone scans. The extent of necrosis was determined by

the method described by Kerboul et al. [13] and the exact

location of the lesion was determined by MRI. This

information was used to determine the rotation angle

required for the modified transtrochanteric rotational oste-

otomy. Anterior rotated osteotomy was indicated if the

lesion involved less than the posterior third of the entire

femoral head on true lateral radiograph. Posterior rotated

osteotomy was indicated if the lesion involved more than

the posterior third of the entire femoral head but the

anterior portion of the head was still intact.

The surgery was performed by one surgeon (TRY). The

patient was placed in a lateral decubitus position, and a

lateral, straight, longitudinal skin incision of 12 to 17 cm

was made, depending on the size and weight of the patient.

The incision was centered over the greater trochanter and

extended from 5 cm below the vastus lateralis ridge of the

greater trochanter to 5 to 7 cm proximal to the greater

trochanter. We used a posterior approach to the hip joint.

The presence of the posterior branch of the medial cir-

cumflex artery was confirmed using Doppler (Minidop

ES-100VX; Habeco, Tokyo, Japan), and protected from

injury by not detaching the quadratus femoris. The short

external rotator muscles, except the quadratus femoris,

were completely transected. The joint capsule was circum-

ferentially incised close to the acetabular rim. A 3.5-mm

Steinman pin was driven centrally along the axis of the

Table 1. Classification of ARCO [1] stage and treatment method

Stage Number of cases MTRO MTRO with simple bone graft MTRO with MPBG Cases with progression

2-A-central 4 3 1

2-B-central 2 2

2-B-lateral 4 2 2

2-C-central 3 1 2

2-C-lateral 4 4 1

3-A-lateral 2 2

3-B-lateral 5 2 1 2 1

3-C-central 1 1

3-C-lateral 18 2 1 15 1

MTRO = modified transtrochanteric rotational osteotomy; MPBG = muscle-pedicle-bone graft.

Volume 466, Number 5, May 2008 Modified Transtrochanteric Rotational Osteotomy 1111

123

femoral neck from the lateral aspect of the greater

trochanter. Using a k-wire bent to 90� as a guide, the

transtrochanteric osteotomy site was determined perpen-

dicular to the wire just proximal to the intertrochanteric

line. In contrast to Sugioka’s technique [27], the greater

trochanter was not detached (Fig. 1). With mobilization of

the proximal fragment, any remnants of the capsule

attachment to the proximal fragment was confirmed and

detached. A Steinman pin was inserted into the proximal

fragment and was used as a joystick to rotate the proximal

fragment 70� to 90� in the anterior direction or 90� to 100�in the posterior direction. (Fig. 2). Two or three Steinman

pins were inserted to fix the transtrochanteric osteotomy

site temporarily. The position and rotation were confirmed

by fluoroscopy. We used two or three 6.5-mm cancellous

screws to fix the osteotomy site and then removed the

temporary Steinman pins (Fig. 3). If we performed anterior

rotation of the proximal fragment, one of the cancellous

screws was inserted from the anteroinferior aspect of the

trochanteric area to the posterosuperior area of the femoral

neck to obtain fixation through the cortical bone, providing

added stability and vice-versa in a case of posterior rotation of

the proximal fragment. The remaining one or two cancellous

screws were fixed from the lateral side of the greater tro-

chanter to the femoral head. In the cases of ARCO Stage III

ON, bone grafting was performed. In a small collapsed lesion,

we performed simple bone grafting. However, if the lesion

was relatively large, muscle-pedicle-bone grafting from the

distal gluteus medius muscle and its attachment to the

anterior greater trochanter was performed. We created a

window in the neck-head junction for insertion of this

muscle-pedicle-bone graft. Two cannulated cancellous

screws were used for fixation in 29 cases, and three

cannulated cancellous screws were used in 14 cases.

The average operation time was 159.3 minutes (range,

125–220 minutes). Hemoglobin level changed from a

preoperative mean of 12.4 gm/dL (range, 9.3–15.6 gm/dL)

to 10.2 gm/dL (range, 7.6–13.2 gm/dL) postoperatively.

Hematocrit levels dropped from 36.1% (range, 27.2%–45.1

%) to 26.6 % (range, 19.8%–32.3%).

We reconfirmed the presence of the artery with Doppler

(Minidop ES-100VX; Habeco, Tokyo, Japan) after confir-

mation of the fixation by fluoroscopy again and prior to

repair of the deep fascia, subcutaneous layer, and skin.

Postoperatively, patients began nonweightbearing crutch

walking within 1 week, depending on the general condition

of the patient. Range-of-motion exercises were recom-

mended during the postoperative period. The crutch

walking with nonweightbearing was continued until the

radiological bone union was confirmed, usually for 3 to

4 months. Radiological bone union was defined as absence

of the radiolucent transtrochanteric osteotomy line. Post-

operative scintigram was performed at 2 to 3 weeks and

3 months postoperatively.

We (TRY, SGC, JHL) performed a clinical evaluation

using the Harris hip score (HHS) [11]. Other hip functions

such as squatting and range of motion were also

evaluated.

Fig. 1 The osteotomy sparing the greater trochanter is shown.

Fig. 2 The femoral head was rotated anteriorly depending on the

location of the necrotic area.

1112 Yoon et al. Clinical Orthopaedics and Related Research

123

We (TRY, AAA, CIH) used regular anteroposterior and

lateral radiographs to monitor femoral head collapse or

degenerative changes. Radiographs were taken at 3 weeks,

6 months, and 1 year, then annually after the operation.

Bone scan with pin-hole spectrometry was performed at 2

to 3 weeks and 3 months postoperatively.

If there was progression of osteonecrosis, if THAs were

performed for any reason, or if collapse occurred in the

followup period, the results were considered a ‘‘failure.’’

We considered the surgery successful if there was no

further collapse or increase in apparent necrotic area within

the minimum 24-month followup.

Results

Sixteen of 17 ARCO Stage II cases and 24 of 26 ARCO

Stage III cases had no progression of collapse or lesion

size. The location of the lesion in all three cases with

collapse was lateral and the size of lesion in two was over

30%. All three cases with progression were treated by

MTRO in combination with muscle-pedicle-bone graft or

simple bone graft. One of the three cases underwent THA.

The early postoperative scintigrams revealed increased

blood flow that gradually increased during the 3-month

followup studies.

Excluding the three failed cases, the average preopera-

tive Harris hip score was 70 points (range, 59–82 points),

and it improved to 92 points (range, 77–100 points) at the

last followup. The average range of motion of hips at last

followup improved compared to that of preoperative values

(Table 2). Thirty-nine cases (90.7%) could squat down and

40 cases (93%) could sit cross-legged.

Bone union occurred at the osteotomy site in all cases.

The average union time was 14 weeks (range, 11–

22 weeks). The complications included delayed union in

one case, valgus angulation over 140� in two cases, and

osteophyte formation in three cases. In the two cases with

valgus angulation, the average postoperative neck-shaft

angle was 146�, but no additional treatment was performed.

We had no cases of infection or deep vein thrombosis.

Three patients had subcapital osteophyte formation on

radiograph, but no additional treatment was performed

because these patients were free of pain.

Discussion

We asked whether our technique of modified transtro-

chanteric rotational osteotomy could prevent further

collapse of most hips with ARCO II and III osteonecrosis,

whether blood flow to the femoral head would be restored

following this procedure, whether patients would have

improved functional abilities postoperatively and whether

these can be achieved without increased complication

rates.

Our study is limited by the short-term followup. Longer

followup would be necessary in this cohort of patients to

determine the true survivability of this procedure. This

study also lacked controls and the patients were not ran-

domized to any other treatment methods.

Osteonecrosis of the femoral head is a devastating

condition because of its propensity to affect young people

and its often unrelenting progression despite treatment

[30]. Treatments for osteonecrosis of the femoral head are

varied and can be largely categorized into joint-preserving

procedures and THA. Most patients are treated by THA.

Fig. 3 Fixation of the osteotomy with two cannulated screws is

shown.

Table 2. Average range of motion of hip at last followup versus

preoperative values

Motion Hip range of motion

Preoperative Postoperative

Flexion 90.9� 98.7�Internal rotation 8� 13.3�External rotation 36.1� 48.4�Abduction 24.3� 27�Adduction 13.1� 14.8�


123

However, THA is not a definitive treatment because new

problems such as liner wear, osteolysis, and loosening have

developed, requiring later revision surgery. For these rea-

sons we believe THA is not the best choice for young

patients. Therefore, we prefer head-preserving procedures

for those who are young and diagnosed early.

A report on 474 patients treated with the Sugioka oste-

otomy [27] revealed a success rate of 78%, with higher

success rates seen in cases in earlier stages (stage II had an

89% success rate, stage III 73%, and stage IV 70%), and in

cases involving smaller lesions. A comparison of several

joint-preserving techniques was made by Saito et al. [22].

In their study, 54 hips were classified according to the

classification of Inoue and Ono [12] and treated with core

decompression (stage I, 17 cases), bone grafting (stage II,

18 cases), or osteotomy (stage III, 15 rotation, 4 varus).

Overall, good or excellent results were seen in 67% of

cases. For Stage II and III lesions, necrosis involving less

than 50% of the femoral head resulted in a success rate of

91% compared to 27% success in cases involving larger

lesions.

Sugioka [27] proposed a transtrochanteric rotational

osteotomy (TRO) to preserve the femoral head in young

patients when the posterior portion of the femoral head was

not involved. By rotating the femoral head, the diseased

weight-bearing surface is reestablished by repositioning the

femoral head, reducing the forces on the diseased part to

prevent collapse and allow healing [16, 28]. Sugioka [28]

reported successful outcomes with rotation angles of

55�–70� in anterior rotated TRO and Atsumi and Kuroki

[2] reported successful outcomes with rotation angles of up

to 180� when performing a TRO with posterior rotation. As

with THA, TRO is not permanent but it can delay THA for

those young patients who have neither metabolic bone

disease nor articular destruction.

We do not recommend TRO in Ficat Stage I hips in

which core decompression seems more appropriate, or in

Stage IV hips in which head-preserving surgery is no

longer effective. For Stages II and III, although successful

results have been reported on short-term followup, long-

term followup results are variable and we believe unsatis-

factory [10, 17]. We judged TRO had a high success rate

for at least 24 months in Stage II, when success was

defined by absence of progression of collapse or size of the

osteonecrotic region (Table 1). Sugioka [28] reported 89%

success in hips followed 2 to 11 years postoperatively and

Masuda et al. [18] reported 82% success at average

5.1 years. In our series, ‘‘success’’ was defined as no evi-

dence of further progression of osteonecrosis. The success

rate for Stage II ON in our series was 94% (Fig. 4A–E).

For Stage III, there is no consensus in the literature con-

cerning results. Dean and Cabanela [7] had only 17%

Fig. 4A–E (A) Radiographs from

a 42-year-old man with osteone-

crosis of the femoral head (Ficat-

Arlet Stage II) are shown. (B) An

axial MRI shows medial collapse.

(C) A coronal MRI shows necrosis

extending into the femoral neck.

(D) An immediate radiograph after

transtrochanteric rotational osteot-

omy with bone graft is shown. (E)

Radiographs at 14 months postop-

eratively showed good union of the

osteotomy site with good incorpo-

ration of grafted bone at the

necrotic area.


123

satisfactory results, but Saito et al. [23] had 45%, Sugano

et al. [26] had 56%, and Sugioka [28] reported 73% sat-

isfactory results. Atsumi and Kuroki [2] reported

successful outcomes in 17 of 18 hips with FICAT III and

IV treated with posterior rotated transtrochanteric osteot-

omy at a minimum of 24 months of followup (mean,

42 months; range, 24–94 months). However, our study

revealed a 92% success rate in Stage III. The success rate

in our study may be related to a more limited indication for

the osteotomy and the use of supplementary bone and

muscle pedicle-bone-grafting. Muscle pedicle-bone-grafts

were indicated for ARCO Stage III hips where there was

relatively large extent of necrosis and collapse of the

femoral head. We believe the high success rate is partly

attributable to this muscle pedicle-bone-grafting, which

increased the vascularity of the femoral head. The location

of the lesions in all three cases with progression was lateral

and the size of the lesions in two cases was large; caution

should be taken if a lesion is lateral and large as in all other

preserving surgeries.

Saito et al. [22] reported a high postoperative compli-

cation rate of 33% in the rotational osteotomy group of that

series, consisting of femoral neck fracture in three patients

with renecrosis of the femoral head in two and two late

varus deformities. Sugioka [27] also reported complica-

tions related to his procedure, including lesser trochanteric

fracture in one, femoral neck fracture in four, delayed

union in five leading to increased varus deformities, and

progression of osteonecrosis in two. Ohzono et al. [20]

proposed a lack of skilled surgical technique or inappro-

priate patient selection or fixation causes a high failure rate.

Our complications were not greatly different from those

reported in the literature. There was one case of delayed

union at 22.2 weeks, two cases had valgus angulation of

the osteotomy, and three cases had osteophyte formation,

all of which did not require any surgical intervention.

Valgus position was one of our complications that devel-

oped during our early experience with the modified TRO

technique, as part of the learning curve. As we gained more

experience, we utilized intraoperative fluoroscopy and took

extra care to avoid valgus positioning of the osteotomy.

Varus positioning has the disadvantage of limb shortening

so we did not perform intentional varus positioning to

avoid limb length discrepancy. We believe the results of

TRO depend on the indications for the surgery and the skill

of the surgeons, both of which may vary.

In comparison with the original technique of TRO, a

MTRO has several advantages. There is no need to detach

and reattach the greater trochanter. Therefore, there is no

concern about nonunion of the greater trochanter. The

quadratus femoris is also not detached. By redirecting one

of the screws for fixation of the osteotomy, we have had no

cases of nonunion of the osteotomy site. Additional

procedures such as muscle-pedicle-bone graft can be

combined with MTRO. The postoperative rehabilitation as

described by Sugioka [27] includes continuous skin trac-

tion for 1 week, followed by nightly skin traction for a

further 2 weeks. Active hip exercises commenced within

2 weeks postoperatively. In our series, early rehabilitation

is possible as skin traction is not required postoperatively

and our patients begin hip mobilization exercises the day

after surgery. Subsequent THA may be easier because the

anatomy of the greater trochanter is not altered and

the quadratus femoris, which may be important to preserve

the circulation, is not detached. When the posterior branch

of the medial circumflex artery is injured during surgery,

the circulation through the quadratus femoris may be

maintained. One study suggested quadratus femoris mus-

cle-pedicle-bone grafting for treating displaced femoral

neck fractures since the microcirculation in the muscle

would theoretically provide additional blood flow through

the quadratus femoris muscle [19].

Most of our patients had rotational osteotomy without a

greater trochanteric osteotomy. With this method, we were

able to perform anterior and posterior transtrochanteric

rotation. Bone grafting was a supplementary procedure and

was performed with a small window through the head-neck

junction. We believe by adding this small procedure, the

success rate could be improved. With the combination of

rotational osteotomy and muscle pedicle bone grafting the

indication for this MTRO could be further extended.

This procedure prevented progression (no collapse or

increase regions of ON) in 93% by the minimum 24-month

followup. In the short term the MTRO seems effective in

Stages II and III with less than 50% involvement in either

anterior or posterior portions of the femoral head. We

therefore believe this technique is promising in young

patients with Stage II or III osteonecrosis of the femoral

head.

References

1. ARCO (Association Research Circulation Osseous). Committee

on Terminology and Classification. ARCO News. 1992;4:41–46.

2. Atsumi T, Kuroki Y. Modified Sugioka’s osteotomy: More than

130� posterior rotation for osteonecrosis of the femoral head with

large lesion. Clin Orthop Relat Res. 1997;334:98–107.

3. Bonfiglio M, Bardenstein MB. Treatment by bone-grafting of

aseptic necrosis of the femoral head and non-union of the femoral

neck (Phemister technique). J Bone Joint Surg Am. 1958;40:

1329–1346.

4. Brinker MR, Rosenberg AG, Kull L, Galante JO. Primary total

hip arthroplasty using noncemented porous coated femoral

components in patients with osteonecrosis of the femoral head.


5. Buckley PD, Gearen PF, Petty RW. Structural bone-grafting for

early atraumatic avascular necrosis of the femoral head. J BoneJoint Surg Am. 1991;73:1357–1364.


123

6. Coventry MB, Beckenbaugh RD, Nolan DR, Ilstrup DM. 2,012

total hip arthroplasties: A study of postoperative course

and early complications. J Bone Joint Surg Am. 1974;56:

273–284.

7. Dean MT, Cabanela ME. Transtrochanteric anterior rotational

osteotomy for avascular necrosis of the femoral head. Long-term

results. J Bone Joint Surg Br. 1993;75:597–601.

8. Fairbank AC, Bhatia D, Jinnah RH, Hungerford DS. Long-term

results of core decompression for ischemic necrosis of the fem-

oral head. J Bone Joint Surg Br. 1995;77:42–49.

9. Fuchs B, Knothe U, Hertel R, Ganz R. Femoral osteotomy and

iliac graft vascularization for femoral head osteonecrosis. ClinOrthop Relat Res. 2003;412:84–93.

10. Ganz R, Buchler U. Overview of attempts to revitalize the dead

head in aseptic necrosis of the femoral head–osteotomy and

revascularization. In: Hungerford DS, ed. Hip. St Louis, MO:

Mosby;1983:96–305.




12. Inoue A, Ono K. A histological study of idiopathic avascular

necrosis of the head of the femur. J Bone Joint Surg Br. 1979;61-

B:138–143.

13. Kerboul M, Thomine J, Postel M, D’Aubigne RM. The conser-

vative surgical treatment of idiopathic aseptic necrosis of the


14. Kinnard P, Lirette R. The Borden and Gearen modification of the

Sugioka transtrochanteric rotational osteotomy in avascular

necrosis: A preliminary report. Clin Orthop Relat Res.

1990;255:194–197.

15. Krackow KA, Mont MA, Maar DC. Limited femoral endopros-

thesis for avascular necrosis of the femoral head. Orthop Rev.

1993;22:457–463.

16. Lafforgue P, Dahan E, Chagnaud C, Schiano A, Kasbarian M,

Acquaviva PC. Early-stage avascular necrosis of the femoral

head: MR imaging for prognosis in 31 cases with at least 2 years

of follow-up. Radiology. 1993;187:199–204.

17. Maistrelli G, Fusco U, Avai A, Bombelli R. Osteonecrosis of the

hip treated by intertrochanteric osteotomy. A four- to 15-year

follow-up. J Bone Joint Surg Br. 1988;70:761–766.

18. Masuda T, Matsuno T, Hasegawa I, Kanno T, Ichioka Y, Kaneda K.

Results of transtrochanteric rotational osteotomy for nontraumatic

osteonecrosis of the femoral head. Clin Orthop Relat Res.

1988;228:69–74.

19. Morewessel R, Evarts CM. The use of quadratus femoris muscle

pedicle bone graft for the treatment of displaced femoral neck

fractures. Orthopedics. 1985;8:972–976.




21. Rosenwasser MP, Garino JP, Kiernan HA, Michelsen CB. Long

term followup of thorough debridement and cancellous bone

grafting of the femoral head for avascular necrosis. Clin OrthopRelat Res. 1994;306:17–27.


opathic avascular necrosis of the femoral head: Results of core


1988;70:78–84.


of total hip arthroplasty for osteonecrosis of the femoral head. A

comparison with osteoarthritis. Clin Orthop Relat Res.

1989;244:198–207.

24. Stauffer RN. Ten-year follow-up study of total hip replacement.


25. Steinberg ME. Management of avascular necrosis of the femoral

head–an overview. Instr Course Lect. 1988;37:41–50.

26. Sugano N, Takaoka K, Ohzono K, Matsui M, Saito M, Saito S.

Rotational osteotomy for non-traumatic avascular necrosis of the


27. Sugioka Y. Transtrochanteric anterior rotational osteotomy of the

femoral head in the treatment of osteonecrosis affecting the hip: a

new osteotomy operation. Clin Orthop Relat Res. 1978;130:191–201.

28. Sugioka Y. Transtrochanteric rotational osteotomy in the treat-

ment of idiopathic and steroid induced femoral head necrosis,

Perthes’ disease, slipped capital femoral epiphysis, and osteoar-

thritis of the hip. Indications and results. Clin Orthop Relat Res.

1984;184:12–23.

29. Tooke SMT, Amstutz HC, Hedley AK. Results of transtrochan-

teric rotational osteotomy for femoral head osteonecrosis. ClinOrthop Relat Res. 1987;224:150–157.

30. Vail TP, Covington DB. The incidence of osteonecrosis. In

Urbaniak JR, Jones JP, eds. Osteonecrosis : Etiology, Diagnosis,and Treatment. Chicago, Ill: American Academy of Orthopaedic

Surgeons; 1997:43–49.


123


Vascularized Fibular Grafting for Osteonecrosis of the FemoralHead With Unusual Indications

J. Mack Aldridge III MD, James R. Urbaniak MD



Abstract We retrospectively reviewed the charts of 154

patients of various subgroups treated with the free vascu-

larized fibular graft procedure for osteonecrosis of the

femoral head (ONFH), evaluating pre- and postoperative

Harris hip scores, hip range of motion, radiographs, and

number of conversions to total hip arthroplasty (THA).

Patients were followed a minimum of 1 year (mean,

6.8 years, range, 1 to 19 years). Athletes and patients with

pyarthrosis-related osteonecrosis had high Harris hip scores

at final review with scores of 94 and 97, respectively. Patients

with ONFH after a slipped capital femoral epiphysis or fol-

lowing pregnancy had a low conversion rate to THA at 6%

and 8%, respectively. Twenty-five percent of patients with

transplant-related osteonecrosis of the femoral head were

converted to THA at an average of 2.7 years. However, with

select subsets of patients (athletes, pregnancy, organ trans-

plant, femoral neck non-union, slipped capital femoral

epiphysis, infection) the FVFG can result in a high rate of

success.



of evidence.

Introduction

Free vascularized fibular grafting (FVFG) for the treatment of

osteonecrosis of the femoral head (ONFH) was first described

in the 1970s concurrent with the emergence of microsurgical

techniques and during a time when durable and predictable

hip arthroplasty components were not readily available.

Because ONFH tends to affect younger patients, most

surgeons have traditionally believed any procedure aimed at

preserving the patient’s native hip preferable. That remains

true today, although our enthusiasm for the FVFG procedure

in patients between the ages of 40 and 50 years with pre-

operative femoral head collapse is tempered with our

acknowledgment of time-proven hip arthroplasty as a rea-

sonable surgical alternative. We recognize the FVFG

procedure is not a panacea for ONFH nor is it indicated for all

patients with ONFH; however, drawing from our experience

with over 7000 cases of ONFH and performing over 2800

FVFG procedures, certain trends have emerged with respect

to patient selection, outcomes, and technical refinements.

We have reviewed select subsets of patients with ONFH

treated with the FVFG and have updated reviews of previ-

ously reviewed groups [11, 16, 18] in hopes of identifying in

which patients this procedure is beneficial. We provide

evidence for our belief that the FVFG procedure remains a

reasonable and effective option in patients with ONFH and

will and continue to have a role in the foreseeable future.


For this article we retrospectively reviewed the charts of

selected nonconsecutive subsets of over 2,800 patients who

underwent FVFG and whom we presumed had performed

better postoperatively than our general population with









J. M. Aldridge III (&), J. R. Urbaniak

Division of Orthopaedic Surgery, Duke University Medical

Center, 3116 North Duke Street, Durham, NC 27704, USA


123


DOI 10.1007/s11999-008-0201-z

ONFH. These subsets included: athletes (n = 15, 19 hips),

pregnancy (n = 39 patients, 41 hips), organ transplant

(n = 36 patients, 47 hips), femoral neck nonunion (n = 22

patients, 22 hips), slipped capital femoral epiphysis (n = 31

patients, 36 hips), infection (n = 11 patients, 11 hips). We

prospectively contacted all patients directly in these subsets

with followup questionnaires (Harris hip score and SF-12).

For the physical examination portion of the Harris Hip

evaluation, we either brought patients back to the clinic for

an examination or, for patients who lived too far away to

return directly to us, we used hip range of motion measure-

ments from their local orthopaedic surgeon. All patients were

diagnosed with osteonecrosis of one or both femoral heads

and were referred to our institution where either author

(JMA, JRU) performed a vascularized fibular graft. The

surgical technique has been described previously [1] and has

changed little in the 30 years since it was first introduced. A

few minor and recent additions to the procedure are detailed

in the Discussion section of this paper. Both authors perform

the procedure identically. We obtained prior approval from

the Committee on Clinical Investigation of our Institutional

Review Board. We offer the procedure to patients under

50 years of age, with symptomatic ONFH, and with little or

no articular stepoff in the femoral head.

Patients were followed at the following postoperative

times: six weeks, 3 months, 6 months, one year, then yearly

thereafter. Preoperatively and on each postoperative visit we

(JRU, JMA) determined hip range of motion and the Harris

hip score. We determined patient satisfaction by the SF-12

form. We consider an outcome as successful if the patient has

an improvement in or absence of pain, an improved Harris

hip score, and preservation of their native hip (ie, no hip

arthroplasty) at last followup.

We also obtained an anteroposterior (AP) pelvis and

frog leg lateral radiographs of the operative hip at each

visit. We (JRU, JMA) determined on each film the size and

location of the necrotic lesion and the presence or absence

of collapse and/or joint space narrowing. Size of the lesion

was determined by the authors’ (JRU, JMA) estimation of

percentage involvement on the AP and lateral radiograph

and the coronal and axial magnetic resonance imaging.

From this, a number is then selected that represents a

percentage of a sphere.

Athletes with Osteonecrosis of the Femoral Head

Athletes with their drive to succeed and disciplined approach

to overcoming physical challenges appear to have particular

benefit from the FVFG procedure. Coincidentally, this is a

group of patients in whom a biology-sparing procedure is

particularly attractive for allowing unrestricted return to

sporting activities. The obligate restrictions of hip

resurfacing or THA frequently herald the end of competitive

sports participation and, as such, are typically viewed as last

options for this group of patients.

We have performed the FVFG procedure on 15 athletes

(19 hips). The various sports included baseball, basketball

(one patient was on a national women’s basketball team),

ballet, football, roping horses, downhill skiing, triathlons,

gymnastics, and volleyball. Not included was the typical

‘‘weekend athlete,’’ but rather these were all competitive

athletes on the high school, intercollegiate, or professional

level. The average age of the patients was 27.8 years (range,

11–43 years). There were 10 male and five female patients.

The hips were classified as Stage II in six patients, Stage III in

two patients, Stage IV in six patients, and Stage V in one

patient, using the Steinberg classification. Etiologies of

ONFH included idiopathic in eight, trauma in two, alcohol in

two, corticosteroids in one, Legg-Calve-Perthes in one, and

hemangioma of the femoral head with osteonecrosis in one.

Followup was available for all 15 athletes at a mean of

8 years (range, 1.8–19 years).

The mean Harris hip score improved from 73.6 (range,

17–96) preoperatively to 94 postoperatively. Average final

hip flexion for 12 hips in which range of motion data were

available was 113� (range, 75�–130�). Radiographic changes

were noted in three patients (two joint space narrowing; one

femoral head collapse), whereas the remaining 12 patients

showed no further collapse or change in their hip joint space.

Eleven patients (73%) postoperatively returned to athletic

activities and eight of these patients believed they could

perform at the same level of competition as before devel-

oping ONFH. One such patient returned to competitive

football within 9 months following the FVFG procedure

(Fig. 1A–D). Three hips were converted to THA at an

average of 10 years (one hip at 3 years, one at 9 years, and

one at 17 years after FVFG). Patients rated their overall

satisfaction (SF-12) with the procedure as extremely satis-

fied in 10, moderately in four, and slightly satisfied in one.

Pregnancy-related Osteonecrosis of the Femoral Head

We earlier reported treating female patients with the FVFG

procedure for pregnancy-related ONFH [14]. The average

age in this cohort of 39 patients was 33.1 years. The stage at

time of presentation for the group was Steinberg Stage I

(n = 1), Stage II (n = 8), Stage III (n = 3), Stage IV

(n = 25), Stage V (n = 1), and Stage VI (n = 1). We fol-

lowed these patients a minimum of 24 months (mean,

46 months; range, 24 to 95 months). Of these 39 patients,

one presented with unilateral disease of the right femoral

head, whereas two had bilateral involvement and the

remainder (n = 36) had ONFH of the left femoral head. Our

results with the FVFG procedure for pregnancy-related

1118 Aldridge and Urbaniak Clinical Orthopaedics and Related Research

123

ONFH have been consistently good with a 94% success rate

at 5 years. Average preoperative Harris hip score was 44.2

(range, 26–93) for the group, improving to 80.2 (range,

22–100) at final followup. Hip motion remained the same or

improved for every patient. Two patients’ hips were con-

verted to THA at 2 and 14 years after the FVFG procedure.

Both of these patients had collapse of the femoral head prior

to surgery with approximately 40% involvement of the

femoral heads.

When evaluating a pregnant patient with new-onset hip

pain, it is important to distinguish ONFH from bone marrow

edema syndrome (BME), a condition known to occur with

greater frequency in pregnant women. BME is a poorly

understood entity but is easily distinguished from ONFH

because the latter has a characteristic serpiginous border

between viable and nonviable bone seen on T1- and T2-

weighted MRI images (Fig. 2). BME will not have this dis-

tinct serpiginous border and, unlike ONFH, BME will have

bone marrow signal changes extending down the femoral neck

into the trochanteric region. Furthermore the MRI changes

seen in BME syndrome ultimately reverse to normal, whereas

those changes from ONFH persist or enlarge with time.

Patients Who Have Undergone Transplantation

We have performed the FVFG procedure for transplant-

dependent steroid-induced ONFH in 36 patients (47 hips).

Followup was available for all 36 patients at a minimum of

1 year (mean, 4.3 years; range, 1–16 years). Eleven patients

(23%) have had conversions to THA. The average time to

conversion was 2.7 years (range, 1.5–4.0 years). Preopera-

tively, eight of those 11 patients had at least 50% estimated

involvement of the femoral head. We now consider the

percentage of femoral head involvement in our decision to

offer the FVFG procedure. We are continually challenged in

deciding who would benefit most from this procedure,

especially because patients having undergone renal trans-

plantation are also not ideal recipients of THA. Although a

25% THA conversion rate might imply to some a contrain-

dication to the FVFG procedure, we believe the many more

Fig. 1A–D (A) A pelvic MRI of a

sixteen year old with septic-related

ONFH is shown. (B) This lateral

radiograph shows increased den-

sity of the epiphysis and

irregularity and collapse of the

subchondral bone. (C) The one-

year radiograph demonstrates

good fibular incorporation and

preservation of the femoral head

preoperative state. In fact, it

appears there has been some

improvement. (D) Three years

after the FVFG procedure, the

patient played quarterback for his

high school football team.

Fig. 2 A T1-weighted coronal MRI image shows a patient with

osteonecrosis of the left femoral head. The arrow is pointing to the

characteristic serpiginous border between nonviable and viable bone.

Volume 466, Number 5, May 2008 Vascularized Fibular Grafting for Hip ON 1119

123

patients who continue to function well with their native hips

is rather an indication. For example, a 32-year-old man

underwent renal transplantation for glomerulosclerosis and

2 years afterward developed left-sided groin pain. Sub-

sequent workup revealed Steinberg et al. [16] Stage IVB

ONFH and he was referred to our institution for consider-

ation of the FVFG procedure. Because of his young age,

preserved joint space and, equally important, his hip motion,

we performed FVFG. He is now 8 years postsurgery and

walking without a limp or hip discomfort. His Harris hip

score improved from 73 to 100 at final followup. Harris hip

scores for this cohort improved from 58.6 (range, 18–83)

preoperatively to 81.3 (range, 33–100) postoperatively.

Femoral Neck Nonunion

A unique group of patients to whom we offer FVFG are

those patients with concomitant ONFH and femoral neck

nonunion. The risk of developing posttraumatic ONFH in

patients with femoral neck fractures is well established [3,

18]. The concern for nonunion in this particular fracture is

also well recognized in the literature [6]. Despite an

awareness of these potential complications and a timely

and anatomic reduction of the fracture, not infrequently,

either femoral neck nonunion and/or ONFH still occur.

This is a particularly devastating problem for the younger

patient (\ 40 years of age) in whom THA is considered a

salvage procedure and imparts certain lifestyle restrictions,

potentially interfering with avocational and vocational

interests.

We recently reported our experience with vascularized

fibular bone grafting in this particular set of patients [10].

We have performed the FVFG in 23 patients with com-

bined femoral neck nonunion and ONFH. The average age

of these patients was 28.7 years (range,10–49 years). Of

these 23 patients, four presented with Steinberg Stage I, 12

with Stage II, 2 with Stage III, four with Stage IV, and one

with Stage V ONFH. The minimum followup was

24 months (mean, 82 months; range, 24–195 months). One

such case involved an 18-year-old girl who presented with

a 2-year-old femoral neck nonunion with ONFH (Fig. 3).

We treated her hip with open reduction, internal fixation,

and placement of a FVFG. She ultimately healed and

reported ‘‘occasional aches’’ in her hip at long-term fol-

lowup. She was able to deliver two children subsequent to

the FVFG procedure. Twenty of the 22 nonunions healed at

an average time of 9.9 months (range, 3–23 months). Two

underwent additional procedures to facilitate healing.

Ultimately all fractures healed. The final median Harris hip

score for the group was 78.9 (range, 60–98). Two hips were

converted to THA an average of 1 year after surgery

because of femoral head collapse and accelerated hip

arthrosis. These two patients presented with 40%

Fig. 3 An 18-year-old patient is shown with Stage V osteonecrosis of

the femoral head and femoral neck nonunion before surgery,

4 months after, and 10 years after the free vascularized fibular

grafting procedure. The femoral neck has healed and there has been

no interval collapse of the femoral head with preservation of the joint

space. The reduction, screw fixation and FVFG are performed

contemporaneously with placement of the screws preceding the

insertion of the fibula, thus ensuring the screw threads do not disrupt

the vascular pedicle. Visual inspection of the core with no screw

threads visible or palpable, confirms safe placement of the screws.

Two screws and one FVFG have proven adequate in our experience

treating this entity.


123

involvement and no preoperative collapse of the femoral

head; however, both patients were noncompliant and dis-

carded their crutches prematurely 2 months after the

surgery.

Slipped Capital Femoral Epiphysis

The development of ONFH is a well recognized compli-

cation of a slipped capital femoral epiphysis [9]. We have

performed FVFG on 31 patients (36 hips; 26 unilateral, five

bilateral) with slipped capital femoral epiphysis compli-

cated by ONFH with an average patient age of 13.4 years

(range, 9–17 years) [5]. There were 20 male and 11 female

patients. All patients in this particular group presented with

some degree of femoral head collapse (Fig. 4A–B): one

patient with Duke Stage 3 (3.6%), 24 patients with Stage 4

(75%), and six patients with Stage 5 (21.4%) disease. We

followed these patients a minimum of 26 months (mean,

75 months; range, 26 months to 120 months). Followup

was possible for all patients. Three hips in two patients had

been converted to THA at the time of this review. One

additional patient’s hip had been converted to fusion. The

overall hip survival rate was 91.9% at 5 years. Reported

pain and functional activity improved in all patients and

Harris hip scores increased from an average preoperative

score of 55 (range, 11–90) to an average postoperative

score of 82.8 (range, 28–100). Twenty-seven of 28 patients

were extremely or very satisfied at final followup.

Infection

ONFH after pyarthrosis of the hip can be difficult to treat

because there is often bony destruction at the capsular

reflection (head/neck junction) in addition to the osteone-

crosis within the femoral head. Furthermore, many surgeons

consider a history of infection a contraindication to the use of

large metal implants if there is femoral head-neck disconti-

nuity. For these patients we routinely use FVFG and have

found the structural integrity of the fibular graft is sufficient

to allow rigid fixation of the neck while also addressing the

ONFH (Fig. 5A–C). We augment the FVFG with one or two

screws, with less concern about implanting nonbiologic

materials in a previously infected area, because we believe

the extra delivery of blood flow diminishes this concern for

reinfection.

We have treated 11 such patients with an average age of

12.5 years (range, 9–20 years) for ONFH after pyarthrosis

of the hip [17]. This cohort included eight male and three

female patients. Followup was possible for nine patients at

a minimum of 2 years (mean, 4 years; range, 2–5 years)

after surgery. The mean preoperative Harris hip score for

the group was 68 (range, 62–79), which improved to 97

(range, 90–100) postoperatively. All patients presented

with femoral head collapse of some degree, ranging from

flattening of the femoral head up to 3 mm of articular

stepoff. Despite this advanced presentation, none of these

patients had subsequent or conversion surgery, and as a

subgroup of patients, they have the highest Harris hip

scores at most recent followup.

Discussion

We believe it important to review the context in which the

concept for vascularized bone grafting for the treatment of

ONFH was conceived. In the late 1960s and early 1970s,

when so many of the biologic-preserving procedures were

developed, a durable and reliable artificial hip prosthesis

largely evaded orthopaedic surgeons. Today, technologi-

cally advanced metals and polymers provide excellent wear

characteristics that have allowed surgeons greater freedom

of implanting such components in much younger patients

who, only years ago, would have not been offered that

option. Similarly, refinements in the surgical technique

have provided greater longevity in total hip arthroplasty

(THA), as have improvements in component fixation

(biologic ingrowth, third-generation cement technique).

For these reasons, THA has become a more durable and

reliable procedure. However; these implants do have a

finite lifespan inversely proportional to the patient’s

activity level [4, 7, 8, 11, 15], which in younger patients

can be very demanding. Because a younger patient will

Fig. 4A–B (A) Preoperative ant-

eroposterior radiograph of a 13-

year-old boy shows a slipped

capital femoral epiphysis on the

left. Notice the large cyst and

increased density of the epiphysis,

both indicative of osteonecrosis of

the femoral head. (B) The same

patient is shown at 10-year

followup.


123

likely outlive his or her hip prosthesis, a scenario requiring

one or more revision surgeries, preserving the native hip of

a patient with some disabling hip abnormality for as long as

possible has obvious benefit.

We acknowledge the lack of uniform longer-term

followup among the various groups studied. The senior

author (JRU) has been performing the FVFG procedure for

30 years and a full-time research analyst has been engaged

in clinical data collection on these patients for nearly

20 years. Consistent long-term followup is often difficult

because the majority of patients are referred from all

regions of the United States and other countries, which

challenges consistent acquisition of yearly followup. Also,

there are small numbers of patients in all groups because of

the unusual circumstances leading to the development of

the ONFH. We also acknowledge that since our patients are

all relatively young they and their surgeon jointly want to

delay arthroplasty as long as possible. Such deferment of

arthroplasty can lead to bias in interpreting the benefit and/

or longevity of the FVFG procedure. Finally, the estimates

of involvement of the femoral head were based on the

subjective evaluations, rather than a formal attempt to

quantify involvement. These evaluations limit any inter-

pretation regarding lesion size.

It is well established ONFH, if left untreated, progresses

to femoral head collapse with subsequent hip degeneration

in the majority of cases [13]. Despite recent technologic

advances in THA, an excellent option for the older patient

with an arthritic hip joint, it remains difficult for the

arthroplasty surgeon to feel justified in proceeding with

THA in patients younger than 50 years of age simply for

ONFH-related pain. This is particularly true for the

symptomatic patient without femoral head collapse, a

preserved joint space, and no acetabular involvement. As

we have contended since the original procedure was per-

formed over 30 years ago by the senior author (JRU), the

Fig. 5A–C (A) Lateral radio-

graph shows the proximal femur

of a 14-year-old girl. The infection

resulted in femoral head-neck dis-

continuity and femoral head

osteonecrosis. (B) One year after

the free vascularized fibular graft-

ing procedure. Screws are placed

before inserting the fibula to pre-

vent the head from spinning during

the reaming portion of the case.

Notice the femoral head has healed

to the neck and there is continued

remodeling of the anterior portion

of the femoral head. (C) Two years

after free vascularized fibular

grafting, the cortices of the fibular

graft are less noticeable indicating

good incorporation. Femoral head

shape and joint space are relatively

well preserved.


123

ideal patient is young with a small lesion, no femoral head

collapse, and good hip motion. Any deviation from this

ideal candidate must be the result of careful consideration

of numerous variables by the operative surgeon, which

often comes only with experience.

Several approaches to treatment for osteonecrosis of the

femoral head have been described, including weight

restriction and observation, core decompression, various

osteotomies, bone grafting (structural or nonstructural and

vascularized [2] or nonvascularized), and arthroplasty

(hemiarthroplasty, resurfacing techniques, and THAs). Few

centers around the world perform the FVFG with great

frequency. From China, Zhang and colleagues [21] repor-

ted their experience with 48 patients (56 hips) undergoing

the FVFG procedure with an average patient age of

37.7 years and an average followup of 16 months. Etiolo-

gies included trauma, steroids, alcohol, and idiopathic.

Patients who had Steinberg Grade [16] II ONFH had better

Harris hip scores at last followup than did patients who had

Steinberg Stage [16] III or IV disease. The preoperative

Harris hip scores for patients who had Steinberg Grades

[16] II, III, and IV ONFH were 78.5, 69.3, and 58.4,

respectively. At the most recent followup, the Harris hip

scores improved to 94.4, 85.7, and 76.4, respectively.

Shaffer [12] reported his series of 101 hips treated with the

FVFG procedure with a minimum followup of 5 years.

Sixty-one percent of the hips had not been converted to

THA at the 5-year mark and 42% survived until the 8-year

postoperative mark. The average Harris hip score for the

cohort improved from 58 ± 13 preoperatively to 80 ± 15

at the 5-year mark. The majority of these patients had

preoperative femoral head collapse [12].

A recent level IV study [20] reported the use of the new

commercially available tantalum implant from Zimmer

(Warsaw, IN). The authors contend the early results are

equal to those of patients treated with the FVFG. The

24-month survival rate for the tantalum dowel was 81.7%,

which decreased to 68.1% at 48 months. The survivorship

improved to 92% at 48 months if patients with systemic

disease were excluded. However, it is typically these

excluded patients who comprise our series and whom we

believe would be underserved with a nonvascularized,

nonbiologic implant. We also avoid implanting metal in

women who are pregnant or of child-bearing age, and those

patients with a history of a hip infection, or renal com-

promise (i.e., renal transplants). We are further concerned

about the presence of metal in the femur at the time of

THA should that be needed in the future.

Some modifications to the FVFG surgical technique are

worthy of mention. We have recently begun obtaining an

intraoperative arteriogram after the fibula has been placed

within the femoral head but before the anastomosis is

completed. This ensures the pedicle is not kinked,

strangulated, or otherwise not flowing properly. Renogr-

affin can be visualized flowing up the main pedicle into the

femoral head and diffusing into the periosteal and endos-

teal vessels. If this is not confirmed, the fibula is removed,

the pedicle is checked, and the core may be enlarged

slightly. Also, in 2007 we began using, in certain cases,

computer navigation with standard fluoroscopy and/or CT

for exact localization of the necrotic lesion. This serves to

increase accuracy of the core placement into the necrotic

lesion while decreasing the total radiation exposure. We

are scientifically studying the benefit of this modality.

There are several unique benefits to this procedure,

namely its ability to preserve the native hip in young

patients. In addition, there are no bridges burned should

this procedure fail [5]. Lastly there is the potential to return

to full-time activity in heavy work or athletics. The greatest

drawback is prolonged protective weightbearing approxi-

mately 3 to 4 months if no preoperative collapse, or

6 months if preoperative collapse was present. The pro-

cedure is criticized for prolonged operative time; however

in our hands it is usually 3 hours ± 30 minutes. The donor

site morbidity has been minimal [19]. The most common

complication, occurring in 3% of patients, is a flexion

contracture of the flexor hallucis longus (FHL). If this

becomes bothersome to the patient it can easily be cor-

rected with ‘‘Z’’ lengthening of the tendon at the ankle

level. Only one patient has had a persistent distal tibio-

fibular syndesmotic problem advanced enough to warrant

surgery. Expense is also often cited as a negative factor;

however, there is no cost for the implant (which may be

considerable in the lifetime of a young patient) and the

duration of hospital stay is only 3 days.

We believe the left femoral head is uniquely involved in

pregnancy-related osteonecrosis because the growing fetus

and uterus compress the left common iliac vein, which is

directly posterior to the uterus on the left side. Such com-

pression decreases venous egress from the femoral head, in

turn increasing vascular capacitance, thus decreasing arte-

rial perfusion, and ultimately resulting in an intraosseous

compartment syndrome. This local anoxia leads to the

demise of bone-forming and supporting cells. Perhaps there

is also some synergy between the hypercoagulability of

pregnancy and this femoral head venous congestion.

Patients who have undergone either solid organ or bone

marrow transplantation are, with few exceptions, commit-

ted to a prolonged period of corticosteroid administration

to curtail immunologic-mediated rejection. Although the

benefits of steroids in this context are unquestioned for

prolonging life, such chronic exposure to high levels of

steroids exposes this group of patients to a high risk of

developing osteonecrosis of the femoral head(s). We have

observed several unique features within this particular

group of patients. Patients who have undergone


123

transplantation and who have ONFH tend to have larger

necrotic areas within the femoral heads; bilateral involve-

ment is more common than unilateral disease, and these

patients tend to present later in the disease process than

patients with ONFH from other causes. We believe this is

primarily because the requisite steroids suppress the oste-

onecrosis-related synovitis, which often alerts the patients

to the presence of the disease process.

While we continue to have success with the FVFG in

younger patients with idiopathic ONFH, we have also used

this procedure to treat special subsets of patients repre-

sented in this paper. We present our data for these groups

and contend the FVFG remains a reasonable option in the

treatment of ONFH.

Acknowledgments We thank Dawn Pedrotty, PhD, MS, and

Jennifer Friend for their assistance in gathering the data for this paper.

References

1. Aldridge JM 3rd, Berend KR, Gunneson EE, Urbaniak JR. Free

vascularized fibular grafting for the treatment of postcollapse

osteonecrosis of the femoral head. Surgical Technique. J BoneJoint Surg Am. 2004;86(Suppl 1):87–101.

2. Aldridge JM 3rd, Urbaniak JR. Avascular necrosis of the femoral

head: role of vascularized bone grafts. Orthop Clin North Am.

2007;38:13–22.

3. Bachiller FG, Caballer AP, Portal LF. Avascular necrosis of the

femoral head after femoral neck fracture. Clin Orthop Relat Res.

2002;399:87–109.

4. Berend KR, Gunneson E, Urbaniak JR, Vail TP. Hip arthroplasty

after failed free vascularized fibular grafting for osteonecrosis in

young patients. J Arthroplasty. 2003;18:411–419.

5. Dean GS, Kine RC, Fithc RD, Gunneson EE, Urbaniak JR. Treatment

of osteonecrosis in the hip of pediatric patients by free vascularized

fibular graft. Clin Orthop Relat Res. 2001;386:106–113.

6. Dedrick DK, Mackenzie JR, Burney RE. Complications of fem-

oral neck fracture in young adults. J Trauma. 1986;26:932–937.

7. Herberts P, Malchau H. How outcome studies have changed total

hip arthroplasty practices in Sweden. Clin Orthop Relat Res.

1997;344:44–60.

8. Johnsen SP, Sorensen HT, Lucht U, Soballe K, Overgaard S,

Pedersen AB. Patient-related predictors of implant failure after

primary total hip replacement in the initial, short- and long-terms.

A nationwide Danish follow-up study including 36,984 patients.

J Bone Joint Surg Br. 2006;88:1303–1308.

9. Krahn TH, Canale ST, Beatty JH, Warner WC, Lourenco P. Long

term follow-up of patients with avascular necrosis after treatment

of slipped capital femoral epiphysis. J Pediatr Orthop.

1993;13:154–158.

10. LeCroy CM, Rizzo M, Gunneson EE, Urbaniak JR. Free vascu-

larized fibular bone grafting in the management of femoral neck

nonunion in patients younger than fifty years. J Orthop Trauma.

2002;16:464–472.

11. Manley MT, Capello WN, D’Antonio JA, Edidin AA, Geesink

RG. Fixation of acetabular cups without cement in total hip

arthroplasty. A comparision of three different implant surfaces at

a minimum duration of follow-up of five years. J Bone Joint SurgAm. 1998;80:1175–1185.

12. Marciniak D, Furey C, Shaffer JW. Osteonecrosis of the femoral

head. A study of 101 hips treated with vascularized fibular

grafting. J Bone Joint Surg Am. 2005;87:742–747.



adults. J Bone Joint Surg Br. 1965;47:612–633.

14. Montella BJ, Nunley JA, Urbaniak JR. Osteonecrosis of the

femoral head associated with pregnancy. A preliminary report.


15. Prudhommeaux F, Hamadouche M, Nevelos J, Doyle C,

Meunier A, Sedel L. Wear of alumina-on-alumina total hip

arthroplasties at a mean 11-year followup. Clin Orthop RelatRes. 2000;379:113–122.


for staging avascular necrosis. J Bone Joint Surg Br. 1995;77:34–

41.

17. Stubbs AJ, Gunneson EE, Urbaniak JR. Pediatric femoral avas-

cular necrosis after pyarthrosis. Use of free vascularized fibular

grafting. Clin Orthop Relat Res. 2005;439:193–200.

18. Tooke SM, Favero KJ. Femoral neck fractures in skeletally

mature patients, fifty years old or less. J Bone Joint Surg Am.

1985;67:1255–1260.

19. Vail TP, Urbaniak JR. Donor-site morbidity with use of vascu-

larized autogenous fibular grafts. J Bone Joint SurgAm.1996;78:204–211.

20. Veillette CJ, Mehdian H, Schemitsch EH, McKee MD. Survi-

vorship analysis and radiographic outcome following tantalum

rod insertion for osteonecrosis of the femoral head. J Bone JointSurg Am. 2006;88:48–55.

21. Zhang C, Zeng B, Xu Z, Song W, Shao L, Jing D, Sui S.

Treatment of femoral head necrosis with free vascularized fibular

grafting: a preliminary report. Microsurgery. 2000;25:305–309.


123


Nonvascularized Bone Grafting Defers Joint Arthroplasty in HipOsteonecrosis

Thorsten M. Seyler MD, David R. Marker BS,

Slif D. Ulrich MD, Tobias Fatscher BS,

Michael A. Mont MD



Abstract A variety of nonvascularized bone grafting

techniques have been proposed with varying degrees of

success as treatment alternatives for osteonecrosis of the

femoral head. The success of these procedures may be

enhanced using ancillary growth and differentiation fac-

tors. We retrospectively reviewed 33 patients (39 hips)

with osteonecrosis of the hip who had nonvascularized

bone grafting procedures with supplemental OP-1. We

compared the outcomes in this cohort to similar patients

treated nonoperatively or with other nonvascularized bone

grafting procedures. We used a trapdoor to make a window

at the head-neck junction to remove necrotic bone and

packed the excavated area with autogenous cancellous

bone graft, marrow, and OP-1. The minimum followup was

24 months (mean, 36 months; range, 24–50 months). We

performed no further surgery in 25 of 30 small- and

medium-sized lesions (80%) but did in two of nine large

lesions. Hips with Ficat Stage II disease were not reoper-

ated in 18 of 22 cases during the followup periods. Our

short-term results compare similarly to nonoperative

treatment and other reports of nonvascularized bone

grafting. With the addition of ancillary growth factors,

these procedures effectively reduce donor site morbidity

and may defer joint arthroplasty in selected patients.



of evidence.

Introduction

Osteonecrosis of the femoral head is a devastating disease

that often leads to destruction of the hip and the need for

total hip arthroplasty [32, 35]. Annual reports from various

joint registries such as the Canadian Joint Replacement

Registry, the Australian National Joint Replacement Reg-

istry, and the Swedish Hip Arthroplasty Register have

demonstrated that the diagnosis of osteonecrosis accounts

for between 2.8% to 6% of all primary total hip arthro-

plasties performed [1, 7, 60]. In early stages of the disease,

head-preserving treatment modalities such as core decom-

pression, osteotomy, and vascularized or nonvascularized

bone grafting are often utilized to defer head-replacing

options such as total hip arthroplasty [32, 35].

The rationale for the use of nonvascularized bone grafting

is to remove necrotic bone and replace it with cancellous and

cortical autografts that support the subchondral bone and

articular cartilage of the femoral head and may stimulate

bone formation [11, 43]. Three different surgical techniques

have been popularized for nonvascularized bone grafting:


(e.g., consultancies, stock ownership, equity interest, patent/licensing






Electronic supplementary material The online version of thisarticle (doi:10.1007/s11999-008-0211-x) contains supplementarymaterial, which is available to authorized users.

T. M. Seyler, D. R. Marker, S. D. Ulrich, T. Fatscher,

M. A. Mont (&)

Rubin Institute for Advanced Orthopedics, Center for Joint

Preservation and Reconstruction, Sinai Hospital of Baltimore,

2401 West Belvedere Avenue, Baltimore, MD 21215, USA


T. M. Seyler

Department of Orthopaedic Surgery, Wake Forest University,

Winston-Salem, NC, USA

123


DOI 10.1007/s11999-008-0211-x

http://dx.doi.org/10.1007/s11999-008-0211-x

(1) grafting through a core decompression tract (Phemister

technique) (Appendix 1 -Supplemental Website Materials;

supplemental materials are available with the online version

of CORR ) [2–4, 24, 43, 55]; (2) grafting through a window

or trapdoor in the articular cartilage (Appendix 2 - Supple-

mental Website Materials; supplemental materials are

available with the online version of CORR) [21, 28–30]; and

(3) grafting through a window made in the femoral neck or

femoral head-neck junction (Fig. 1) [31, 48]. Each of these

techniques has its advantages and its limitations. While

earlier studies of nonvascularized bone grafting through a

core tract or cartilage window reported promising clinical

results [2, 6, 24, 29, 48], later studies using this technique

reported less favorable outcomes [9, 39].

The use of OP-1 (BMP 7) in combination with allograft

has been applied in various bone healing applications

(nonunions, trauma, spine fusion) [36]. For osteonecrosis,

it was used in a canine model in which defects treated with

OP-1 and bone grafting healed faster radiographically than

defects simply treated with bone grafting [34]. This study

provided a rationale for the possible use of OP-1 in com-

bination with allograft to heal human osteonecrotic defects.

We describe the principles, indications, and surgical

techniques for nonvascularized bone grafting through a

window made at the femoral head-neck junction. We asked

whether this technique effectively and similarly deferred

further surgical treatment options when compared to those

reported in studies using nonoperative treatment. In addi-

tion, we questioned how these outcomes compared to other

studies of nonvascularized bone grafting.



osteonecrosis of the femoral head who had nonvascular-

ized bone grafting procedures with supplemental OP-1

performed consecutively for the appropriate indications

between December 1, 2002, and January 1, 2004. Indi-

cations for the procedure were Ficat and Arlet Stage II or

III lesions that met various intraoperative criteria (descri-

bed later). There were 15 women (16 hips) and 18 men

(23 hips) who had a mean age of 35 years (range, 18–

52 years). The mean body mass index was 27.2 kg/m2

(range, 19.4–36.0 kg/m2). No patients were lost to fol-

lowup. Minimum followup was 24 months (mean,

36 months; range, 24–50 months). After obtaining institu-

tional review board approval, a prospective database was

used to collect relevant surgical, clinical, and radiographic

data.

We identified the following risk factors and associated

conditions with osteonecrosis of the femoral head: corti-

costeroid usage (defined as a dose greater than 2 g

prednisone or its equivalent per month for 3 months min-

imum [42]) in 9 patients (12 hips), alcohol abuse (defined

as alcohol consumption of more than 400 mL per week

[25]) in 8 patients (eight hips), systemic lupus erythemat-

osus in 6 patients (seven hips), tobacco abuse (defined as

20 cigarettes or more per day [25]) in 3 patients (four hips),

hepatitis C in 2 patients (three hips), and HIV infection in 2

patients (two hips). Of the remaining 4 patients (four hips),

one each had an underlying diagnosis of ulcerative colitis,

sickle cell disease, high levels of plasminogen activator

inhibitor with hypofibrinolysis, and chronic obstructive

pulmonary disease. Three patients (four hips) had no

apparent associated risk factors and were deemed idio-

pathic osteonecrosis. Some patients had more than one

associated risk factor.

We (TMS, SDU) assessed patients using the Harris hip

rating system [14]. We defined failure as patients who

underwent total hip arthroplasty surgery.

Anteroposterior and lateral radiographs were made

preoperatively and postoperatively at 6 weeks, 3 months,

6 months, 1 year, and annually thereafter. We determined

Ficat and Arlet stage [10], combined Kerboul angle [12],

presence or absence of new bone formation, location of the

Fig. 1 The five key steps for vas-

cularized bone grafting through a

window made in the femoral neck

or femoral head-neck junction are

illustrated.

1126 Seyler et al. Clinical Orthopaedics and Related Research

123

lesion, and disease progression. Preoperative radiographs

were evaluated by two of us (TMS, SDU) to determine the

staging according to the system by Ficat and Arlet. The

size of the lesions was measured using the combined

necrotic angle technique described by Kerboul et al. [19].

The combined angle is derived from evaluating antero-

posterior and lateral radiographs by adding the sums of the

angle of the lesions delineated on each view. In vague

cases in which the lesion was not clearly demarcated on

plain radiographs, MRI and computed tomography evalu-

ations were used to assist in the evaluation of lesion size.

Using this method, the extent of the necrosis was stratified

into three categories: (1) large lesions, when the combined

necrotic angle was 200� or greater; (b) medium lesions,

when the angle was between 150� and 200�; and (c) small

lesions, when the angle was 150� or less. The location of

the lesion was defined using a system initially described by

Ohzono et al. [41]. Lesions were classified as type A, B,

C1, or C2. A Type A lesion was one that occupied the

medial third or less of the weight-bearing portion. A Type

B lesion occupied the medial two-thirds or less of the

weight-bearing portion. A Type C lesion occupied more

than the medial two-thirds of the weight-bearing portion.

The subtypes C1 and C2 were used to further stratify the C

type lesions with a Type C2 lesion extending laterally to

the acetabular edge, whereas a Type C1 lesion did not.

Because of the possible introduction of error assessing

radiographic measurements, an evaluation of interobserver

and intraobserver error in radiographic assessment was

performed by two of us (TMS, SDU) before reviewing

study-related radiographs. The intraobserver agreement

was 100% in the 10 pilot cases and the interobserver

agreement was an exact match in 90% of the pilot cases. To

guarantee objectivity and avoid the problem of intraob-

server and interobserver variability in assessing the various

radiographic parameters, two of the authors (TMS, SDU)

independently evaluated the radiographs 2 weeks apart. If

there was a disagreement, the senior author (MAM) inter-

preted the films until a unanimous decision could be made

regarding the best estimate at staging, size, or extent of

collapse of lesion evaluation. The various radiographic

variables (Ficat and Arlet stage and Kerboul angle) were

assessed to see whether they had any prognostic value. Of

the 39 hips, 22 hips were classified as Ficat and Arlet Stage

II and 17 hips were classified as Ficat and Arlet Stage III

preoperatively. The assessment of lesions size using the

Kerboul technique revealed seven small lesions, 23 med-

ium lesions, and nine large lesions.

All procedures were performed by the senior author

(MAM) using a trapdoor made at the femoral head-neck

junction (Fig. 1). Large lesions were not considered a

contraindication for the present patient cohort. The tech-

nique [48, 49] was performed using the anterolateral

approach (Watson-Jones [62]) with the patient lying in the

lateral decubitus position. The skin incision was started just

distal to the anterosuperior iliac spine and carried out to a

point just posterior to the greater trochanter. The incision

was then angled at about 110� anteriorly and extended

distally to parallel the femoral shaft for 8 to 10 cm. In the

next step, the interval between the tensor fascia latae

muscle and the gluteus medius muscle was identified by

dividing the gluteus maximus fascia and the fascia latae.

The dissection was carefully extended proximally to

expose but protect the superior gluteal nerve. The fascia

latae was then split in the direction of the skin incision and

the anterior 40% of the gluteus medius was detached and

retracted posteriorly. The gluteus minimus muscle was

detached fully revealing the capsule with the head of the

rectus femoris muscle attached to the upper part of ace-

tabular rim. The capsule was then excised with the labrum

left intact and the capsule peeled anteriorly to preserve the

medial circumflex artery and its branches posteriorly. This

approach allowed for preservation of the blood supply to

the femoral head. We inspected the femoral head cartilage

in situ by rotating and distracting the femur without dis-

locating the femoral head. The femoral head cartilage was

then inspected to ascertain whether there were any full-

thickness defects or areas of delaminated cartilage. We

considered a defect of 1 cm or greater, cartilage delami-

nation, or erosive areas as contraindications for performing

this bone grafting procedure. This occurred in five cases

during the time period of the study and these patients

received a total hip arthroplasty. An approximate 2-cm 9

2-cm window was then made at the femur head-neck

junction (trapdoor) using a microoscillating saw and os-

teotomes. The window segment was preserved and stored

in normal saline-wrapped gauze for replacement at the end

of the procedure. A 6-mm mushroom-tipped burr was used

to debride necrotic bone in the femoral head using the

trapdoor as an entrance point. If 70% or more of the

femoral head was involved with the disease (necrotic

bone), the procedure was abandoned and a hip arthroplasty

was performed. Accidental head penetration with the burr

was avoided. The cavity was filled with cancellous bone

chips and bone marrow. In addition, recombinant human

bone morphogenetic protein 7 was added to promote new

bone formation. Each sterile unit of implant contained

3.5 mg OP-1 (purchased from Stryker Biotech, Hopkinton,

MA) mixed with 1 g Type I bovine bone-derived collagen.

The material was tightly packed into the cavity with a

layered approach and the saved bony window segment was

put back and fixed with three, 2-mm poly-p-dioxanone

resorbable pins (Orthosorb1, Johnson and Johnson, New

Brunswick, NJ). Finally, the hip was relocated, and the

gluteus minimus muscle was reattached to bone and the

gluteus medius muscle and fascia latae were repaired with

Volume 466, Number 5, May 2008 Nonvascularized Bone Grafting in Hip ON 1127

123

interrupted sutures. The procedure had a mean operative

time of 62 minutes (range, 37–102 minutes).

All patients were maintained at toe-touch weightbearing

with two crutches or a walker for 5 to 6 weeks. For the next

5 to 6 weeks, patients were advanced to approximately

50% weightbearing using a cane or crutch in the opposite

hand. Patients were then advised to start full weightbearing

as tolerated at 10 weeks postoperatively. Participation in

sports and higher impact loading activities such as running

were not recommended for the first 10 months

postoperatively.

Survival was defined by whether the patient had sub-

sequent surgery on the hip.

To assess how the results of the procedures for our

cohort compared other nonvascularized bone grafting

procedures in similarly aged patients at a similar length of

followup, the authors carried out an extensive literature

review of the databases of the National Library of Medi-

cine, the National Institutes of Health, and EMBASE. We

identified all articles concerning nonvascularized bone

grafting for osteonecrosis of the femoral head. The key

words used in the search were ‘‘hip,’’ ‘‘femoral head,’’

‘‘osteonecrosis,’’ ‘‘avascular necrosis,’’ and ‘‘necrosis.’’

The initial search was refined with the addition of the

keywords ‘‘core decompression,’’ ‘‘bone grafting,’’ ‘‘non-

vascularized,’’ ‘‘trapdoor,’’ and ‘‘lightbulb’’ [49]. All

articles identified in this manner were then subject to a

review by two of us (TMS, DRM, MAM, or TF). The

search revealed 26 published studies. A similar review was

conducted to identify reports of nonoperative treatment for

osteonecrosis of the head. This search revealed 11 reports.

For both the nonoperative and nonvascularized bone

grafting literature reviews we collected the following data:

failure rates (in terms of later receiving a total hip arthro-

plasty), surgical technique, bone grafting procedure, and

demographic variables.

Results

Overall, 26 of the hips survived out of the 39 hips treated

(67%). At most recent followup, 24 of the 30 hips (80%)

with small- or medium-sized lesions had avoided further

surgery. Patients with large lesions fared poorly with only

two of nine hips avoiding further surgery. When stratified

by Ficat and Arlet stage, 18 of the 22 hips with Stage II

disease did not undergo further surgery. Stage III hips were

less successful with only eight of 17 hips surviving. There

were similar results when analyzing location of lesion, with

more lateral lesions faring more poorly than centrally

located lesions (Table 1). Failures (n = 13) had a mean

time to femoral head collapse of 13 months (range,

2–34 months) (Table 2).

The mean preoperative Harris hip scores for all patients

in this series was 50 points (range, 28–76 points). The

preoperative scores for the hips that subsequently failed

(mean, 47 points; range, 28–72 points) were similar

(p = 0.175) to those of the survival group (mean, 52 points;

range, 28–76 points). At a mean followup of 35 months, the

mean postoperative score for the entire series improved to

75 points (range, 27–100 points) (p \ 0.001). There were

no perioperative complications documented.

Medically, one patient had a urinary tract infection

which resolved without any sequelae. There were no other

medical complications.

The overall early clinical success (defined as not later

undergoing total hip arthroplasty) rate of 67% (26 of 39

hips) for this procedure as well as the 80% (24 of 30 hips)

success rate for small and medium sized lesions compared

similarly to other nonvascularized procedures performed at

similar mean followup (range, 28–144 months) (Table 3).

We have also provided results of nonoperative studies for

comparison (Table 4).

Discussion

Nonvascularized bone grafting techniques for the treatment

of osteonecrosis of the femoral head were popularized in

the 1950s and 1960s [3, 4, 43]. The literature reports a wide

range of success rates with these techniques and this may

be a result of the various surgical techniques and/or reflect

the problem of choosing the appropriate treatment modality

for the various disease stages. We evaluated our recent

Table 1. Correlation between lesion size, location, Ficat and Arlet

stage, and incidence of collapse

Number

of hips

Number

collapsed

Incidence

of collapse

Lesion Size

Small 7 1 13%

Medium 23 5 17%

Large 9 7 78%

Location of Lesion

A 8 1 13%

B 12 5 42%

C1 12 2 17%

C2 7 5 71%

Ficat and Arlet Stage

Stage I 0 NA NA

Stage II 22 4 18%

Stage III 17 9 53%

Stage IV 0 NA NA

NA = not applicable.


123

experience with nonvascularized bone grafting. The pri-

mary questions were whether this technique effectively

deferred further surgical treatment when compared to those

reported in studies using nonoperative treatment. In addi-

tion, we questioned whether the outcomes in this study

were comparable to other studies of nonvascularized bone

grafts.

Our study has several shortcomings including the small

number of patients and the short-term followup. Never-

theless, the early results encourage the continued use and

further study of this procedure. A larger series with longer

followup will further help assess positive and negative

predictors of outcome.

Several authors have described results comparable to

ours using variations of these nonvascularized bone graft-

ing procedures. Saito et al. [51] reported various treatment

modalities for idiopathic necrosis of the femoral head.

Their series included 18 hips with Ficat and Arlet Stage II

osteonecrosis treated with a similar technique of nonvas-

cularized bone grafting using cancellous bone obtained

from the ipsilateral iliac crest. At a minimum followup of

24 months (mean, 48 months; range, 24–144 months), the

clinical evaluation revealed Merle D’Aubigne [27] scores

of 15 or more points in 13 of 18 hips. However, radio-

graphic results demonstrated less favorable results, with

seven of the 18 hips showing progressive femoral head

collapse. We included both Ficat and Arlet Stage II and III

hips, which may have contributed to the slightly lower

chance of having a Harris hip score above 70.

The percentage of hips in our cohort of patients with

nonvascularized bone grafting patients whom we consid-

ered had success treatment (67%) was similar to that in

other reports in the literature (Table 3). The clinical

success of the lightbulb technique ranged from 68% to 87%

compared to a range of 36% to 90% reports for the

Phemister technique. Similarly, the clinical success of the

trapdoor technique ranged from 71% to 89%.

The proportion of nonvascularized bone grafting

patients in our cohort who underwent total hip replacement

(67%) was lower than six of the 11 studies that reported the

outcomes of patients who were treated nonoperatively. The

success (defined as not having total hip replacement by

final followup) in studies from 1986 to 2007 of nonoper-

ative treatment ranged from 9% to 86% (Table 4).

Other authors combined this technique with intertro-

chanteric osteotomy, use of growth factors, or gluteus

medius muscle pedicle bone graft [31, 48, 52]. Scher and

Jakim [52] prospectively studied 45 hips with Ficat and

Arlet Stage III osteonecrosis treated with intertrochanteric

osteotomy and nonvascularized bone grafting through a

window in the femoral neck. The 5-year survival rate was

87%. This encouraging survival rate, however, should be

critically evaluated because of the stringent inclusion cri-

teria that were employed. The study included only patients

younger than 45 years of age, with Ficat and Arlet Stage III

of the anterosuperior part of the femoral head, with no

underlying metabolic bone disease or systemic condition

treated with chemotherapy or corticosteroids, and with no

extensive involvement of the posterior part of the femoral

head. Rosenwasser et al. [48] reported the long-term results

of their series using the lightbulb technique. At a minimum

followup of 120 months (mean, 144 months; range, 120–

180 months), the survival rate was 87% with minimal

disease progression. In three patients, the authors used a

gluteus medius muscle pedicle graft to augment blood

supply to the femoral neck. Mont et al. [31] reported on a

Table 2. Characteristics of clinical failures

t Age Gender Risk factors Ficat and

Arlet stage

Lesion size

(Kerboul)

Location

of lesion

Time to failure

(months)

1 36 Male hyperlipidemia, smoking II Medium B 16

2 22 Male alcohol III Large B 31

3 51 Female SLE, corticosteroids III Large C1 12

4 27 Female SLE, corticosteroids II Medium B 8

5 37 Male HIV, hepatitis C III Large C2 6

6 30 Female SLE, corticosteroids II Small B 34

7 36 Male alcohol, smoking III Large C2 2

8 44 Female SLE, corticosteroids III Large B 16

9 52 Male HIV, hepatitis C III Large C2 8

10 31 Female SLE, corticosteroids II Medium A 24

11 55 Female SLE, corticosteroids II Medium C2 10

12 29 Female alcohol, smoking III Large C1 7

13 41 Male corticosteroids II Medium C2 9

SLE = systemic lupus erythematosus.


123

series of 19 patients (21 hips) treated with bone morpho-

genetic protein-enriched allograft to avoid donor site

morbidity. At a minimum followup of 36 months (mean,

48 months; range, 36–55 months), three hips had failed the

bone grafting procedure. Interestingly, all failures occurred

in hips with large-sized lesions, suggesting lesion size was

associated with failure.

Despite the limitations of the study, we are encouraged

by these early results using cancellous bone chips, bone

marrow, and bone morphogenetic protein-7 as a nonvas-

cularized bone grafting technique for the treatment of Stage

II and III osteonecrosis of the femoral head. The decreased

progression of symptoms at a mean of 36 months suggests

the natural progression of the disease and subsequent hip

arthroplasty surgery has been delayed. This technique is

straightforward, has low donor site morbidity, and

Table 3. Literature review of nonvascularized bone grafting techniques

Study Year Hips Followup (months) Clinical

success (%)

Radiographic

success (%)

Trapdoor technique

Meyers et al. [29] 1983 21 NA 71 NA

Meyers et al. [29] 1991 9 35 (12–107) 89 NA

Ko et al.* [21] 1995 14 53 (24–108) 85 70

Mont et al. [33] 1998 30 56 (30–60) 73 73

Phemister technique

Bonfiglio and Voke [4] 1968 116 67 (24–204) 78 NA

Boettcher et al. [2] 1970 38 72 (24–204) 79 76

Marcus et al. [24] 1973 11 N/A (24–48) 90 91

Dunn and Grow [9] 1977 23 40 (27–98) 74 30

McBeath and Oeljen [26] 1977 6 NA 83 0

Smith et al. [55] 1980 56 144 (24–332) 57 NA

Steinberg et al. [57] 1984 19 [ 6 82 36

Buckley et al. [6] 1991 20 96 (24–228) 90 90

Nelson and Clark [39] 1993 52 NA (24–144) 77 13

Steinberg et al. [58] 2001 312 63 (23–146) 64 61

Mont et al. [31] 2003 21 48 (36–55) 86 76

Plakseychuk et al. [45] 2003 50 60 (36–96) 36 28

Rijnen et al. [46] 2003 28 50 (24–119) 71 57

Lieberman et al. [23] 2004 17 53 (26–94) 82 82

Kim et al. [20] 2005 30 50 (36–67) 78 80

Israelite et al. [16] 2005 276 N/A (24–145) 62 NA

Wang et al. [61] 2005 28 26 (24–39) 68 64

Keizer et al. [18] 2006 80 84 (36–NA) 46 43

Lightbulb technique

Saito et al. [51] 1988 18 48 (24–168) 72 61

Scher and Jakim* [53] 1993 45 65 (36–126) 87 71

Rosenwasser et al. [48] 1994 15 138 (108–180) 86 86

Mont et al. [31] 2003 21 48 (36–55) 86 NA

Our study 2007 47 28 (12–50) 68 64

NA = data not available; *combined with osteotomy.

Table 4. Literature review of nonoperative treatment outcomes

Musso et al./1986 [38] 50 30 32

Steinberg et al./1989 [56] 55 21 (6–120) 16

Churchill and Spencer/1991 [8] 18 60 50

Stulberg et al./1991 [59] 22 27 9

Robinson and Springer/1992 [47] 16 39 (24–61) 56

Bradway and Morrey/1993 [5] 15 23 (3–66) 13

Jergesen and Khan/1997 [17] 19 111 (51–81) 42

Lai et al./2005 [22] 25 24 32

Hernigou et al./2006 [15] 121 168 (120–240) 25

Neumayr et al./2006 [40] 21 36 86

Morse et al./2007 [37] 67 23 (17–31) 70

*Defined as not requiring conversion to total hip arthroplasty by final

followup.


123

demonstrates a high degree of efficacy for Stage II and

small to medium sized lesions.

Acknowledgments We thank Colleen Kazmarek for her assistance

in the preparation of this manuscript.

References

1. Australian Orthopaedic Association Web site. The National

Joint Replacement Registry: Annual Report. Available at: http://

www.dmac.adelaide.edu.au/aoanjrr/documents/aoanjrr_2006_

supplementary.pdf. Accessed March 15, 2007.

2. Boettcher WG, Bonfiglio M, Smith K. Non-traumatic necrosis of

the femoral head. II. Experiences in treatment. J Bone Joint SurgAm. 1970;52:322–329.

3. Bonfiglio M, Bardenstein MB. Treatment by bone-grafting of

aseptic necrosis of the femoral head and non-union of the femoral

neck (Phemister technique). J Bone Joint Surg Am. 1958;40:

1329–1346.

4. Bonfiglio M, Voke EM. Aseptic necrosis of the femoral head and

non-union of the femoral neck. Effect of treatment by drilling and

bone-grafting (Phemister technique). J Bone Joint Surg Am.

1968;50:48–66.

5. Bradway JK, Morrey BF. The natural history of the silent hip in

bilateral atraumatic osteonecrosis. J Arthroplasty. 1993;8:383–387.

6. Buckley PD, Gearen PF, Petty RW. Structural bone-grafting for

early atraumatic avascular necrosis of the femoral head. J BoneJoint Surg Am. 1991;73:1357–1364.

7. Canadian Institute for Health Information Web site. Canadian

Joint Replacement Registry: Annual Report. Available at:

http://secure.cihi.ca/cihiweb/dispPage.jsp?cw_page = services_

cjrr_e#publications. Accessed April 1, 2007.

8. Churchill MA, Spencer JD. End-stage avascular necrosis of bone

in renal transplant patients. The natural history. J Bone Joint SurgBr. 1991;73:618–620.

9. Dunn AW, Grow T. Aseptic necrosis of the femoral head.

Treatment with bone grafts of doubtful value. Clin Orthop RelatRes. 1977;249–254.



11. Ganz R, Buchler U. Overview of attempts to revitalize the dead

head in aseptic necrosis of the femoral head–osteotomy and

revascularization. Hip. 1983;296–305.

12. Gibson A. Posterior exposure of the hip joint. J Bone Joint SurgBr. 1950;32:183–186.

13. Hardinge K. The direct lateral approach to the hip. J Bone JointSurg Br. 1982;64:17–19.







16. Israelite C, Nelson CL, Ziarani CF, Abboud JA, Landa J,

Steinberg ME. Bilateral core decompression for osteonecrosis of

the femoral head. Clin Orthop Relat Res. 2005;441:285–290.

17. Jergesen HE, Khan AS. The natural history of untreated asymp-

tomatic hips in patients who have non-traumatic osteonecrosis.


18. Keizer SB, Kock NB, Dijkstra PD, Taminiau AH, Nelissen RG.

Treatment of avascular necrosis of the hip by a non-vascularised

cortical graft. J Bone Joint Surg Br. 2006;88:460–466.







2005;87:2012–2018.

21. Ko JY, Meyers MH, Wenger DR. ‘‘Trapdoor’’ procedure for

osteonecrosis with segmental collapse of the femoral head in

teenagers. J Pediatr Orthop. 1995;15:7–15.

22. Lai KA, Shen WJ, Yang CY, Shao CJ, Hsu JT, Lin RM. The use

of alendronate to prevent early collapse of the femoral head in

patients with nontraumatic osteonecrosis. A randomized clinical


23. Lieberman JR, Conduah A, Urist MR. Treatment of osteone-

crosis of the femoral head with core decompression and human

bone morphogenetic protein. Clin Orthop Relat Res. 2004;429:

139–145.

24. Marcus ND, Enneking WF, Massam RA. The silent hip in idio-

pathic aseptic necrosis. Treatment by bone-grafting. J Bone JointSurg Am. 1973;55:1351–1366.

25. Matsuo K, Hirohata T, Sugioka Y, Ikeda M, Fukuda A. Influence

of alcohol intake, cigarette smoking, and occupational status on

idiopathic osteonecrosis of the femoral head. Clin Orthop RelatRes. 1988;234:115–123.

26. McBeath AA, Oeljen CG. Phemister bone graft for osteonecrosis

post renal transplant. Clin Orthop Relat Res. 1977:164–168.

27. Merle D’Aubigne R. [Numerical classification of the function of

the hip. 1970]. Rev Chir Orthop Reparatrice Appar Mot.1990;76:371–374.



adults. Journal of Bone and Joint Surgery Br. 1965;47:612–633.

29. Meyers MH, Jones RE, Bucholz RW, Wenger DR. Fresh

autogenous grafts and osteochondral allografts for the treatment

of segmental collapse in osteonecrosis of the hip. Clin OrthopRelat Res. 1983;174:107–112.

30. Mont MA, Einhorn TA, Sponseller PD, Hungerford DS. The

trapdoor procedure using autogenous cortical and cancellous

bone grafts for osteonecrosis of the femoral head. J Bone JointSurg Br. 1998;80:56–62.

31. Mont MA, Etienne G, Ragland PS. Outcome of nonvascularized

bone grafting for osteonecrosis of the femoral head. Clin OrthopRelat Res. 2003;417:84–92.





growth and differentiation factors. Clin Orthop Relat Res.

1998;355(Suppl):S314–335.

34. Mont MA, Jones LC, Elias JJ, Inoue N, Yoon TR, Chao EY,

Hungerford DS. Strut-autografting with and without osteogenic

protein-1 : a preliminary study of a canine femoral head defect

model. J Bone Joint Surg Am. 2001;83:1013–1022.

35. Mont MA, Jones LC, Hungerford DS. Nontraumatic osteone-

crosis of the femoral head: ten years later. J Bone Joint Surg Am.

2006;88:1117–1132.

36. Mont MA, Ragland PS, Biggins B, Friedlaender G, Patel T, Cook

S, Etienne G, Shimmin A, Kildey R, Rueger DC, Einhorn TA.

Use of bone morphogenetic proteins for musculoskeletal appli-

cations. An overview. J Bone Joint Surg Am. 2004;86(Suppl

2):41–55.

37. Morse CG, Mican JM, Jones EC, Joe GO, Rick ME, Formentini

E, Kovacs JA. The incidence and natural history of osteonecrosis

in HIV-infected adults. Clin Infect Dis. 2007;44:739–748.


123

http://www.dmac.adelaide.edu.au/aoanjrr/documents/aoanjrr_2006_supplementary.pdf



http://secure.cihi.ca/cihiweb/dispPage.jsp?cw_page = ser�vices_cjrr_e#pub�li�ca�tions

http://secure.cihi.ca/cihiweb/dispPage.jsp?cw_page = ser�vices_cjrr_e#pub�li�ca�tions

38. Musso ES, Mitchell SN, Schink-Ascani M, Bassett CA. Results of

conservative management of osteonecrosis of the femoral head. A

retrospective review. Clin Orthop Relat Res. 1986;207:209–215.

39. Nelson LM, Clark CR. Efficacy of phemister bone grafting in

nontraumatic aseptic necrosis of the femoral head. J Arthroplasty.

1993;8:253–258.

40. Neumayr LD, Aguilar C, Earles AN, Jergesen HE, Haberkern

CM, Kammen BF, Nancarrow PA, Padua E, Milet M, Stulberg

BN, Williams RA, Orringer EP, Graber N, Robertson SM,

Vichinsky EP. Physical therapy alone compared with core

decompression and physical therapy for femoral head osteone-

crosis in sickle cell disease. Results of a multicenter study at a

mean of three years after treatment. J Bone Joint Surg Am.

2006;88:2573–2582.




42. Ono K, Tohjima T, Komazawa T. Risk factors of avascular

necrosis of the femoral head in patients with systemic lupus

erythematosus under high-dose corticosteroid therapy. ClinOrthop Relat Res. 1992;277:89–97.

43. Phemister DB. Treatment of the necrotic head of the femur in

adults. J Bone Joint Surg Am. 1949;31:55–66.

44. Phemister DB. Repair of bone in the presence of aseptic necrosis

resulting from fractures, transplantations, and vascular obstruc-

tion. 1930. J Bone Joint Surg Am. 2005;87:672.





46. Rijnen WH, Gardeniers JW, Buma P, Yamano K, Slooff TJ,

Schreurs BW. Treatment of femoral head osteonecrosis using

bone impaction grafting. Clin Orthop Relat Res. 2003;417:74–83.

47. Robinson Jr. HJ, Springer JA. Success of core decompression in

the management of early stages of avascular necrosis: A four year

prospective study. Orthop Trans. 1993;16:707.

48. Rosenwasser MP, Garino JP, Kiernan HA, Michelsen CB. Long

term followup of thorough debridement and cancellous bone

grafting of the femoral head for avascular necrosis. Clin OrthopRelat Res. 1994;306:17–27.

49. Rosenwasser MP, Michelsen CB, Kiernan HA. Treatment of

avascular necrosis of the femoral head with curettage, iliac

cacellous bone grafting, and revascularization with gluteus

muscle pedicle flap. Orthop Trans. 1983;7:396.

50. Rue JP, Inoue N, Mont MA. Current overview of neurovascular

structures in hip arthroplasty: anatomy, preoperative evaluation,

approaches, and operative techniques to avoid complications.

Orthopedics. 2004;27:73–81; quiz 82–73.


opathic avascular necrosis of the femoral head. Results of core


1988;70:78–84.

52. Scher MA, Jakim I. Intertrochanteric osteotomy and autogenous

bone-grafting for avascular necrosis of the femoral head. J BoneJoint Surg Am. 1993;75:1119–1133.

53. Scher MA, Jakim I. Late follow-up of femoral head avascular

necrosis managed by intertrochanteric osteotomy & bone graft-

ing. Acta Orthop Belg. 1999;65(Suppl 1):73–77.

54. Smith-Petersen MN. Evolution of mould arthroplasty of the hip

joint. J Bone Joint Surg Br. 1948;30:59–75.

55. Smith KR, Bonfiglio M, Montgomery WJ. Non-traumatic

necrosis of the femoral head treated with tibial bone-grafting. A

follow-up note. J Bone Joint Surg Am. 1980;62:845–847.





1989;249:199–208.




stimulation. Clin Orthop Relat Res. 1984:137–153.



for osteonecrosis of the femoral head. Clin Orthop Relat Res.2001;386:71–78.




60. Swedish Orthopaedic Association Web site.The Swedish Hip

Arthroplasty Register: Annual Report. Available at: http://

www.jru.orthop.gu.se/. Accessed March 15, 2007.

61. Wang CJ, Wang FS, Huang CC, Yang KD, Weng LH, Huang

HY. Treatment for osteonecrosis of the femoral head: comparison

of extracorporeal shock waves with core decompression and

bone-grafting. J Bone Joint Surg Am. 2005;87:2380–2387.

62. Watson-Jones R. Fractures of the neck of the femur. Br J Surg.

1935;23:787–808.


123


Long-term Followup of Vascularized Fibular Graftingfor Femoral Head Necrosis

Myung-Chul Yoo MD, PhD, Kang-Il Kim MD, PhD,

Chung-Soo Hahn MD, PhD, Javad Parvizi MD



Abstract Vascularized fibular grafting has been used for

treatment of osteonecrosis of the femoral head and although

some reports demonstrate successful short- to mid-term

outcomes, long-term results are still unknown. We retro-

spectively reviewed 135 patients (151 hips) who underwent

vascularized fibular grafting for osteonecrosis of the femoral

head. One-hundred and ten patients (124 hips) were followed

for a minimum 10 years (mean, 13.9 years; range, 10–

23.7 years). The mean Harris hip score improved from 72 to

88. At the latest followup, we found improved or unchanged

radiographs in 37 of 59 hips initially Stage II hips and 39 of

65 Stage III hips. Thirteen hips (13 patients) (10.5%) failed

treatment and underwent total hip arthroplasty. The location

and size of the necrotic lesion and the patient’s age influ-

enced long-term survival of the graft. Postoperative

complications included clawing of the big toe in 17 patients,

partial peroneal nerve palsy in two, and superficial infection

in two. Subtrochanteric fracture occurred in two hips. The

data suggest free vascularized fibular grafting was successful

in maintaining joint function and delaying the need for joint

replacement procedure. Graft survival was associated with

the patient’s age and size and location of the lesion but not

etiology and stages of the disease.



of evidence.

Introduction

Osteonecrosis of the femoral head (ONFH) typically

affects younger patients [23, 43]. Treatment options

include joint preserving procedures such as electrical

stimulation, drilling, core decompression, vascularized or

non-vascularized fibular grafting, and osteotomy; and joint

replacement procedures such as resurfacing and hemi- or

total hip arthroplasty (THA) [1, 2, 3, 11, 18, 28, 32, 34–36,

38, 41–44]. Early diagnosis and appropriate surgery may

reduce the risk of progression and improve the outcome [6,

12, 18, 19, 21, 24, 29]. Among the joint-preserving surgical

procedures, free vascularized fibular grafting (VFG)

reportedly has a survival of 61%–96% at mid-term (4–

7 years) followup [4, 16, 17, 20, 28, 31, 43, 44]. Although

VFG appears successful in the short- to mid-term [4, 16,

17, 19, 20, 28, 31, 43–45], its long-term benefits are not

known. While most authors report their results in relation

to preoperative etiology or collapse stage, the influence of

other variables (e.g., the radiographic extent or location of

the necrotic lesion) on long-term graft survival are also

unknown.





Each author certifies that his or her institution either has waived or

does not require approval for the human protocol for this investigation

and that all investigations were conducted in conformity with ethical

principles of research.

M.-C. Yoo (&), K.-I. Kim

Department of Orthopaedic Surgery, Center for Joint Diseases,

East-West Neo Medical Center, Kyung Hee University, 149

Sangil-dong, Gangdong-gu, Seoul 134-727, Korea


C.-S. Hahn

Department of Orthopaedic Surgery, Kyung Hee Medical

Center, Kyung Hee University, 1 Haegi-dong, Dongdaeman-gu,

Seoul 130-702, Korea

J. Parvizi

Rothman Institute at Thomas Jefferson University Hospital,

Philadelphia, PA, USA

123


DOI 10.1007/s11999-008-0204-9

We addressed the following questions: (1) Does this

procedure provide a long-term (10 years or more)

improvement in function (as measured by Harris hip

score)?; (2) Does the procedure avert the need for THA

and, if so, for how long?; (3) Do factors such as age, size

and location of the lesion, or etiology of the disease

influence long-term survivorship?; and (4) Does radio-

graphic appearance change over time?


We retrospectively reviewed 135 patients (151 hips) who

underwent free VFG in for Ficat and Arlet stage II and III

ONFH between August 1979 and December 1995 in a single

institution. Important clinical and imaging data including

patient age (two groups: younger than and older than

35 years at the time of operation), etiology, Harris hip score,

and various radiographic parameters (collapse stage, extent

of involvement, and location of the necrotic lesion) were

collected for all the patients. The outcome and survivorship

of VFG was evaluated using conversion to THA as the

endpoint. Seventeen patients (19 hips) died and eight patients

(eight hips) were lost to followup. This left 110 patients

(81%) with 124 hips for review. The minimum followup was

10 years (mean, 13.9 years; range, 10–23.7 years). There

were 94 men and 16 women with a mean age at surgery of

35.5 years (range, 13–63 years). The diagnosis of osteone-

crosis was confirmed in all cases by a histologic examination

of the subchondral bone that was obtained from a core biopsy

of the femoral head during the operation. We divided hips

into four groups based on etiology of the disease: idiopathic

(n = 59), alcoholic (n = 31), posttraumatic (n = 21), and

steroid-induced (n = 13) (Table 1).

We (KKI, PSW) examined the preoperative radiographs

of the patients to determine the location and size of the

necrosis as well as the presence or absence of collapse. For

the presence of radiographic collapse, we used the Ficat

and Arlet system [9] and for quantifying the lesion, the

Steinberg classification [37] was used. Size A lesions

involved less than 15% of the femoral head, Size B

involved 15% to 30%, and Size C involved more than 30%

of the femoral head. Also, for evaluating the location of the

lesion, the method by Sugano et al. [40] was used, which

was adopted as a classification by Ohzono et al. [27]. In

Type A, the lesion involved the medial third of the weight-

bearing dome (sourcil) of the acetabulum. Type B lesions

involved the middle third (medial two-thirds or less) of the

weight-bearing dome, and Type C lesions involved the

lateral third or more of the dome. Preoperatively, 59 hips

were classified as Ficat Stage II and 65 hips as Stage III.

Based on the Steinberg classification, 27 hips were Size A,

38 hips were Size B, and 59 hips were Size C. Based on

location of the lesion, nine hips were classified as Type A,

35 hips were Type B, and 80 hips were Type C (Table 2).

The operative technique has been previously described

[44] and was originally designed by the senior author

(YMC) [44]. One surgical team by the senior author

operates on the femoral side. Briefly, this involves expo-

sure of the femur using a Watson-Jones approach.

Following release of the gluteus maximus insertion and

release of the vastus lateralis from linea aspera the first or

the second perforating branch of the profunda femoris

artery was dissected carefully. In general, the second per-

forating branch was preferable for the recipient vessels

owing to enough length and diameter of the vessels. After

complete dissection of the recipient vessels, a large hole 2

cm in diameter in the lateral cortex just beneath the flare of

the trochanter was made. At this point we performed a

biopsy of the subchondral bone using an 8-mm trephine

directed towards the necrotic lesion. A tunnel was then

created in the femoral neck to admit the fibula and its

vessels without compressing them. The tunnel was directed

towards the lesion and as much of the subchondral bone as

possible was removed. At this point we brought the fibular

Table 1. Demographic data

Variables n

Average patient age (years) 35.5 (range, 13–63)

Number of hips B 35 years old 68

Number of hips [ 36 years old 56

Male:female 94:16

Mean patient weight (kg) 63.5 (range, 45–97)

Etiology (number of hips)

Idiopathic 59

Alcoholic 31

Posttraumatic 21

Steroid-induced 13

Table 2. Classifications of osteonecrosis of the femoral head

Variables Number of hips (%)

Ficat stage [9]

II 59 (47.6)

III 65 (52.4)

Steinberg classification [37]

A 27 (21.8)

B 38 (30.6)

C 59 (47.6)

Ohzono classification [27]

A 9 (7.3)

B 35 (28.2)

C 80 (64.5)

1134 Yoo et al. Clinical Orthopaedics and Related Research

123

graft harvested by another team (HCS) to the field and

performed the vascular anastomosis. The fibula was har-

vested using a curvilinear incision over the fibula of the

contralateral leg. The dissection then proceeded between

the peroneus longus and the soleus muscles. With careful

dissection of the flexor hallucis longus muscle, we exposed

the entire course of the peroneal artery. Then the antero-

lateral musculature attached to the fibula was released and

fibular freed from the interosseous membrane on the

medial side. We used the middle third of the fibula as the

graft. The peroneal vessels supplying this part of the fibula

are usually cut in a sufficient length after checking the

vascularity of the fibula with deflation of the tourniquet.

The average length of the harvested fibula usually ranged

from 8 to 10 cm. Our technique differs from others in some

respects. First, we have used the first or the second per-

forating branch of the profunda femoris artery rather than a

branch of lateral femoral circumflex artery. We think it is

easier and has less morbidity to the hip joint. We do not

routinely perform angiography to assess patency of the

anastomosed vessels. Instead we raise a small area of the

skin overlying fibula during harvest that allows monitoring

the vascular patency of the grafted fibula. We also perform

autografting of subchondral region using cancellous bone

chips obtained from the greater trochanter region.

We gave all patients antibiotic prophylaxis. Postopera-

tive thromboembolic prophylaxis included intravenous

infusion of dextran for 3 days after surgery and application

of compression stockings. Passive range-of-motion exer-

cises were encouraged after removal of suction drains on

Day 3. Postoperative rehabilitation included complete

nonweightbearing (wheelchair-bound) for 1 week, minimal

weightbearing and ambulation with crutches for 10 weeks,

followed by partial weightbearing for a total of 6 months.

Patients were encouraged to bear full weight after this

period. Because of the potential injury to the flexor hallucis

longus and the risk of clawing of the big toe from the fibular

harvest side, patients used a short leg splint including the

big toe for 3 weeks and we encouraged the patient to do

physiotherapy (active and passive dorsiflexion and plan-

tarflexion of the toe) for 6 months to prevent toe clawing.

Clinical evaluation was performed by the senior surgeon

(YMC) whenever the patient visited his outpatient clinic.

Clinical results were recorded preoperatively and postop-

eratively using the Harris hip score [13] (HHS).

Radiographic evaluation was performed by two (KKI,

PSW) individuals who were blinded to the functional

results. We categorized final radiographs (AP, lateral, and

frog leg view) in one of three classes: (1) Improved—

Those cases in which the osteonecrosis had healed or was

being replaced with new bone formation. For the Stage II

lesion, the crescent had disappeared or the density of cystic

lesion had increased with trabecular formation of the tip of

the vascularized fibula. For the Stage III lesion, the col-

lapsed lesion healed or became more rounded with

trabecular formation of the tip of the vascularized fibula;

(2) No change—compared with the preoperative status;

and (3) Progressed—Those cases with progression

observed based on stage or those with more than 3-mm of

collapse. We confirmed any definite change on any of three

radiographs. For the exact measurement of a collapsed

lesion, we used Mose’s template of concentric circles. To

evaluate interobserver validity we compared the radio-

graphic results that were made by the two different

observers. Of 124 total cases, there was agreement between

observers in five, 61, and 48 cases with improved,

unchanged and progressed respectively. The level of

agreement was tested by Kappa statistics (k = 0.85,

p \ 0.0001) which we considered highly in agreement.

We recorded the number of cases converted to THA

during followup resulting from progression of osteone-

crosis or degenerative change. We then calculated survival

with THA as an endpoint for each radiographic group,

etiology, and patient’s age using the Kaplan-Meier method.

The changes in HHS were evaluated with the Wilcoxon

signed rank test. We used Cox proportional hazard model

to assess the independent effects of location and size of

lesion on survivorship; for the independent variables with a

categorical characteristics, we created ‘dummy variables’

if the variables had more than 2 groups. We performed all

analyses using SPSS (version 12.0; SPSS Inc, Chicago, IL).

Results

Preoperative HHS improved from 72 (range, 52–81) to 88

(range, 62–100) at the latest followup (p \ 0.001). There

were 85 hips with HHS of more than 90 points, 13 with

HHS between 80 and 90, 13 with HHS between 70 and 79,

and 13 with HHS of less than 69. HHS over 80 was

observed in 48 of 59 Stage II hips (81%) and in 50 of 65

Stage III hips (77%).

Thirteen patients with 13 hips (10%) had undergone

THA resulting in a survivorship of 93% at ten years and

83% at 20 years. Moreover, the rate of graft survival at ten

years of the patients without preoperative femoral collapse

was 93% and 92% in patients with collapse. The time

interval between fibular grafting and THA averaged

8.4 years (range, 1.3–18.8 years). Conversion to THA was

in 7 hips with Ficat Stage II and 6 hips with stage III at the

time of fibular grafting. The conversion rate to THA was

not statistically different between Stage II or Stage III hips

at 12% and 9% respectively.

We observed a higher (p = 0.019) survival rate in

patients younger than 35 years of age compared with those

older than 35 years. The location of lesion (p = 0.032), as

Volume 466, Number 5, May 2008 Free Vascularized Fibular Grafting 1135

123

well as the extent of involvement (p = 0.015) indepen-

dently influence survivorship. Survivorship was not

influenced by Ficat stage of the hip (p = 0.574) or the

etiology (p = 0.204).

Radiographically seven hips (6%) improved, 69 hips

(56%) were unchanged, and 48 hips (39%) progressed

(Fig. 1A–D). We observed improved or unchanged radio-

graphs in 37 of 59 (63%) hips at Ficat-Arlet Stage II and 39

of 65 (60%) hips at Stage III (Table 3). According to the

location of femoral head necrosis, improved or unchanged

results were seen in seven of nine hips with osteonecrosis

in the medial region, 22 of 35 (63%) hips in the central

region, and 47 of 80 (59%) hips in the lateral region.

Improved or unchanged results were found in 22 of 27

(82%) hips with osteonecrosis less than 15%, 22 of 38

(58%) hips with osteonecrosis less than 30%, and 32 of 59

(54%) hips with osteonecrosis more than 30%. According

to etiology, improved or unchanged results were observed

in 31 of 59 (53%) hips (53 patients) with idiopathic

necrosis, 18 of 31 (58%) hips (26 patients) with alcoholic

necrosis, 17 of 21 hips (21 patients) with traumatic

necrosis, and 10 of 13 hips (10 patients) with steroid-

induced osteonecrosis.

Clawing of the big toe developed in 17 cases and most

of the patients were treated nonoperatively including

physiotherapy except three cases having surgical release of

Fig. 1A–D (A) Preoperative radio-

graph shows a 19-year-old man

with collapse of the femoral head

secondary to osteonecrosis. Vas-

cularized fibular grafting was

performed resulting in an excel-

lent outcome. Anteroposterior

radiograph of the same hip is

shown at (B) 3 months, (C)

7 years, and (D) 15 years.


123

the flexor hallucis longus tendon. This complication was

caused by the extensive dissection and injury of the flexor

hallucis longus muscle. Partial peroneal nerve palsy

developed in two patients; their symptoms resolved within

1.5 years. Superficial infections developed in two patients

and were successfully resolved with adequate antibiotics

therapy. Subtrochanteric fractures occurred in two patients;

these were successfully treated with open reduction and

internal fixation (Fig. 2A–B).

Discussion

Although free VFG in the treatment of ONFH is reported to

have encouraging short to mid-term results, long-term

outcome of this procedure is largely unknown [4, 6, 7, 10,

12, 14, 15, 17–21, 31, 43, 44]. Furthermore, some studies

suggest the success rate after VFG decreases with time [3,

20], various results have been reported both clinically and

radiographically [5, 7, 19, 31, 43, 44] (Table 4). Most

previous studies report the outcome based on etiology and

radiographic stage of the disease [4, 7, 14, 16, 20, 31, 43,

44]. However, size and location of necrotic involvement

also influence outcomes [25–27, 39, 40]. Most of these

reports reflect short- or mid-term followup and rather than

the long-term followup. We therefore addressed the fol-

lowing questions: (1) Does this procedure provide a long-

term (10 years or more) improvement in function (as

measured by Harris hip score)?; (2) Does the procedure

avert the need for THA and, if so, for how long?; (3) Do

factors such as age, size and location of the lesion, or eti-

ology of the disease influence long-term survivorship?; and

(4) Does radiographic appearance change over time?

We are aware of some limitations of our study. First, we

had no control group treated with alternative joint-pre-

serving procedures. Second, because the criteria for

determining both clinical and radiographic assessment is

different in each article, direct comparison of our findings

to those reported by others is difficult. We also recognize

that even for appropriately experienced surgeons VFG is a

complex operation often with long operation time, the

necessity of two surgical teams to reduce the time, donor

site morbidity, and substantial postoperative complications.

Marcus et al. [21] proposed the most desirable time for

joint-sparing surgery for ONFH is before collapse of the

femoral head. Springfield and Enneking [32], on the other

hand, suggested the possibility for regeneration of the

femoral head still exists even in some cases with collapse

and subchondral fracture. Others have also reiterated that

collapse does not necessarily imply a poor prognosis and

cessation of collapse can be expected in a certain per-

centage of hips [25]. Marciniak et al. [20] found no

correlation between the initial radiographic stage and

clinical outcomes or the overall rate of graft survival. Their

5-year results were even more encouraging for the Marcus-

Enneking Stage 3 and 4 hips than for the hips with Stage 2.

Moreover, in the large series of mid-term followup, Scully

et al. [30] also concluded VFG could delay or prevent

collapse in hips that have Ficat Stage II or III. Our long-

term data also suggests similar survival in Ficat Stage II

and III, findings similar to those of Judet and Gilbert [14].

We obtained a rate of 92.1% of graft survival at 10 years in

65 patients with femoral head collapse. These findings

confirm VFG can be used successfully even in the period of

early collapse such as Ficat Stage III.

Previous reports have suggested a direct correlation

between the size of necrotic lesion and the outcome of

VFG [33]. While others have refuted the latter being

unable to identify an association between lesion size and

survivorship of VFG at a mean followup of 4.3 years [4].

The classification system they used was different from the

widely used Steinberg classification because they classified

femoral involvement as less than 25%, 25% to 50%, or

Table 3. Summary of the outcomes

Variables ‘‘Improved’’ or

‘‘Unchanged,’’

number of

hips (%)

HHS over 80,

number of

hips (%)

Conversion to

THA, number

of hips (%)

Ficat stage [9]

II 37 (62.7) 48 (81.3) 7 (11.8)

III 39 (60.0) 50 (76.9) 6 (9.2)

p-value* NS NS NS

Ohzono classification [27]

A 7 (77.8) 9 (100) 0 (0)

B 22 (62.8) 31 (88.6) 1 (2.8)

C 47 (58.7) 58 (72.5) 12 (15.0)

p-value* NS 0.011 0.039

Steinberg classification [37]

A 22 (81.5) 27 (100) 0 (0)

B 22 (57.9) 30 (78.9) 3 (78.9)

C 32 (54.2) 41 (69.5) 10 (16.9)

p-value* 0.026 0.004 0.012

Etiology

Idiopathic 31 (52.5) 47 (79.6) 8 (13.5)

Alcoholic 18 (58.0) 22 (70.9) 4 (12.9)

Posttraumatic 17 (80.9) 18 (85.7) 0 (0)

Steroid-induced 10 (76.9) 11 (84.6) 1 (7.7)

p-value* 0.039 NS NS

Age

B 35 years 50 (73.5) 57 (83.8) 3 (4.4)

[ 36 years 26 (46.4) 41 (73.2) 10 (17.8)

p-value* 0.009 NS 0.014

* The chi square test was used to test significance among the groups.


123

more than 50%. A direct comparison between the two

results is thus impossible. Our data showed a relationship

between the size of the lesion and survivorship. Our data

support the quantitative analysis of lesion morphology by

Nishii et al. [26], demonstrated lesion volume correlated

with progression.

Currently, the importance of lesion location and size is

well accepted [22, 26]. A laterally located lesion on the

weight-bearing surface of the acetabulum predicts poor

outcomes [25–27, 39, 40]. In such types, regardless of size,

head collapse is likely to occur soon after the onset of the

disease [27]. Thus, joint-preserving surgery may have a

limited role for treatment of lateral lesions, particularly

when they are large. Our data showed a relationship

between the size of the lesion and outcome. Twelve of 13

failures in our series occurred in patients with lateral lesion

(Type C). On the contrary, we had a 100% rate of graft

survival with nine cases of Type A lesions, but such lesions

are believed less predictive than Type B or C [25]. Thus,

we no longer perform this procedure in patients with Type

A lesions unless a simpler procedure of core decompres-

sion fails to alleviate consistent pain.

Fig. 2A–B (A) Preoperative radio-

graph of the right hip of a 46-year-

old man who slipped and fell

1 month after VFG shows subtro-

chanteric fracture. (B) 16-year

followup radiograph shows excel-

lent bony union and well-

maintained fibular graft without

substantial collapse of the femoral

head.

Table 4. Comparison of our results with those in the literature

Study Number of hips Followup (years) HHS [ 80 (%) Radiographic

progression (%)

Survival (%)

Malizos et al. [19] 40 2.7 87.5 12.5 92.5

Louie et al. [17] 59 4.2 NA 48 73

Soucacos et al. [31] 184 4.7 NA 37.5 92.4

Plakseychuk et al. [28] 50 5 70 24 86

Yoo et al. [44] 81 5 91 11 96

Marciniak et al. [20] 101 5 NA 57.4 61

Berend et al. [4] 121 5.7 63 NA 64.5

Urbaniak et al. [43] 103 7 81 NA 70

Brunelli and Brunelli [5] 18 7.7 78 46 NA

Judet and Gilbert [14] 68 18 52* NA 73.5

Current study 124 13.9 79 38.7 89.6

* Merle d’Aubigne score [ 15.


123

A few studies considered patient age at the time of

operation as a possible factor predicting survival [8, 14, 20,

43]. Several authors [7, 20, 43] suggest age does not affect

the results in mid-term followup, whereas Judet and Gilbert

[14] reported, in 68 cases of VFG with an average followup

of 18 years, that better results were obtained in patients

younger than 40 years of age. Another report [8] suggests a

trend toward a lower rate of failure in younger patients.

Our long-term results suggest a better outcome in patients

younger than 35 years of age. Thus, the results of Judet and

Gilbert [14] and our long-term results support the view that

the patient’s age can be one of the key factors in long-term

survival. Because this procedure involves a microvascular

repair, it is generally agreed younger patients undergoing

microvascular surgery have a higher success rate than older

patients.

Berend et al. [4] and others [43, 44] reported etiology

was not a factor in the success of VFG in their group.

Urbaniak et al. [43] also found no difference in survival

rate according to etiology. Our long-term study confirms

those findings.

We conclude this method as a joint-preserving treatment

for osteonecrosis is a reasonable option. Preoperative

evaluation should include not only the stage, but also the

extent and location of the necrosis to predict long-term

graft survival. This modality appears especially effective in

young patients.

Acknowledgment We thank Dr. Sung-Woo Park for the radio-

graphic assessment.

References

1. Aaron RK. Treatment of osteonecrosis of the femoral head with

electrical stimulation. Instr Course Lect. 1994;43:495–498.

2. Arai K, Toh S, Tsubo K, Nishikawa S, Narita S, Miura H.

Complications of vascularized fibula graft for reconstruction of

long bones. Plast Reconstr Surg. 2002;1097:2301–2306.

3. Berend KR, Gunneson E, Urbaniak JR, Vail TP. Hip arthroplasty

after failed free vascularized fibular grafting for osteonecrosis in

young patients. J Arthroplasty. 2003;184:411–419.

4. Berend KR, Gunneson EE, Urbaniak JR. Free vascularized fibular

grafting for the treatment of postcollapse osteonecrosis of the

femoral head. J Bone Joint Surg Am. 2003;85:987–993.

5. Brunelli G, Brunelli G. Free microvascular fibular transfer for

idiopathic femoral head necrosis: long-term follow-up. J Recon-str Microsurg. 1991;7:285–295.

6. Chillag KJ. Survival analysis of hips treated with core decom-

pression or vascularized fibular grafting because of avascular

necrosis. J Bone Joint Surg Am. 2000;82:289–290.

7. Cho BC, Kim SY, Lee JH, Ramasastry SS, Weinzweig N, Baik

BS. Treatment of osteonecrosis of the femoral head with free

vascularized fibular transfer. Ann Plast Surg. 1998;40:586–593.

8. Dean GS, Kime RC, Fitch RD, Gunneson E, Urbaniak JR.

Treatment of osteonecrosis in the hip of pediatric patients by free

vascularized fibular graft. Clin Orthop Relat Res. 2001;386:106–

113.

9. Ficat P, Arlet J, Vidal R, Ricci A, Fournial JC. Therapeutic

results of drill biopsy in primary osteonecrosis of the femoral

head (100 cases) [in French]. Rev Rhum Mal Osteoartic.

1971;38:269–276.

10. Garberina MJ, Berend KR, Gunneson EE, Urbaniak JR. Results

of free vascularized fibular grafting for femoral head osteone-

crosis in patients with systemic lupus erythematosus. Orthop ClinNorth Am. 2004;353:353–357.

11. Gonzalez Della Valle A, Bates J, Di Carlo E, Salvati EA. Failure

of free vascularized fibular graft for osteonecrosis of the femoral

head: a histopathologic study of 6 cases. J Arthroplasty.

2005;203:331–336.

12. Goodman SB. Survival analysis of hips treated with core

decompression or vascularized fibular grafting because of avas-

cular necrosis. J Bone Joint Surg Am. 2000;82:289.




14. Judet H, Gilbert A. Long-term results of free vascularized fibular

grafting for femoral head necrosis. Clin Orthop Relat Res.

2001;386:114–119.

15. Kane SM, Ward WA, Jordan LC, Guilford WB, Hanley EN Jr.

Vascularized fibular grafting compared with core decompression

in the treatment of femoral head osteonecrosis. Orthopedics.

1996;19:869–872.




2005;879:2012–2018.

17. Louie BE, McKee MD, Richards RR, Mahoney JL, Waddell JP,

Beaton DE, Schemitsch EH, Yoo DJ. Treatment of osteonecrosis

of the femoral head by free vascularized fibular grafting: an

analysis of surgical outcome and patient health status. Can JSurg. 1999;42:274–283.

18. Malizos KN, Quarles LD, Dailiana ZH, Rizk WS, Seaber AV,

Urbaniak JR. Analysis of failures after vascularized fibular

grafting in femoral head necrosis. Orthop Clin North Am.

2004;353:305–314.

19. Malizos KN, Soucacos PN, Beris AE. Osteonecrosis of the

femoral head. Hip salvaging with implantation of a vascularized

fibular graft. Clin Orthop Relat Res. 1995;314:67–75.

20. Marciniak D, Furey C, Shaffer JW. Osteonecrosis of the femoral

head. A study of 101 hips treated with vascularized fibular

grafting. J Bone Joint Surg Am. 2005;874:742–747.

21. Marcus ND, Enneking WF, Massam RA. The silent hip in idio-

pathic aseptic necrosis. Treatment by bone-grafting. J Bone JointSurg Am. 1973;55:1351–1366.



growth and differentiation factors. Clin Orthop Relat Res.

1998;355(Suppl):S314–S335.

23. Mont MA, Jones LC, Hungerford DS. Survival analysis of hips



2000;82:290–291.

24. Mulliken BD. Osteonecrosis of the femoral head: current con-

cepts and controversies. Iowa Orthop J. 1993;13:160–166.

25. Nishii T, Sugano N, Ohzono K, Sakai T, Haraguchi K, Yoshik-

awa H. Progression and cessation of collapse in osteonecrosis of

the femoral head. Clin Orthop Relat Res. 2002;400:149–157.

26. Nishii T, Sugano N, Ohzono K, Sakai T, Sato Y, Yoshikawa H.

Significance of lesion size and location in the prediction of

collapse of osteonecrosis of the femoral head: a new three-

dimensional quantification using magnetic resonance imaging.

J Orthop Res. 2002;201:130–136.


123


Kadowaki T. Natural history of nontraumatic avascular

necrosis of the femoral head. J Bone Joint Surg Br. 1991;73:

68–72.





29. Plancher KD, Razi A. Management of osteonecrosis of the

femoral head. Orthop Clin North Am. 1997;283:461–477.

30. Scully SP, Aaron RK, Urbaniak JR. Survival analysis of hips



1998;80:1270–1275.

31. Soucacos PN, Beris AE, Malizos K, Koropilias A, Zalavras H,

Dailiana Z. Treatment of avascular necrosis of the femoral head

with vascularized fibular transplant. Clin Orthop Relat Res.

2001;386:120–130.

32. Springfield DS, Enneking WJ. Surgery for aseptic necrosis of the


33. Steinberg ME, Bands RE, Parry S, Hoffman E, Chan T, Hartman

KM. Does lesion size affect the outcome in avascular necrosis?






1989;249:199–208.

35. Steinberg ME, Brighton CT, Hayken GD, Tooze SE, Steinberg

DR. Electrical stimulation in the treatment of osteonecrosis of the

femoral head—a 1-year follow-up. Orthop Clin North Am.

1985;16:747–756.





37. Steinberg ME, Hayken GD, Steinberg DR. A quantitative system for

staging avascular necrosis. J Bone Joint Surg Br. 1995;77:34–41.



for osteonecrosis of the femoral head. Clin Orthop Relat Res.

2001;386:71–78.




J Orthop Sci. 2002;75:601–605.

40. Sugano N, Takaoka K, Ohzono K, Matsui M, Masuhara K, Ono

K. Prognostication of nontraumatic avascular necrosis of the

femoral head. Significance of location and size of the necrotic

lesion. Clin Orthop Relat Res. 1994;303:155–164.

41. Sugioka Y, Hotokebuchi T, Tsutsui H. Transtrochanteric anterior

rotational osteotomy for idiopathic and steroid-induced necrosis

of the femoral head. Indications and long-term results. ClinOrthop Relat Res. 1992;277:111–120.

42. Trancik T, Lunceford E, Strum D. The effect of electrical stim-

ulation on osteonecrosis of the femoral head. Clin Orthop RelatRes. 1990;256:120–124.

43. Urbaniak JR, Coogan PG, Gunneson EB, Nunley JA. Treatment

of osteonecrosis of the femoral head with free vascularized fibular

grafting. A long-term follow-up study of one hundred and three

hips. J Bone Joint Surg Am. 1995;77:681–694.

44. Yoo MC, Chung DW, Hahn CS. Free vascularized fibula grafting

for the treatment of osteonecrosis of the femoral head. ClinOrthop Relat Res. 1992;277:128–138.

45. Zhang C, Zeng B, Xu Z, Sui S, Song W, Jin D, Shi H, Wang K.

Treatment of osteonecrosis of femoral head with free vascular-

ized fibula grafting [in Chinese]. Zhongguo Xiu Fu Chong JianWai Ke Za Zhi. 2004;18:367–369.


123

SYMPOSIUM: MOLECUAR AND SURGICAL ADVANCES IN OSTEONECROSIS

THA Using an Anatomic Stem in Patients With Femoral HeadOsteonecrosis

Yong-Chan Ha MD, Hee Joong Kim MD,

Shin-Yoon Kim MD, Tae-Young Kim MD,

Kyung-Hoi Koo MD



Abstract Treating young patients with femoral head

osteonecrosis (ON) remains challenging. Anatomic stems

were introduced in the 1980s and 1990s to improve the

proximal canal fit in an attempt to enhance long-term

implant survival, an important aspect of treating young

patients. We began using one design in 1993 and asked

three questions to confirm whether the design criteria

improved outcomes in patients with ON: (1) What is the

long term survivorship of these implants?; (2) What is the

amount and rate of wear?; and (3) What is the incidence

of osteolysis? We retrospectively reviewed 56 patients

(69 hips) who underwent THA for femoral head ON with

a cementless anatomic stem proximally coated with

hydroxyapatite. Four patients (four hips) were lost to fol-

lowup and 16 patients (19 hips) died. In the remaining 36

patients (46 hips) the minimum followup was 10 years

(mean, 11.2 years; range, 10–13 years). The mean age at

operation was 48.6 years. The average Harris hip score at

last followup was 87 points. Worst-case survivorship was

58.1% at 13 years and best-case was 93.3%. The average

linear wear of the polyethylene liner was 2.02 mm and the

average annual wear was 0.18 mm per year. Thirty-seven

hips (80%) had femoral osteolysis and 14 (30%) had ace-

tabular osteolysis. One patient who had extensive femoral

osteolysis and stem loosening was revised at 11.2 years

postoperatively. The high rates of polyethylene wear and

osteolysis are of concern.



of evidence.

Introduction

Femoral head osteonecrosis (ON) occurs in young patients

with a mean age of younger than 50 years [19, 29, 31] and

treating these young patients remains a major therapeutic

challenge [5, 18, 22, 34].

Cementless THA was developed to obtain biologic fix-

ation and increase the longevity of the implant. Short-term

results of various types of cementless THA were encour-

aging [3, 4, 7]. However, THA using the first-generation

straight femoral stems was associated with high rates of

failure as a result of thigh pain, subsidence of the femoral

stem, aseptic loosening, proximal loss of bone attributable

to stress shielding, and polyethylene particle-induced

osteolysis [1, 2, 8, 13, 21, 24, 28, 32, 33, 35].









Y.-C. Ha, H. J. Kim, K.-H. Koo

Department of Orthopaedic Surgery, Seoul National University

College of Medicine, Seoul, South Korea

S.-Y. Kim

Department of Orthopaedic Surgery, Kyungpook National

University College of Medicine, Daegu, South Korea

T.-Y. Kim

Department of Orthopaedic Surgery, Korea University College

of Medicine, Seoul, South Korea

K.-H. Koo (&)

Department of Orthopaedic Surgery, Seoul National University

Bundang Hospital, 300 Gumi-dong, Bundang-gu, Seongnam

463-707, South Korea


123


DOI 10.1007/s11999-008-0202-y

Anatomic stems were designed to maximize the proxi-

mal fit in both the coronal and the sagittal planes and

hopefully enhance implant survival compared to that of the

first-generation stems. Implant survival would, of course,

be particularly important for the younger patients with ON.

However, the effectiveness of the anatomic stem remains

controversial and it is not known whether the design cri-

teria solved the problems with the first-generation straight

stems [3, 20, 28].

We therefore asked three questions: (1) What is the long

term survivorship of these implants?; (2) What is the

amount and rate of wear?; and (3) What is the incidence of

osteolysis?



femoral head ON treated with an anatomic cementless stem

design between July 1993 and December 1995. Of the 56

patients (69 hips), 16 patients (19 hips) died because of

problems unrelated to the operation and four patients (four

hips) were lost before a minimum followup of 10 years.

These 20 patients (23 hips) were followed for an average of

4.7 years (range, 1–9 years). The causes of death in the 16

deceased patients were chronic liver disease in seven,

chronic renal failure in two, heart disease in two, malignant

neoplasm in two, traffic accident in two, and unknown in

one. None of the 16 deceased patients (19 hips) and four

lost patients (four hips) had a revision or a reoperation at

last followup. Their mean Harris hip score was 91.4 (range,

82–98) at the last followup. None of these patients used

support and one patient (one hip) had a mild limp; one

patient had mild thigh pain. None of the 20 hips had

loosening at last followup but femoral osteolysis was seen

in one hip in Gruen zones 1 and 7 and acetabular osteolysis

was seen in one hip in DeLee and Charnley zone I. Of the

36 surviving patients there were 30 men (39 hips) and six

women (seven hips). The mean age of these 36 patients was

48.6 years (range, 22–65 years) at the time of the index

operation. Twenty-two (61%, 27 hips) of 36 patients were

less than 50 years old. On preoperative radiographic clas-

sification with the system of Ficat [11], six hips were in

stage II-B, 29 in stage III and 11 in stage IV. Nine patients

(11 hips) were sedentary workers, eight patients (10 hips)

moderate workers, 16 patients (20 hips) intermediate

workers, and three patients (five hips) intensive workers

[12] (Table 1). In the remaining 36 patients (46 hips), the

minimum followup was 10 years (mean, 11.2 years; range,

10–13 years). The study was approved by our Institutional

Review Board; all patients were informed his or her

medical data could be used in a scientific study and pro-

vided consent preoperatively.

The stem design was a cementless anatomic metaphyseal

fitting titanium stem. The stem had a rough surface with an

average roughness of 1.2 micron and the proximal 50% of

the stem was coated with hydroxyapatite in a thickness of

100 micron (Profile, DePuy, Leeds, UK) (Fig. 1).

All operations were performed by one surgeon (K-HK)

using the posterolateral approach. All of the acetabular and

femoral components were inserted in a press-fit manner. The

surgeon tried to position the acetabular cup at the abduction

of 40� ± 10� as suggested by Lewinnek et al. [26]. A por-

ous-coated hemispheric cup (Duraloc 1200; DePuy,

Warsaw, IN), an ultrahigh-molecular-weight polyethylene

liner (Enduron; DePuy), and a 28-mm cobalt-chromium

head (DePuy) were used in all hips.

Patients were instructed to walk with partial weight-

bearing with the aid of two crutches for 4 weeks after

surgery.

We performed followup evaluations at 6 weeks; at 3, 6, 9,

and 12 months; and every 6 months thereafter. Patients who

had not returned for regularly scheduled visits were con-

tacted by telephone. Two nurses and one doctor located and

visited nonresponders. These three individuals performed a

clinical evaluation using the Harris hip scoring system [15].

Table 1. Demographic data

Variable Data

Number of patients 36

Number of hips 46

Gender (male/female) 30 (39 hips) / 6 (7 hips)

Age (years) mean, 48.6; range, 22–65

\ 50 years (%) 22 (61.1%)

C 50 years (%) 14 (38.9%)

Body weight (kg) mean, 64.8; range, 49–89

Height (cm) mean, 167.2; range, 151–183

Body mass index mean, 23.9; range, 22.1–25.8

Preoperative Harris hip score mean, 44.2; range, 20–62

Duration of followup (years) mean, 11.2; range, 10–13

Risk factors for osteonecrosis

Idiopathic 17 patients (23 hips)

Alcohol abuse 13 patients (16 hips)

Steroid 4 patients (5 hips)

Femoral neck fracture 2 patients (2 hips)

Ficat stage

Stage IIB 6 hips

Stage III 29 hips

Stage IV 11 hips

Occupational activity

Sedentary workers 9 patients (11 hips)

Moderate workers 8 patients (10 hips)

Intermediate workers 16 patients (20 hips)

Intensive workers 3 patients (5 hips)

1142 Ha et al. Clinical Orthopaedics and Related Research

123

We considered the 6-week anteroposterior and cross-

table lateral radiographs the baseline study for radiographic

comparison. Two of us (Y-CH and S-YK) measured the

abduction and anteversion angles of the acetabular com-

ponent using the method of Widmer and Zurfluh [36] and

the offset of femur before and after the total hip arthro-

plasty using the method of Jolles et al. [16]. On the final

radiographs we assessed fixation of the femoral and ace-

tabular components, polyethylene liner wear, osteolysis,

and heterotopic ossification. The fixation of the femoral

component was classified with use of the method of Engh

et al. [10] and the fixation of the acetabular component

with use of the method of Latimer and Lachiewicz [25].

The wear of the polyethylene liner was calculated

according to the method developed by Livermore et al.

[27]. Volumetric wear was calculated with the equation

V = [pi]r2w, where V = volumetric wear, r = the radius

of the femoral head, and w = measured linear wear [23,

27]. Osteolytic lesions were defined according to the cri-

teria of Engh et al. [9]. The lesions were recorded

according to the three zones described by DeLee and

Charnley [6] on the acetabular side and the seven zones

described by Gruen et al. [14] on the femoral side.

We performed Kaplan-Meier survival analysis for all

hips with a minimum ten-year followup with revision of

either component as an endpoint [17]. We did two analy-

ses: a best-case scenario (in which all 23 hips with less than

10 year followup were considered to have had no revision

through the 13 year followup) and worst-case scenario (in

which all 23 hips were considered to have required revision

before the 13 year followup). For all analyses we used

SPSS version 11.0 (Chicago, IL).

Results

In the 36 patients (46 hips) who had a minimum followup of

10 years, the mean Harris hip score was 87 (range, 56–95)

at the final followup. No patient used support and three

patients (three hips [7%]) had a mild limp. Thigh pain was

present in three patients (three hips [7%]).

Worst-case survivorship was 58.1% (95% confidence

interval, 41.8%–71.3%) and best-case survivorship was

93.3% (95% confidence interval, 80.7%–100%) at 13 years

(Fig. 2).

The average linear wear of the polyethylene liner was

2.02 mm (range, 0.3–4.7 mm), and the average amount of

volumetric wear was 1243.43 mm3 (range, 184.6–2892.6

mm3). The average linear wear rate was 0.18 mm per year

(range, 0.03–0.48 mm per year), and the average annual rate of

volumetric wear was 110.87 mm3 (range, 18.5–295.4 mm3).

Femoral osteolysis was seen in 37 hips (80%); 19 hips

(41%) had osteolysis in Gruen zone 1 and 17 hips (37%) in

zones 1 and 7. These osteolytic lesions were small (less

than 1 cm2) and were not progressive on serial radiographs.

Forty-five stems (98%) had bone on growth stability

(Fig. 3). However, one stem (2%) had diffuse extensive

Fig. 1 The cementless anatomic

Profile stem, shown from three

angles, has a large proximal seg-

ment to obtain a maximized fit

into the endosteal cavity of the

proximal part of the femur. The

proximal part of the stem is

coated with hydroxyapatite.

Fig. 2 The Kaplan-Meier survival curve including 95% confidence

interval estimates with implant revision as the endpoint. Excluding

patients lost to followup (best-case scenario) there was only one

failure of the femoral stem at 11.5 years (straight line). The dotted

line shows the worst-case scenario presuming all 23 hips lost to

followup had failed.

Volume 466, Number 5, May 2008 Cementless THA Using an Anatomic Stem 1143

123

osteolysis and loosening, which was revised 11 years

2 months after the index operation (Fig. 4) (Table 2).

Acetabular osteolysis was identified in 14 hips (30%); two

hips (4%) in DeLee and Charnley zone I, eight hips (17%)

in zone II, three hips (7%) in zones I to II, and one hip (2%)

in Zones II to III (Fig. 4) (Table 2).

Reactive radiolucent line formation was found around

the uncoated distal tip of the stem in nine hips (20%) at

nine to 24 months after the operation. The line was seen in

only lateral radiograph (Gruen zones 10, 11 and 12) in

eight hips and in both anteroposterior and lateral radio-

graphs (Gruen zones 3, 4, 5, 10, 11 and 12) in one hip. The

line was parallel to the distal tip and the thickness was less

than two millimeters. It was not associated with the for-

mation of a halo pedestal and was not progressive. Thus, it

was not thought to be osteolysis. Three hips (7%) had a

shelf pedestal at the tip of the stem. Cortical hypertrophy

was observed in the distal zone (Gruen zones 3, 4 and 5) in

nine hips (20%). All hips had cortical thinning and canc-

ellization of the cortex in the calcar femorale (Fig. 3).

No acetabular component had loosening. We observed

radiolucent lines around the acetabular cup in 29 hips

(63%) at 6-week radiographs, which was presumed to be

polar gap or peripheral gap. No line had progressed on

serial radiographs. The line disappeared at six to 12 months

after the operation in 20 hips and persisted until the latest

evaluation in nine hips (20%) (Fig. 3).

There was an intraoperative linear fracture of the calcar

femorale in one hip, which was treated with a cerclage wire

and healed completely. One hip dislocated at postoperative

day one, which was treated successfully with closed

reduction and an abduction brace for 3 months. One patient

sustained a periprosthetic fracture of the proximal femur

because of a traffic accident 57 months postoperatively. The

fracture was treated with open reduction and internal fixa-

tion using cerclage wires. The fracture united uneventfully

and the stem was still well-fixed 7 years later (Fig. 5).

Discussion

Treating patients with femoral head ON is a challenge

owing to their relative young age and anticipated many

decade survival. Owing to disappointing survival rates of

Fig. 3A–B A 28-year-old man

underwent THA resulting from

ON of the femoral head with use

of a Profile stem. (A) An antero-

posterior radiograph obtained

6 weeks postoperatively shows

radiolucent line in DeLee and

Charnley zones II and III as well

as screw sites. No remodeling

changes are seen around the stem.

(B) On anteroposterior radiograph

obtained 13 years postopera-

tively, the line disappeared in

DeLee and Charnley zone III.

Focal osteolysis (less than

1 cm2) is seen in Gruen zone 1

(arrows) around the stem and a

shelf pedestal at the tip of the

stem.


123

some straight stems, anatomic stems were developed in the

1980s and 1990s to improve the proximal canal fit and

presumably long-term survival. We began using one design

in 1993 and asked three questions to confirm whether the

design criteria improved outcomes in patients with ON: (1)

What is the long term survivorship of these implants?; (2)

What is the amount and rate of wear?; and (3) What is the

incidence of osteolysis?

We note several limitations to our study. Among the 56

patients (69 hips), 16 patients (19 hips) died and four

patients (four hips) were lost before the 10 year minimum

followup; additionally, the followup rate was 64%, which

might have influenced the long-term results. The unex-

pectedly high death rate in our patients seemed related to

causes of ON including alcohol abuse and steroid use,

which might be potentially confounding comorbidities.

The effectiveness of the anatomic stem remains con-

troversial and the long-term followup results have not yet

been determined. One previous study [3] reporting 2-year

results of 50 cementless THAs with the use of Porous-

Coated Anatomic (PCA) stems (Howmedica, Rutherford,

NJ), the clinical results were encouraging. However, pro-

gressive radiodense femoral lines developed in 41%,

progressive loosening of beads from the stem in 24%, and

thigh pain in 16%. In another study [28], 52 THAs with the

use of the PCA stem were evaluated and a high failure rate

was reported. At a mean of 2.4 years followup, four (8%)

femoral components were revised because of subsidence

and persistent thigh pain was reported in 33%. Kim et al.

[20] reviewed 108 patients (116 hips) who were followed

for 10 to 12 years after THA using a PCA hip prosthesis.

The rate of revision of the femoral component was 11%,

the rate of revision of the acetabular component was 15%,

and the incidence of thigh pain was 28%. Moskal et al. [30]

evaluated 107 PCA arthroplasties at an average of

12.4 years. The failure rate was 13% in the acetabular

components and 4% in the stems. The design of the Profile

stem used in our study has a similar design to a PCA stem.

Fig. 4A–C A 53-year-old man underwent THA because of ON of the

femoral head with use of a Profile stem. (A) An anteroposterior

radiograph obtained 6 weeks postoperatively shows no remodeling

changes. (B) An anteroposterior radiograph and a (C) lateral

radiograph obtained 11 years postoperatively show extensive femoral

osteolysis (arrows). Cavitary osteolysis (arrowheads) is also seen

around the acetabular cup in DeLee and Charnley zones I and II.

Table 2. Periprosthetic bone change along the implants

Bone change type Percentage

Radiolucent line

Femoral 9 (19.6%)

Acetabular 9 (19.6%)

Osteolysis

Femoral 37 (80.4%)

Acetabular 14 (30.4%)

Shelf pedestal 3 (6.5%)

Cortical hypertrophy 9 (19.6%)

Calcar atrophy 46 (100%)


123

Both stems are cementless anatomic metaphyseal fitting

stems with a circumferential coating on the proximal one-

third. However, the proximal portion of the Profile stem is

larger than that of the PCA stem and has a closer match to

the endosteal cavity of the proximal part of the femur and a

better surface coating.

We observed only one patient with a loose stem (2%) and

three with thigh pain (7%) at a mean of 11.2 years followup.

Our findings agree with those of Kim et al. [23] who eval-

uated 118 THAs with the use of the Profile stem. DePuy

supplied two versions of the Profile stem. The two versions

are identical with regard to geometry and stem material. The

two versions differed only with regard to the surface treat-

ment of the proximal portion; one was porous-coated and the

other was hydroxyapatite-coated. Although we used

hydroxyapatite-coated Profile stems, Kim et al. [23] used

porous-coated Profile stems. At a mean of 9.8 years fol-

lowup they had no aseptic loosening and the incidence of

transitory thigh pain was 10%. We believe the improved

design features of the Profile stem might lead to the better

results with the Profile stem compared to the PCA stem.

We observed a femoral osteolysis rate of 80% and an

acetabular osteolysis rate of 30%. These rates were much

higher than rates in the study of Kim et al. [23] who

reported 12% femoral osteolysis and 9% acetabular oste-

olysis. Their low incidence of osteolysis around the

acetabular and femoral components might be related to the

relatively low rate of volumetric wear of polyethylene

because they used a 22-mm head. The different surface

treatments, hydroxyapatite coating and porous coating,

might have influenced the rate of osteolysis.

Our data suggest the anatomic fit cementless Profile stem

had durable fixation in young, active patients who had fem-

oral head ON. However, a high wear rate of the polyethylene

liner and a high incidence of osteolysis are concerning.

References

1. Bourne RB, Rorabeck CH, Ghazal ME, Lee MH. Pain in the thigh

following total hip replacement with a porous-coated anatomic

prosthesis for osteoarthrosis. A five-year follow-up study. J BoneJoint Surg Am. 1994;76:1464–1470.

2. Callaghan JJ. Results of primary total hip arthroplasty in young

patients. Instr Course Lect. 1994;43:315–321.

3. Callaghan JJ, Dysart SH, Savory CG. The uncemented porous-

coated anatomic total hip prosthesis. Two-year results of a pro-

spective consecutive series. J Bone Joint Surg Am. 1988;70:337–

346.

4. Cameron HU. The results of early clinical trials with a micro-

porous coated metal hip prosthesis. Clin Orthop Relat Res.

1982;165:188–190.

5. Cornell CN, Salvati EA, Pellicci PM. Long-term follow-up of

total hip replacement in patients with osteonecrosis. Orthop ClinNorth Am. 1985;16:757–769.

6. DeLee JG, Charnley J. Radiological demarcation of cemented

sockets in total hip replacement. Clin Orthop Relat Res.

1976;121:20–32.

Fig. 5A–B A 59-year-old man

underwent THA because of ON

of the femoral head with use of a

Profile stem. The patient sustained

injury resulting from a traffic acci-

dent 57 months postoperatively.

(A) An anteroposterior radiograph

shows a periprosthetic fracture of

the proximal femur. The fracture

was treated with open reduction

and internal fixation using cerclage

wires and the fracture united

uneventfully. (B) On an anteropos-

terior radiograph obtained 7 years

after the fracture operation, the

stem is still well fixed.


123

7. Engh CA. Hip arthroplasty with a Moore prosthesis with porous

coating. A five-year study. Clin Orthop Relat Res. 1983;176:52–66.

8. Engh CA, Culpepper WJ II, Engh CA. Long-term results of use

of the anatomic medullary locking prosthesis in total hip

arthroplasty. J Bone Joint Surg Am. 1997;79:177–184.

9. Engh CA, Hooten JP Jr, Zettl-Schaffer KF, Ghaffarpour M,

McGovern TF, Bobyn JD. Porous-coated total hip replacement.


10. Engh CA, Massin P, Suthers KE. Roentgenographic assessment

of the biologic fixation of porous-surfaced femoral components.

Clin Orthop Relat Res. 1990;257:107–128. Erratum in: ClinOrthop Relat Res. 1992;284:310–312.

11. Ficat RP. Idiopathic bone necrosis of the femoral head: Early


12. Flugsrud GB, Nordsletten L, Espehaug B, Havelin LI, Meyer HE.

Risk factors for total hip replacement due to primary osteoar-

thritis: A cohort study in 50,034 persons. Arthritis Rheum. 2002;

46:675–682.

13. Galante JO, Jacobs J. Clinical performances of ingrowth surfaces.


14. Gruen TA, McNeice GM, Amstutz HC. ‘Modes of failure’ of

cemented stem-type femoral components: a radiographic analysis

of loosening. Clin Orthop Relat Res. 1979;141:17–27.




16. Jolles BM, Zangger P, Leyvraz PF. Factors predisposing to dis-

location after primary total hip arthroplasty: a multivariate

analysis. J Arthroplasty. 2002;17:282–288.

17. Kaplan EL, Meier P. Nonparametric estimation from incomplete

observations. J Am Stat Assoc. 1958;53:457–481.

18. Katz RL, Bourne RB, Rorabeck CH, McGee H. Total hip

arthroplasty in patients with avascular necrosis of the hip: follow-

up observation on cementless and cemented operations. ClinOrthop Relat Res. 1992;281:145–151.




20. Kim YH, Kim JS, Cho SH. Primary total hip arthroplasty with a

cementless porous-coated anatomic total hip prosthesis: 10- to

12-year results of prospective and consecutive series. J Arthro-plasty. 1999;14:538–548.

21. Kim YH, Kim VE. Results of the Harris-Galante cementless hip

prosthesis. J Bone Joint Surg Br. 1992;74:83–87.

22. Kim YH, Oh JH, Oh SH. Cementless total hip arthroplasty in

patients with osteonecrosis of the femoral head. Clin OrthopRelat Res. 1995;320:73–84.

23. Kim YH, Oh SH, Kim JS. Primary total hip arthroplasty with a

second-generation cementless total hip prosthesis in patients

younger than fifty years of age. J Bone Joint Surg Am. 2003;85:

109–114.

24. Lachiewicz PE, Anspach WE 3rd, DeMasi R. A prospective study

of 100 consecutive Harris-Galante porous total hip arthroplasties.

2–5 year results. J Arthroplasty. 1992;7:519–526.

25. Latimer HA, Lachiewicz PF. Porous coated acetabular compo-

nents with screw fixation. Five to ten-year results. J Bone JointSurg Am. 1996;78:975–981.

26. Lewinnek GE, Lewis JL, Tarr R, Compere CL, Zimmerman JR.

Dislocation after total hip-replacement arthroplasties. J boneJoint Surg Am. 1978;60:217–220.

27. Livermore J, Ilstrup D, Morrey B. Effect of femoral head size on

wear of the polyethylene acetabular component. J Bone JointSurg Am. 1990;72:518–528.

28. Maric Z, Karpman RR. Early failure of noncemented porous

coated anatomic total hip arthroplasty. Clin Orthop Relat Res.

1992;278:116–120.

29. Merle d’Aubigne R, Postel M, Mazabraud A, Massias P, Gueguen

J, France P. Idiopathic necrosis of the femoral head in adults.


30. Moskal JT, Jordan L, Brown TE. The porous-coated anatomic total

hip prosthesis: 11- to 13-year results. J Arthroplasty. 2004;19:

837–844.




32. Owen TD, Moran CG, Smith SR, Pinder IM. Results of unce-

mented porous-coated anatomic total hip replacement. J BoneJoint Surg Br. 1994;76:258–262.

33. Piston RW, Engh CA, De Carvalho PI, Suthers K. Osteonecrosis

of the femoral head treated with total hip arthroplasty without

cement. J Bone Joint Surg Am. 1994;76:202–214.

34. Saito M, Nishina T, Ohzono K, Ono K. Long-term results of total

hip arthroplasty for osteonecrosis of the femoral head: a compari-

son with osteoarthritis. Clin Orthop Relat Res. 1989;244:198–207.

35. Smith SE, Garvin KL, Jardon OM, Kaplan PA. Uncemented total

hip arthroplasty. Prospective analysis of the tri-lock femoral

component. Clin Orthop Relat Res. 1991;269:43–50.

36. Widmer KH, Zurfluh B. Compliant positioning of total hip compo-

nents for optimal range of motion. J Orthop Res. 2004;22:815–821.


123


Metal-on-Metal Hip Arthroplasty Does Equally Wellin Osteonecrosis and Osteoarthritis

Manish R. Dastane MD, William T. Long MD,

Zhinian Wan MD, Lisa Chao BS, Lawrence D. Dorr MD



Abstract Many previous reports suggest total hip

arthroplasty performs suboptimally in young patients with

osteonecrosis. We retrospectively compared the perfor-

mance of metal-on-metal articulation in a select group

of 107 patients with 112 hips (98 uncemented and 14

cemented stems) 60 years of age or younger with either

osteonecrosis (27 patients, 30 hips) or primary osteoar-

thritis (80 patients, 82 hips). We evaluated all patients with

patient-generated Harris hip score forms and serial radio-

graphs. Five mechanical complications were caused by

impingement, two with pain, two dislocations, and one

liner dissociation. At a minimum followup of 2.2 years

(mean, 5.5 years; range, 2.2–11.7 years), we observed no

osteolysis or aseptic loosening in the osteonecrosis group,

whereas one osteoarthritic hip had cup revision for loos-

ening (none showed evidence of osteolysis). None of the

stems were loose. Patients with osteonecrosis or primary

osteoarthritis were similar in clinical and radiographic

performance. The patients with metal-on-metal hip

arthroplasty for osteonecrosis had no revisions for aseptic

loosening, but did have one liner change in a cup for

painful impingement.

Level of Evidence: Level III, therapeutic study. See the


of evidence.

Introduction

Osteonecrosis (ON) is predominantly a disease of the

young, causing secondary arthritis [22]. Few reports sug-

gest longevity of THA for ON is inferior when compared

with THA for osteoarthritis (OA) [24, 28, 32]. Young,

more active patients have higher revision rates with THA

performed for any disease, but failure rates with ON are

reportedly even higher for reasons not clearly understood

[23, 24].

Metal-on-metal articulations in younger active patients

have a low rate of wear and osteolysis [30, 31]. Low wear

has been the most important factor in long-term perfor-

mance of metal-on-metal articulations [35].

We asked whether metal-on-metal articulation, com-

bined with noncemented fixation of the stem and cup,

would provide equivalent survival and clinical scores in

patients aged 60 years or younger with ON compared with

primary OA.


We retrospectively compared clinical outcomes from

clinical examination, medical records, and radiographs in

129 selected patients (135 hips) who were 60 years

or younger with ON and OA and who had Metasul1

(Zimmer, Inc., Warsaw, IN) metal-on-metal articulation.

The group is selected, in part, because of inconsistent

availability of the implant until 1999. In addition, from

One or more of the authors (LDD) have received benefits from

Zimmer Inc for conducting this study.





M. R. Dastane, W. T. Long, Z. Wan, L. Chao, L. D. Dorr (&)

Arthritis Institute, 501 E Hardy Street, 3rd Floor, Inglewood,

CA 90301, USA


123


DOI 10.1007/s11999-008-0180-0

1999 to 2000, there was contamination of the Sulzer

InterOp metal shell (Sulzer Orthopedics, Austin, TX) used

by us, which required revision in 14 patients; these patients

were eliminated from this study group. Nine of the 129

patients (nine hips) had surgery between 1991 and 1993; 33

patients (35 hips) had surgery between 1993 and 1998 in an

investigational device exemption for Metasul1; and 87

patients (91 hips) had surgery 1999 to 2003 after the

Metasul1 articulation was approved by the US Food and

Drug Administration. The total number of hips operated on

by us from 1999 to 2003 was 1016, so the 91 metal-on-

metal hips in that same period represent 9% of our volume.

Of the 129 patients potentially available, three (three hips)

died, five (five hips) were lost to followup, and 14 patients

(15 hips) were eliminated from the study because they

had revision surgery from a failed recalled InterOp cup

(Sulzer Orthopedics, Austin, TX) [20]. The final study

group therefore had 107 patients (112 hips), of which 80

patients (82 hips, two bilateral) had primary OA and 27 (30

hips, three bilateral) had ON. The patients with OA were

7 years older on average (p \ 0.0005) than those with

ON with no other differences between the two groups

(Table 1). All patients were contacted for recall for clinical

and radiographic examination with five patients lost to

followup. We obtained prior Institutional Review Board

consent for review of the records.

The causes of ON were idiopathic (48%), posttraumatic

(26%), alcohol abuse (15%), corticosteroids (7%), and

sickle cell disease (4%). There were six hips in Stage 3 of

ON with an obvious sequestrum and segmental collapse of

the femoral head and 24 hips in Stage 4 with severe fem-

oral head deformity and secondary OA using a staging

system designed by Ficat [14]. Only one patient with

bilateral ON had received surgical treatment in the past in

the form of core decompression.

Patients were operated on with a traditional posterior

approach as previously described [6]. All procedures were

performed by the senior surgeons (LDD, WTL). Epidural

anesthesia was augmented with general anesthesia to keep

the average arterial pressure between 60 and 80 mmHg.

Between 1991 and 1998, we used 12 cemented Weber cups

(Sulzer Medica, Winterthur, Switzerland) and 32 cement-

less APR cups (Anatomic Porous Replacement; Zimmer)

(Table 2). The APR cup was a 3.5-mm wall thickness

titanium shell with a cancellous structured titanium porous

coating. These 44 cups were coupled with 44 APR stems

(11 cemented and 33 cementless). Between 1999 and 2003,

we used 28 cementless InterOp cups (Sulzer) and 40

cementless Converge cups (Zimmer) with 67 cementless

stems and one cemented APR stem. The InterOp was

changed to the Converge in 2001 because of the recall of

the InterOp in 2000 [20]. The InterOp metal shell and the

Converge metal shell did not differ from the APR metal

shell in thickness or porous surface. The only difference in

the InterOp and Converge cups was the locking mechanism

for the acetabular insert. The Metasul1 acetabular insert

for all cups had an articulation surface of cobalt-chromium

metal, which was inlaid into a polyethylene hemisphere

having the locking mechanism for the metal shell. This

metal insert was manufactured separately and then

Table 1. Patient demographic and preoperative clinical data according to group

Variable Osteonecrosis Primary osteoarthritis p Value

Number of patients (hips) 27 (30) 80 (82)

Mean age, years (SD) 44.7 (±6.9) 51.67 (±6.7) \ 0.0005

Male patients (hips) 22 (25) 56 (57)

Mean followup, years (range) 5.5 (2.25–11.7) 5.35 (1.1–13.2) 0.2

Female patients (hips) 5 (5) 24 (25)

Weight, kg (SD) 80.6 (± 12.43) 87.95 (± 21.8) 0.181

Height, m (SD) 1.71 (± 0.10) 1.76 (± 0.10) 0.108

Body mass index (SD) 27.53 (± 4.96) 28.21 (± 6.18) 0.675

Dorr bone type A = 14, B = 16, C = 0 A = 31, B = 50, C = 1 0.56

Preoperative Harris hip score 45.92 (± 10.26) 46.15 ( ± 15.25) 0.96

SD = standard deviation.

Table 2. Various implant combinations used during the study period

Implant Osteonecrosis

(n = 30)

Primary osteoarthritis

(n = 82)

Cup design

Weber 4* 8*

APR 8 24

Interop 10 18

Converge 8 32

Stem type

APR 30 (2*) 82 (10*)

* Cemented fixation; APR = anatomic porous replacement.

Volume 466, Number 5, May 2008 Metal-on-Metal THA for Osteonecrosis 1149

123

embedded into the polyethylene [35]. This insert was the

same for all metal shells used with the exception of the

locking mechanism of the polyethylene into the metal

shell. Metasul1 (Zimmer) was designed to have better

clearance of surfaces to avoid excess friction, promote

lubrication, and allow clearance of debris [29, 35]. The

cobalt-chromium metal used in the acetabular surface of

the Metasul1 liner and the femoral head was Protasul-21

WF (Zimmer) cobalt-chromium alloy, a high carbon

wrought forged alloy. The diameter of the femoral head

used in this study was 28 mm. The clearance between the

femoral and acetabular articulation surfaces was a mean

120 lm (range, 70–170 lm). The Metasul1 insert had an

elevated metal edge where it was inlaid. This protruding

edge could cause impingement of the metal neck and cup

(Fig. 1).

We obtained data on pain and functional outcome pre-

operatively and at the final followup with a patient self-

assessment form (patient-generated Harris hip score [16];

Orthographics, Salt Lake City, UT). We determined

activity separately by asking the patients their activity

level; activity was graded as unlimited community ambu-

lation (more than eight blocks), active community

ambulation (can walk up to eight blocks), limited com-

munity ambulation (can walk two blocks), and household

ambulation (limited to household activities) [12]. Patients

completed their forms either by mail or during followup in

the office. Ninety-six of the 107 patients (101 hips) were

seen at final followup, and 11 (11 hips) were graded by

forms returned by mail. We reviewed the medical records

for revisions, complications, and clinical scores.

We obtained anteroposterior pelvic radiographs and lat-

eral radiographs (iliac oblique views) preoperatively and at

each followup visit. The preoperative radiograph was used

to determine the diagnosis. We used the 6-week postoper-

ative radiographs as the baseline for comparison with final

followup radiographs for fixation and osteolysis. Wear

could not be measured from the radiographs because it was

not possible to distinguish between the edge of the femoral

head and the metal articulation surface of the acetabular

liner. One of us (ZW) measured inclination of the cup using

the technique of Callaghan et al. [4] and anteversion using

the modified technique of Ackland et al. [1, 11]. Femoral

radiolucent lines and osteolysis were recorded in each of

seven Gruen zones [15] on the anteroposterior and lateral

radiographs [17]. Calcar resorption was a focal radiolucent

area that was seen immediately under the collar of the stem

and was located between the cortex of the calcar and the

medial edge of the stem. Fixation and osteolysis of the cup

were measured by the zones of DeLee and Charnley [8].

Cup loosening was diagnosed when there was: (1) a cir-

cumferential radiolucent line of 1 mm or wider; (2)

appearance of a new radiolucent line in any zone; (3) pro-

gression of a radiolucent line; or (4) migration of the cup by

more than 2 mm of vertical or horizontal shift or a change in

inclination of more than 5� [33].

We used the Student’s t-test to compare demographic

parameters such as age, height, weight, and body mass

index and for pre- and postoperative Harris hip scores, pain

and function scores, and number of years of followup in

both groups. Chi square test was used to compare the

categorical data (gender, bone type [9], patient self-

assessment score, and postoperative level of activity) in the

two groups. A probability value of p B 0.05 was consid-

ered significant. All data were analyzed using SPSS

software (SPSS Inc, Chicago, IL).

Results

At a mean followup of 5.5 years, the postoperative score

was similar for patients with ON and those with OA

(93.73 ± 8.2 versus 93.12 ± 8.5, respectively). Mean pain

scores at the final followup were also similar (40.48 ± 5.78

for ON versus 40.74 ± 5.76 for OA) and only three

patients with ON (11.11%) and six patients with OA

(7.5%) had self-described mild to moderate pain. There

was no difference in the mean functional scores for either

group (44.64 ± 2.78 for ON versus 43.93 ± 4.71 for OA)

with only two patients in each group requiring an assistive

device for walking. Seventeen patients (20 hips) out of 27

(30 hips) with ON reported their outcome as excellent in

the ‘‘patient self-assessment form’’ compared with 60

patients (62 hips) out of 80 (82 hips) patients with OA.Fig. 1 Retrieved Metasul1 liner with a protruded edge of the inlay

has damage to the polyethylene caused by impingement.

1150 Dastane et al. Clinical Orthopaedics and Related Research

123

Overall clinical outcome and functional activity were

similar for all measured parameters (Tables 3, 4).

Radiographic results were also similar between the OA

and ON hips. The mean cup inclination for the ON group

was 39� ± 5.9� compared with 38� ± 5.7� for OA; the

mean cup anteversion for ON hips was 18.2� ± 5.4� and

17.9� ± 5.1� for OA hips. No pelvic osteolysis was

observed in either of the groups. Femoral osteolysis was

seen in Zones 3 and 4 in one of 82 hips (1.22% in the OA

group and none of the ON hips) and calcar lysis of 3 mm x

3 mm or less was observed in two hips with ON and in

three with OA.

There were no loose stems in either group and one loose

cup in the OA group. Femoral radiolucent lines, confined to

Zones 3, 4, and 5, were seen in two hips with ON and eight

with OA. Radiolucent lines were more prevalent around the

cup with seven cups in the ON group and 20 in the OA

group affected. These incomplete radiolucent lines were in

three zones in one hip with ON and in three hips with OA;

in two zones in three hips with ON and eight hips with OA;

and in one zone in three hips with ON and nine hips with

OA. Other than the revised cup, no cup had a complete

radiolucent line in all three zones or progressive lines, and

no cup showed migration.

Overall, there were six acetabular revisions with four

metal shell replacements and two liner changes. There

were no stem revisions. We revised one cup in the OA

group for aseptic loosening. This cup had bone graft for

protrusio acetabuli and had three zone circumferential

radiolucent lines on the postoperative radiograph. We

revised two cups in the OA group for dislocation. There

were two liner changes, one in each group, for painful

impingement at 2 years and 8.5 years postoperatively. One

patient with OA had a liner dissociation, which occurred at

7.7 years followup (Fig. 2). In this hip, the acetabular

component was malpositioned with 30� of inclination and

2� of anteversion, which resulted in impingement and

failure of the locking mechanism. This hip had a revision

of the cup to a position that prevented impingement. The

only other reoperation was in one patient with ON in whom

a periprosthetic fracture occurred distal to the femoral

component as a result of a traffic accident; it was suc-

cessfully fixed with open reduction and internal fixation.

Discussion

Traditionally, ON of the femoral head as the reason for

THA has had outcomes inferior to the hips with OA as the

cause of the operation [24, 28]. Specifically, the ON hips

have had more loosening of components [24, 26, 28]. We

asked whether the outcome of THA was different in

patients 60 years old or younger with ON compared with

OA when using noncemented implant fixation and metal-

on-metal articulation (Metasul1).

Our study was limited in that it was not randomized and

has nonconsecutive patient selection with a smaller sample

size. These patients were operated on at various time

periods, depending on availability of Metasul1 implants.

The study did, however, include all of the patients 60 years

or younger operated on by us who had ON and OA and a

Metasul1 insert. The study included both cementless and

cemented cups, which have different propensities for

osteolysis. However, we had no case of osteolysis around

the cup in either group so this did not influence results.

Table 3. Clinical outcome in patients with osteonecrosis and

primary osteoarthritis at final followup

Outcome

(clinical grade)

Patients in the

osteonecrosis

group (hips)

Patients in the

primary osteoarthritis

group (hips)

p Value

Excellent 17 (20) 60 (62) 0.58

Good 8 (8) 15 (15)

Fair 2 (2) 5 (5)

Table 4. Functional activity in patients with osteonecrosis and

primary osteoarthritis at final followup

Outcome

(functional

activity)

Patients in the

osteonecrosis

group (hips)

Patients in the

primary osteoarthritis

group (hips)

p Value

Unlimited

ambulator

25 (28) 68 (70) 0.32

Active community

ambulator

2 (2) 10 (10)

Limited community

ambulator

0 2 (2)

Fig. 2 Anteroposterior pelvic radiograph shows a disassociated

Metasul1 liner in the right THA at 7.7 years postoperatively.


123

Finally, wear cannot be measured in metal-on-metal

articulation so we could not compare it with series using

polyethylene articulations.

We found no difference in the clinical or radiographic

outcome for the length of our followup. Our mean followup

was 5.35 years for OA and 5.5 years for ON with the

longest followup being 13.2 years and 11.7 years, respec-

tively. There was no osteolysis of the pelvis in either group

and only one OA hip showed osteolysis in the femur.

Fixation was secure in all cemented or noncemented hips

and failures in both groups were caused by impingement

except for one OA hip with a technical error, which was

revised.

The importance of our data is reflected in the similarity

of outcomes in ON and OA hips. The results of cemented

THAs with metal-on-polyethylene articulation in ON have

not generally been satisfactory in studies reported with a

similar age group and followup as our mean 5.5 years

[5, 7, 10, 24, 26, 28]. One study [7] reported an overall

failure rate of 37% at a mean followup of 7.6 years in 28

cemented arthroplasties; a second study [28] reported

unsatisfactory results in 14 of 29 ON hips (48%) compared

with 16 of 63 (25%) in patients with OA, and a third study

[26] had a poor outcome in 11 of 12 cemented ON hips. At

a long-term followup of 15 years, Ortiguera et al. [24] had

nine of 18 failed hips in 35 patients as compared with four

of 17 in patients with OA.

In contrast, cementless arthroplasties with metal-on-

polyethylene articulation have had better survival than

cemented arthroplasties for ON. One study [23] reported no

difference in fixation at 3 years among 52 matched hips; a

second [25] reported loosening of 3% of acetabular com-

ponents in 35 ON hips at 7.5 years; and a third [19] had

98% survival of 100% cementless hips at 10 years.

Failure with cemented components may be related to

changes in cancellous bone structure and remodeling with

ON. Defective cancellous bone might not support the

interdigitation of cement and the increased load placed on

it. The framework of cancellous bone in ON is apparently

weak. Arlot et al. [2] studied the histomorphometry of iliac

bone in 77 patients with ON and normal kidney function

and found osteomalacia in nine patients with the remaining

68 patients having reduced trabecular bone volume, a

reduced calcification rate, and a thin osteoid seam indi-

cating defective osteoblastic apposition and healing. Calder

et al. [3] described extensive osteocyte death and an

abnormal remodeling capacity in the proximal femur in

ON, and proposed premature loosening of implants in

patients with ON may be related to this presence of

abnormal cancellous bone at the implant-bone and cement-

bone interfaces.

Metasul1 metal articulation also protects against bone

failure by a low volume of particles, which prevents

changes in osteolysis. In retrieval analysis of 118 second-

generation Metasul1 articulations for up to 8 years, there

was volumetric wear of 0.3 mm3 per year, which is 60

times less than metal-on-polyethylene articulation [31].

Osteolysis with Metasul1 metal-on-metal articulation has

been rarely observed in studies with no osteolysis in 39

cementless arthroplasties (20 ON, 19 OA hips) in one study

[21]; in a second study [13], none at 5 to 12 years followup

of 56 cemented and cementless arthroplasties; in a third

[27], none in 106 cementless arthroplasties at a mean

6.4 years; and in the fourth [18], one of 68 hips with pelvic

osteolysis needing revision and another hip with two small

areas of focal femoral lesions around a stable stem.

We observed several mechanical complications from

impingement. Two dislocations, two liner changes, and one

liner disassociation had evidence of impingement at revi-

sion with indentations on the femoral neck and acetabular

liner. The Metasul1 liners used in our patients had an inlay

with a prominent metal rim. In addition, we used a 28-mm

head on a 12 to 14 taper femoral neck giving a head-neck

ratio of 2.0, which is a risk for impingement [34].

Metasul1 liners have been redesigned to have a buried

metal inlay in a chamfered polyethylene rim (Fig. 3), and

we use a 32-mm or larger femoral head (36-mm+ Durom;

Zimmer) when we implant Metasul1 articulations.

THA for arthritis secondary to ON of the femoral head

did not result in higher failure rates than OA with modern

cementless implants. We continue to use cementless fixa-

tion and this metal-on-metal articulation for patients

60 years of age or younger with either ON or OA as a

cause of their arthritic hip.

Fig. 3 The current Metasul1 liner has a buried metal inlay and a

chamfered polyethylene rim to reduce impingement.

1152 Dastane et al. Clinical Orthopaedics and Related Research

123

References

1. Ackland MK, Bourne WB, Uhthoff HK. Anteversion of the

acetabular cup. Measurement of angle after total hip replacement.


2. Arlot ME, Bonjean M, Chavassieux PM, Meunier PJ. Bone his-

tology in adults with aseptic necrosis. Histomorphometric

evaluation of iliac biopsies in seventy-seven patients. J BoneJoint Surg Am. 1983;65:1319–1327.

3. Calder JD, Pearse MF, Revell PA. The extent of osteocyte death

in the proximal femur of patients with osteonecrosis of the


4. Callaghan JJ, Salvati EA, Pellicci PM, Wilson PD Jr, Ranawat

CS. Results of revision for mechanical failure after cemented

total hip replacement, 1979 to 1982. A two to five-year follow-up.


5. Chandler HP, Reineck FT, Wixson RL, McCarthy JC. Total hip

replacement in patients younger than thirty years old. A five-year

follow-up study. J Bone Joint Surg Am. 1981;63:1426–1434.

6. Cohen J, Bindelglass DF, Dorr LD. Total hip replacement using

the APR II system. Techniques Orthop. 1991;6:40–58.

7. Cornell CN, Salvati EA, Pellicci PM. Long-term follow-up of

total hip replacement in patients with osteonecrosis. Orthop ClinNorth Am. 1985;16:757–769.

8. DeLee JG, Charnley J. Radiological demarcation of cemented

sockets in total hip replacement. Clin Orthop Relat Res.

1976;121:20–32.

9. Dorr LD, Faugere MC, Mackel AM, Gruen TA, Bognar B,

Malluche HH. Structural and cellular assessment of bone quality

of proximal femur. Bone. 1993;14:231–242.

10. Dorr LD, Takei GK, Conaty JP. Total hip arthroplasties in

patients less than forty-five years old. J Bone Joint Surg Am.

1983;65:474–479.

11. Dorr LD, Wan Z. Ten years of experience with porous acetabular

components for revision surgery. Clin Orthop Relat Res.

1995;319:191–200.

12. Dorr LD, Wan Z, Gruen T. Functional results in total hip

replacement in patients 65 years and older. Clin Orthop RelatRes. 1997;336:143–151.

13. Dorr LD, Wan Z, Longjohn DB, Dubois B, Murken R. Total hip

arthroplasty with use of the Metasul metal-on-metal articulation.

Four to seven-year results. J Bone Joint Surg Am. 2000;82:789–

798.



15. Gruen TA, McNeice GM, Amstutz HC. ‘Modes of failure’ of






17. Johnston RC, Fitzgerald RH Jr, Harris WH, Poss R, Muller ME,

Sledge CB. Clinical and radiographic evaluation of total hip

replacement. A standard system of terminology for reporting

results. J Bone Joint Surg Am. 1990;72:161–168.

18. Kim SY, Kyung HS, Ihn JC, Cho MR, Koo KH, Kim CY.

Cementless Metasul metal-on-metal total hip arthroplasty in

patients less than fifty years old. J Bone Joint Surg Am.

2004;86:2475–2481.

19. Kim YH, Oh SH, Kim JS, Koo KH. Contemporary total hip

arthroplasty with and without cement in patients with osteone-

crosis of the femoral head. J Bone Joint Surg Am. 2003;85:675–

681.

20. Manning DW, Ponce BA, Chiang PP, Harris WH, Burke DW.

Isolated acetabular revision through the posterior approach: short-

term results after revision of a recalled acetabular component.


21. Migaud H, Jobin A, Chantelot C, Giraud F, Laffargue P,

Duquennoy A. Cementless metal-on-metal hip arthroplasty in

patients less than 50 years of age: comparison with a matched

control group using ceramic-on-polyethylene after a minimum

5-year follow-up. J Arthroplasty. 2004;19(Suppl 3):23–28.



23. Mont MA, Seyler TM, Plate JF, Delanois RE, Parvizi J. Unce-

mented total hip arthroplasty in young adults with osteonecrosis

of the femoral head: a comparative study. J Bone Joint Surg Am.

2006;88S:104–109.

24. Ortiguera CJ, Pulliam IT, Cabanela ME. Total hip arthroplasty

for osteonecrosis: matched-pair analysis of 188 hips with long-

term follow-up. J Arthroplasty. 1999;14:21–28.

25. Piston RW, Engh CA, De Carvalho PI, Suthers K. Osteonecrosis

of the femoral head treated with total hip arthroplasty without

cement. J Bone Joint Surg Am. 1994;76:202–214.

26. Ranawat CS, Atkinson RE, Salvati EA, Wilson PD Jr. Conven-

tional total hip arthroplasty for degenerative joint disease in

patients between the ages of forty and sixty years. J Bone JointSurg Am. 1984;66:745–752.

27. Saito S, Ryu J, Watanabe M, Ishii T, Saigo K. Midterm results of

Metasul metal-on-metal total hip arthroplasty. J Arthroplasty.

2006;21:1105–1110.


of total hip arthroplasty for osteonecrosis of the femoral head. Acomparison with osteoarthritis. Clin Orthop Relat Res.

1989;244:198–207.

29. Santavirta S, Bohler M, Harris WH, Konttinen YT, Lappalainen

R, Muratoglu O, Rieker C, Salzer M. Alternative materials to

improve total hip replacement tribology. Acta Orthop Scand.

2003;74:380–388.

30. Schmalzried TP, Peters PC, Maurer BT, Bragdon CR, Harris WH.

Long-duration metal-on-metal total hip arthroplasties with low

wear of the articulating surfaces. J Arthroplasty. 1996;11:322–

331.

31. Sieber HP, Rieker CB, Kottig P. Analysis of 118 second-gener-

ation metal-on-metal retrieved hip implants. J Bone Joint SurgBr. 1999;81:46–50.

32. Stulberg BN, Singer R, Goldner J, Stulberg J. Uncemented total

hip arthroplasty in osteonecrosis: a 2- to 10-year evaluation. ClinOrthop Relat Res. 1997;334:116–123.

33. Udomkiat P, Wan Z, Dorr LD. Comparison of preoperative

radiographs and intraoperative findings of fixation of hemispheric

porous-coated sockets. J Bone Joint Surg Am. 2001;83:1865–

1870.

34. Usrey MM, Noble PC, Rudner LJ, Conditt MA, Birman MV,

Santore RF, Mathis KB. Does neck/liner impingement inc-

rease wear of ultrahigh-molecular-weight polyethylene liners?


35. Weber BG. Experience with the Metasul total hip bearing system.

Clin Orthop Relat Res. 1996;329S:69–77.


123

ORIGINAL ARTICLE

Do Patient Expectations of Spinal Surgery Relate to FunctionalOutcome?

Albert Yee MD, Nana Adjei BSc, Jennifer Do,

Michael Ford MD, Joel Finkelstein MD

Received: 27 June 2007 / Accepted: 15 February 2008 / Published online: 18 March 2008


Abstract It is important for surgeons to understand

patients’ expectations for surgery. We asked whether

patient factors and preoperative functional outcome scores

reflect the degree of expectations patients have for pos-

terior spinal surgery. Second, we asked whether patients’

expectations for surgery predict improvements in func-

tional outcome scores after surgery. We prospectively

enrolled 155 consecutive surgical patients with greater than

90% followup. Patients’ expectations were evaluated pre-

operatively along with SF-36 and Oswestry disability

questionnaires. Postoperatively (6 months for decompres-

sion; 1 year for fusions), we quantified patient-derived

satisfaction regarding whether expectations were met and

by patient-derived functional outcome scores. In patients

undergoing decompression, gender, SF-36 general health

domain, and SF-36 physical component score predicted

patients with high expectations for surgery. Patients with

high expectations also reported greater postoperative

improvements in SF-36 role physical domain scores after

surgery. Expectations for surgery were met in 81% of

patients. In a subset of patients (21 of 143), expectations

were not met. These patients reported lower mean preop-

erative SF-36 general health, vitality, and mean mental

component scores.

Level of Evidence: Level I, prognostic study. See the


of evidence.

Introduction

Surgery for degenerative conditions of the lumbar spine is

a frequent indication for spinal surgery. The efficacy of

spinal surgical procedures and its potential impact on the

natural history of the degenerative process is under

increasing scrutiny [5, 6]. The rates of spinal surgery for

degenerative conditions have increased with time and our

general population continues to age [3]. Various factors can

influence patient outcome after lumbar spinal surgery that

may be important in guiding patient selection for surgery

[5, 6, 15].

Physical variables such as preoperative functional status

and medical comorbidity have influenced surgical outcome

[12, 15]. Psychologic variables reportedly correlate with

patient satisfaction after spine surgery [13]. A patient’s

preoperative rating of his or her health may be an important

predictor of symptom severity, walking capacity, and sat-

isfaction after lumbar decompression [13]. In one study of

patients undergoing total joint arthroplasty, patients with

high mental distress, such as anxiety and depression, before

surgery were more likely to have worse reported physical

outcomes than those with minimal or no mental distress [1].

What patients expect from spine surgery also appears to

influence outcome [4, 10, 18]. Patients’ satisfaction after








A. Yee (&), N. Adjei, J. Do, M. Ford, J. Finkelstein

The Spine Program, Division of Orthopaedic Surgery,

Sunnybrook Health Sciences Centre, 2075 Bayview Avenue,

Room MG 371-B, Toronto, ON, Canada M4N 3M5


A. Yee, M. Ford, J. Finkelstein

Department of Surgery, University of Toronto, Toronto, ON,

Canada

123


DOI 10.1007/s11999-008-0194-7

lumbar surgery may not always correlate with postoperative

physical functioning [22]. Patient gender and type of

surgery performed also may influence surgical outcome

[19, 20]. The association between patients’ expectation for

surgery and how that may relate to postoperative outcomes

has not been clearly delineated. Patients with high expec-

tations for surgery may have a greater result from surgery if

their expectations reflect their motivation. Alternately,

patients with high expectations for surgery may have

unrealistic expectations in what surgery can accomplish

and experience a poorer result from surgery.

The primary question was whether patient factors and

baseline preoperative functional outcome scores reflected

the degree of expectations that patients have for surgery.

Second, we asked whether patients’ expectations for sur-

gery predict patient-reported improvements in functional

outcome after surgery.


We prospectively followed 155 consecutive patients

undergoing posterior lumbar spinal surgery for degenera-

tive conditions of the lumbar spine between 1998 and 2002.

Indications for surgery included back, buttock, and/or

lower extremity pain of spondylogenic origin. We included

patients undergoing decompression and/or spondylodesis

(spinal fusion) regardless whether they had prior lumbar

surgery. Patients with spinal stenosis underwent decom-

pression and patients with spondylolisthesis underwent

decompression and fusion. We excluded 26 patients

because they were not capable of completing the ques-

tionnaires (eg, cognitive or language limitations) (n = 17)

or declined participation (n = 9). After the exclusions, 143

remaining patients were assessed with questionnaires

(SF-36, Oswestry Disability Index) preoperatively and

6 months (decompressions) and 1 year (fusions) after sur-

gery. The mean age of the 143 patients was 52 years

(range, 18–84 years; male:female ratio, 1:1) (Fig. 1). We

calculated preoperative patient comorbidity using the

Charlson Comorbidity Index [2]. Institutional review board

approval was obtained for the study.

Baseline patient and surgical demographics of patients

in the study included an average age at surgery of 52 years

(range, 18–84 years) and a male:female ratio of 1:1. Forty-

three percent of surgeries were performed for disc herniation,

9% for isthmic spondylolisthesis, 10% for degenerative

spondylolisthesis, 30% for stenosis, 6% for spondylosis,

1% for pseudarthrosis, and 1% for adjacent segment dis-

ease. Among the patients in whom decompression was

performed (n = 94), single-level decompressions were

performed in 70%, two-level decompressions in 21%, and

multilevel in 9%. Thirty-four percent involved spinal

fusion of which 75% were instrumented (Fig. 1). Among

the patients in whom fusions were performed (n = 49),

49% had single-level fusions and 51% had multilevel

fusions. Forty-two of 49 patients who had fusions also

underwent spinal decompression. Revision cases and

workers’ compensation or litigation cases accounted for

11% and 9%, respectively.

The mean Mental Component and Physical Component

scores preoperatively were 42.1 ± 1.2 and 22.3 ± 1.1,

respectively. These values are approximately one and three

standard deviations below age- and gender-matched

national norms. The mean preoperative Oswestry score was

48.7 ± 1.7%.

Surgery was performed by one of two spine fellowship-

trained surgeons (AY, JF). Our standard approach for a disc

herniation was a discectomy with partial medial facetec-

tomy and lateral recess decompression either unilaterally or

bilaterally according to patient symptoms. For fusion pro-

cedures, a posterior intertransverse process lumbar fusion

was performed using autogenous iliac crest bone. Instru-

mented procedures used a pedicle screw/rod system (USS,

Synthes, Inc, (Monument, CO) from 1998–2000 and Xia,

Stryker1, (Kalamazoo, MI) from 2000–2002).

Patients were permitted activity ad lib after surgery. No

lumbar orthoses were used postoperatively. A 6-week

course of active and passive physiotherapy was recom-

mended at the 6-week postoperative followup.

Patients were reviewed clinically and radiographically

(fusion procedures) at 6 weeks, 3 months, 6 months, and

1 year (fusion procedures) after surgery. Study personnel

not involved in care of the patients and blinded to outcome

status sent the patients questionnaires before surgery and

again 6 months and 1 year after surgery. In the cover letter,

patients were instructed to contact the study coordinator for

clarification needed for any of the survey questions.

Patients were requested to complete the preoperative

questionnaire during the week before surgery. Preopera-

tively, patients completed a generic health status measure

(SF-36) and a disease-specific questionnaire (Oswestry

Disability Index). In addition, patients completed an

expectations questionnaire asking them to rate their

expectations for surgery regarding relief of back and leg

pain, their ability to sleep, recreational and daily activities,

and return to work (Table 1). Postoperatively, we evalu-

ated patients’ expectations and compared them with

patient-derived functional outcome measures at 6 months

for decompressions and 1 year for procedures involving

spinal fusion. The postoperative expectation questionnaire

investigated the patients’ attitudes toward the outcome of

surgery as it related to meeting their initial expectations

(Table 2). Surgeons were blinded to the patients’ expec-

tations and functional outcome questionnaires until

completion of the study.

Volume 466, Number 5, May 2008 Patient Expectations of Spinal Surgery 1155

123

Patients’ responses to the expectation questionnaires

were used to define a priori the patients who had either high

or low preoperative expectations for surgery and to deter-

mine if surgery met preoperative expectations. We

assumed a high preoperative expectation for surgery if the

average of applicable items (Table 1) was greater than 3.5

(ie, majority of replies to items in Table 1 indicating either

a very likely or extremely likely response). Excluding

items in which patients indicated the particular question

stem was not applicable (ie, last column, Table 2), we

summed and averaged patient-specific raw scores for the

items that were applicable to the patient. We assumed a

score of 2.5 or less would constitute overall expectations

for surgery being met (ie, majority of items that were

applicable to the patient would be recorded as either defi-

nitely yes or probably yes as depicted in Table 2). We

considered 94 four patients to have lower preoperative

expectations and 51 to have higher preoperative expectations.

Fig. 1 This consort flow chart

depicts patient recruitment and

followup during the study period.

Table 1. Preoperative expectations questionnaire

Parameter Not at all

likely

Slightly

likely

Somewhat

likely

Very

likely

Extremely

likely

Not

applicable

Relief from back pain 1 2 3 4 5 6

Relief from leg pain 1 2 3 4 5 6

Relief from numbness, weakness, instability 1 2 3 4 5 6

To do more everyday household or yard activities 1 2 3 4 5 6

To sleep more comfortably 1 2 3 4 5 6

To go back to my usual job and normal activities 1 2 3 4 5 6

To exercise and do recreational activities 1 2 3 4 5 6

1156 Yee et al. Clinical Orthopaedics and Related Research

123

The distribution of patients with high versus low preoper-

ative expectations for surgery was similar between the two

surgical groups (decompression versus fusion).

We created two prediction models: (1) Patient age, gen-

der, comorbidity, and preoperative functional outcome

scores were evaluated to determine if these variables

reflected patients who had either high or low expectations for

surgery; and (2) Degree of improvement from baseline

generic and disease-specific functional outcome scores after

surgery was evaluated to determine if they could predict

patients who possessed greater expectations for surgery. We

performed a post hoc analysis by the operating surgeon to

ensure surgery by one of the two surgeons did not influence

patients’ outcomes and expectations in our study.

Improvement in patient-derived functional outcome

measures after surgery was analyzed by paired analysis

comparing patient-specific preoperative with postoperative

SF-36 and Oswestry scores. After dichotomizing patients

into those with high or low preoperative expectations,

logistic regression analysis was performed. Because of the

differences in length of followup according to surgery type

(decompression versus fusion), subgroup analysis was

performed separately for these two procedures. In the first

prediction model on preoperative data, factors including

patient age, gender, comorbidity, and preoperative func-

tional scores (SF-36 domain scores, SF-36 Mental

Component score, SF-36 Physical Component score,

Oswestry Disability Index) were evaluated to determine if

these variables reflected the likelihood of patients having

high preoperative expectations for surgery. The second

prediction model focused on postoperative analysis. We

calculated the improvements each patient had after surgery

for the eight domains of the SF-36, mental and physical

components, and Oswestry Disability Index scores. We

then determined if improvements to these variables pre-

dicted the likelihood of patients having had high

expectations for surgery. Analysis was performed with and

without inclusion of patients who are known to have poor

prognostic factors for outcome (workers’ compensation/

litigation, revision surgical cases).

Results

Several patient demographic and preoperative functional

outcome variables reflected patients with high preoperative

expectations for surgery. In the subgroup analysis of

patients with decompressions (n = 94), gender, SF-36

general health domain, and SF-36 Physical Component

scores reflected patients who had high preoperative

expectations for surgery (Table 3). Specifically, male

gender, better preoperative SF-36 general health domain,

and poorer preoperative SF-36 Physical Component score

reflected patients who possessed high expectations for

surgery (Table 3). Remaining SF-36 domain and compo-

nent scores were not statistically significant. In the

subgroup analysis of patients undergoing fusion (n = 49),

patient age, gender, and preoperative functional outcome

scores did not reflect higher patient expectations. We

observed no difference in patient age (p = 0.18), comorbidity

Table 2. Postoperative expectations questionnaire

Parameter Definitely yes Probably yes Not sure Probably not Definitely not Not applicable

Relief from back pain 1 2 3 4 5 6

Relief from leg pain 1 2 3 4 5 6

Relief from numbness, weakness, instability 1 2 3 4 5 6

To do more everyday household or yard activities 1 2 3 4 5 6

To sleep more comfortably 1 2 3 4 5 6

To go back to my usual job and normal activities 1 2 3 4 5 6

To exercise and do recreational activities 1 2 3 4 5 6

* Are you satisfied with your surgical result?; Are the results of your treatment what you expected? Yes No.

Table 3. Patient parameters and baseline functional outcome scores

as predictors

Parameter Odds

ratio

95% Confidence

interval

p Value*

Age 1.08 0.98–1.19 0.11

Gender 0.18 0.03–1.00 0.05*

Comorbidity 1.01 0.97–1.05 0.75

SF-36 Physical functioning

domain

1.03 0.98–1.09 0.20

SF-36 Role physical domain 1.01 0.99–1.04 0.34

SF-36 Bodily pain 1.04 0.99–1.10 0.12

SF-36 General health 1.04 1.01–1.08 0.02*

SF-36 Vitality 1.04 1.00–1.09 0.06

SF-36 Social functioning 1.01 0.97–1.06 0.58

SF-36 Role emotional 1.01 0.97–1.04 0.74

SF-36 Mental health 1.05 0.97–1.13 0.24

SF-36 Mental Component score 0.81 0.63–1.04 0.10

SF-36 Physical Component score 0.75 0.59–0.96 0.02*

Oswestry Disability Index 1.00 0.96–1.04 0.98

* p \ 0.05.


123

(p = 0.5), distribution by revision (p = 0.6), or workers’

compensation/litigation cases (p = 0.4) comparing de-

compressive versus fusion groups. There were more

(p = 0.02) males in the group having decompressions and

patients undergoing decompression recorded higher SF-36

physical function (p = 0.04) and general health domain

(p = 0.03) scores when compared with patients undergo-

ing fusion preoperatively. In both groups, significant

improvements in functional scores were observed after

surgery (Table 4).

In our second prediction model, higher preoperative

expectations predicted greater improvement in some but

not all functional outcome measures after surgery. Patients

with higher preoperative expectations had greater

improvement in mean SF-36 role physical domain scores

(OR, 3.7; 95% CI, 1.59–8.58; p = 0.002). In the majority

of patients expectations for surgery were met (Figs. 2, 3).

Overall patient satisfaction with surgery as quantified in

our postoperative questionnaire was 81% (116 of 143). In

general, patients had a higher expectation for the relief of

leg versus back pain and a higher expectation for

improvements in sleep and return to household and recre-

ational activities (Fig. 2). Expectations for return to work-

related activities were lower than expectations for relief of

leg pain (Fig. 2). In 19% (27 of 143 patients) of patients,

surgery did not meet overall expectations. Of these 27

patients, there were two cases of pseudarthroses, one case

of pedicle screw misplacement, and three additional cases

in which medical comorbidities were believed to be con-

tributing factors.

For the 21 of 27 patients whose expectations for surgery

were not met and no other poor prognostic factor could be

identified, we observed lower reported preoperative SF-36

general health, vitality domain scores, and mean Mental

Component scores (p = 0.02, 0.01, and 0.04, respectively).

Patients in whom expectations were not met also reported

less (p \ 0.05) improvement in SF-36 and Oswestry scores

when compared with patients in whom expectations were

met. Patients were likely to be less satisfied if they had

prior lumbar surgery (p = 0.02) and were involved with

workers’ compensation or litigation (p \ 0.001). They also

were more likely (p = 0.004) to undergo additional spinal

surgery.

Table 4. Results of SF-36 and Oswestry Disability Index scores

Parameter Preoperative

± SD

Postoperative

± SD

SF-36 Physical functioning domain 30.0 ± 2.1 61.6 ± 2.4

SF-36 Role physical domain 10.8 ± 2.0 50.7 ± 3.5

SF-36 Bodily pain domain 23.8 ± 1.5 57.9 ± 2.2

SF-36 General health domain 58.4 ± 2.3 67.9 ± 2.1

SF-36 Vitality domain 38.3 ± 1.8 56.3 ± 1.8

SF-36 Social functioning domain 40.7 ± 2.3 73.3 ± 2.4

SF-36 Role emotional domain 45.2 ± 3.8 69.6 ± 3.4

SF-36 Mental health domain 61.9 ± 1.9 72.8 ± 1.5

SF-36 Mental Component score 42.1 ± 1.2 48.1 ± 1.1

SF-36 Physical Component score 22.3 ± 1.1 38.6 ± 1.2

Oswestry Disability Index

(percent disability)

48.7 ± 1.7 23.1 ± 1.9

SD = standard deviation.

Fig. 2 Patients generally had higher expectations for relief of leg

versus back pain and for improvements in sleep and return to

household and recreational activities. There appeared to be a lower

expectation for return to work-related activities.

Fig. 3 The majority of patients believed their expectations for

surgery were met in the seven categories relating to symptoms and

physical function.


123

Discussion

What patients expect from spine surgery is important as it

relates to patient satisfaction. Patients’ satisfaction after

lumbar surgery may not always correlate with postopera-

tive physical functioning [22]. We therefore asked whether

patient factors and baseline preoperative functional out-

come scores reflected the degree of expectations that

patients have for surgery. We then asked whether patient

expectations for surgery predict patient-reported improve-

ments in functional outcome after surgery. By determining

if patients’ expectations for surgery are met and whether

this translates into satisfaction after surgery is important to

our role as clinicians.

We note several limitations. Varying diagnostic degen-

erative conditions of the lumbar spine were evaluated. We

did perform a subgroup analysis in the current study

evaluating decompressive and fusion procedures sepa-

rately. Although the SF-36 includes a mental component to

the assessment, a formal psychometric evaluation was not

performed on the study cohort. This study evaluated the

short-term satisfaction and outcomes of patients undergo-

ing posterior lumbar spinal surgery for degenerative

conditions. At the last followup, despite improvement after

surgery, the mean SF-36 Physical Component score of our

patients was still on average one standard deviation below

age- and gender-matched national norms [8]. Longer-term

followup may be needed to determine any potential addi-

tional improvement after surgery and how this may

influence patients’ expectations [12, 14].

We observed several patient demographic and preop-

erative functional outcome variables reflecting patients

who reported higher preoperative expectations for sur-

gery. Male gender, greater perceived SF-36 general

health, and lower reported SF-36 Physical Component

scores were predictors of patients possessing greater

expectations for surgery in the decompressive group. In a

study of older patients than those in our study cohort,

Shabat et al. evaluated patients older than 65 years

undergoing decompression for lumbar spinal stenosis

[19]. They observed the satisfaction rate after surgery at

a minimum of 1-year followup as determined by tele-

phone interview was worse in women, although both

genders reported improvements in activities of daily

living and reduction in pain perception. Hakkinen et al.

also reported gender differences existed in baseline

Oswestry Disability Index scores in patients undergoing

surgery for lumbar disc herniation [7]. They observed

greater baseline disability in walking, sex life, social life,

and traveling items of the Oswestry Disability Index in

women. In our study, a lower baseline SF-36 Physical

Component score was predictive of greater expectations

for surgery. When considering an outcome measure that

gauges a patient’s perception of their overall function

from a physical perspective, the issue of chronicity of

clinical course may be an important variable in addition

to the absolute magnitude of that function that a patient

reports before surgery. Because current indications for

surgery are primarily for pain and function, patients

reporting lower function physically may have more to

gain by surgical intervention and therefore have greater

expectations for their surgical results.

Patients with high expectations also reported greater

improvements in SF-36 role physical domain after surgery,

but not greater improvements in other SF-36 domains,

component scores, and Oswestry Disability Index. Longer

patient followup and/or a larger sample size may be nec-

essary to more accurately define parameters in which

expectations impact the magnitude of improvements in

functional outcomes. We did observe that patients’

expectations for surgery were met in the majority of

patients (81%). We also observed that when expectations

for surgery were met, greater patient satisfaction and

improvements in functional outcome were reported. Spinal

surgery for degenerative conditions of the lumbar spine are

more likely to be successful in meeting patients’ expecta-

tions for relief of radicular leg symptoms when compared

with low back pain [13]. Revision lumbar surgery, workers’

compensation, and litigation predicted a poorer functional

outcome; however, these cases accounted for a small pro-

portion of our study cohort. Katz et al. studied the

prognostic importance of patients’ assessment of their

health and comorbidity in outcome after surgery in

degenerative lumbar spinal stenosis [15]. They observed

that patients who perceived their general health to be poor

were less likely to show substantial improvement after

surgery when compared with patients who perceived their

general health to be good. In our subgroup analysis of

patients undergoing decompression, we also observed that

patients who reported a higher SF-36 general health

domain score also tended to have greater expectations for

surgery. Gepstein et al. [4] reported the expectations rela-

ted to satisfaction and preoperative expectations could aid

in predicting postoperative satisfaction in elderly patients

with lumbar spinal stenosis. However, in their study, pre-

operative expectation was assessed by one question

regarding either low or high expectations for successful

surgical treatment when compared with our study evalu-

ating several parameters of pain, physical, and daily

function relating to expectations [4]. A patient’s motivation

appears important in that patients with high expectations

for surgery may more likely report improved function and

satisfaction after surgery [10, 17].

The notion of meeting patients’ expectations for treat-

ment is important in their perception of satisfaction

[10, 11, 16]. We observed concordance in that patients who


123

believed their expectations for surgery were not met also

reported less improvement as quantified by functional

outcome measures. Although surgery type (fusion versus

decompression) was not associated with the probability of

meeting expectations after surgery in our study, the study

by Toyone et al. of 98 patients with decompression sug-

gested patients who were undergoing surgery for stenosis

were more likely to have unrealistic expectations when

compared with patients undergoing surgery for disc her-

niation [20]. Overall satisfaction with spinal surgery was

71% to 86% in their series, which is consistent with the

results of our study.

An important consideration in patient satisfaction and

expectations for surgery is the surgeon-patient discussion

regarding the role of surgery for the patient’s condition.

Although there is the potential for surgeon bias in edu-

cating what patients may expect from surgery, we used a

standard discussion between the operating surgeon and the

patient regarding the role and expected benefits of surgery.

Preoperative information was provided by our two

surgeons, including a standardized patient-oriented infor-

mation package for either decompressive or fusion surgery.

The provision of information whereby leg pain is managed

more satisfactorily than back pain may prebias patients’

expectations for outcome [13]. What patients retain from

preoperative instructions and surgical counseling in

informed consent is generally poor [9, 21]. Patients’

expectations for surgery is a multifaceted issue, and patient

characteristics and surgical counseling regarding what

patients expect from surgery influence outcome. Although

we have dichotomized patients into those with high versus

low expectations for surgery based on their responses to

aspects of physical function and symptoms, what consti-

tutes unrealistic expectations patients may have for surgery

and conversely surgical counseling that is appropriate to

guide realistic expectations for surgery requires additional

study.

Posterior lumbar spinal surgery for degenerative condi-

tions can assist in improving patients’ symptoms and

functioning. The expectations for surgery are met in the

majority of patients. Patients’ preoperative perception of

general health, vitality, and mental health was worse in

patients in whom surgery did not meet expectations. In

patients undergoing decompressive surgery, gender and

some baseline functional measures including the SF-36

physical component score could reflect patients who were

more likely to possess a higher degree of expectation for

their surgical result. A higher degree of expectation for

surgery modestly predicted greater improvement in some

but not all functional outcome measures after surgery.

Functional outcome measures may be of value in guiding

patient selection and education regarding potential surgical

outcomes.

Acknowledgments We appreciate the contributions of Christine Le,

Emi Do, Dawn Barbieri, Dr. Mubarak Al-gahtany, and Lynn Antwi-

Boasiako to this study, and we thank Dr. Marjan Vidmar for assis-

tance with the statistical analysis.

References

1. Ayers DC, Franklin PD, Trief PM, Ploutz-Snyder R, Freund D.

Psychological attributes of preoperative total joint replacement

patients: implications for optimal physical outcome. J Arthro-plasty. 2004;19(7 suppl 2):125–130.

2. Charlson M, Szatrowski TP, Peterson J, Gold J. Validation of

a combined comorbidity index. J Clin Epidemiol. 1994;47:

1245–1251.

3. Ciol MA, Deyo RA, Howell E, Kreif S. An assessment of surgery

for spinal stenosis: time trends, geographic variations, compli-

cations, and reoperations. J Am Geriatr Soc. 1996;44:285–290.

4. Gepstein R, Arinzon Z, Adunsky A, Folman Y. Decompression

surgery for lumbar spinal stenosis in the elderly: preoperative

expectations and postoperative satisfaction. Spinal Cord.

2006;44:427–431.

5. Gibson JN, Grant IC, Waddell G. Surgery for lumbar disc pro-

lapse. Cochrane Database Syst Rev. 2000(3):CD001350.

6. Gibson JN, Waddell G, Grant IC. Surgery for degenerative

lumbar spondylosis. Cochrane Database Syst Rev. 2000(3):

CD001352.

7. Hakkinen A, Kautiainen H, Jarvenpaa S, Arkela-Kautiainen M,

Ylinen J. Changes in the total Oswestry Index and its ten items in

females and males pre- and post-surgery for lumbar disc herni-

ation: a 1-year follow-up. Eur Spine J. 2007;16:347–352.

8. Hopman WM, Towheed T, Anastassiades T, Tenenhouse A,

Poliquin S, Berger C, Joseph L, Brown JP, Murray TM, Adachi

JD, Hanley DA, Papadimitroupolos E. Canadian normative data

for the SF-36 health survey. Canadian Multicentre Osteoporosis

Study Research Group. CMAJ. 2000;163:265–271.

9. Hutson MM, Blaha JD. Patients’ recall of preoperative instruction

for informed consent for an operation. J Bone Joint Surg Am.

1991;73:160–162.

10. Iversen MD, Daltroy LH, Fossel AH, Katz JN. The prognostic

importance of patient pre-operative expectations of surgery for

lumbar spinal stenosis. Patient Educ Couns. 1998;34:169–178.

11. Jackson JL, Kroenke K. The effect of unmet expectations among

adults presenting with physical symptoms. Ann Intern Med.

2001;134(9 pt 2):889–897.

12. Jonsson B, Annertz M, Sjoberg C, Stromqvist B. A prospective,

consecutive study of surgically treated lumbar spinal stenosis.

Part II: Five-year follow-up by an independent observer. Spine.

1997;22:2938–2944.

13. Katz JN, Lipson SJ, Brick GW, Grobler LJ, Weinstein JN, Fossel

AH, Lew RA, Liang MH. Clinical correlates of patient satisfac-

tion after laminectomy for degenerative lumbar spinal stenosis.

Spine. 1995;20:1155–1160.

14. Katz JN, Lipson SJ, Chang LC, Levine SA, Fossel AH, Liang

MH. Seven- to 10-year outcome of decompressive surgery for

degenerative lumbar spinal stenosis. Spine. 1996;21:92–98.

15. Katz JN, Stucki G, Lipson SJ, Fossel AH, Grobler LJ, Weinstein

JN. Predictors of surgical outcome in degenerative lumbar spinal

stenosis. Spine. 1999;24:2229–2233.

16. Lin CT, Albertson GA, Schilling LM, Cyran EM, Anderson SN,

Ware L, Anderson RJ. Is patients’ perception of time spent with

the physician a determinant of ambulatory patient satisfaction?

Arch Intern Med. 2001;161:1437–1442.

17. Mahomed NN, Liang MH, Cook EF, Daltroy LH, Fortin PR,

Fossel AH, Katz JN. The importance of patient expectations in


123

predicting functional outcomes after total joint arthroplasty.

J Rheumatol. 2002;29:1273–1279.

18. Ronnberg K, Lind B, Zoega B, Halldin K, Gellerstedt M, Brisby

H. Patients’ satisfaction with provided care/information and

expectations on clinical outcome after lumbar disc herniation

surgery. Spine. 2007;32:256–261.

19. Shabat S, Folman Y, Arinzon Z, Adunsky A, Catz A, Gepstein R.

Gender differences as an influence on patients’ satisfaction rates in

spinal surgery of elderly patients. Eur Spine J. 2005;14:1027–1032.

20. Toyone T, Tanaka T, Kato D, Kaneyama R, Otsuka M. Patients’

expectations and satisfaction in lumbar spine surgery. Spine.

2005;30:2689–2694.

21. Turner P, Williams C. Informed consent: patients listen and read,

but what information do they retain? N Z Med J. 2002;115:U218.

22. Yamashita K, Hayashi J, Ohzono K, Hiroshima K. Correlation of

patient satisfaction with symptom severity and walking ability

after surgical treatment for degenerative lumbar spinal stenosis.

Spine. 2003;28:2477–2481.


123

ORIGINAL ARTICLE

Is the Long-term Outcome of Cemented THA Jeopardizedby Patients Being Overweight?

Daniel Haverkamp MD, PhD, F. Harald R. de Man MD,

Pieter T. de Jong MD, Renee A. van Stralen MSc,

Rene K. Marti MD, PhD

Received: 26 June 2007 / Accepted: 9 January 2008 / Published online: 21 February 2008


Abstract Although the effect of being overweight on the

long- and short-term outcome of THA remains unclear, the

majority of orthopaedic surgeons believe being overweight

negatively influences the longevity of a hip implant. We

asked whether complications and long-term survival of

cemented THA differed in overweight patients (body mass

index [BMI] [ 25 kg/m2) and obese patients (BMI [ 30

kg/m2) compared with normal-weight patients (BMI \ 25

kg/m2). We retrospectively analyzed 411 consecutive

patients (489 THAs) treated with cemented THA between

1974 and 1993. Except for cardiovascular comorbidity, we

observed no differences in demographics among these

weight groups. We found no differences in the number of

intraoperative or postoperative complications. The survival

rates for the three BMI groups were similar. The 10-year

survival for any revision was 94.9% (95% confidence

interval, 91.6%–98.2%), 90.4% (95% confidence interval,

85.6%–95.2%), and 91% (95% confidence interval, 81.2%–

100%) for normal-weight, overweight, and obese patients,

respectively. Cox regression analysis showed BMI and

weight had no major influence on survival rates. The

differences in mean Harris hip score at final followup were

4.8 between normal-weight and overweight patients and

7.1 between normal-weight and obese patients. Being

overweight and obesity had no influence on perioperative

complication rates in this cohort and did not negatively

influence the long-term survival of cemented THA.

Level of Evidence: Level III, prognostic study. See the


of evidence.

Introduction

Whether being overweight influences the fate of a THA is

still debated. One study suggests obese patients are more

likely to undergo THA for osteoarthritis (OA) of the hip

than control patients with lower body mass index (BMI)

[7]. Therefore, it is important for the orthopaedic surgeon

who is planning the joint arthroplasty to know the effect of

obesity on the fate of THA [7, 11, 22]. Although being

overweight or obese have a negative influence on health

and mobility, it is not certain whether they have a negative

influence on the short- and long-term results after THA as

well [4, 6, 19, 21].

The assumption that being overweight or obese neg-

atively influences the long-term survival of THA could

preclude some obese patients from having joint arthro-

plasty. Recently, the Wall Street Journal mentioned more

orthopaedic surgeons refuse to perform THA in obese

patients because of the fear of complications [15]. A

large international survey of orthopaedic surgeons per-

formed in 12 European countries revealed 80.9% believe

the long-term outcome of THA is impaired by being

overweight [20]. Several short-term outcome studies,

summarized in two reviews [4, 19], however, failed to









D. Haverkamp (&), F. H. R. de Man, P. T. de Jong,

R. A. van Stralen, R. K. Marti

Department of Orthopedic Surgery G4-No, Academic Medical

Centre Amsterdam, Orthopaedic Research Centre Amsterdam,

PO Box 22660, 1100DD Amsterdam, The Netherlands


123


DOI 10.1007/s11999-008-0129-3

show a negative influence of obesity on the short-term

results of THA.

We asked whether obesity influences the long-term

survival, clinical outcomes scores, and perioperative com-

plication rates. We also asked whether BMI and body

weight were risk factors for revision.


We retrospectively reviewed the medical records of 411

consecutive patients (489 hips) who underwent primary

THA between 1974 and 1993. We divided our patients into

three groups based on body mass index (BMI) at the time

of surgery: (1) patients with a normal body weight

(BMI \ 25 kg/m2); (2) patients who were overweight

(BMI [ 25 kg/m2); and (3) patients who were morbidly

obese (BMI [ 30 kg/m2). One hundred sixty-three patients

(201 hips [41%]) had a normal body weight. One hundred

forty-two patients (172 hips [35%]) had a BMI greater than

25 kg/m2 and 35 (42 hips [9%]) of these patients had a

BMI greater than 30 kg/m2. For 106 patients (116 hips

[24%]), no BMI (weight and/or height) was documented

preoperatively. To avoid selection bias, these patients were

included in the overall (survival) analysis. During fol-

lowup, 164 patients (184 hips) died after a minimum

followup of 1 year (mean, 11.6 years; range, 1–29.3 years)

and an additional 37 patients (50 hips) were lost to fol-

lowup after a minimum followup of 0.1 year (mean,

6.8 years; range, 0.1–15.6 years). These patients are

included in the survival analysis and radiographic analysis

until their last outpatient clinic contact. Of these patients

lost to followup, two had a BMI greater than 30 kg/m2,

eight had a BMI greater than 25 kg/m2, and 12 had a

normal BMI; for 16 patients, no BMI was documented.

Sample size power analysis was performed assuming a

10-year survival rate of 95% in normal-weight individuals.

We assumed a difference of 10% survival rate in over-

weight patients was of clinical importance. When using a

power of 0.8 and an alpha of 0.05, a sample size of 159

hips is needed per group. Our number of patients with a

BMI greater or less than 25 kg/m2 therefore seems

sufficient.

For maximum followup, 210 patients (255 hips) were

available. The minimum followup in these 210 patients was

10 years (mean, 14.9 years; range, 10–28.1 years). We

then compared long-term survivorship, functional outcome,

and perioperative complication rate. The average age at the

time of surgery was 67 years (range, 22–88 years). One

hundred seventeen (24%) of these patients were male

(Table 1). The indication for THA was idiopathic OA in

235 hips (48%), acetabular dysplasia in 165 hips (34%),

rheumatoid arthritis in eight (2%), avascular necrosis in 30

(6%), posttraumatic in 23 (5%), and other causes in 28

(4%). Apart from cardiologic comorbidity, which occurred

more often in overweight and obese patients (Fisher’s exact

test, p = 0.028 for BMI[30 kg/m2 versus BMI\30 kg/m2

and p = 0.044 for BMI [ 25 kg/m2 versus BMI \ 25

kg/m2), we observed no differences between the patients

who were obese or overweight and the normal-weight

patients (Table 1). The average BMI of all patients was

25.3 kg/m2 (range, 17.9–41.1 kg/m2).

The same prosthetic implant and surgical procedure

were used in all patients. All patients were placed in a

supine position and all had an anterolateral approach and a

cemented Weber Rotation THA System (Allopro, Baar,

Switzerland) implanted [5]. This system consists of a

wrought CoNiCrMo alloy stem (Protasul1 10; Sulzer AG,

Winterthur, Switzerland) with a cylindrical neck (the

trunnion) made of a cast CoCrMo alloy (Protasul1 2)

composite welded to the stem, which is grit-blasted with

glass particles. The 32-mm head was made from Protasul1

2 or Al2O3 ceramic (Biolox1; Feldmuhle, Plochingen,

Germany) and placed on a Protasul1 2 cylinder. The stem

Table 1. Demographic data per BMI group shown in number and percentage

Demographics

and comorbidity

BMI \ 25 kg/m2

(n = 201 hips)

BMI [ 25 kg/m2

(n = 172 hips)

p Value* BMI [ 30 kg/m2

(n = 42 hips)

p Value*

Age (years)� 65.0 (21–83) 65.7 (22–87) 0.50 64.0 (49–79) 0.56

Percent idiopathic osteoarthritis 90 (44.8%) 82 (42.7%) 0.46 23 (54.8%) 0.22

Female 152 (75.6%) 134 (69.8%) 0.63 30 (71.4%) 0.84

Comorbidity

Central nervous system 14 (7.0%) 17 (8.9%) 0.35 5 (11.9%) 0.33

Respiratory 11 (5.5%) 10 (5.2%) 1.0 5 (11.9%) 0.16

Cardiovascular§ 43 (21.4%) 51 (26.6%) 0.07 16 (38.1%) 0.03

Diabetes 8 (4.0%) 9 (4.7%) 0.62 4 (9.5%) 0.12

* p values show comparison with the group with a BMI of less than 25 kg/m2; �age is given as an average, with range in parentheses; age was

compared using a t test; §cardiovascular comorbidity is higher (p \ 0.05) in the group with a BMI of greater than 30 kg/m2; for all the other

demographic data, no differences were found using a Fisher’s exact test; BMI = body mass index.

Volume 466, Number 5, May 2008 Long-term Effect of Obesity on Cemented THA 1163

123

and the nonhighly crosslinked polyethylene Weber socket

were cemented using low-viscosity Sulfix1 (Sulzer AG)

cement. Until the 1980s, we used two types of cups, a flat

type and a hemispheric type. Because of the inferior results

of the flat type, their use was discontinued. In this study,

112 flat type and 377 hemispheric type sockets were used.

The percentages of flat cups used were not different among

the weight groups.

We (DH, RKM, FHRdM) obtained Harris hip scores

(HHS) for patients whose THA was not revised at final

followup.

We (DH, FHRdM) performed a radiographic analysis

using the weightbearing pelvic and lateral radiographs

taken at the latest followup. Loosening of the stem was

ranked according to Harris et al. [8] and loosening of the

cup according to Hodgkinson et al. [9]. For both compo-

nents, loosening was scored as definitive, probable,

possible, or no loosening. Loosening was scored by com-

paring the radiographs at last followup with previous

radiographs.

Complications were retrieved from the clinical charts.

We noted the presence of hematoma when patients under-

went exploratory surgery for suspected hematoma. Early

infection was defined as requiring antibiotic treatment and/

or debridement within 3 months after the operation.

A survival analysis was performed using the Life Table

Method using revision for aseptic loosening, revision for

any reason, and radiographic loosening (definitive loosen-

ing) as end points. We performed survivorship analysis for

the acetabular and femoral component separately and for

both components combined. Because all patients were seen

annually or biannually, all could be included in the survival

analysis until their last followup. Equality of the survival

curves for the normal-weight, overweight, and obese

patients were compared using a log rank test. Differences

in HHS among the three study groups were evaluated using

analysis of variance. A difference greater than 4 points was

considered clinically important [10]. We also compared

BMI as a continuous variable with the HHS at maximum

followup by means of Pearson correlation analysis to

explore the overall influence of BMI on outcome. Differ-

ences in loosening between the normal-weight, overweight,

and obese patients were evaluated using Fisher’s exact test.

Differences in perioperative and postoperative complica-

tions were compared using Fisher’s exact test. Cox

regression analysis was performed for survival of the

implant (any revision) with weight and BMI as risk factors.

Results

We observed no differences between the survival rates for

normal-weight patients and overweight patients and

morbidly obese and normal-weight patients for all end

points using a log rank test (Table 2; Fig. 1). Fifty four

patients (64 hips) underwent revision surgery, of which five

hips were revised for septic loosening, 54 for aseptic

loosening of at least one of the components, and five for

other reasons (periprosthetic fractures and heterotopic

ossifications). The rate of infection causing septic loosening

was similar in patients with a BMI of between 25 kg/m2 and

30 kg/m2 (n = 4) and with a normal body weight (n = 1)

(p = 0.13).

Patients with a BMI greater than 30 kg/m2 had lower

(p = 0.02) HHS than patients with a BMI less than 25 kg/m2

and patients with a BMI greater than 25 kg/m2 had

lower (p = 0.02) HHS than patients with a BMI less than

25 kg/m2 (Table 3). The differences in average HHS

between the three groups were greater than 4 points,

indicating these differences were clinically relevant. Body

mass index showed a poor correlation (rho = -0.17;

p = 0.024) with HHS.

Several local and systemic complications occurred,

which were similarly distributed among the normal-weight,

overweight, and obese patients (Table 4). We observed no

differences in the rates of radiographic loosening among

the normal-weight versus overweight patients (p = 0.30)

and normal-weight versus obese patients (p = 0.47)

(Table 5).

Body mass index and body weight were not risk factors

for revision (Exp[B] = 1.00 [95% confidence interval,

0.93–1.08] and Exp[B] = 1.01 [95% confidence interval,

0.99–1.03], respectively).

Discussion

The influence of being overweight on the long- and short-

term outcome of THA is controversial in the literature but

the majority of orthopaedic surgeons believe being over-

weight negatively influences the longevity of a hip implant

[20]. Because the issue is controversial, we asked whether

obesity influences the long-term survival, clinical outcomes

scores, and perioperative complication rates, and whether

BMI and body weight were risk factors for revision.

We note several limitations of our study. First, we did

not study wear. It could be hypothesized that more body

weight causes more wear. Although it can be expected that

excessive wear may influence the rate of revision, we did

not see a difference in revision rates between the weight

groups [2]. Second, we studied only patients with cemented

THA. Our analysis may not be valid for uncemented THA.

One study of 300 patients with the cementless PM pros-

thesis suggested obesity negatively influenced medium-

term survival, showing a twofold increase in loosening/

revision rate in obese patients [6]. Another recent study

1164 Haverkamp et al. Clinical Orthopaedics and Related Research

123

suggested no difference in the outcome of uncemented

THA in obese versus normal-weight patients, although a

high revision rate for the acetabular component was present

[13].

Our data suggest BMI and weight do not influence the

long-term survival of cemented THA. We also found no

differences in the incidence of THA-related complications

for the overweight patients undergoing THA. Cardiovas-

cular comorbidity was more common in the obese patients;

however, we observed no differences in perioperative

cardiac complications.

The percentage of overweight and obese individuals in

our study is lower than those reported in American studies.

In a study including 1071 American patients undergoing

THA, 36% of the patients had a BMI greater than 30 kg/m2

[16]. In The Netherlands, the annual incidence of obesity

(BMI [ 30 kg/m2) gradually inclined from 5% in 1981 to

7% in 1993 and 10% in 2005 [3]. In our study, 9% had a

BMI greater than 30 kg/m2. For the overweight patients

(BMI [ 25 kg/m2), these percentages were 33% in 1981

and 37% in 1993 and 35% in our study. Because OA is

more common in overweight patients, we believe these

percentages indicate our patient group is comparable to the

average Dutch population [7]. This also indicates absence

of a selection bias. All patients were operated on in our

hospital regardless of their weight. Another major

Table 2. Survival rates

Number at risk and revisions All BMI \ 25 kg/m2 BMI [ 25 kg/m2 BMI [ 30 kg/m2

Number at risk

At start 489 201 172 42

At 10 years 336 161 122 30

At 15 years 181 92 69 14

At 20 years 49 29 17 4

Any revision

At 10 years 92.4 (89.8–95.0) 94.9 (91.6–98.2) 90.4 (85.6–95.2) 91.0 (81.2–100)

At 15 years 83.7 (79.4–88.0) 85.9 (80.0–91.8) 83.1 (76.2–90.0) 79.5 (61.5–97.4)

At 20 years 72.6 (64.5–96.4) 75.6 (65.5–85.6) 68.3 (53.0–83.6) 79.5 (61.5–97.4)

Aseptic stem loosening

At 10 years 95.1 (92.9–97.2) 96.6 (93.9–99.3) 94.2 (90.3–98.1) 91.0 (81.2–100)

At 15 years 89.3 (85.7–92.9) 91.4 (86.6–96.2) 87.5 (81.1–93.9) 79.5 (61.5–97.4)

At 20 years 84.1 (78.1–90.0) 85.2 (76.4–94.0) 82.7 (73.8–91.6) 79.5 (61.5–97.4)

Aseptic cup loosening

At 10 years 96.9 (95.1–98.6) 97.7 (94.4–100) 97.2 (94.5–99.9) 97.1 (91.4–100)

At 15 years 90.0 (86.4–93.5) 89.6 (84.3–94.9) 91.5 (85.9–97.1) 84.9 (67.5–100)

At 20 years 79.9 (72.3–98.5) 79.4 (69.7–89.0) 80.0 (66.4–93.6) 84.9 (67.5–100)

Aseptic loosening, both components

At 10 years 94.0 (91.6–96.4) 96.0 (93.1–98.9) 92.8 (88.5–97.1) 91.0 (81.2–100)

At 15 years 85.9 (81.8–90.0) 86.7 (80.8–92.6) 86.1 (79.4–93.0) 79.5 (61.5–97.4)

At 20 years 74.5 (66.3–82.7) 85.2 (76.4–94.0) 70.8 (55.1–86.5) 79.5 (61.5–97.4)

Radiographic stem loosening

At 10 years 94.9 (92.7–97.1) 96.5 (93.7–99.3) 94.0 (89.9–98.1) 91.0 (81.2–100)

At 15 years 88.9 (85.1–92.7) 91.1 (86.1–96.1) 86.7 (79.8–93.6) 78.7 (59.8–97.6)

At 20 years 78.1 (70.7–85.5) 78.9 (68.3–98.5) 77.5 (65.8–98.5) 63.0 (31.5–98.5)

Radiographic cup loosening

At 10 years 96.8 (95.0–98.6) 97.6 (95.2–99.9) 97.1 (94.3–99.9) 97.1 (91.4–100)

At 15 years 89.3 (85.5–93.1) 84.9 (79.4–90.4) 90.8 (84.7–96.9) 84.2 (65.6–100)

At 20 years 76.6 (68.5–84.7) 76.2 (65.8–86.6) 76.1 (61.6–98.5) 67.3 (34.2–100)

Radiographic loosening, both components

At 10 years 93.4 (91.0–95.8) 95.9 (93.5–98.3) 92.6 (88.2–97.4) 91.0 (81.2–100)

At 15 years 85.1 (80.8–89.4) 85.6 (81.3–89.9) 85.4 (78.4–92.4) 78.7 (59.8–97.6)

At 20 years 67.4 (58.4–76.4) 69.6 (60.6–78.6) 63.5 (46.9–80.1) 50.0 (16.1–83.8)

Values are expressed as percentages, with 95% confidence intervals in parentheses; BMI = body mass index.


123

difference between our Dutch population and the American

population is extreme obesity (BMI [ 40 kg/m2) was low

in our country before 1993. We had only two patients who

had a BMI greater than 40 kg/m2 (neither had revision and

had HHS of 87 and 90). This low number of patients with a

BMI greater than 40 kg/m2 means our study does not

supply an answer for the long-term fate of THAs in these

extremes.

Several publications report on the short-term results of

THA in the obese in which the HHS after surgery are

compared between obese and normal-weight patients. The

literature contains controversial data suggesting either

similar or worse outcomes for obese patients undergoing

THA. Two large studies reported lower HHS in obese

patients after short-term followup [1, 14]. Both showed

lower HHS with an average difference of 5 points, but

neither compared the preoperative HHS among the differ-

ent groups. The clinical relevance of these small

differences in the postoperative HHS without a comparison

of the preoperative HHS is debatable, especially because

other studies showed no differences in postoperative HHS

between the several weight groups [18]. Another study

suggested the level of activity is lower, which continues to

be so after THA [12]. The same problem occurs in our

study because no preoperative HHS was available for

analysis. If patients who are more obese have initial lower

HHS and similar improvement as normal-weight patients

after the arthroplasty, the same difference remains.

Although our data suggest differences between the average

HHS in the weight groups, the differences between the

mean HHS were small (4.8 and 7.1). However; the only

study on the responsiveness and discriminative ability of

Fig. 1A–C Survival rates are shown for patients with (A) a BMI less than 25 kg/m2, (B) a BMI greater than 25 kg/m2, and (C) a BMI greater

than 30 kg/m2. The x-axis shows years and the y-axis shows survival rates. The solid line represents survival rate and the dotted lines represent

the 95% confidence intervals.

Table 3. Average Harris hip score per BMI group

BMI \ 25 kg/m2 BMI [ 25 kg/m2 BMI [ 30 kg/m2

91.6 (89.3–93.9) 86.8 (83.5–90.1)* 83.7 (74.5–92.3)*

Values are expressed as averages, with 95% confidence intervals

in parentheses; * difference with group with a BMI of less than

25 kg/m2 (p = 0.02); BMI = body mass index.


123

the HHS showed a difference of 4 points is enough to be

clinically relevant, indicating our measured differences are

clinically relevant [10]. However, the correlation of HHS

with BMI as a continuous variable was poor (rho =

-0.17), but the content validity of the HHS is poor, eg, a

large ceiling effect is visible, which could influence the

correlation coefficient measured (Fig. 2).

In a review of patient characteristics affecting the

outcome of THA, a body weight greater than 70 kg was

mentioned as a factor that negatively influences the

outcome of THA [23]. They suggest weight alone is a

much stronger predictor for the outcome than BMI

because height has no influence on the prosthesis. In

our series, neither body weight nor BMI influenced

outcome.

One study stated patients who underwent bariatric sur-

gery before having THA had an excellent outcome,

although the average postoperative BMI of 29 kg/m2 still

indicated overweight. The main question we would ask is

whether the outcome would have been worse if no bariatric

surgery was performed [17].

We do not intend to suggest being overweight has no

risks. We believe it is important to motivate overweight

patients to lose weight. Being overweight could increase

the rate of OA and has an increased risk for several non-

orthopaedic morbidities [7]. However, should a (cemented)

THA be necessary in an overweight or obese patient, the

arguments that survival is shorter in obese patients and that

obese patients have a higher risk of perioperative compli-

cations do not seem valid.

Table 5. Radiographic analysis of the unrevised hips

Component Definitive loosening Probable loosening Possible loosening

Number of hips Time until

loosening (years)*


loosening (years)*


loosening (years)*

Acetabular� 2 18.3 (18.2–18.3) 2 16.2 (13.9–18.4) 15 15.9 (9.0–23.0)

Femoral� 6 18.9 (15.9–22.6) 1 23.2 11 17.9 (14.0–22.8)

* Values are expressed as averages, with ranges in parentheses; �according to the criteria of Hodgkinson et al. [9]; �according to the criteria of

Harris et al. [8].

Table 4. Complications per BMI group

Complication All (n = 489 hips) BMI \ 25 kg/m2

(n = 201 hips)

BMI [ 25 kg/m2

(n = 172 hips)

p Value* BMI [ 30 kg/m2

(n = 42 hips)

p Value*

Venous thromboembolism 2 (0.4%) 1 (0.5%) 0 0

Cardiac 6 (1.2%) 1 (0.5%) 4 (2.3%) 1.0 2 (4.8%) 1.0

Respiratory 3 (0.6%) 1 (0.5%) 1 (0.6%) 1.0 1 (2.4%) 0.31

Abdominal 4 (0.8%) 2 (1.0%) 1 (0.6%) 1.0 0

Other systemic (including urinary

tract infection)

18 (3.7%) 8 (4.0%) 9 (5.2%) 0.62 1 (2.4%) 1.0

Hematoma 10 (2.0%) 6 (3.0%) 2 (1.2%) 0.30 2 (4.8%) 0.63

Early infection 5 (0.8%) 2 (1.0%) 3 (1.7%) 0.67 0

Intraoperative complication 24 (4.9%) 11 (5.5%) 11 (6.4%) 0.67 2 (4.8%) 1.0

Any complication 68 (13.9%) 30 (14.9%) 28 (16.3%) 0.78 6 (14.3%) 1.0

* p values are given for the comparison with the group with a BMI of less than 25 kg/m2 (Fisher exact test); BMI = body mass index.

Fig. 2 A scatterplot shows HHS versus BMI. The ceiling effect of

the HHS can be seen.


123

References

1. Aderinto J, Brenkel IJ, Chan P. Weight change following total hip

replacement: a comparison of obese and non-obese patients.

Surgeon. 2005;3:269–272, 305.

2. Bordini B, Stea S,De ClericoM, Strazzari S,Sasdelli A,Toni A. Factors

affecting aseptic loosening of 4750 total hip arthroplasties: multivariate

survival analysis. BMC Musculoskelet Disord. 2007;8:69.

3. Central Bureau of Statistics, The Netherlands. Available at:

http://www.cbs.nl. Accessed January 2007.

4. Crawford RW, Murray DW. Total hip replacement: indications

for surgery and risk factors for failure. Ann Rheum Dis.

1997;56:455–457.

5. de Jong PT, van der Vis HM, de Man FH, Marti RK. Weber

rotation total hip replacement: a prospective 5- to 20-year fol-

lowup study. Clin Orthop Relat Res. 2004;419:107–114.

6. Dickob M, Martini T. The cementless PM hip arthroplasty:

four-to-seven-year results. J Bone Joint Surg Br. 1996;78:

195–199.

7. Flugsrud GB, Nordsletten L, Espehaug B, Havelin LI, Engeland

A, Meyer HE. The impact of body mass index on later total hip

arthroplasty for primary osteoarthritis: a cohort study in

1.2 million persons. Arthritis Rheum. 2006;54:802–807.

8. Harris WH, McCarthy JC Jr, O’Neill DA. Femoral component

loosening using contemporary techniques of femoral cement

fixation. J Bone Joint Surg Am. 1982;64:1063–1067.

9. Hodgkinson JP, Shelley P, Wroblewski BM. The correlation

between the roentgenographic appearance and operative find-

ings at the bone-cement junction of the socket in Charnley low

friction arthroplasties. Clin Orthop Relat Res. 1988;228:

105–109.

10. Hoeksma HL, van den Ende CH, Ronday HK, Heering A,

Breedveld FC. Comparison of the responsiveness of the Harris

Hip Score with generic measures for hip function in osteoarthritis

of the hip. Ann Rheum Dis. 2003;62:935–938.

11. Karlson EW, Mandl LA, Aweh GN, Sangha O, Liang MH,

Grodstein F. Total hip replacement due to osteoarthritis: the

importance of age, obesity, and other modifiable risk factors. AmJ Med. 2003;114:93–98.

12. McClung CD, Zahiri CA, Higa JK, Amstutz HC, Schmalzried TP.

Relationship between body mass index and activity in hip or knee

arthroplasty patients. J Orthop Res. 2000;18:35–39.

13. McLaughlin JR, Lee KR. The outcome of total hip replacement in

obese and non-obese patients at 10- to 18-years. J Bone JointSurg Br. 2006;88:1286–1292.

14. Moran M, Walmsley P, Gray A, Brenkel IJ. Does body mass

index affect the early outcome of primary total hip arthroplasty?


15. Naik G. Surgeons’ weighty dilemma; wary of extra risk, work,

some doctors won’t replace knees, hips of obese patients. WallStreet Journal. February 28, 2006:B1, B8.

16. Namba RS, Paxton L, Fithian DC, Stone ML. Obesity and peri-

operative morbidity in total hip and total knee arthroplasty

patients. J Arthroplasty. 2005;20(suppl 3):46–50.

17. Parvizi J, Trousdale RT, Sarr MG. Total joint arthroplasty in

patients surgically treated for morbid obesity. J Arthroplasty.

2000;15:1003–1008.

18. Stickles B, Phillips L, Brox WT, Owens B, Lanzer WL. Defining

the relationship between obesity and total joint arthroplasty. ObesRes. 2001;9:219–223.

19. Stukenborg-Colsman C, Ostermeier S, Windhagen H. [What

effect does of obesity have on the outcome of total hip and knee

arthroplasty: review of the literature] [in German]. Orthopade.

2005;34:664–667.

20. Sturmer T, Gunther KP, Brenner H. Obesity, overweight and

patterns of osteoarthritis: the Ulm Osteoarthritis Study. J ClinEpidemiol. 2000;53:307–313.

21. Sutherland CJ, Wilde AH, Borden LS, Marks KE. A ten-year

follow-up of one hundred consecutive Muller curved-stem totalhip-replacement arthroplasties. J Bone Joint Surg Am.

1982;64:970–982.

22. Wendelboe AM, Hegmann KT, Biggs JJ, Cox CM, Portmann AJ,

Gildea JH, Gren LH, Lyon JL. Relationships between body mass

indices and surgical replacements of knee and hip joints. Am JPrev Med. 2003;25:290–295.

23. Young NL, Cheah D, Waddell JP, Wright JG. Patient charac-

teristics that affect the outcome of total hip arthroplasty: a review.

Can J Surg. 1998;41:188–195.


123

http://www.cbs.nl

ORIGINAL ARTICLE

Reliable Angle Assessment During Periacetabular Osteotomy witha Novel Device

Anders Troelsen MD, Brian Elmengaard MD, PhD,

Lone Rømer MD, Kjeld Søballe MD, DMSc

Received: 9 July 2007 / Accepted: 15 January 2008 / Published online: 9 February 2008


Abstract We developed and assessed a measuring device

for intraoperative assessment of the acetabular index and

center edge angle during acetabular reorientation in peri-

acetabular osteotomy. We asked whether reliable

assessment of angles could be made using the device; to be

reliable we presumed the variability of angle measurements

should not exceed that of inherent variability when

assessing angles on radiographs (± 5�). The device was

mounted bilaterally on the pelvis, and using fluoroscopy,

angle measurements were obtained with adjustable mea-

suring discs. We conducted a cadaver study to assess

intraobserver and interobserver variability of the device

and to assess if pelvic positioning influenced variation of

measurements. Intraoperative measurements of 35 con-

secutive patients were compared with measurements on

postoperative radiographs. Intraoperatively obtained angle

measurements differed less than ± 5� from measurements

on postoperative radiographs and the intraobserver and

interobserver variability of the device were confined within

± 5�. Positioning did not influence the variation of angle

measurements beyond intraobserver variability of the

device when applying arcs of tilt and rotation of ± 12.5�.

We believe the device is a potentially helpful tool in the

periacetabular osteotomy. It is simple to use and facili-

tates repeated reliable angle measurements during

acetabular reorientation, making intraoperative radiographs

unnecessary.

Introduction

Developmental dysplasia of the hip (DDH) is characterized

by an excessively oblique and shallow acetabulum with

insufficient coverage of the femoral head laterally and

anteriorly [1, 10, 19]. The periacetabular osteotomy is a

well-established treatment for DDH in young adults [6, 20,

21, 24, 32, 33]. In this procedure, the acetabulum is

reoriented to enhance coverage of the femoral head and the

aim is to achieve congruity, to stabilize the joint, to med-

ialize the joint center, and to reduce contact pressures [6, 7,

13, 31]. This will relieve pain and improve function and is

likely to prevent additional overload of the labrum, carti-

lage, and soft tissues, thereby delaying or preventing the

development of osteoarthritis [20, 21, 24, 32, 33]. Under-

correction or overcorrection of the acetabulum can cause

symptoms such as the feeling of instability and impinge-

ment, respectively [9, 18, 25]. One study reported a

postoperative acetabular index (AI) outside the interval of

0� to 10� negatively influenced the outcome after peri-

acetabular osteotomy [24], and another study found the

postoperative center edge (CE) angle averaged 29� for hips

that had an increase in the apparent joint space compared

with an average 21� in hips that did not [33]. Although

not thoroughly investigated, it seems warranted to consider

One or more of the authors (AT) have received funding from a grant

from the Danish Rheumatism Association during conduction of this

study.




A. Troelsen (&), B. Elmengaard, K. Søballe

Orthopaedic Research Unit, University Hospital of Aarhus,

Tage-Hansens Gade 2, Building 7B, DK-8000 Aarhus C,

Denmark


L. Rømer

Department of Radiology, University Hospital of Aarhus, Tage-

Hansens Gade 2, Building 2B, DK-8000 Aarhus C, Denmark

123


DOI 10.1007/s11999-008-0133-7

acetabular reorientation an important step in surgical

decision making when performing periacetabular

osteotomy.

The AI and the CE angle are commonly used to char-

acterize the dysplastic anatomy of the hip [1, 10, 19, 26, 29,

34]. In the dysplastic hip undergoing a periacetabular

osteotomy, these angles must be assessed intraoperatively

to ascertain whether the intended reorientation of the ace-

tabulum has been achieved [5, 6, 17, 20, 25, 31]. One way

to assess the AI and the CE angle intraoperatively is by

taking anteroposterior pelvic radiographs during reorien-

tation of the acetabulum. Several radiographs may be

necessary and the surgeon must wait for the radiographs to

be developed and the angles to be measured. Alternatively,

assessment can be made by eye using fluoroscopy, but this

approach is qualitative and might only be reliable for an

experienced surgeon. Image-guided techniques seemingly

facilitate surgery but without improving acetabular cor-

rection, and are relatively expensive [8, 14, 15].

The senior author (KS) developed a measuring device

that allows intraoperative assessment of the AI and the CE

angle during acetabular reorientation when performing

periacetabular osteotomy. The device is mounted bilater-

ally at the anterior superior iliac spines and angle

measurements are performed with adjustable measuring

discs using fluoroscopy.

The primary research question was whether the mea-

suring device could assist the surgeon in obtaining good

correction of the acetabulum in terms of reliable intraop-

erative determination of the AI and the CE angle. We also

determined (1) the variability between angle measurements

obtained with the device and angle measurements on

postoperative radiographs of the same patients, (2) whether

this variability was increased compared with the intraob-

server variability of angle measurements obtained on

postoperative radiographs, (3) the intraobserver and inter-

observer variability when using the device for angle

measurements, and (4) whether patient positioning in terms

of differing pelvic tilt and rotation influenced variation of

angle measurements.


Prospective intraoperative assessment of the AI and the CE

angle was made in 35 patients undergoing unilateral peri-

acetabular osteotomies performed by the senior author

(KS) from May 2006 to March 2007. Intraoperative angle

measurements were performed by the senior author (KS)

using the measuring device. Indications for surgery were

symptomatic DDH defined by persistent hip pain, a CE

angle less than 25�, a congruent joint, Tonnis osteoarthritis

Grade 0 to 1, hip flexion greater than 110�, and internal

rotation greater than 15�. The study group consisted of 31

females and four males with a median age of 30 years

(range, 14–57 years). Double measurements of the AI and

the CE angle were performed on the patients’ postoperative

anteroposterior pelvic radiographs by one author (AT). We

presumed the device satisfactory from clinical and radio-

graphic points of view if the measurements differed less

than ± 5� from measurements on postoperative radio-

graphs and if intraobserver and interobserver variability of

the device were within ± 5�. We selected this level as it

corresponds approximately to the inherent variability of AI

and CE angle measurements on plain radiographs [2, 11,

22, 30]. In a cadaver study, measurements of the AI and the

CE angle were made by two authors (AT, KS) in a setup

mimicking differing tilt and rotation of the pelvis.

The landmarks for the CE angle [34] are the center of

the femoral head and the most lateral point of the sclerotic

acetabular roof. For the AI [29], the landmarks are the most

medial and lateral points of the sclerotic acetabular roof.

Intraoperative and postoperative measurements on antero-

posterior pelvic radiographs demand alignment of the

pelvis using a line of reference (Fig. 1).

The measuring device is used under fluoroscopy in the

anteroposterior plane. It is mounted bilaterally at the

anterior-superior iliac spines and the position is secured by

inserting small spikes. To secure alignment of the pelvis

for angle measurement, a rod connects the spikes (Fig. 2).

Adjustable angle measuring discs can be mounted on the

alignment rod. We use two different angle measuring discs:

(1) the disc for AI measurement is positioned and adjusted

Fig. 1 Drawing a line of reference precedes construction of radio-

graphic angles. It is constructed by drawing a line going through the

most caudal points on the inferior ramus bilaterally. The acetabular

index (AI) is constructed by drawing a line from the most lateral to

the most medial limit of the sclerotic acetabular roof and from there

another line parallel to the line of reference. The center edge (CE)

angle is constructed by drawing a line from the most lateral limit of

the sclerotic acetabular roof to the center of the femoral head and

another line perpendicular to the line of reference and through the

center of the femoral head.

1170 Troelsen et al. Clinical Orthopaedics and Related Research

123

until it is placed correctly in relation to the most medial and

lateral points of the sclerotic acetabular roof (Fig. 3A); and

(2) the disc for CE angle measurement is positioned and

adjusted until it is placed correctly in relation to the center

of the femoral head and the most lateral point of the

sclerotic acetabular roof (Fig. 3B). If fine-tuning of the

reorientation is necessary, the measuring discs are easily

adjusted for new assessment of the angle measurements.

Version of the acetabulum cannot be measured using the

device but is equally important and must be addressed to

achieve an appropriate anteversion [20, 30]. This is

accomplished by identifying the anterior and posterior

acetabular rim (Fig. 3A). In appropriate anteversion, it is

observed (1) the posterior rim is lateral to the anterior rim

and the center of the femoral head and (2) the anterior rim

is medial to the center of the femoral head [16, 20, 31].

Crossing of the anterior and posterior rim (crossover sign)

is a sign of inappropriate anteversion or retroversion [12,

16]. Acetabular version, that is, the appearance of the

acetabular rims, is dependent on the pelvic tilt [12, 23, 28,

30]. We attempt to minimize intraoperative misinterpreta-

tion of the acetabular version by ensuring the pelvic tilt

intraoperatively corresponds to that of the anteroposterior

pelvic radiograph used for diagnosis and preoperative

planning. Pelvic tilt can be assessed in the anteroposterior

plane measuring the distance from the symphysis to the

sacrococcygeal joint [23, 27, 28]. We use fluoroscopy to

obtain an approximate measure intraoperatively. The aim

of the reorientation is to achieve an AI between 0� and 10�and CE angle between 30� and 40�. To achieve appropriate

coverage, we approximate the AI to 0�. We avoid a neg-

ative value of the AI and a CE angle greater than 40� when

approximating the AI to 0�. A negative AI, a CE angle

greater than 40�, or the crossover sign are indicators for

overcorrection and it is recognized impingement and

reduced range of motion can result from a periacetabular

osteotomy [9, 18, 25]. We routinely assess range of motion

intraoperatively after reorientation. If the CE angle

becomes excessive, it is adjusted to 40� or less and the AI

is adjusted keeping it between 0� and 10�, which in our

experience is possible in almost every case. Also, in some

patients, the hip is too dysplastic to achieve a CE angle

greater than 30� when approximating the AI to 0�. Using

the above guidelines, the senior author (KS) decided when

optimal reorientation was achieved during surgery; the AI

(range, 0�–10�) and CE angle (range, 23�–36�) measure-

ments then were registered. After becoming familiar with

the measuring device, mounting and adjusting the discs for

measurement of the AI and the CE angle take approxi-

mately 2 to 3 minutes.

Anteroposterior pelvic radiographs were taken on the

first or second postoperative day and were stored digitally.

Using a workstation allowing digital management of

radiographs, the AI (range, -1�–9�) and the CE angle

(range, 24�–36�) were measured by one blinded observer

(AT). To assess intraobserver variability, a second blinded

measurement of the AI and the CE angle was performed by

the same observer 4 weeks later. Angle measurements

obtained with the device were compared with angle mea-

surements on postoperative radiographs to assess the

variability. We also compared intraobserver variability

with the variability when comparing angle measurements

obtained intraoperatively with those obtained on postop-

erative radiographs.

To assess intraobserver and interobserver variability and

evaluate the effect of pelvic tilt or rotation on the AI and

CE angle measurements, we did a cadaver study. The

female cadaver specimen was partial and consisted of the

pelvis, hips, thighs, and knees with intact skin and soft

tissues. Initially, the spikes and alignment rod of the

Fig. 2A–B The measuring device is used under fluoroscopy in the

anteroposterior plane. It is mounted bilaterally at the anterior-superior

iliac spines. The position is secured by inserting small spikes. To

secure alignment of the pelvis for angle measurement, a rod connects

the spikes. (A) The measuring device is mounted on a sawbones

model with the disc for CE angle measurement. (B) The measuring

device is mounted during surgery with the disc for CE angle

measurement.

Volume 466, Number 5, May 2008 Intraoperatively Obtained AI and CE Angle 1171

123

measuring device were mounted as described previously.

The position of the pelvis then was adjusted until it was in

a neutral position. This was confirmed by achieving a

foramen obturator index of 1.0 and a distance between the

pubic symphysis and the sacrococcygeal joint of 4 cm on

an anteroposterior pelvic radiograph (the tube was oriented

perpendicular to the table and the tube to film distance was

110 cm, resulting in a magnification of 15%).

Measurement of the AI and the CE angle using the

measurement device was done as described previously.

Two observers (Observer 1: KS, experienced with the

device; Observer 2: AT, inexperienced with the device)

performed the angle measurements on the right hip of the

cadaver. The C-arm of the fluoroscope was tilted in 2.5�increments to the left and to the right of the cadaver in an

arc totaling 25�. In this way, 11 measurements of both

angles were done from an angle of 12.5� to the left and to

12.5� to the right of the cadaver (Table 1). An angle of 0�indicates the anteroposterior plane. Another 11 measure-

ments of both angles were performed similarly tilting the

C-arm of the fluoroscope in 2.5� increments in the cranial

and caudal directions in an arc totaling 25� (Table 1). For

each measurement, the femoral head was focused in the

middle of the image. The observers were blinded to each

other’s measurements and to the actual position of the C-

arm. The order of measurements was random with respect

to the position of the C-arm. We assessed intraobserver and

interobserver variability of angle measurements obtained

using the device.

We determined the variability between intraoperatively

and postoperatively obtained AI and CE angle measure-

ments and present data as mean of the difference with

standard deviation (SD) and 95% limits of agreement

presented in a Bland-Altman plot [3, 4]. The intraobserver

variability of angle measurements on postoperative radio-

graphs and intraobserver and interobserver variability of

angle measurements in the cadaver study were assessed

and presented the same way. We compared the intraob-

server variability of angle measurements on postoperative

Fig. 3A–B (A) The disc for AI measurement is positioned and

adjusted until it is placed correctly in relation to the most medial

(Arrow 1) and lateral (Arrow 2) points of the sclerotic acetabular roof.

The AI in this case is 1� (Arrow 3). The anterior (row of white arrows)

and posterior (row of black arrows) acetabular rims are seen in the

anteroposterior fluoroscopic view. The fluoroscopic view is rotated

slightly clockwise, but alignment is secured by the measuring device.

(B) The disc for CE angle measurement is positioned and adjusted

until it is placed correctly in relation to the center of the femoral head

(Arrow 1) and the most lateral point of the sclerotic acetabular roof

(Arrow 2). The CE angle in this case is 35� (Arrow 3). 0� on the

measuring disc is marked. The fluoroscopic view is rotated slightly

clockwise, but alignment is secured by the measuring device.

Table 1. Angle measurements in the cadaver study

Angle Observer Tilting of the C-arm Number of measurements Range Mean Standard deviation

Acetabular index 1* Right, 12.5�; left, 12.5� 11 1�–4� 2.73� ± 1.01�Cranial, 12.5�; caudal, 12.5� 11 1�–5� 3.00� ± 1.18�

2 Right, 12.5�; left, 12.5� 11 2�–3� 2.36� ± 0.50�Cranial, 12.5�; caudal, 12.5� 11 0�–3� 1.64� ± 0.92�

Center edge 1* Right, 12.5�; left, 12.5� 11 34�–37� 35.73� ± 0.90�Cranial, 12.5�; caudal, 12.5� 11 32�–37� 34.27� ± 1.90�

2 Right, 12.5�; left, 12.5� 11 35�–38� 36.27� ± 1.10�Cranial, 12.5�; caudal, 12.5� 11 35�–38� 36.09� ± 1.14�

* Observer 1 did double measurements to determine intraobserver variability.


123

radiographs with (1) the variability between angle mea-

surements obtained intraoperatively and on postoperative

radiographs and (2) the intraobserver and interobserver

variability of angle measurements in the cadaver study; for

this comparison we used Pitman’s variance ratio test.

Angle measures of the different series in the cadaver study

are presented as range, mean, and SD. The variability of

these series of measurements is compared with the intra-

observer variability of the device using Pitman’s variance

ratio test. Analyses were performed using the Stata1

software package (Intercooled Stata version 9.2; StataCorp

LP, College Station, TX).

Results

We found the measuring device assisted the surgeon in

obtaining good correction of the acetabulum as the intra-

operatively obtained angle measurements differed less than

± 5� from measurements on postoperative radiographs and

the intraobserver and interobserver variability of the device

were confined within ± 5� (Table 2; Fig. 4).

We found 95% of differences between angle measure-

ments obtained with the device and angle measurements on

postoperative radiographs were between -4.3� and +4.4�for the AI and between -4.8� and +4.7� for the CE angle

(Table 2; Fig. 4).

The level of variability (device versus postoperative) did

not differ (AI, p = 0.14; CE angle, p = 0.24) from the

intraobserver variability assessed on double measurement

of angles on postoperative radiographs (Table 2). With

intraobserver variability assessment on postoperative

radiographs, we found 95% of differences between two

repeated measurements would be expected to lie between

-3.5� and +3.3� for the AI and between -6.1� and +1.9�for the CE angle (Table 2).

For intraobserver and interobserver variability we found

95% limits of agreement for both angle measures were

Table 2. Comparison of angle measurements

Compared measurements Angle Number of

measurements

Mean of the

difference

Standard

deviation

95% Limits of

agreement

Pitman’s variance

ratio test

Perioperative versus postoperative AI 35 0.06� ± 2.22� -4.30�–4.42� AI: p = 0.14; CE: p = 0.24

CE 35 -0.03� ± 2.43� -4.80�–4.74�Postoperative versus postoperative AI 35 -0.09� ± 1.72� -3.46�–3.28�

CE 35 -2.09� ± 2.02� -6.05�–1.87�Cadaver study Observer 1 versus Observer 2 AI 22 0.86� ± 1.21� -1.51�–3.23� AI: p = 0.39; CE: p = 0.13

CE 22 -1.18� ± 1.84� -4.79�–2.43�Cadaver study Observer 1 versus Observer 1 AI 22 -0.77� ± 1.45� -3.60�–2.06�

CE 22 0.55� ± 1.30� -2.00�–3.10�

AI = acetabular index; CE = center edge.

Fig. 4A–B Bland-Altman plots of difference against average for

measurements of (A) AI and (B) CE angle on postoperative

radiographs and with the device intraoperatively are shown. The

mean of differences (solid line), the SD of differences (dotted line),

and the 95% limits of agreement (dashed line) are presented. The 95%

limits of agreement show we can expect 95% of differences between

the two measurement methods to lie (A) between -4.3� and +4.4� for

the AI and (B) between -4.8� and +4.7� for the CE angle. Because

inherent variability of radiographic angle assessment is ± 5�, the

reported levels are satisfactory for reliable intraoperative angle

assessment.


123

confined between -4.8� and +3.3� (Table 2). We also

found intraobserver and interobserver variability when

using the measuring device did not differ from each other

(AI, p = 0.39; CE angle, p = 0.13) (Table 2) or from the

intraobserver variability assessed on double measurements

on postoperative radiographs (AI, p = 0.45–0.96; CE

angle, p = 0.06–0.92).

Patient positioning (differing pelvic tilt and rotation) did

not influence the variation of angle measurements beyond

intraobserver variability of the device, within the arcs (±

12.5�) of tilt and rotation applied in this study. The dif-

ferent series of angle measurements performed by both

observers in the cadaver study showed variations (expres-

sed as ± SD) for AI measurement between ± 0.5� and ±

1.2� and for CE angle measurement between ± 0.9� and ±

1.9� (Table 1). These variations either did not differ from

intraobserver variability (AI, p = 0.65–0.81; CE angle,

p = 0.17–0.52), or in one series of AI measurement by

Observer 2 variation actually was less (p = 0.03) than the

intraobserver variability.

Discussion

Periacetabular osteotomy with reorientation of the acetab-

ulum is a well-established treatment to relieve pain,

increase function, and delay or prevent development of

osteoarthritis in young adults with DDH [20, 21, 24, 32,

33]. The AI and the CE angle are commonly used to

describe the morphologic characteristics of DDH [1, 10,

19, 26, 29, 34] and are assessed intraoperatively to ascer-

tain whether the intended reorientation has been achieved

[5, 6, 17, 20, 25, 31]. The senior author developed a

measuring device for intraoperative assessment of the AI

and the CE angle using fluoroscopy. We asked whether the

device could assist the surgeon in obtaining good correc-

tion of the acetabulum in terms of reliable intraoperative

determination of the AI and the CE angle.

Perhaps the major limitation of our study is that we had

no gold standard against which to compare angles using the

measuring device. Measurements of the AI and the CE

angle using three-dimensional imaging techniques could be

considered a gold standard, although for example, com-

puted tomography scanning is unlikely to be conducted

postoperatively. We therefore judged our measurements

against the variability of the measures, presuming the

correct (accurate) measure was within those ranges. It

seems meaningful to compare the angle measurements

obtained with the device with those on postoperative

radiographs as this is the commonly used imaging tech-

nique to evaluate the result of the acetabular reorientation.

We found the measuring device was able to assist the

surgeon in obtaining good correction of the acetabulum as

the intraoperatively obtained AI and CE angle measure-

ments differed less than ± 5� from measurements on

postoperative radiographs and the intraobserver and inter-

observer variability of the device were confined well within

± 5�. The limit for a satisfactory result of the variability

assessment of ± 5� was chosen from clinical and radio-

graphic points of view. Using a two-dimensional imaging

technique for assessment of the AI and the CE angle, there

are some inherent problems adding to variability: (1)

identification of the center of the femoral head; (2) iden-

tification of the medial and lateral limits of the sclerotic

acetabular roof; and (3) construction of the line of refer-

ence. Previously, variability of AI and CE angle

measurements were confined to ± 5� [2, 11, 22, 30]. The

device is built to mimic construction of the AI [29] and the

CE angle [34] when they are drawn on an anteroposterior

pelvic radiograph. Therefore, the expectation was not to

find decreased variability when using the device, but to

make sure it did not exceed existing variability of angle

assessment using two-dimensional imaging techniques.

The intraobserver and interobserver variability of the

device did not differ from each other, suggesting the device

is equally reliable in the hands of an inexperienced

(Observer 2) and experienced (Observer 1) user. This is

likely attributable to the simple construction and straight-

forward use of the device.

One way to assess angles intraoperatively is by record-

ing anteroposterior pelvic radiographs. This is time-

consuming and several radiographs might be needed before

the intended correction has been achieved. An advantage is

that assessment of angles can be made constructing a line

of reference (Fig. 1) securing pelvic alignment. Using the

device, this is achieved by a rod connecting the bilaterally

and symmetrically inserted spikes. Also, the device is used

under fluoroscopy, which allows fast and easy repeated

measurements during fine-tuning of acetabular correction

without exposing patients to heavy radiation of conven-

tional radiographs. A potential disadvantage when using

the device is the insertion of spikes in the anterior-superior

iliac spine. In our experience, it does not convey specific

site-related postoperative pain or skin problems.

Another way is intraoperative assessment of the AI and

the CE angle by eye using fluoroscopy. In our opinion, this

can be done only by someone very experienced, if at all.

The surgeon using this approach for angle assessment can

evaluate postoperative radiographs to see if surgery resul-

ted in the intended reorientation, but to our knowledge,

there is no study evaluating whether this is a reliable

approach for AI and CE angle assessment, either for the

experienced or less experienced surgeon.

Computer-assisted and image-guided techniques using

preoperative computed tomography scans have been

introduced as potentially helpful and eliminate or reduce


123

the need for radiographs in acetabular reorientation surgery

[8, 14, 15]. However, these techniques are relatively

expensive and have not been shown to improve the

achieved acetabular correction compared with a conven-

tional approach [8]. Our measuring device is relatively

inexpensive and, in our opinion, simple and fast to use. In

our hands, mounting and adjusting the discs for both angle

measurements takes approximately 2 to 3 minutes. Also,

the device can assist the surgeon in making a reliable in-

traoperative determination of the AI and the CE angle, with

variability at the same level as angle measurements made

on conventional radiographs.

The appearance of acetabular version on two-dimen-

sional radiographic imaging depends on pelvic tilt [12, 23,

28, 30]. Radiographic dysplastic parameters, such as the AI

and the CE angle, generally are only affected beyond

inherent measuring error if the image is severely distorted

[2, 11, 22, 34]. We wanted to make sure the measuring

device did not add variability to angle measurements when

tilting and rotating the pelvis. This could introduce a

potential risk of misinterpreting the achieved angle mea-

surements. We found patient positioning, in terms of

differing pelvic tilt and rotation, did not influence variation

of angle measurements beyond intraobserver variability of

the device, within the arcs (± 12.5�) of tilt and rotation

applied in this study.

The measuring device is a potentially helpful tool during

acetabular reorientation. Using the device, one can obtain

reliable measures of the AI and the CE angle with a vari-

ability confined well within that of angle measurements on

conventional radiographs. Compared with existing tech-

niques for intraoperative AI and CE angle assessment, it

has the advantages of (1) being simple to use, (2) being

relatively inexpensive, (3) making conventional intraoper-

ative radiographs unnecessary, (4) facilitating fast repeated

angle measurements during fine-tuning of correction, and

(5) being equally reliable in the hands of inexperienced and

experienced users.

Acknowledgments We thank associate professor Peter Holm-

Nielsen from the Institute of Anatomy, Faculty of Health Sciences,

Aarhus University, Denmark, for providing access to the cadaver

specimen.

References

1. Anda S, Terjesen T, Kvistad KA, Svenningsen S. Acetabular

angles and femoral anteversion in dysplastic hips in adults: CT

investigation. J Comput Assist Tomogr. 1991;15:115–120.

2. Ball F, Kommenda K. Sources of error in the roentgen evaluation

of the hip in infancy. Ann Radiol (Paris). 1968;11:298–303.

3. Bland JM, Altman DG. Statistical methods for assessing agree-

ment between two methods of clinical measurement. Lancet.1986;1:307–310.

4. Bland JM, Altman DG. Applying the right statistics: analyses of

measurement studies. Ultrasound Obstet Gynecol. 2003;22:85–

93.

5. Clohisy JC, Barrett SE, Gordon JE, Delgado ED, Schoenecker

PL. Periacetabular osteotomy in the treatment of severe acetab-

ular dysplasia. J Bone Joint Surg Am. 2006;88(suppl 1, pt 1):65–

83.

6. Ganz R, Klaue K, Vinh TS, Mast JW. A new periacetabular

osteotomy for the treatment of hip dysplasias: technique and

preliminary results. Clin Orthop Relat Res. 1988;232:26–36.

7. Hipp JA, Sugano N, Millis MB, Murphy SB. Planning acetabular

redirection osteotomies based on joint contact pressures. ClinOrthop Relat Res. 1999;364:134–143.

8. Hsieh PH, Chang YH, Shih CH. Image-guided periacetabular

osteotomy: computer-assisted navigation compared with the

conventional technique: a randomized study of 36 patients fol-

lowed for 2 years. Acta Orthop. 2006;77:591–597.

9. Hussell JG, Rodriguez JA, Ganz R. Technical complications of

the Bernese periacetabular osteotomy. Clin Orthop Relat Res.

1999;363:81–92.

10. Jacobsen S, Rømer L, Søballe K. The other hip in unilateral hip

dysplasia. Clin Orthop Relat Res. 2006;446:239–246.

11. Jacobsen S, Sonne-Holm S, Lund B, Søballe K, Kiær T, Rovsing

H, Monrad H. Pelvic orientation and assessment of hip dysplasia

in adults. Acta Orthop Scand. 2004;75:721–729.

12. Jamali AA, Mladenov K, Meyer DC, Martinez A, Beck M, Ganz

R, Leunig M. Anterior pelvic radiographs to assess acetabular

retroversion: high validity of the ‘‘cross-over-sign.’’ J OrthopRes. 2007;25:758–765.

13. Kralj M, Mavcic B, Antolic V, Iglic A, Kralj-Iglic V. The Ber-

nese periacetabular osteotomy: clinical, radiographic and

mechanical 7–15-year follow-up of 26 hips. Acta Orthop.

2005;76:833–840.

14. Langlotz F, Bachler R, Berlemann U, Nolte LP, Ganz R. Com-

puter assistance for pelvic osteotomies. Clin Orthop Relat Res.

1998;354:92–102.

15. Langlotz F, Stucki M, Bachler R, Scheer C, Ganz R, Berlemann

U, Nolte LP. The first twelve cases of computer assisted peri-

acetabular osteotomy. Comput Aided Surg. 1997;2:317–326.

16. Mast JW, Brunner RL, Zebrack J. Recognizing acetabular version

in the radiographic presentation of hip dysplasia. Clin OrthopRelat Res. 2004;418:48–53.

17. Mechlenburg I, Nyengaard J, Rømer L, Søballe K. Changes in

load-bearing area after Ganz periacetabular osteotomy evaluated

by multislice CT scanning and stereology. Acta Orthop Scand.

2004;75:147–153.

18. Myers SR, Eijer H, Ganz R. Anterior femoroacetabular

impingement after periacetabular osteotomy. Clin Orthop RelatRes. 1999;363:93–99.

19. Nakamura S, Yorikawa J, Otsuka K, Takeshita K, Harasawa A,

Matsushita T. Evaluation of acetabular dysplasia using a top view

of the hip on three-dimensional CT. J Orthop Sci. 2000;5:533–

539.

20. Peters CL, Erickson JA, Hines JL. Early results of the Bernese

periacetabular osteotomy: the learning curve at an academic

medical center. J Bone Joint Surg Am. 2006;88:1920–1926.

21. Pogliacomi F, Stark A, Wallensten R. Periacetabular osteotomy:

good pain relief in symptomatic hip dysplasia, 32 patients fol-

lowed for 4 years. Acta Orthop. 2005;76:67–74.

22. Portinaro NM, Murray DW, Bhullar TP, Benson MK. Errors in

measurement of acetabular index. J Pediatr Orthop.

1995;15:780–784.

23. Siebenrock KA, Kalbermatten DF, Ganz R. Effect of pelvic tilt

on acetabular retroversion: a study of pelves from cadavers. ClinOrthop Relat Res. 2003;407:241–248.


123

24. Siebenrock KA, Scholl E, Lottenbach M, Ganz R. Bernese

periacetabular osteotomy. Clin Orthop Relat Res. 1999;363:9–20.

25. Søballe K. Pelvic osteotomy for acetabular dysplasia. Acta Ort-hop Scand. 2003;74:117–118.

26. Tallroth K, Lepisto J. Computed tomography measurement of

acetabular dimensions: normal values for correction of dysplasia.

Acta Orthop. 2006;77:598–602.

27. Tannast M, Murphy SB, Langlotz F, Anderson SE, Siebenrock

KA. Estimation of pelvic tilt on anteroposterior x-rays: a com-

parison of six parameters. Skeletal Radiol. 2006;35:149–155.

28. Tannast M, Zheng G, Anderegg C, Burckhardt K, Langlotz F,

Ganz R, Siebenrock KA. Tilt and rotation correction of acetab-

ular version on pelvic radiographs. Clin Orthop Relat Res.

2005;438:182–190.

29. Tonnis D. Congenital Dysplasia and Dislocation of the Hip inChildren and Adults. Berlin, Germany: Springer; 1987.

30. Troelsen A, Jacobsen S, Rømer L, Søballe K. Weightbearing

anteroposterior pelvic radiographs are recommended. Clin Ort-hop Relat Res. 2008; DOI: 10.1007/s11999-008-0156-0.

31. Trousdale RT, Cabanela ME. Lessons learned after more than

250 periacetabular osteotomies. Acta Orthop Scand. 2003;

74:119–126.

32. Trousdale RT, Ekkernkamp A, Ganz R, Wallrichs SL. Periace-

tabular and intertrochanteric osteotomy for the treatment of

osteoarthrosis in dysplastic hips. J Bone Joint Surg Am. 1995;

77:73–85.

33. Trumble SJ, Mayo KA, Mast JW. The periacetabular osteotomy:

minimum 2 year followup in more than 100 hips. Clin OrthopRelat Res. 1999;363:54–63.

34. Wiberg G. Studies on dysplastic acetabula and congenital sub-

luxation of the hip: with special reference to the complication of

osteoarthritis. Acta Chir Scand. 1939;83(suppl 58):5–135.


123

http://dx.doi.org/10.1007/s11999-008-0156-0

ORIGINAL ARTICLE

Curved-stem Hip Resurfacing

Minimum 20-year Followup

James W. Pritchett MD

Received: 5 July 2007 / Accepted: 25 January 2008 / Published online: 13 March 2008


Abstract Hip resurfacing is an attractive concept because

it preserves rather than removes the femoral head and neck.

Most early designs had high failure rates, but one unique

design had a femoral stem. Because that particular device

appeared to have better implant survival, this study asses-

sed the clinical outcome and long-term survivorship of a

hip resurfacing prosthesis. Four hundred forty-five patients

(561 hips) were retrospectively reviewed after a minimum

of 20 years’ followup or until death; 23 additional patients

were lost to followup. Patients received a metal femoral

prosthesis with a small curved stem. Three types of

acetabular reconstructions were used: (1) cemented poly-

urethane; (2) metal-on-metal; and (3) polyethylene secured

with cement or used as the liner of a two-piece porous-

coated implant. Long-term results were favorable with the

metal-on-metal combination only. The mean overall Harris

hip score was 92 at 2 years of followup. None of the 121

patients (133 hips) who received metal-on-metal articula-

tion experienced failure. The failure rate with polyurethane

was 100%, and the failure rate with cemented polyethylene

was 41%. Hip resurfacing with a curved-stem femoral

component had a durable clinical outcome when a metal-

on-metal articulation was used.



of evidence.

Introduction

Hip resurfacing offers several functional benefits over

THA: the size of the femoral head and neck remains close

to normal, the resurfaced hip is stable [1, 2, 14, 40] and

capable of an excellent range of motion [2, 3, 14, 30], and

the joint retains a greater degree of normal biomechanical

function [25, 30, 33, 42, 43]. It also offers several

procedural benefits: it is more bone conserving than con-

ventional hip arthroplasty because it does not involve

decapitation of the femur, and it results in less blood loss

and rehabilitates more easily [25, 42, 43]. The disadvan-

tages of this procedure include the risk of femoral neck

fracture (0%–7%) [2, 3, 14, 29, 40] and collapse of the

femoral head resulting from osteonecrosis (0%–4%) [8,

26]. Additionally, it is a demanding procedure that requires

anterior and posterior dislocation of the joint [2, 14, 40].

The first total hip resurfacing arthroplasty was devel-

oped by Charnley [10] using a polytetrafluorethylene-on-

polytetrafluorethylene (Teflon1 or Fluon1) bearing. The

procedure failed because of osteonecrosis of the femoral

head. Townley and Walker [39] introduced a device (total

articular replacement arthroplasty, or TARA) with a small

and short curved femoral stem; none of the other sub-

sequent designs, including that of Charnley, used a femoral

stem. In the 1970s, hip resurfacing was popular in several

centers in Europe, Japan, England, and the United States.

However, initial promising results [15, 16, 17, 44] gave

way to unacceptable failure rates (22%–76%) [21, 22, 41],

owing primarily to acetabular loosening from polyethylene

The author certifies that he has no commercial associations (eg.




The author certifies that his institution has approved the human

protocol for this investigation, that all investigations were conducted

in conformity with ethical principles of research, and that informed

consent for participation in the study was obtained.

J. W. Pritchett (&)

168 Lake WA Boulevard E, Seattle, WA 98112, USA


123


DOI 10.1007/s11999-008-0165-z

wear (10%–46%) [4, 28, 36]. Less commonly, femoral

neck fracture, osteonecrosis, or loosening of the femoral

component occurred [4, 21, 22, 36, 41, 44].

Resurfacing was largely abandoned again until the

1990s when it was resurrected for the same reasons that

made it attractive initially: many patients want an active

lifestyle that would include participation in sports or rec-

reation [33, 42, 43], they want to keep their bone, and some

patients have the perception that revisions, if necessary, are

easier than with a conventional stem-supported intramed-

ullary hip prosthesis [2, 5, 6]. Modifications were made to

the original design based on the presumed cause of failure,

one of which was the requirement for a very thin and

flexible polyethylene component when retaining a femoral

implant the size of the normal femoral head. However, as

noted earlier, none of the original devices that had high

failure rates had a femoral stem. The one device that did

have a femoral stem appeared to have better midterm

outcomes than the nonstemmed devices [31, 38].

Therefore the following questions were raised: what are

the functional results from curved-stem total hip resurfac-

ing and what is the survivorship of the prosthesis over

long-term followup?


Four hundred forty-five patients (561 hips) who underwent

total hip resurfacing (TARA) procedures from 1960 to

1987 were retrospectively reviewed. Conventional THAs

also were performed and it is estimated that approximately

20% of patients treated received a resurfacing prosthesis.

Patients were generally selected for resurfacing procedures

if they were younger than 60 years. Patients older than

60 years were offered the resurfacing procedure if they

were active and if they had excellent bone quality on

their radiographs. None of the patients had a prior implant

arthroplasty, although 18 had previous surgery for a dis-

located hip or fracture. The underlying diagnosis was

osteoarthritis in 334 patients (75%), osteonecrosis in 44

(10%), posttraumatic arthritis in 31 (7%), inflammatory

arthritis in 18 (4%), and developmental dysplasia in 18

(4%). The patient population consisted of 218 women and

227 men with a mean body weight of 71 and 82 kg,

respectively (range, 50–107 kg). The mean age was

52 years (range, 30–74 years) with 97 patients aged 30 to

40 years, 118 aged 40 to 50 years, 109 aged 50 to 60 years,

100 aged 60 to 70 years, and 21 aged 70 to 74 years.

All patients were followed up until death or a minimum

of 20 years; 374 (84%) of the 445 patients had died by the

time of final followup. Twenty-three additional patients

underwent hip resurfacing but were lost to followup and

are not otherwise included in the results. The mean age at

the time of death was 80 years (range, 58–99 years) and

the mean survival time from surgery until the time of death

was 22 years. The remaining 71 patients (16%) had been

followed a minimum of 20 years (average, 27 years; range,

20–41 years) (Table 1). Prior Institutional Review Board

approval was obtained for this study.

Surgery was performed by one of two surgeons (JWP,

COT). Each surgical procedure was done through an

anterolateral approach without trochanteric osteotomy. The

hip was dislocated anteriorly and the femur prepared. The

femoral head was downsized when possible, trying not to

notch the femoral neck. The zenith of the femoral head was

removed at an approximate 140� angle to the femur

(measured by a goniometer), and all cystic or structurally

damaged at-risk bone was removed. The guide stem then is

placed into the femoral canal. Fitting this curved stem into

the femur creates slight valgus relative to the medial tra-

becular system of the femur. Cylinder and chamfer cutters

were made to complete the preparation of the femoral

head [38]. Prostheses were placed using an interference

fit, cemented, or porous-coated technique. The surgeon

attempted to place the femoral component in valgus.

The type of prosthesis varied with the time at which the

procedure was performed. In the earliest procedures from

1960 to 1962, the acetabular surface used was polyurethane

(24 patients). This polymer was prepared by mixing the

prepolymer with resin and the catalyst at the time of surgery

and shaping it in situ or on the back table to the femoral

prosthesis. Polyurethane therefore served as the anchoring

cement for the femoral side and as the articular replacement

and cement for the acetabulum. Although it is a plastic, it had

a fairly rough finish. The length of the femoral stem varied

from 127 to 165 mm, with longer stems used more com-

monly in the earlier cases. Metal-on-metal implants became

Table 1. Survivorship among original 445 patients treated with hip

resurfacing

Years since surgery Number (%) Mean age at death

or follow-up

(years; range)

Patients who had died 374 (84) 80 (58–99)

Less than 5 years 19 (5)

5–9 years 24 (6)

10–19 years 54 (14)

20–30 years 166 (45)

Longer than 30 years 111 (30)

Patients alive at followup 71 (16) 75 (53–94)

Survival periods

20–30 years 51 (72)

30–40 years 18 (25)

40 years 2 (3)

Patients lost to followup 23

1178 Pritchett Clinical Orthopaedics and Related Research

123

available in 1962 and were used in 121 patients through the

mid 1970s; these were made of cobalt chromium (DePuy

Orthopaedics, Inc, Warsaw, IN; Howmedica, Rutherford,

NJ; Zimmer, Inc, Warsaw, IN) (Fig. 1). They were implan-

ted without cement on the acetabular side and with or without

cement on the femoral side. Polyethylene components

(DePuy), which became available in the 1970s (222 pati-

ents), had an initial thickness of 4.5 mm. These components

were later increased to 6.0 mm and cemented in place using

polymethylmethacrylate (Simplex1; Howmedica, NJ). The

two-piece metal-polyethylene component (78 patients) was

porous-coated with a coxcomb fin for adjunctive fixation

(Fig. 2). Fifteen patients received a two-piece cementless

acetabular prosthesis in one hip and a cemented polyethylene

prosthesis in the other (Fig. 2).

Patients were followed prospectively and asked to return

at 1 year, 2 years, 5 years, and every 5 years thereafter.

The Harris hip score was used (COT, JWP) to evaluate the

surgical results [20]. The hip score at 2 years was used to

grade the functional result. When this was not possible,

patients were sent a written questionnaire (Appendix 1) or

contacted by telephone and interviewed using the same

questionnaire. Clinical examinations to final followup were

available for 226 (51%) patients. Written questionnaires

were available for 88 (20%) patients and telephone ques-

tionnaires were available for 131 (29%) patients. Patients

were queried specifically about the need for additional

surgery on their hip. If surgery had been performed, the

patient was asked to provide information about that pro-

cedure. The date of death was obtained by direct

communication with the family. Information regarding the

patient’s hip function was obtained from the family for

patients who had died. Twenty seven patients (6%)

underwent a resurfacing procedure on one side and a

conventional THA on the other. They were asked which

was the better hip based on their perception of a more

natural feel and superior strength or function.

Immediate postoperative radiographs were assessed and

the abduction angle of the acetabular component and the

stem shaft angle of the femoral prosthesis were measured

[2, 7]. The femoral component was considered malposi-

tioned if it was 5� more horizontal (varus) than the medial

trabecular system of the proximal femur [12, 35]. The

acetabular component was considered malpositioned if

the abduction angle was greater than 65� or less than 30�.

The observers (JWP, COT) were not blinded to the results.

Survivorship was computed using Kaplan-Meier survi-

vorship estimates [24]. and the end points consisted of

Fig. 1 A photograph shows the curved-stem metal-on-metal hip

resurfacing prosthesis. The acetabular component has a small fin and

screw holes for adjunctive fixation.

Fig. 2 An anteroposterior radiograph shows a pelvis with a cemented

polyethylene cup on the left side and a cementless two-piece

acetabular prosthesis on the right side. The radiograph was taken

21 years after insertion of the prosthesis on the right and 29 years

after insertion of the prosthesis on the left.

Volume 466, Number 5, May 2008 Curved-stem Hip Resurfacing 1179

123

revision or removal (or recommendation for revision or

removal) of either component for any reason. Patients were

censored at death or at revision. A 95% confidence interval

was calculated. Survivorship analyses were calculated for

each type of acetabular reconstruction used (Figs. 3, 4).

Failure was defined by removal or revision of the pros-

thesis or consideration for revision based on reduction in

function of the hip with radiographic evidence of loosening

of the components, such as change in position of either the

femoral or acetabular component or extensive radiolucent

lines around the acetabular component and resorption of

bone [1].

Results

The mean peak Harris hip score improved from 57 (range,

8–79) to 92 (range, 63–100) at 2 years. Flexion improved

from a mean of 83� (range, 5�–118�) to a mean of 110�(range, 65�–140�) between preoperative and postoperative

evaluations. Most patients experienced no pain and only

four (less than 1%) experienced severe pain. Of the 445

patients assessed for postsurgical activity, 1.3 participated

in strenuous athletics or work and only 22 (5%) did not

work or participate in activities. Ninety percent were not

limited in their activities (Table 2). Of the 27 patients who

had a resurfacing procedure on one side and a conventional

THA on the other, all indicated the hip that had resurfacing

was the better hip.

Among living patients and those who died with their

implant in place, the survivorship for the femoral prosthesis

(including patients with all three acetabular implants) was

84% (Fig. 4). However, the metal-on-metal prostheses had

100% survivorship. Failure rates for the remaining ace-

tabular prostheses ranged from 34% to 100% (Table 3).

The highest failure rate (100%) was seen with polyure-

thane. This bearing surface disappeared radiographically

with time (Fig. 5); thereafter, this prosthesis seemed to

function as a hemiarthroplasty. Of the two patients with

polyurethane prostheses undergoing revision, one had

metal-on-metal resurfacing with a good outcome, and the

other underwent THA because of a femoral neck fracture.

The cemented polyethylene acetabular prosthesis (Fig. 2)

also resulted in high failure rates. The 15 patients who

received a two-piece cementless acetabular prosthesis in

one hip and a cemented polyethylene prosthesis in the other

also experienced high failure rates (Table 3). All but two

of the 141 revisions were in patients with metal-on-

polyethylene articulation and two involved a metal-on-

polyurethane prosthesis. None of the metal-on-metal

prostheses underwent revision (Table 3). We removed both

components and inserted an entirely new resurfacing

prosthesis in two patients. The acetabular prosthesis alone

Fig. 3 A Kaplan-Meier survivorship curve for the cemented poly-

ethylene acetabular component is shown. The survivorship is 59% at

20 years after prosthesis insertion. Dashed lines indicate 95%

confidence intervals.

Fig. 4 A Kaplan-Meier survivorship curve for the curved-stem

femoral component is shown. The survivorship rate is 84% at

20 years. Dashed lines indicate 95% confidence intervals.


123

was revised in 22 hips. The femoral component was secure

in these cases. Revision surgery in the remaining patients

(117 hips) was conventional THA. Thirty-two of 44

patients (73%) with osteonecrosis experienced prosthesis

failure (mean time to failure, 7 years; range, 3–12 years).

Postoperative radiographs revealed technical errors in

approximately 13% of patients, most commonly a malpo-

sitioned femoral component (28 hips or 5%), and smaller

numbers of malpositioned acetabular components, malpo-

sitioned femoral and acetabular components in the same

patient, with notched femoral necks, and incompletely

seated femoral components in 36 instances (Table 4).

Twenty-one of these 64 patients (33%) had a body mass

index greater than 35. The most common complications

seen at any time during the followup included deep

infection, dislocation, and periprosthetic fracture. The

periprosthetic fractures occurred sporadically any time

after the surgical procedure from 6 months to 36 years

later. Less frequently, intraoperative fracture and nerve

palsy occurred (Table 5). Medical complications of various

types occurred in approximately 5% of patients.

Discussion

The curved-stem hip resurfacing prosthesis was the second

attempt (1960) at total hip resurfacing [15]. John Charnley

made the first attempt (1951) before his work on low-

friction arthroplasty [11]. The innovator (COT) continued

to use the curved-stem prosthesis for over 40 years and

long-term followup of the patients is available.

There are some limitations of this study. The investi-

gation is retrospective, but the primary outcome,

prosthesis, and survival are known on all but a few patients

who were lost to followup. Second, this study investigates

a prosthesis that was in evolution as it was being used.

Three different materials were used for the acetabular

resurfacing, although most were metal-on-metal and metal-

on-polyethylene a few were metal-on-polyurethane. Also

the femoral component was secured without or with

cement and varied in stem length adding variations for

which statistical analysis could not be done. Pathologic

specimens of failed cases or autopsy retrievals also are not

available to show the reasons for success or failure. The

Table 2. Complications of hip resurfacing procedures

Outcome Number of patients (%) Comments

Complications

Deep infection 11 (2) Over lifetime of prosthesis

Dislocation 5 (\ 1)

Periprosthetic fracture (hips) 6 (\ 1) Intertrochanteric and subtrochanteric

Femoral neck fractures 10 (1.7)

Intraoperative femoral neck fracture 1 Converted to THA

Femoral nerve palsy 2 Both patients recovered

Sciatic palsy 5 (\ 1) Recovery: 2 full; 2 partial; 1 limited

as a result of peroneal and tibial involvement

Table 3. Functional results of hip resurfacing

Pain Number (%) Assessed 2 years after procedure

No pain 459 (82)

Slight pain 86 (15)

Moderate pain 12 (2)

Severe pain 4 (\ 1)

Function: postsurgical activity Assessed 2 years after procedure in 445 patients

Highly active 147 (33) Strenuous sports or job

Active and no limitations necessary 254 (57)

Moderately active 22 (5)

Inactive 22 (5)

Patient satisfaction

Satisfied with outcome 427 (96)

Dissatisfied with outcome 18 (4) Nine patients were dissatisfied because of a limp

or weakness Nine patients were dissatisfied because of pain


123

two surgeons involved performed all of the clinical and

radiographic analyses. Complete followup data (particu-

larly radiographs) were not available on many patients so

questionnaires were relied on for some of the information.

There are no long-term functional outcomes reported in

this study and validated instruments were not available at

the time of surgery for the earlier patients. Finally, because

this is a single patient series, there are no patients or groups

available with other stemmed femoral devices for direct

comparison.

The data suggest a survivorship of 59% at 20 years

when using a polyethylene acetabular component. Mesko

et al. [31] reported a 75% survivorship with the curved-

stem TARA prosthesis at 10 years, but failure rates of 57%

and 76% were reported in two other studies [21, 41]. The

THARIESTM total resurfacing prosthesis had a failure rate

of 50% at 10 years and 80% at 15 years [4, 28]. The

Indiana conservative hip had a failure rate of 66% at

9 years and the Wagner had a failure rate of 60% at 8 years

[22, 36].

Metal-on-metal hip resurfacing had a survival rate of

100% in this study and as a generic type is the most

commonly used resurfacing today. Success rates of 94% or

better are reported with as much as 9 (range, 2–9 years)

years of followup [2, 3, 14, 40].

Femoral neck fracture is a rare complication after hip

resurfacing, occurring at reported rates of 0% to 7% [2, 3,

29, 37]. The rate of femoral fracture and femoral compo-

nent failure was low in this series. This was despite the

effort made to downsize the femoral head that resulted in

femoral neck notching in some cases. Placing the femoral

component in valgus reduces the stresses in the superior

aspect of the femoral head and neck [23, 27, 45]. Femoral

components placed in 5� valgus have a factor of 6.1

Fig. 5A–C Anteroposterior radiographs show a metal-on-polyurethane curved-stem resurfacing prosthesis. (A) There is 9 mm of polyurethane

immediately after insertion. (B) Two years later, approximately ½ of the polyurethane has worn away. (C) All the polyurethane has worn away

6 years after prosthesis insertion.

Table 4. Radiographic findings after hip resurfacing

Radiographic finding Number of hips (%) Comments

Femoral component malpositioned 28 (5) Greater than 5� more varus postoperatively

measured versus medial trabecular system

Acetabular component malpositioned 17 (4) Includes 11 with hip resurfacing failure

Acetabular and femoral components malpositioned 6 (1) Includes three with hip resurfacing failure

Notched femoral neck 11 (2) Includes three with a femoral neck fracture

Femoral component incompletely seated 2 (\ 1) Includes one with hip resurfacing failure


123

reduction in the relative risk of an adverse outcome [7].

Obese patients have a higher incidence of varus positioning

and femoral neck fracture.

Most early resurfacing implants involved hemispheric

preparation of the femoral head followed by placement of a

hemispheric femoral implant; unfortunately, shear often

resulted in loosening of these implants. These implants also

did not have a femoral stem [4, 16, 22, 36]. The presence of

a stem reduces the shear force on the prosthetic femoral

head-native femoral neck junction by 34% [13, 19]. A

curved femoral stem reduces the shear force on the femoral

neck by 17% compared with a straight stem [13, 19]. This

may be an additional explanation for the lower rate of

femoral neck fracture and femoral component loosening

observed in the current study with other implants [4, 22, 28,

36]. The preparation required to implant a curved stem

promotes valgus positioning of the femoral component [18,

38]. Although I report what appears to be the first attempt

to use a metal-on-metal resurfacing prosthesis, there were

other early innovators. Gerard [17] used a metal-on-metal

prosthesis but did not fix the acetabular component to the

pelvis; Mueller [32] also performed metal-on-metal resur-

facing procedures. In this series, a prosthesis originally

known as cup-stem arthroplasty was used [39], in which

the hemisphere was replaced by a flat-topped cylinder. The

technique used to place this implant excised at-risk bone in

the femoral head and this may have contributed to the low

failure rate. The head design provides compressive resis-

tance stability; and a short, curved stem on the prosthesis

adds stability without stress relieving the proximal femur

[13, 38]. Current designs use a straight femoral stem [3, 14,

40]. The results in this report and biomechanical

considerations suggest a curved femoral stem may be the

superior design for a resurfacing prosthesis.

The difficulties with hip resurfacing in this series were

primarily on the acetabular side. Well-performed femoral

resurfacing rarely fails with time; this was true when an

interference press-fit technique was used when neither

cement nor porous coating was yet available. Early pro-

cedures involved the use of materials that did not provide

an appropriate acetabular surface. Charnley [10, 11] used

polytetrafluorethylene in the first hip resurfacing procedure

and it failed. In this series, polyurethane failed every time.

However, polyurethane does not cause an osteolytic reac-

tion; as a result, patients functioned generally well as it

wore away. They had some pain and radiographs of the hip

looked as though hemiarthroplasty had been performed

(Fig. 5). The crude polyurethane used in the early days has

now been reformulated. Thus far, the wear characteristics

of the new formulation seem favorable [9]. Another con-

tributor to resurfacing arthroplasty failure in this series

(and in others) was the use of cemented polyethylene

acetabular components that loosened and wore through,

often resulting in osteolysis [1, 4, 16, 21, 22, 36]. Metal-

backed cemented polyethylene sockets were not used in

this series, but others have reported prosthesis failure when

they were used in such procedures [34, 41].

Exposing and positioning the acetabular component

with the femoral head in the way is technically difficult [2,

3, 37]. Exacting preparation of the femoral head is neces-

sary. Hip resurfacing using the curved femoral stem

performed well on the femoral side for more than 20 years.

Although polyethylene acetabular components failed reg-

ularly, metal acetabular components performed well. Hip

Table 5. Revisions of hip resurfacing prostheses

Item Type of prosthesis

Metal-on-polyurethane Metal-on-

metal

Metal-on-cemented

polyethylene

Metal on two-piece cementless

with polyethylene

Revision needed 2 0 105 34

Patients/hips 24/26 121/133 222/282 78/120

Mean followup (years; range) 24 (20–31) 26 (20–41) 25 (20–31) 21 (20–22)

Alive at followup 0 0 41 30

Lost to followup 0 2 15 6

Prosthesis failure rate 100% 0 % 41% 34%

Reason for failure

More than one reason

in some patients

Polyurethane wear (26)

Femoral neck fracture (1)

N/A Loosening of acetabulum (76)

Polyethylene wear (30)

Loosening of femoral prosthesis (5)


Polyethylene wear (27)

Component loosening with

migration (11)


N/A = not applicable.


123

resurfacing may be an attractive option for a young patient

fearing a potentially difficult future total hip replacement

revision.

Acknowledgments I thank Charles O. Townley, MD, for contrib-

uting his cases and knowledge. He died on December 22, 2006.

References

1. Amstutz H. Surface replacement arthroplasty. In: Amstutz HC,

ed. Hip Arthroplasty. Edinburgh, UK: Churchill Livingstone;

1991:295–332.

2. Amstutz HC, Ball ST, Le Duff MJ, Dorey FJ. Resurfacing THA

for patients younger than 50 years. Clin Orthop Relat Res.

2007;460:159–164.

3. Amstutz HC, Beaule PE, Dorey FJ, Le Duff MJ, Campbell PA,

Gruen TA. Metal-on-metal hybrid surface arthroplasty: two to

six-year follow-up study. J Bone Joint Surg Am. 2004;86:28–39.

4. Amstutz HC, Dorey F, O’Carroll PF. THARIES resurfacing

arthroplasty: evolution and long-term results. Clin Orthop RelatRes. 1986:213:92–114.

5. Alberton GM, High WA, Morrey BF. Dislocation after total hip

arthroplasty: an analysis of risk factors and treatment options.

J Bone Joint Surg Am. 2002:84:1788–1797.

6. Ball ST, Le Duff MJ, Amstutz HC. Early results of conversion of

failed femoral component in hip resurfacing arthroplasty. J BoneJoint Surg Am. 2007:89:735–741.

7. Beaule PE, Lee JL, Le Duff MJ, Amstutz HC, Ebramzadeh E.

Orientation of the femoral component in surface arthroplasty of

the hip. J Bone Joint Surg Am. 2004:86:2015–2021.

8. Campbell P, Beaule PE, Ebramzadeh E, Le Duff M, DeSmet K,

Lu Z, Amstutz HC. The John Charnley Award: a study of implant

failure in metal-on-metal surface arthroplasties. Clin OrthopRelat Res. 2006;453:35–46.

9. Carbone A, Howie DW, McGee M, Field J, Pearcy M, Smith N,

Jones E. Aging performance of a compliant bearing acetabular

prosthesis in an ovine hip arthroplasty model. J Arthroplasty.

2006;21:899–906.

10. Charnley J. Arthroplasty of the hip: a new operation. Lancet.1961;1:1129–1132.

11. Charnley J. Low Friction Arthroplasty of the Hip: Theory,Practice. New York, NY: Springer; 1979.

12. Clark JM, Freeman MA, Witham D. The relationship of neck

orientation to the shape of the proximal femur. J Arthroplasty.

1987;2:99–109.

13. Collier J, Kennedy F, Mayor M, Townley CO. The importance of

stem geometry, porous coating and collar angle of femoral hip

prosthesis on the strain distribution in the normal femur. TransSoc Biomater. 1983;9:96.

14. Daniel J, Pynsent PB, McMinn DJ. Metal-on-metal resurfacing

arthroplasty of the hip in patients under 55 years with osteoar-

thritis. J Bone Joint Surg Br. 2004;86:177–184.

15. Freeman MA. Total surface replacement hip arthroplasty. ClinOrthop Relat Res. 1978;134:2–4.

16. Freeman MA, Cameron HU, Brown GC. Cemented double cup

arthroplasty of the hip: a 5-year experience with the ICLH

prosthesis. Clin Orthop Relat Res. 1978;134:45–52.

17. Gerard Y. Hip arthroplasty by matching cups. Clin Orthop RelatRes. 1978;134:25–35.

18. Grecula MJ, Thomas JA, Kreuzer SW. Impact of implant design

on femoral head hemiarthroplasty. Clin Orthop Relat Res.

2004;418:41–47.

19. Haboush EJ. A new operation for arthroplasty of the hip based on

biomechanics, photoeleasticity, fast setting dental acrylic, and

other considerations. Bull Hosp Joint Dis. 1953;14:242–276.

20. Harris WH. Traumatic arthritis of the hip after dislocation

and acetabular fractures: treatment by mold arthroplasty: an

end-result study using a new method of result evaluation. J BoneJoint Surg Am. 1969;51:737–755.

21. Head WC. Total articular resurfacing arthroplasty: analysis of

failure in 67 hips. J Bone Joint Surg Am. 1984;66:28–34.

22. Howie DW, Campbell D, McGee M, Cornish BL. Wagner

resurfacing hip arthroplasty: the results of one hundred consec-

utive arthroplasties after eight to ten years. J Bone Joint Surg Am.1990;72:708–714.

23. Huiskes R, Strens PH, van Heck J, Slooff TJ. Interface stresses in

the resurfaced hip: finite element analysis of load transmission in

the femoral head. Acta Orthop Scand. 1985;56:474–478.

24. Kaplan E, Meier P. Nonparametric estimation from incomplete


25. Lilikakis AK, Arora A, Villar RN. Early rehabilitation comparing

hip resurfacing and total hip replacement. Hip Int. 2005;15:189–

194.

26. Little CP, Ruiz AL, Harding IJ, McLardy-Smith P, Gundle R,

Murray DW, Athanasou NA. Osteonecrosis in retrieved femoral

heads after failed resurfacing arthroplasty of the hip. J Bone JointSurg Br. 2005;87:320–323.

27. Long JP, Bartel DL. Surgical variables affect mechanics of a

hip resurfacing system. Clin Orthop Relat Res. 2006;453:115–

122.

28. Mai MT, Schmalzried TP, Dorey FJ, Campbell PA, Amstutz HC.

The contribution of frictional torque to loosening at the cement

bone interface in THARIES hip replacements. J Bone Joint SurgAm. 1996;78:505–511.

29. Marker DR, Seyler TM, Jinnah RH, Delanois RE, Ulrich SD,

Mont MA. Femoral neck fractures after metal-on-metal total hip

resurfacing. J Arthroplasty. 2007;22(7 suppl 3):66–71.

30. Mont MA, Seyler TM, Ragland PS, Starr R, Erhart J, Bhave A.

Gait Analysis of patients with resurfacing hip arthroplasty com-

pared with hip osteoarthritis and standard total hip arthroplasty.


31. Mesko JW, Goodman FG, Stanescu S. Total articular replace-

ment arthroplasty: a three-to ten-year case-controlled study. ClinOrthop Relat Res. 1994;300:168–177.

32. Mueller M. The benefits of metal-on-metal total hip replacement.


33. Naal FD, Maffiuletti NA, Munzinger U, Hersche O. Sports after

hip resurfacing. Am J Sports Med. 2007;35:705–711.

34. Pritchett JW. Success rates of the TARA hip. Am J Orthop.

1998;27:658.

35. Pritchett JW, Perdue KD, Dona GA. The neck shaft-plate shaft

angle in slipped capital femoral epiphysis. Orthop Rev.

1989;28:1187–1192.

36. Ritter MA, Lutgring JD, Berend ME, Pierson JL. Failure mech-

anisms of total hip resurfacing. Clin Orthop Relat Res.

2006;453:110–114.

37. Shimmin AJ, Back D. Femoral neck fractures following

Birmingham hip resurfacing: a national review of 50 cases.


38. Townley CO. Hemi and total articular replacement arthroplasty

of the hip with a fixed femoral cup. Orthop Clin North Am.

1982;13:869–894.

39. Townley CO, Walker S. Intramedullary cup-stem arthroplasty of

the hip. J Bone Joint Surg Am. 1961;43:602.

40. Treacy RB, McBryde CW, Pynsent PB. Birmingham hip resur-

facing: a minimum follow-up of five years. J Bone Joint Surg Br.

2005;87:167–170.


123

41. Treuting RJ, Waldman D, Hooten J, Schmalzried TP, Barrack

RL. Prohibitive failure rate of the total articular replacement

arthroplasty at five to ten years. Am J Orthop. 1997;26:114–118.

42. Vail TP, Mina CA, Yergler JD, Pietrobon R. Metal-on-metal hip

resurfacing compares favorably with THA at 2 years followup.


43. Vendittoli PA, Lavigne M, Roy AG, Lusignan D. A prospective

randomized clinical trial comparing metal-on-metal total hip

replacement and metal-on-metal total hip resurfacing in patients

less than 65 years old. Hip Int. 2006;16:73–81.

44. Wagner H. Surface replacement arthroplasty of the hip. ClinOrthop Relat Res. 1978;134:102–130.

45. Watanabe Y, Shiba N, Matsuo S, Higuchi F, Tagawa Y, Inoue A.

Biomechanical study of resurfacing arthroplasty: finite element

analysis of the femoral component. J Arthroplasty. 2000;15:505–

511.


123

ORIGINAL ARTICLE

Alumina Inlay Failure in Cemented Polyethylene-backed TotalHip Arthroplasty

Kentaro Iwakiri MD, Hiroyoshi Iwaki MD, PhD,

Yukihide Minoda MD, PhD, Hirotsugu Ohashi MD, PhD,

Kunio Takaoka MD, PhD

Received: 21 July 2007 / Accepted: 30 January 2008 / Published online: 21 February 2008


Abstract Alumina-on-alumina bearings for THA have

markedly improved in mechanical properties through

advances in technology; however, alumina fracture is still a

concern. We retrospectively reviewed 77 patients (82 hips)

with cemented alumina-on-alumina THAs to identify fac-

tors relating to alumina failure. The mean age of the

patients at surgery was 63 years. The prostheses had a

cemented polyethylene-backed acetabular component with

an alumina inlay and a 28-mm alumina head. Revision

surgery was performed because of alumina inlay failure in

four hips (three fractures and one dissociation; 5.6%), deep

infection in two, and recurrent dislocation in one. The

8-year survival rate was 90.7% with revision for any reason

and 94.4% with revision for alumina failure as the end

point. There were no differences in age, body mass index,

gender, mobility, function, abduction angle, or size of

component among the four hips with alumina failure and

the remaining 68 hips without it; however, radiolucent lines

in the sockets were more apparent in four cases with

alumina inlay failure. This alumina-on-alumina THA thus

yielded unsatisfactory medium-term results because we

observed a high rate of catastrophic alumina inlay failure.



of evidence.

Introduction

The alumina-on-alumina articulation in THA was intro-

duced in the 1970s to reduce wear and its consequences

[19, 26]. Alumina particles induced less macrophage

reaction and cytokine secretion than polyethylene particles

[8], and THA using alumina-on-alumina articulation

induced little periprosthetic osteolysis [13, 25, 31]. How-

ever, early alumina prostheses, eg, with conically threaded

monoblocks or spherical press-fit acetabular components,

generally were found to have insufficient fixation of the

acetabular component and the risk of fracture of the

alumina component seemed to be a problem [3, 13]. During

the last decade, the quality of materials has improved

considerably and the risk of fracture has decreased [13, 27].

Subsequently, good clinical results have been obtained

with a cementless, press-fit, metal-backed acetabular

component with an alumina insert [3, 31]. However, con-

cerns still remain regarding problems with the alumina

component.

A unique polyethylene-backed acetabular component

with an alumina insert intended for fixation with bone

cement was developed in 1998. Recently, there have been

reports regarding problems with the alumina inlay in this

design [1, 12, 14, 18, 22, 24, 25, 28, 30, 31], but what

factors might relate to the socket or insert failure are

unclear as there have been no reports regarding the clinical









K. Iwakiri (&), H. Iwaki, Y. Minoda, K. Takaoka

Department of Orthopaedic Surgery, Osaka City University

Graduate School of Medicine, 1-4-3 Asahi-machi, Abeno-ku,

Osaka 545-8585, Japan


H. Ohashi

Department of Orthopaedic Surgery, Saiseikai Nakatsu Hospital,

Osaka, Japan

123


DOI 10.1007/s11999-008-0168-9

results of this cemented polyethylene-backed alumina-on-

alumina THA.

We asked whether age, body mass index (BMI), gender,

mobility, function, abduction angle, size of component, the

existence of radiolucent lines, or component type with or

without a flange were associated with alumina failure.


We retrospectively reviewed 77 consecutive patients (82

hips) who underwent THA between February 1998 and

July 2000. In all 82 hips, cemented THA was performed

using a polyethylene-backed acetabular component with an

alumina inlay (ABS Cup; Kyocera, Kyoto, Japan) (Fig. 1),

KC stem (Kyocera), and 28-mm alumina femoral head.

Four patients (four hips) died within 27 months after the

operation without complications from surgery. Two

patients (two hips) were excluded because of recurrent

dislocation and one patient (one hip) was excluded because

of deep infection; these patients underwent revision sur-

gery within 24 months. Three patients (three hips) were

lost to followup. The remaining 67 patients (72 hips) were

followed for a minimum of 5 years. There were 60 women

and seven men. The mean age at the index operation was

63 years (range, 41–87 years), mean weight 53.9 kg (range,

38–85 kg), mean height 152 cm (range, 138–172 cm), and

mean BMI 23.2 kg/m2 (range, 16.2–34.7 kg/m2). The

primary diagnosis was osteoarthritis in 61 hips, osteone-

crosis in five, rheumatoid arthritis in four, and sequelae of

pyogenic infection in two. The minimum duration of fol-

lowup was 5 years (mean, 6.7 years; range, 5–8.3 years)

(Table 1). The study was approved by the Institutional

Review Board of the hospital, and all patients provided

informed consent.

The acetabular components consisted of a spherical

cemented polyethylene socket with an alumina inlay (ABS;

Kyocera) without a flange (Fig. 1A) in 20 hips and the

same socket with a flange (Fig. 1B) in 52 hips. The outer

diameter of the acetabular component was 42 mm in 14

hips, 44 mm in 42, 46 mm in eight, 48 mm in seven, and

50 mm in one. The femoral component was a tapered

collarless titanium stem (KC stem; Kyocera). The stem was

Fig. 1A–C A spherical cemented polyethylene-alumina composite

cup, ABS cup (Kyocera, Kyoto, Japan), was developed to obtain

stability between the alumina cup and bone cement. There were two

designs for this cup: (A) one is the ABS cup without a flange and (B)

the other is the ABS cup with a flange. (C) A cross section of the ABS

cup is shown. The thickness of the alumina inlay is fixed at 4 mm in

any size of acetabular component.

c

Volume 466, Number 5, May 2008 Polyethylene-backed Cemented Alumina THA 1187

123

tapered only in the anteroposterior projection. The proxi-

mal end of the stem was coated with macrotexture. The

neck-shaft angle of the stem was 130�. The standard offset

was 40 mm in 42 hips, and the offset of the narrow stem

was 35 mm in 30 hips. The femoral component was fixed

with Simplex P1 cement (Stryker Howmedica Osteonics,

Allendale, NJ). A 28-mm alumina femoral head (Kyocera)

was used. A short neck-head component was used in 18

hips, a medium neck in 50, and a long neck in four. All

operations were performed by one surgeon (HO) through

an anterolateral approach in which an attempt was made to

place the acetabular component in an anatomic position.

All patients received intravenous antibiotic prophylaxis

preoperatively and for 3 days after surgery. The patients

received mechanical prophylaxis for thromboembolism by

intermittent pneumatic compression with the A-V Impulse

System1 (Novamedix, Andover, UK) for 2 days, but no

pharmacologic prophylaxis using warfarin, heparin, or

aspirin was administered. Patients were encouraged to walk

with full weightbearing as tolerated without the aid of

crutches 4 weeks after surgery. Routine followups were

scheduled for 3, 6, 9, and 12 months and yearly thereafter.

We (HI) performed clinical evaluation using the Merle

d’Aubigne and Postel score [16] that allocates up to 6

points for each category of pain, mobility, and function

with a total of 18 points given to a normal hip. Patients

were routinely asked at followup whether they had expe-

rienced audible hip noise because we were concerned about

separation of alumina-on-alumina bearings and alumina

fractures [18, 28].

The radiographic evaluation was performed by one

observer (KI) who did not participate in the index opera-

tions. The 6-month anteroposterior and lateral radiographs

were used for assessment of the abduction angle of the

acetabular socket [17]. On the radiographs at the final

examination, radiolucency and osteolysis were evaluated

around the acetabular component using the zone classifi-

cation of DeLee and Charnley [9] and around the femoral

component using the criteria of Hodgkinson et al. [15] and

Gruen et al. [11]. Migration of the acetabular and femoral

component center was evaluated by comparing the hori-

zontal and vertical distance from the inferior points of

the teardrops and the center of the lesser trochanter,

respectively, on the immediate postoperative and final

radiographs [20]. Loosening of each component was con-

sidered to have occurred when migration of the component

was greater than 2 mm. Alumina component failure was

checked. Heterotopic ossification was defined according to

Brooker et al. [7].

The mean Merle d’Aubigne and Postel hip score of the

remaining 68 hips improved from 10.1 (pain 2.4, mobility

4.2, function 3.5) before the operation to 16.3 (pain 5.8,

mobility 5.6, function 4.9) at final followup. No patient

used any type of walking support. On 6-month anteropos-

terior radiographs of the 76 hips, the mean abduction angle

of the acetabular component was 37.6� (range, 20�–50�).

On the final radiographs of the remaining 68 hips, we found

radiolucencies around the acetabular component in Zone 1

in 20 hips, in Zone 2 in five, and in Zone 3 in four.

However, there was no osteolysis in any zone around the

acetabular component and no evidence of migration of the

acetabular component. On the femoral side, there was no

radiolucency or osteolysis in any of the hips. No patients

had heterotopic ossification. During the followup, there

were no cases of nerve palsy, deep vein thrombosis, or

pulmonary embolism.

Cumulative survival rates were calculated using the

Kaplan-Meier method with failure defined as the end point

of revision for alumina failure or for any reason. To

compare groups with and without alumina failures in age,

BMI, gender, mobility, function, abduction angle, size of

component, or the existence of radiolucent lines, we used

the nonparametric Mann-Whitney U-test. Fisher’s exact

probability test was used to compare the alumina failure

rate between polyethylene acetabular components with and

without flanges. All analyses were performed with SAS1

software (Version 9.1; SAS Institute Inc, Cary, NC).

Results

We detected four (5.6%) ceramic failures at a mean of

5.6 years (range, 3.5–6.8 years) after the index operation.

Three alumina inlays had fractured and one had dissociated

from its polyethylene-backed acetabular component

(Fig. 2); three had been revised, whereas for the remaining

one, revision surgery was intended. None of the failures

occurred during implantation or in association with trau-

matic episodes. Kaplan-Meier survival analysis revealed a

Table 1. Demographics of the 67 patients

Variable Value

Age at surgery (years)* 63 (41–87)

Gender (male/female) 7/60

Body mass index (kg/m2)*

Male patients 22.5 (16.4–30.5)

Female patients 23.3 (16.2–34.7)

Preoperative diagnosis (number of hips)

Osteoarthritis resulting from

developmental dislocation of the hip

61 (91%)

Osteonecrosis 5 (7%)

Rheumatoid arthritis 4 (6%)

Sequelae of pyogenic infection 2 (3%)

*Values expressed as mean, with range in parentheses.

1188 Iwakiri et al. Clinical Orthopaedics and Related Research

123

survival rate of 94.4% (95% confidence interval) at

6.8 years with failure defined as revision for alumina

failure and 90.7% (95% confidence interval) at 6.8 years

with revision for any reason as the end point (Fig. 3).

There were no differences in age, BMI, gender, mobil-

ity, function, abduction angle, or size of the component

between the four hips with alumina failure and the

remaining 68 hips without it (p = 0.090, 0.278, 0.512,

0.246, 0.239, 0.607, and 0.912, respectively). However, the

four cases of alumina inlay failure had radiolucent lines

(especially in Zones 1 and 2) to a greater (p = 0.046)

extent than the cases without alumina inlay failure. We

observed fretting on the stem neck in one of three fracture

cases or a dissociation case (Fig. 4). There was no differ-

ence (p = 0.307) in alumina failure rate between

polyethylene acetabular components with or without a

flange.

Discussion

Although evolution in technology has improved the

quality of alumina considerably and the risk of alumina

fracture has decreased, concerns still remain regarding

problems related to alumina. Numerous factors might be

related to alumina failure. We explored whether age,

BMI, gender, mobility, function, abduction angle, size of

component, the existence of radiolucent lines, or com-

ponent type with or without a flange were associated with

alumina failure.

Our study was limited by few patients with failure and

therefore low power: we observed four (5.6%) alumina

failures at a mean of 5.6 years (range, 3.5–6.8 years) after

the index operation.

The first alumina-on-alumina THA was performed in

April 1970 by Boutin [6]. During the last two decades, the

mechanical strength of alumina has substantially improved.

The third generation of alumina, in which the ABS cup is

classified, is hot isostatically pressed, laser-marked, and

proof-tested [2]. Compared with the first-generation alu-

mina ceramics, grain size has decreased from 4.2 to 1.8 lm

and burst strength has improved from 46 to 65 kN [2].

These advantages of alumina materials are related to its

distinctive tribologic properties resulting from high scratch

resistance and wettability of the material, both of which

reduce third-body and adhesive wear. There are three other

advantages of alumina: lower linear wear rate than metal-

on-polyethylene articulation [10]; lower concentration of

Fig. 3 Kaplan-Meier survivorship curves of 72 consecutive polyeth-

ylene-backed alumina-on-alumina THAs are shown. The 8-year

survival rate was 90.7% with revision for any reason and 94.4% with

revision for alumina failure as the end point. Dotted lines indicate the

95% confidence intervals.

Fig. 2A–B The radiographs show alumina inlay failure: (A) fracture

of the alumina inlay occurred in three hips without trauma, and (B)

dissociation of the alumina inlay from the polyethylene shell occurred

in one hip without trauma.


123

wear particles in the periprosthetic tissue around the

bearing than metal-on-polyethylene articulation [5]; and

less release of TNF-a, which is one of the main factors

inducing osteolysis, than by polyethylene particles [23].

These advantages are related to avoidance of the acetabular

osteolysis observed with alumina-on-alumina THA [13].

Osteolysis has seldom been reported after alumina-on-

alumina THA, and the few cases reported of this usually

were associated with use of a Mittelmeier total hip system

[29, 32], which is made of first-generation alumina with

large grain size, low density, and high porosity. Each of

these characteristics of first-generation alumina could have

led to the production of a large amount of debris. In

addition, this prosthesis had a poor acetabular component

design that was responsible for a rate of failure as much as

27% by the 26-month followup [21]. Meanwhile, fracture

of the alumina component is one of the disadvantages, and

it remains despite the advance in technology [1, 12, 14, 18,

22, 24, 25, 28, 30, 31].

One alumina-on-alumina THA with a cementless, press-

fit, metal-backed acetabular component yielded a survival

rate of 93.7% at 9 years with revision for any reason as the

end point without any alumina fracture [3]. However,

results observed with alumina-on-alumina THA with

cemented acetabular components rarely have been repor-

ted. The survival rate of cemented alumina-on-alumina

THA with a monoblock alumina acetabular component

for 20 years was reported as 61.2% with failure defined as

revision [13]. The main reason for revision was aseptic

loosening of the acetabular component. Loosening of the

cemented acetabular components was always an acute

event related to debonding of the alumina acetabular

component from the bone cement caused by a mechanical

phenomenon resulting from mismatch of stiffness

between the alumina component and either the bone or

cement [13].

The unique design of the polyethylene-backed acetab-

ular component with an alumina inlay (ABS cup; Kyocera)

was developed in 1998 to ensure sufficient fixation of the

alumina surface with bone cement despite mismatch in

stiffness [4, 14, 22] by using the stable fixation among

bone, cement, and polyethylene; this was used in Japan.

Although there were a few reports regarding cementless

metal-backed polyethylene-alumina composite liner, none

was available for the cemented polyethylene-backed socket

while we used this device. Therefore, we continued to

implant these components until July 2000.We observed

four alumina inlay failures (5.6%), including three frac-

tures and one dissociation, but no alumina head fractures,

and the survival rate was 94.4% when failure was revision

for alumina failure 7 years postoperatively. Cases with

alumina inlay failure had considerably more radiolucent

Fig. 4A–C Fretting by the alumina inlay on the stem neck was observed

on the radiographs of (A) a patient with dissociation and (B) a patient

with a fracture. (C) Macroscopic fretting on the stem neck is shown.


123

lines (especially in Zones 1 and 2) than cases without

failure.

There have been some reports of failures of the poly-

ethylene-alumina composite liner within a cementless

titanium alloy shell [1, 12, 14, 22, 24, 30] in which alumina

inlay dissociation and fracture were caused by impinge-

ment, microseparation, and squeeze force [14, 22, 30]. We

thus speculated the following three disadvantageous fea-

tures in this study led to alumina inlay failure in the unique

acetabular component design modification: (1) use of a

much thinner, 4-mm alumina inlay despite improved

quality of material; (2) the narrow clearance of the alumina

inlay and alumina head (5–35 lm), which generated strong

squeeze force leading to separation of the alumina inlay

from the polyethylene shell; and (3) a relatively narrow

oscillation angle, 120�, which readily produced contact

force leading to dissociation of the alumina inlay insert

from its polyethylene shell or increased the chance of

peripheral chip fracture and subsequent crack propagation

resulting from the brittle alumina material under conditions

of impingement. The radiolucent lines, observed to a

considerable extent in the four cases of alumina inlay

failure, might have been induced by large numbers of

polyethylene particles generated from the interface

between the dissociated or fractured alumina inlay and the

polyethylene shell or by high shear stress in the bone-

cement interface resulting from the strong squeeze force

generated on the alumina-on-alumina surface. In July 2000,

we discontinued use of this type of THA to avoid alumina

failure. We suggest all patients with this type of acetabular

component be followed carefully.

Cemented polyethylene-backed alumina-on-alumina

THA with a composite of alumina inlay had a relatively

high rate of catastrophic alumina inlay failure (5.6%)

during a mean of 6.7 years’ followup. We believe the

socket fixation still needs to be improved.

Acknowledgments We thank A. Kobayashi, MD, PhD, M. Ikebuchi,

MD, Y. Ohta, MD, and R. Sugama, MD, PhD, for assistance and advice

concerning polyethylene-backed, cemented, alumina-on alumina THA.

References

1. Akagi M, Nonaka T, Nishisaka F, Mori S, Fukuda K, Hamanishi

C. Late dissociation of an alumina-on-alumina bearing modular

acetabular component. J Arthroplasty. 2004;19:647–651.

2. Bierbaum BE, Nairus J, Kuesis D, Morrison JC, Ward D. Cera-

mic-on-ceramic bearings in total hip arthroplasty. Clin OrthopRelat Res. 2002;405:158–163.

3. Bizot P, Banallec L, Sedel L, Nizard R. Alumina-on-alumina

total hip prostheses in patients 40 years of age or younger. J BoneJoint Surg Br. 2004;86:190–194.

4. Boehler M, Knahr K, Plenk H Jr, Walter A, Salzer M, Schreiber

V. Long-term results of uncemented alumina acetabular implants.


5. Bohler M, Mochida Y, Bauer TW, Plenk H Jr, Salzer M. Wear

debris from two different alumina-on-alumina total hip arthro-

plasties. J Bone Joint Surg Br. 2000;82:901–909.

6. Boutin P. [Total arthroplasty of the hip by fritted aluminum

prosthesis: experimental study and 1st clinical applications]

[in French]. Rev Chir Orthop Reparatrice Appar Mot. 1972;58:

229–246.

7. Brooker AF, Bowerman JW, Robinson RA, Riley LH Jr.

Ectopic ossification following total hip replacement: incidence

and a method of classification. J Bone Joint Surg Am. 1973;55:

1629–1632.

8. Catelas I, Petit A, Marchand R, Zukor DJ, Yahia L, Huk OL.

Cytotoxicity and macrophage cytokine release induced by cera-

mic and polyethylene particles in vitro. J Bone Joint Surg Br.1999;81:516–521.

9. DeLee J, Charnley J. Radiological demarcation of cemented

sockets in total hip replacement. Clin Orthop Relat Res.1976;121:20–32.

10. Dorlot JM, Christel P, Meunier A. Wear analysis of retrieved

alumina heads and sockets of hip prostheses. J Biomed MaterRes. 1989;23(A3 suppl):299–310.

11. Gruen T, McNeice G, Amstutz H. ‘‘Modes of failure’’ of



12. Ha YC, Koo KH, Jeong ST, Joon Yoo J, Kim YM, Joong Kim

H. Ceramic liner fracture after cementless alumina-on-alumina

total hip arthroplasty. Clin Orthop Relat Res. 2007;458:106–

110.

13. Hamadouche M, Boutin P, Daussange J, Bolander ME, Sedel L.

Alumina-on-alumina total hip arthroplasty: a minimum 18.5-

years follow-up study. J Bone Joint Surg Am. 2002;84:69–77.

14. Hasegawa M, Sudo A, Hirata H, Uchida A. Ceramic acetabular

liner fracture in total hip arthroplasty with a ceramic sandwich

cup. J Arthroplasty. 2003;18:658–661.

15. Hodgkinson J, Shelley P, Wroblewski B. The correlation

between the roentgenographic appearance and operative find-

ings at the bone-cement junction of the socket in Charnley low

friction arthroplasties. Clin Orthop Relat Res. 1988;228:105–

109.

16. Merle d’Aubigne R, Postel M. Functional results of hip arthro-

plasty with acrylic prosthesis. J Bone Joint Surg Am. 1954;36:

451–475.

17. Mulliken BD, Nayak N, Bourne RB, Rorabeck CH, Bullas R.

Early radiographic results comparing cemented and cementless

total hip arthroplasty. J Arthroplasty. 1996;11:24–33.

18. Nevelos J, Ingham E, Doyle C, Streicher R, Nevelos A, Walter

W, Fisher J. Microseparation of the centers of alumina-alumina

artificial hip joints during simulator testing produces clinically

relevant wear rates and patterns. J Arthroplasty. 2000;15:793–

795.

19. Nizard RS, Sedel L, Christel P, Meunier A, Soudry M, Witvoet J.

Ten-year survivorship of cemented ceramic-ceramic total hip

prosthesis. Clin Orthop Relat Res. 1992;282:53–63.

20. Nunn D, Freeman MA, Hill PF, Evans SJ. The measurement of

migration of the acetabular component of hip prostheses. J BoneJoint Surg Br. 1989;71:629–631.

21. O’Leary JF, Mallory TH, Kraus TJ, Lombardi AV Jr, Lye CL.

Mittelmeier ceramic total hip arthroplasty: a retrospective study.


22. Park YS, Hwang SK, Choy WS, Kim YS, Moon YW, Lim SJ.

Ceramic failure after total hip arthroplasty with an alumina-on-

alumina bearing. J Bone Joint Surg Am. 2006;88:780–787.

23. Petit A, Catelas I, Antoniou J, Zukor DJ, Huk OL. Differential

apoptotic response of J774 macrophages to alumina and ultra-

high-molecular-weight polyethylene particles. J Orthop Res.2002;20:9–15.


123

24. Ravasi F, Sansone V. Five-year follow-up with a ceramic sand-

wich cup in total hip replacement. Arch Orthop Trauma Surg.2002;122:350–353.

25. Sedel L. Evolution of alumina-on-alumina implants: a review.


26. Sedel L, Nizard R, Kerboull L, Witvoet J. Alumina-alumina hip

replacement in patients younger than 50 years old. Clin OrthopRelat Res. 1994;298:175–183.

27. Skinner HB. Ceramic bearing surfaces. Clin Orthop Relat Res.1999;369:83–91.

28. Toni A, Traina F, Stea S, Sudanese A, Visentin M, Bordini B,

Squarzoni S. Early diagnosis of ceramic liner fracture: guidelines

based on a twelve-year clinical experience. J Bone Joint Surg Am.2006;88(suppl 4):55–63.

29. Wirganowicz PZ, Thomas BJ. Massive osteolysis after ceramic

on ceramic total hip arthroplasty: a case report. Clin Orthop RelatRes. 1997;338:100–104.

30. Yamamoto K, Shishido T, Tateiwa T, Katori Y, Masaoka T,

Imakiire A, Clarke IC. Failure of ceramic THR with liner

dislocation: a case report. Acta Orthop Scand. 2004;75:

500–502.

31. Yoo JJ, Kim YM, Yoon KS, Koo KH, Song WS, Kim HJ.

Alumina-on-alumina total hip arthroplasty: a five-year mini-

mum follow-up study. J Bone Joint Surg Am. 2005;87:

530–535.

32. Yoon TR, Rowe SM, Jung ST, Seon KJ, Maloney WJ. Osteolysis

in association with a total hip arthroplasty with ceramic bearing

surfaces. J Bone Joint Surg Am. 1998;80:1459–1468.


123

ORIGINAL ARTICLE

Late Hardware-induced Sciatic Nerve Lesions After AcetabularRevision

Martti Vastamaki MD, PhD, Pekka Ylinen MD, PhD,

Asko Puusa MD, Timo Paavilainen MD

Received: 3 September 2007 / Accepted: 4 February 2008 / Published online: 26 February 2008


Abstract We encountered late hardware-induced sciatic

nerve lesions after acetabular revision in six patients. There

were five female patients and one male patient. The mean

age of the patients at the time of index acetabular revision

was 59.3 years (range, 42–76 years). The interval from the

index acetabular revision to the onset of sciatic nerve

symptoms averaged 9.4 months (range, 4–16 months) and

that from the onset of symptoms to nerve release was

11.3 months (range, 8–13 months), except in two patients

with intermittent symptoms in which it was 9 and

10.5 years, respectively. Sciatic nerve release was suc-

cessful in two patients, but in four patients, the nerve had

been partly or entirely cut by the metallic hardware

resulting in a permanent deficit. The minimum followup

was 2 years (mean, 4 years; range, 2–7 years). Mechanical

irritation should be suspected in the case of any late sign of

peroneal neuropathy after acetabular revision with a mac-

rocup or antiprotrusion device, and plate fixation of the

posterior column. We recommend exploration and nerve

release before a permanent lesion of the nerve has

developed.

Level of Evidence: Level II, prognostic study. See the


of evidence.

Introduction

Nerve lesions after hip arthroplasty are disabling compli-

cations occurring in 0.06% to 2.2% of arthroplasties [4, 7,

10–12, 16]. Most of them are surgery-related and occur

during the procedure or are delayed by a few days [9],

especially when caused by a hematoma [2, 6]. Late nerve

lesions are uncommon and are reported only sporadically

[3, 5]. Late hardware-induced sciatic nerve complications

are rarely reported [1, 8, 14]. In three such reports, a

migrated fragment of a Kirschner wire violated the sciatic

nerve 6 years after THA [1], the posterior flange of a pro-

trusion ring cut the sciatic nerve 3 months after THA [8],

and a loose screw after pelvic reconstruction with a plate

caused sciatic nerve entrapment 6 months after THA [14].

We report six cases in which metallic hardware used for

acetabular revision caused severe late problems to the

sciatic nerve.


From 1991 to 1998, we performed 1570 hip revision ar-

throplasties in our hospital. Acetabular revision was

included in approximately 90% of the patients. According

to our practice, the loosened acetabular cup was replaced

by a larger porous-coated press-fit cup whenever possible,

combined with autogeneic or allogeneic bone transplanta-

tion for the cavitary defects. In cases with more severe

segmental defects, we used a reinforcement device with






human protocol for this investigation, and that all investigations were


M. Vastamaki, P. Ylinen, A. Puusa, T. Paavilainen

ORTON Orthopaedic Hospital, Invalid Foundation, Helsinki,

Finland

M. Vastamaki (&)

Elotie 1 A 2, Kaarina 20780, Finland


123


DOI 10.1007/s11999-008-0176-9

allogeneic cancellous bone graft. The Burch-Schneider ring

(Sulzer Medica AG, Winterthur, Switzerland) was most

popular during that period. Plate fixation of the posterior

column also was performed in the patients with a posterior

column fracture or pelvic discontinuity. We encountered

late hardware-induced sciatic nerve lesions in six patients

(0.4%). There were five female patients and one male

patient. The mean age of the patients at the index acetab-

ular revision was 59.3 years (range, 42–76 years). The

interval from the index acetabular revision to the onset

of symptoms averaged 9.4 months (range, 4–16 months)

and that from the onset of symptoms to nerve release was

11.3 months (range, 8–13 months). In two patients,

symptoms were intermittent, and surgery was scheduled 9

and 10.5 years, respectively, after the onset of symptoms.

All patients reported pain and numbness in the peroneal

area of the ipsilateral lower limb, and peroneal weakness.

Some kind of local pain at the hip level also was present.

The minimum followup was 2 years (mean, 4 years; range,

2–7 years).

Patient 1

In 1984, a 40-year-old woman had an uneventful THA

resulting from congenital hip dysplasia-induced arthritis.

She did not have previous hip surgery. She did well for

5 years postoperatively, but in 1991, revision was per-

formed because of loosening of an uncemented threaded

cup. A macrocup (68-mm Universal1; Biomet, Inc,

Warsaw, IN) was implanted. One year after the revision

surgery, the patient reported slight radicular pain in her leg

on the surgically treated side, and in 1994, electroneur-

omyography (ENMG) showed slight neurogenic findings in

the muscles innervated by the peroneal division of the

sciatic nerve at the level of the hip but no clear injury of the

sciatic nerve. She did quite well and could walk 2 to 3 km

without difficulties but still reported slight sporadic sciatic

pain. In 2001, the patient experienced temporary severe

numbness and fatigue in her leg. Electroneuromyography

showed slight to moderate neurogenic findings in the

muscles innervated by the peroneal division of the sciatic

nerve. The injury was localized at the level of the hip. The

plain hip radiographs were interpreted as normal. Magnetic

resonance imaging of the lumbar spine showed only pre-

sacral protrusion. Sciatic nerve exploration was postponed

because the symptoms resolved spontaneously. In 2003,

12 years after the cup revision, disabling sciatic nerve

symptoms recurred. Radiographs were interpreted as nor-

mal (Fig. 1). However, sciatic nerve injury was apparent

on ENMG, and surgery was scheduled. The sciatic nerve

was tightly adherent to the corner of the macrocup and

severely entrapped (Fig. 2). The nerve was released, and a

connective tissue flap was developed between the ring and

the nerve (Fig. 3). No resection of the corner of the mac-

rocup was performed to avoid excessive metallic debris

formation during the procedure. Sciatic pain resolved, and

2 months after surgery, the patient was free of symptoms.

Patient 2

A 59-year-old woman with rheumatoid disease since 1974

had acetabular revision performed in 1996 with a Burch-

Schneider ring. Primary THA was performed in 1989.

During the next 2 years after the revision, a slight peroneal

paresis developed. In December 2005, she experienced

severe radicular pain in her ipsilateral lower limb. Lumbar

MRI was normal. On plain radiographs, the distal part of

Fig. 1 A radiograph of Patient 1 taken 12 years after a macrocup

revision arthroplasty was interpreted as normal. The arrow shows the

anatomic location prone to nerve lesion.

Fig. 2 A photograph shows an impingement of the sciatic nerve

(CHIA) caused by the edge of the acetabular macrocup and scar tissue

in Patient 1.

1194 Vastamaki et al. Clinical Orthopaedics and Related Research

123

the plate seemed loose (Fig. 4). Electroneuromyography

suggested a sciatic nerve lesion at the level of the hip; the

peroneal division was severely injured and the tibial divi-

sion moderately injured. In surgery, the distal half of the

plate was loose, the sciatic nerve was adherent to the plate

at the joint level, and there were metallosis and severe

damage of the nerve induced by the corner of the Burch-

Schneider ring. The nerve was released without any

attempt at reconstruction (Fig. 5). The Burch-Schneider

ring was refixed, and the posterior fracture was recon-

structed with a titanium plate (LCP1 Reconstruction Plate,

Synthes AG, Solothurn, Switzerland) and a titanium mesh,

also using bone transplants. After that, the nerve was

protected with a substantial amount of subcutaneous fat

tissue between the reconstruction plate and the nerve. The

pain resolved, but the peroneal paresis did not recover.

Patient 3

In 1996, a 65-year-old man underwent acetabular revision

with a Burch-Schneider ring. Total hip arthroplasty

resulting from primary arthrosis had been performed

10 years earlier. The patient was free of symptoms for

1 year, but the plate was broken. After 2 years, he was still

free of symptoms. No cup migration was detected, and

bone healing was good. In 2000, the patient reported some

pain and numbness in the peroneal area of the ipsilateral

lower limb. Peroneal weakness was detected. Electro-

neuromyography showed severe nerve injury in the

muscles and nerves innervated by the peroneal division of

the sciatic nerve. The nerve lesion was localized at the

level of the hip. At surgery in 2000, the broken end of the

plate had violated the peroneal division of the sciatic nerve;

approximately 1.3 of the nerve was lacerated. The broken

plate was removed, and the nerve was released but not

reconstructed because of the chronic lesion, the age of the

patient, and the long distance to the muscles. The pain

remitted, but the patient had marked peroneal palsy at the

1-year clinical followup, which remained when the patient

was interviewed by telephone 7 years later.

Fig. 3 A connective tissue flap (arrows) was developed between the

acetabular shell and the nerve shown in Figure 2.

Fig. 4 A radiograph of Patient 2 taken 9 years after acetabular

revision with a Burch-Schneider ring shows some loosening of the

distal plate. The arrow shows the level of the nerve injury.

Fig. 5 The sciatic nerve was severely damaged at the joint level by

the Burch-Schneider ring (arrow) in Patient 2. The picture was taken

after reconstruction of the posterior column fracture and before

creation of a protective connective tissue flap.

Volume 466, Number 5, May 2008 Hardware-induced Sciatic Nerve Lesions 1195

123

Patient 4

In 1991, a 67-year-old woman had acetabular revision

using a 62-mm Universal1 cup. The primary THA was

performed in 1984 with a Lord prosthesis (Benoist Girard,

Bagneoux, France) as a result of osteoarthrosis. Nine

months after the acetabular revision, hip pain developed,

and during the next 3 months, peroneal palsy appeared.

Electroneuromyography showed a severe lesion of the

peroneal division of the sciatic nerve at the level of the hip

and moderate changes in the tibial division. Surgery was

performed within a few months in 1993. The sharp corner

of the metallic acetabular shell had cut the sciatic nerve

almost entirely. The nerve was only released. After 4 years,

her neuromotor symptoms and signs were unchanged.

Patient 5

In 1996, a 76-year-old woman underwent acetabular revi-

sion with a Burch-Schneider ring 14 years after her

primary THA. Four months after the revision surgery,

sciatic pain developed. There was no muscular weakness.

In May 1997, ENMG showed moderate neurogenic find-

ings, but it was impossible to differentiate the findings

between L5 nerve root lesion and injury of the peroneal

division of the sciatic nerve. Spinal causes of the nerve

lesion were excluded by computed tomography, and the

pain resolved to some extent. However, during the next few

months, peroneal paresis developed, and 1 year after the

index surgery, ENMG showed progression of the nerve

injury in the peroneal division of the sciatic nerve. There

were also slight findings in the muscles innervated by the

tibial division. The nerve lesion could now be localized at

the hip level. At surgery 1 year after acetabular revision,

the sharp corner of the Burch-Schneider plate had cut the

peroneal division of the sciatic nerve. The nerve was

released, and neurorraphy of the peroneal division was

performed by a younger colleague. The pain resolved, but

no recovery was detected during the next 4 years before

her death resulting from unrelated causes.

Patient 6

In 1998, a 42-year-old woman had acetabular revision

with a Burch-Schneider ring. Her primary THA was

performed in 1982 as a result of Perthes disease, and

successive acetabular revisions then were performed in

1989, 1994, and 1995 as a result of recurrent dislocations.

She also had iatrogenic injury of the superior gluteal

nerve diminishing the abduction strength of the hip. The

patient began to report some pain from 2002 to 2004 in

her ipsilateral lower extremity, and acetabular revision

was again scheduled in 2004 as a result of loosening of

the cup. During surgery, the broken distal plate of the

Burch-Schneider ring was removed, and the sciatic nerve

was released. The sciatic nerve was severely tethered to

the broken plate and compressed by the plate and scar

tissue. Postoperatively, Grade 3/5 peroneal palsy was

detected, but it recovered substantially during the next

3 years. In all likelihood, the patient was treated before

severe damage of the sciatic nerve had developed from

the hardware.

Discussion

A clinical neurologic deficit is not uncommon after THA,

occurring in 0.06% to 2.2% of arthroplasties [1, 4, 7, 10–

12, 16]; many are related to hematomas or technical errors.

In the series of 4339 THAs performed at our institute, we

have observed only 27 sciatic nerve lesions (0.6 %) [11]. In

another series of 3126 THAs, 42 sciatic nerve lesions

occurred (1.3 %) [12]. Few articles describe late neuropa-

thies, especially those induced by hardware. Masses from

particulate debris related to acetabular loosening [5] and

migration of a trochanteric wire after THA [1] can cause

late sciatic neuropathy. An acetabular reinforcement ring

has been reported to cause impingement of the sciatic nerve

between the dorsal aspect of the acetabular reinforcement

ring and scar tissue [13]. We detected similar findings in

two patients (Patients 1 and 4). In one reported case [8], an

antiprotrusion ring caused a sciatic nerve lesion 3 months

after THA when the patient fell on his involved hip. The

sciatic nerve was cut through by approximately 1.3 appar-

ently by the prominent edge of the nonanatomic

antiprotrusion ring [8]. The nerve was released approxi-

mately 10 cm proximally and distally from the hip and

protected using a posterior third of the gluteus medius [8].

Our Patients 2, 3, and 5 showed similar lesions of the

sciatic nerve. In another case [14], a loose screw of the

reconstruction plate after THA caused sciatic nerve prob-

lems 6 months after surgery. Screw removal and nerve

release 6 months after the onset of symptoms enabled

substantial improvement in clinical symptoms [14]. We

observed similar findings in one of our patients (Patient 6).

It is important to recognize the cause of symptoms even

years after THA and especially after acetabular revision.

Our first patient was fortunate enough to be treated before a

permanent lesion had developed. Also, Patient 6 had sur-

gery early enough as a result of the need for revision

arthroplasty. At an early stage, it may be difficult to dis-

tinguish between spine- and hip-related causes of

symptoms, and therefore lumbar imaging modalities might

be necessary. We did not find in our material any alerting

1196 Vastamaki et al. Clinical Orthopaedics and Related Research

123

radiographic signs, except breakage or loosening of a

reconstruction plate.

Mechanical irritation should be suspected in cases of

any late sign of peroneal neuropathy after acetabular

revision with a macrocup or antiprotrusion device and after

plate fixation of the posterior column. In posterior column

fractures, we have used a locking compression titanium

reconstruction plate with combined holes. A straight plate

is bent to meet the anatomy of the posterior wall of the

acetabulum. A reconstruction plate seems to cause a bigger

risk to bring about nerve problems than a macrocup. Ten to

15 years ago, we used antiprotrusion ring, macrocup, or

plate fixation only in approximately 10% of all acetabular

revision cases. If the posterior acetabular wall is so

defective that a macrocup extends over the bone rim, the

risk seems greater. The most susceptible place for nerve

injury is the posterior lateral corner of the macrocup or

reconstruction plate in the proximal part of the posterior

acetabular wall.

The sciatic nerve should always be identified during

THA, preferably by palpation [15]. We now routinely

expose the sciatic nerve during revision surgery and

develop a protecting connective tissue flap between the

nerve and hardware if needed. Ten years ago, that was not

routine. We have not observed any adverse effects with

nerve exposure, although harmful irritation by hardware

would be possible, especially without connective tissue flap

protection.

One should always keep in mind the potential risk for

nerve entrapment or lesion when using antiprotrusion

devices or when a posterior column has been reconstructed,

and moreover, if a macrocup has been used in acetabular

reconstruction. In the case of sciatic nerve symptoms,

careful repetitive ENMG examinations are mostly decisive.

Exploration and nerve release should be performed before

a permanent lesion of the nerve has developed. We rec-

ommend using a connective tissue flap between the sciatic

nerve and metallic hardware to minimize the risk of late

nerve lesions.

References

1. Asnis SE, Hanley S, Shelton PD. Sciatic neuropathy secondary to

migration of trochanteric wire following total hip arthroplasty.


2. Cohen B, Bhamra M, Ferris BD. Delayed sciatic nerve palsy fol-

lowing total hip arthroplasty. Br J Clin Pract. 1991;45:292–293.

3. Edwards MS, Barbaro NM, Asher SW, Murray WR. Delayed

sciatic palsy after total hip replacement: case report. Neurosur-gery. 1981;9:61–63.

4. Eftekhar NS, Stinchfield FE. Experience with low-friction

arthroplasty: a statistical review of early results and complica-

tions. Clin Orthop Relat Res. 1973;95:60–68.

5. Fischer SR, Christ DJ, Roehr BA. Sciatic neuropathy secondary

to total hip arthroplasty wear debris. J Arthroplasty. 1999;14:

771–774.

6. Fleming RE Jr, Michelsen CB, Stinchfield FE. Sciatic paralysis: a

complication of bleeding following hip surgery. J Bone JointSurg Am. 1979;61:37–39.

7. Johanson NA, Pellicci PM, Tsairis P, Salvati EA. Nerve injury in

total hip arthroplasty. Clin Orthop Relat Res. 1983;179:214–222.

8. McLean M. Total hip replacement and sciatic nerve trauma.

Orthopedics. 1986;9:1121–1127.

9. Navarro RA, Schmalzried TP, Amstutz HC, Dorey FJ. Surgical

approach and nerve palsy in total hip arthroplasty. J Arthroplasty.

1995;10:1–5.

10. Oldenburg M, Muller RT. The frequency, prognosis and signifi-

cance of nerve injuries in total hip arthroplasty. Int Orthop.

1997;21:1–3.

11. Pekkarinen J, Alho A, Puusa A, Paavilainen T. Recovery of

sciatic nerve injuries in association with total hip arthroplasty in

27 patients. J Arthroplasty. 1999;14:305–311.

12. Schmalzried TP, Amstutz HC, Dorey FJ. Nerve palsy associated

with total hip replacement: risk factors and prognosis. J BoneJoint Surg Am. 1991;73:1074–1080.

13. Schuh A, Riedel F, Cralovan B, Zeiler G. Verzogerte Lasion des

Nervus ischiadicus nach Totalendoprosthesenimplantaion des

Huftgelenkes mit Stutzringosteosynthese. Zentralbl Chir. 2003;

128:871–873.

14. Stiehl JB, Stewart WA. Late sciatic nerve entrapment following

pelvic plate reconstruction in total hip arthroplasty. J Arthro-plasty. 1998;13:586–588.

15. Vastamaki M, Paavilainen T. Preventing neurologic complica-

tions of total hip arthroplasty. Complications in Orthopaedics.

1991;6:147–151.

16. Weber ER, Daube JR, Coventry MB. Peripheral neuropathies

associated with total hip arthroplasty. J Bone Joint Surg Am.

1976;58:66–69.

Volume 466, Number 5, May 2008 Hardware-induced Sciatic Nerve Lesions 1197

123

ORIGINAL ARTICLE

The Width:thickness Ratio of the Patella

An Aid in Knee Arthroplasty

Farhad Iranpour MD, Azhar M. Merican MS (Orth),

Andrew A. Amis DSc (Eng), Justin P. Cobb MCh, FRCS

Received: 4 September 2007 / Accepted: 10 January 2008 / Published online: 11 March 2008


Abstract Establishing the appropriate size of the patellar

implant-bone composite is one of the important steps

ensuring functional success in arthroplasty. Convention-

ally, the patella is measured intraoperatively and its

thickness is used to guide the depth of resection. However,

in a diseased joint, this may not reflect the native patellar

thickness. We studied the relationship between the patellar

thickness and various patellar dimensions on three-

dimensional reconstructed computed tomographic scans

from 37 normal adult knees. Patellar width correlated with

thickness. The average patellar width:thickness ratio was

2.0 (standard deviation, 0.106; 95% confidence interval,

1.96–2.03). The cartilage thickness was on average 2.5 mm

(standard deviation, 1.0). The width:thickness ratio was

similar in 79 digital radiographs taken before TKA of

knees without patellofemoral disease (mean, 2.1; standard

deviation, 0.28). When compared with the two other

methods for calculating patellar resection described in the

literature, the width:thickness ratio was more reliable. The

width:thickness ratio appears anatomically constant and

may be a useful guide for estimating premorbid patellar

thickness.

Introduction

For surgeons who choose to resurface the patella,

establishing appropriate thickness of the patellar implant-

bone composite during knee arthroplasty is important to

optimize the patellofemoral joint kinematics and to balance

its soft tissues [2]. Knee range of motion can be decreased

by an increased thickness of the patellar prosthesis-bone

composite after knee arthroplasty [5]. Other detrimental

effects of overstuffing the patellofemoral joint, such as

lateral patellar subluxation, increased patellofemoral con-

tact pressure on the lateral condyle, and increased

patellofemoral compression forces, have been reported in

laboratory studies [8, 10, 21].

Surgeons tend to avoid overstuffing the patellofemoral

joint by resecting the amount of bone that corresponds to

the thickness of the patellar implant. In other words, the

final patellar bone-prosthesis composite thickness is

intended to match the original patellar thickness before

surgery. However, the thickness is difficult to estimate

when it has been reduced substantially by the wearing

process. In advanced cases, the patella may be excavated

and the median ridge altered. In the most severe cases, the

patella will be quite thin and will not reflect the original

thickness.

The preresection thickness of the patella typically is

measured as the anteroposterior dimension from the anterior

surface of the patella to the deepest part of the median ridge

of the patella [18]. To address patellae with marked articular

surface wear, two principal methods of reconstructing the









F. Iranpour (&), A. M. Merican, J. P. Cobb

Division of Surgery, Oncology, Reproductive Biology

and Anaesthetics, Imperial College London, 7th Floor, Charing

Cross Hospital, Fulham Palace Road, London W6 8RF, UK


A. A. Amis

Biomechanics Division, Mechanical Engineering Department,

Imperial College London, London, UK

123


DOI 10.1007/s11999-008-0130-x

patella without reference to the articular surface have been

described: (1) the lateral facet subchondral bone thickness

method [9, 18], in which all bone that is farther from the

anterior surface than the shallowest part of the patella –

typically on the lateral facet - is resected, and (2) the tendon-

capsule method, in which all bone is resected deep to the

posterior limit of the quadriceps tendon and the patellar

tendon attachment [12, 13, 15] or the capsular attachment

onto the patella [4].

We first asked whether a reliable relationship could be

found between the thickness of the patella and any of its

other dimensions that might allow the native thickness of a

worn patella to be predicted from the nonarticular parts.

Secondarily we asked whether any predictive method we

explored would be superior to the two described in the

literature.


We obtained 37 computed tomographic (CT) scans of

knees from 21 female and 16 male patients older than

55 years (range, 55–70 years) without patellofemoral dis-

ease from the contralateral knees of active people whose

other knee was part of a study of unilateral medial com-

partmental arthritis. Computed tomographic scans were

obtained using an established protocol that reduced the

total radiation exposure to 0.7 mSev, the same radiation

dose as for a long-leg standing film [7]. Three-dimensional

images were reconstructed using computer software; the

surface models enabled manipulation of the images and

measurements.

A robust method for aligning the patella was necessary

to produce reliable and reproducible measurements. The

anterior surface of the patella was established by fitting a

plane to multiple points on this surface. We aligned the

patella with this plane vertically and the most posterior

points in seven axial images from superior to inferior were

used to define the deepest points on the median ridge. The

patellar median ridge was simplified by fitting a line to

these points. After aligning the patella with the anterior

plane horizontal and the median ridge line in screen, the

patellar thickness was measured from the anterior surface

of the patella to the median ridge at the proximodistal

center of the median ridge. At this level, the patellar width

was measured. We also made measurements of the patellar

length, lateral:medial facet ratio, and length of the median

ridge (Fig. 1).

To establish precision of the measurements, we

determined the agreement between two different observers

for patellar width and thickness in 20 measurements. We

assessed interobserver agreement by Bland-Altman graphs

and intraclass correlation coefficient [11, 17] for 27 knees.

The intraclass correlation coefficient was 0.95 and 0.97

for the thickness and width, respectively. We found no

systematic biases between observers and the difference

between the readings from both observers was 0.04

(standard deviation [SD], 1.07) and 0.2 mm (SD, 0.78) for

width and thickness, respectively.

The patella can be resected at the level of the deep limit

of the quadriceps tendon attachment and nearly posterior to

the attachment of the patellar tendon (tendon method) [15]

or at the level of the subchondral bone of the lateral facet

(subchondral method) [9, 18]. However, neither of these

Fig. 1A–H Three-dimensional images were reconstructed from CT

scans of the knees in extension; software generates all figures

automatically. (A) Posterior reconstruction with the black arrow

shows the length of the medial ridge; (B) the sagittal view with the

white arrow shows the length of the patella; (C) axial and (D) coronal

views with two-headed arrows show the widths of the medial and

lateral facets; (E) sagittal reconstruction is shown; (F) an axial view

with a black line shows patellar width; (G) a coronal view shows...;

and (H) this sagittal view with white line shows patellar thickness.

Volume 466, Number 5, May 2008 The Width:thickness Ratio of the Patella 1199

123

methods is precise in relation to the depth of the patella. To

virtually reproduce the tendon method, we used a sagittal

image at the median ridge to locate the posterior (deep)

limit of the quadriceps tendon by noting when the

Hounsfield units just outside the bone changed from fat to

fascia-tendon (Fig. 2). To virtually reproduce the sub-

chondral bone method, after aligning the patella with the

anterior surface horizontally, the axial image at the center

of the median ridge was used to define a plane parallel to

the anterior surface but just down to the subchondral bone

of the lateral facet (Fig. 3). We then measured the thick-

ness of the patellar bone to be resected using these two

methods as references for the depth of patellar resection.

We determined the cartilage thickness at the point from

which the patellar bony thickness was measured. This was

possible on a CT scan because, in the extended relaxed

knee, the articular surface of the patella rests on the

supracondylar area with intervening fat between it and the

underlying femur. Thus, the fat-cartilage junction was

located where the Hounsfield unit changes from negative

(fat) to positive (cartilage).

In addition, we studied the preoperative axial

radiographs of 79 patients undergoing TKA. These patients

had minimal radiographic changes of their patellofemoral

joint. We measured the bony width and thickness of the

patella on a digital axial radiograph using Centricity1

Picture Archiving and Communication Systems (PACS)

3.0 software (GE Healthcare, Chalfont St Giles, UK).

We used Spearman’s rho correlation to ascertain any

relationships between patellar thickness and the other

measurements (patellar width, patellar length, patellar

ridge length). We used the Statistical Package for Social

Sciences (SPSS) Version 13 (SPSS Inc, Chicago, IL).

Results

Patellar thickness correlated (r = 0.89, p \ 0.001) with

its width (Tables 1, 2; Fig. 4). The ratio of the width of

the patella to the thickness was 2.0 ± 0.106 (mean ± SD)

(95% confidence interval, 1.96–2.03). At the point from

which the thickness of the patella was measured, the

mean cartilage thickness was 2.5 ± 1.0 mm (95% confi-

dence interval, 1.8–3.70 mm). However, we found no

correlation between the length and width of the patella or

the length and thickness of the patella (Table 2). The

average ratio of the lateral facet to medial facet width was

1.3 (range, 0.8–1.6).

The width:thickness ratio was the most reliable of the

three ways of restoring native thickness in normal knees.

The alternative methods based on the lateral facet or the

tendon attachments were substantially less reliable in

Fig. 2A–D These images illustrate the method of resecting the

patella at the level of the quadriceps tendon attachments (tendon-

capsule method). (A) A sagittal reconstruction is shown; (B) an axial

image with the two-headed black arrow shows the amount to be

resected; (C) a coronal view at the level of the patellar tendon is

shown; and (D) a sagittal image with a two-headed black arrow shows

the amount to be resected; the attachment of the patella tendon also

can be seen.

Fig. 3A–D These images show the method to simulate resection of

the patella at the level of the subchondral bone of the lateral facet. (A)

A sagittal reconstruction is shown; (B) an axial image with a two-

headed black arrow shows the amount to be resected; (C) a coronal

view shows the subchondral bone of the lateral facet; and (D) a

sagittal image with a two-headed black arrow shows the amount to be

resected.

1200 Iranpour et al. Clinical Orthopaedics and Related Research

123

restoring normal patella thickness when a single thickness

of patella implant was used (Fig. 6). When comparing the

three methods, the width:thickness ratio allowed the native

thickness to be restored with an average of 0.1 mm and a

standard deviation of 1 mm. On average, the tendon

method removed 7.5 mm of bone and the subchondral

method removed 9.4 mm of bone (Table 3). The influence

of these methods on the final thickness of the bone-

prosthesis composite depends on the range of components

available. The ratio of patellar width:thickness measured

on axial radiographs was on average 2.1. The correlation

between width and thickness of the patella was good

(r = 0.63, p \ 0.001) (Fig. 5). The variability of this ratio

in the study group was small (SD, 0.28; 95% confidence

interval, 2.07–2.19).

Discussion

The disadvantages of overstuffing the patellofemoral joint

are well recognized [2, 5, 8, 10, 21]. In addition, a thin

patella resulting from over-resection has had poor strain

characteristics, which may contribute to early failure [14,

19]. Our primary aim was to investigate whether a reliable

relationship could be found between the thickness of the

patella and any of its other dimensions. Our secondary aim

was to determine whether our predictive method was more

accurate in reproducing patellar thickness than the two

main methods previously described.

The major shortcoming of this study is the fact that these

scans were obtained from patients whose other knee had

medial compartment osteoarthritis. This potentially will

bias our findings because medial osteoarthritis is a common

variant that is usually symmetric. However, these knees

had not yet succumbed to obvious osteoarthritis by their

sixth decade, although some early changes may be devel-

oping. We measured only patellae whose articular cartilage

remained of normal thickness in active people older than

55 years, so we believe the patellae were essentially nor-

mal. The study is essentially preclinical: we were not

measuring these distances in the operating theater. We used

CT scans rather than radiographs for clinical measure-

ments. However, the method, based on reliably oriented

patellae in three dimensions, is likely to be as accurate as

any method using calipers because there is user variability

in the use of manual measurement devices and intervening

soft tissue can overestimate dimensions. Measurements

obtained in this study, based on three-dimensional images

and the use of Hounsfield units to correctly identify bony

limits, further improve the repeatability of this observation.

This is reflected in the agreement between observers.

The width of the patella appears to be a reliable

indicator for predicting normal patellar thickness. We

found, for normal patellae unaffected by erosive disease

changes, the thickness was ½ of the maximum width. This

simple ratio is independent of damage to the articular

surface and may help the surgeon when deciding on the

thickness of the patella-prosthesis composite during

arthroplasty. The relationship between patellar thickness

and width has not been described, and the low variability in

this measurement is surprising. Two other recent studies

Table 1. Patellar dimensions of 37 knees

Dimensions Mean Standard deviation Range 95% Confidence intervals

Width (mm) 44.8 4.8 36.8–53 43.2–46.4

Thickness (mm) 22.4 2.3 18.4–27.3 21.7–23.2

Length (mm) 34.3 3.8 24.3–39.2 33.0–35.5

Ridge length (mm) 23.7 2.3 18.7–28.6 22.9–24.5

Table 2. Correlation coefficients for patellar dimensions of 37 knees

Dimensions Ridge length Length Thickness Width

Width 0.68* 0.40 0.89* 1

Thickness 0.52* 0.22 1

Length 0.65* 1

Ridge length 1

* Highly significant correlation.

54.0051.0048.0045.0042.0039.0036.00Width

28.00

26.00

24.00

22.00

20.00

18.00

Th

ickn

ess

Fig. 4 The regression line shows the relationship when patellar width

was 2.0 times patellar thickness. There was a strong relationship

between the patellar thickness and its width (r = 0.89, p \ 0.001;

thickness = 0.44; width + 2.8).


123

that measured dimensions of the patella during surgery

reported width and thickness [1, 20]. They did not report a

ratio, but if one were to calculate a ratio based on their

average measurements, it would be comparable to ours.

Moreover, they did not emphasize the reliable and constant

relationship nor did they highlight its usefulness.

The width:thickness ratio was more reliable than the

two published conventional methods, especially when

the median ridge is considerably worn away by disease, the

feature most commonly used by surgeons to gauge the

preresection thickness. The alternative methods based on

the lateral facet or the tendon attachments were substan-

tially less reliable in restoring normal patella thickness

when a single thickness of patella implant was used (Fig. 6).

The simple 2:1 ratio for estimating the patellar thickness

from its width does not take into account the thickness of

the patellar cartilage. The patellar cartilage thickness is

approximately 4 mm [3, 6], although there is progressive

thinning after the age of 50 years [16], presumably a nor-

mal aging process. The cartilage thickness in patients in

our CT-based study was on average 2.5 mm and one pos-

sible reason may be all of these patients were older than

60 years. This is more reflective of the population who

undergo knee arthroplasty. Therefore, strictly speaking, to

restore normal patellar thickness, 2.5 mm should be added

to ½ the width of the patella. However, if one considers the

ideal thickness of the cement mantle and the fact that

cartilage is more compressible than the prosthesis, it may

be more practical to use the original ratio [6, 7, 9, 12, 21].

The width:thickness ratio of the patella is not the only

variable in reconstructing the patella during arthroplasty; it

clearly will be impacted by different designs of femoral

trochlea and patellar button, which more or less reproduce

the natural morphologic features. In grossly abnormal

patellofemoral joints, such as those with primary patel-

lofemoral arthritis secondary to trochlea dysplasia, we do

not yet know whether changing an abnormal patella into

one with a normal width:thickness ratio is desirable or

appropriate. In these difficult cases, there is a real risk of

overstuffing the joint, but this ratio gives the surgeon some

numeric ground rules to start from. However, the majority

of patellae resurfaced in the course of total condylar knee

arthroplasty will not have substantial morphologic disor-

ders of the patellofemoral joint. For these cases, a

width:thickness ratio of 2 may be a starting point on which

to base decisions in reconstructive surgery of the patella.

Acknowledgments We thank Dr. Robin Richards for technical

support and designing the three-dimensional image analysis software

that was used in this study.

Table 3. Thickness of the resected part of the patella

Method of resection Mean (mm) Standard deviation Range 95% Confidence intervals

Subchondral bone of the lateral facet 9.4 1.4 13–6.3 8.9–9.8

Quadriceps tendon 7.5 1.4 5.3–10.3 7.0–7.9

65.060.055.050.045.040.035.0

Width

35.0

30.0

25.0

20.0

15.0

10.0

Th

ickn

ess

Fig. 5 Patellar thickness and width were measured from digital axial

radiographs of 79 knees. There was good correlation between the

patellar thickness and its width (r = 0.63, p \ 0.001; thick-

ness = 0.40; width + 4.0). Method UsingWidth:thickness Ratio

Lateral FacetMethod

Quadriceps TendonMethod

2.5

0.0

-2.5

Ove

rstu

ff (

mm

)U

nd

erst

uff

(m

m)

Patellar Resection Using Three Methods

Fig. 6 This box plot shows the postoperative thickness of the patella

using each method and a 9-mm patella prosthesis.

1202 Iranpour et al. Clinical Orthopaedics and Related Research

123

References

1. Baldwin JL, House CK. Anatomic dimensions of the patella

measured during total knee arthroplasty. J Arthroplasty.2005;20:250–257.

2. Bengs BC, Scott RD. The effect of patellar thickness on intra-

operative knee flexion and patellar tracking in total knee

arthroplasty. J Arthroplasty. 2006;21:650–655.

3. Cohen ZA, Mow VC, Henry JH, Levine WN, Ateshian GA.

Templates of the cartilage layers of the patellofemoral joint and

their use in the assessment of osteoarthritic cartilage damage.

Osteoarthritis Cartilage. 2003;11:569–579.

4. Fitzpatrick C, FitzPatrick D, Lee J, Auger D. Statistical analysis

of patellar resurfacing in Caucasian and Japanese subjects.

J Biomech. 2006;39(suppl 1):519.

5. Greenfield MA, Insall JN, Case GC, Kelly MA. Instrumentation

of the patellar osteotomy in total knee arthroplasty: the rela-

tionship of patellar thickness and lateral retinacular release. Am JKnee Surg. 1996;9:129–131; discussion 131–132.

6. Hardy PA, Nammalwar P, Kuo S. Measuring the thickness of

articular cartilage from MR images. J Magn Reson Imaging.2001;13:120–126.

7. Henckel J, Richards R, Lozhkin K, Harris S, Baena FM, Barrett

AR, Cobb JP. Very low-dose computed tomography for planning

and outcome measurement in knee replacement: the Imperial

knee protocol. J Bone Joint Surg Br. 2006;88:1513–1518.

8. Hsu HC, Luo ZP, Rand JA, An KN. Influence of patellar thickness

on patellar tracking and patellofemoral contact characteristics

after total knee arthroplasty. J Arthroplasty. 1996;11:69–80.

9. Insall JN. Surgical techniques, instrumentation in total knee

arthroplasty. In: Insall JN, ed. Surgery of the Knee. New York,

NY: Churchill Livingstone; 1993:767–768.

10. Jiang CC, Chen CH, Huang LT, Liu YJ, Chang SL, Wen CY, Liu

TK. Effect of patellar thickness on kinematics of the knee joint.

J Formos Med Assoc. 1993;92:373–378.

11. Lamraski G, Monsaert A, De Maeseneer M, Haentjens P. Reli-

ability and validity of plain radiographs to assess angulation of

small finger metacarpal neck fractures: human cadaveric study.

J Orthop Res. 2006;24:37–45.

12. Ledger M, Shakespeare D, Scaddan M. Accuracy of patellar

resection in total knee replacement: a study using the medial

pivot knee. Knee. 2005;12:13–19.

13. Lee TQ, Kim WC. Anatomically based patellar resection cri-

teria for total knee arthroplasty. Am J Knee Surg. 1998;11:

161–165.

14. Lie DT, Gloria N, Amis AA, Lee BP, Yeo SJ, Chou SM. Patellar

resection during total knee arthroplasty: effect on bone strain and

fracture risk. Knee Surg Sports Traumatol Arthrosc.2005;13:203–208.

15. Lombardi AV Jr, Mallory TH, Maitino PD, Herrington SM,

Kefauver CA. Freehand resection of the patella in total knee

arthroplasty referencing the attachments of the quadriceps tendon

and patellar tendon. J Arthroplasty. 1998;13:788–792.

16. Meachim G, Bentley G, Baker R. Effect of age on thickness of

adult patellar articular cartilage. Ann Rheum Dis. 1977;36:563–

568.

17. Pynsent PB. Choosing an outcome measure. J Bone Joint SurgBr. 2001;83:792–794.

18. Rand JA. Total knee arthroplasty: techniques. In: Morrey BF, ed.

Joint Replacement Arthroplasty. New York, NY: Churchill

Livingstone; 1991:1002–1003.

19. Reuben JD, McDonald CL, Woodard PL, Hennington LJ. Effect

of patella thickness on patella strain following total knee


20. Rooney N, Fitzpatrick DP, Beverland DE. Intraoperative knee

anthropometrics: correlation with cartilage wear. Proc Inst MechEng H. 2006;220:671–675.

21. Star MJ, Kaufman KR, Irby SE, Colwell CW Jr. The effects of

patellar thickness on patellofemoral forces after resurfacing. ClinOrthop Relat Res. 1996;322:279–284.


123

ORIGINAL ARTICLE

Hybrid Total Knee Arthroplasty

13-year Survivorship of AGC Total Knee Systems with Average 7 Years Followup

Philip M. Faris MD, E. Michael Keating MD,

Alex Farris, John B. Meding MD, Merrill A. Ritter MD

Received: 7 June 2007 / Accepted: 15 February 2008 / Published online: 7 March 2008


Abstract A retrospective study of 201 anatomic gradu-

ated component total knee arthroplasties implanted with

hybrid fixation at the authors’ center was performed in

response to conflicting data in the literature concerning the

benefits of a hybrid method. Selection for hybrid fixation

was nonrandomized and based on femoral component fit.

Survivorship analysis was performed, and rates of radio-

lucent lines surrounding the femoral component and

occurrence of osteolysis were noted. At 7 and 13 years,

survivorship with tibial or femoral revision as the end point

was 0.9926 and 0.9732, respectively. Radiolucencies were

found adjacent to 15 femoral components at final followup

(seven in Zone 1, three in Zone 2, five in Zone 3, one in

Zone 4, two in Zone 5, zero in Zone 6). Osteolysis was

observed in one knee after secondary evaluation. Hybrid

fixation in a selected patient population can result in

excellent results in middle to long-term followup.



of evidence.

Introduction

Despite small, but prevalent, incidences of osteolysis [1, 9, 16,

26, 31, 36, 37, 47, 50, 56, 57] (ranging from 4.1% to 34%),

polyethylene wear [10, 14, 15, 32, 38, 41, 53, 55], and lack of

adequate fixation [3, 7, 33, 52, 54], TKA is a highly successful

operation with success rates greater than 90% [4, 12, 17–19, 24,

36, 39, 40, 43, 45, 48, 51]. To further minimize the aforemen-

tioned concerns that lead to TKA failure, various fixation

methods have been proposed [2, 5, 21] and used. Cementless

fixation with porous coating has largely met with mixed results

[8, 11, 12, 13, 17, 19, 20, 27, 39, 40], including a 15-year

survival of 72% [13] and greater loosening among uncemented

tibial components compared with cemented components [7]. In

contrast, short-term studies of hybrid fixation showed promise

for this second alternative [23, 28, 30, 49, 58]. However, one

intermediate-term report [6] of 65 press-fit condylar (PFC)

arthroplasties had unacceptable implant survivorship (89%

after 5 years, 85% after 8 years) and problems with the femoral

component. These problems included six of nine revisions for a

loose femoral prosthesis, two of nine for a fractured femoral

prosthesis, and one for osteolysis, which led the authors of the

study to recommend abandonment of hybrid TKA.

Because of this conflict of data, we examined the results of

a nonrandomized study of the survivorship of hybrid TKA. In

our long-term study performed over a minimum of 2.0 years

(average, 7.9 years; range, 2.0–17.4 years), we examined

the clinical and survivorship results of 201 hybrid TKAs

using one design.


Of 403 TKAs performed at our institution between August

24, 1988, and May 17, 1989, 201 (49.9%) were hybrid



arrangements, etc.) that might pose a conflict of interest with the

submitted article.





P. M. Faris (&), E. M. Keating, A. Farris,

J. B. Meding, M. A. Ritter

The Center for Hip and Knee Surgery, St Francis Hospital,

1199 Hadley Road, Mooresville, IN 46158, USA


123


DOI 10.1007/s11999-008-0195-6

fixation TKAs, all of which used anatomic graduated

components (AGC; Biomet, Warsaw, IN). The femoral

component consisted of a cobalt-chrome articular surface

with a plasma-sprayed titanium undersurface, including

anterior, posterior, distal, and chamfer surfaces. The pegs

were poly grit-blasted. The patellae were all polyethylene,

single-pegged, and the tibial component was a monoblock

titanium-backed component. No other hybrid procedures

were performed after the study period.

The study group comprised 80 women (61.1%) and 51

men (38.9%). Seventy patients (34.8%) received bilateral

hybrid arthroplasties; five others received bilateral

arthroplasties with one knee implanted with hybrid fixa-

tion. The average age of the patients at the time of surgery

was 70.3 ± 8.1 years (mean ± standard deviation; range,

44–87 years). The average body mass index at the time of

surgery was 27.0 ± 4.3 kg/m2 (range, 17.4–39.6 kg/m2).

Diagnoses in this group were osteoarthritis in 181 knees

(90.0%), rheumatoid arthritis in 12 (6.0%), osteonecrosis in

seven (3.5%), and Paget’s disease in one (0.5%). The

preoperative Knee Society score was 51.6 ± 13.7 (range,

7–81); preoperative function score was 49.9 ± 15.8 (range,

10–90); and preoperative pain score was 29.5 ± 11.0

(range, 0–50). Of patients who did not receive hybrid

components during the study period, 83 were women

(69%) and 37 were men (31%). Their average age at the

time of surgery was 73 ± 8.0 years (range, 50–90 years),

and their average body mass index was 29.2 ± 5.6 kg/m2

(range, 19.4–48.9 kg/m2).

During the study period, we performed 202 all cemented

AGC TKAs. Selection for hybrid TKA was based on sur-

geon preference taking into account the coaptation of the

implant; once the trial femoral component was implanted,

the patient received a hybrid prosthesis if the performing

surgeon determined that it fit snugly. Cement was used as

the primary method of fixation in all tibial and patellar

components, and the posterior cruciate ligament (PCL) was

retained in all patients. We used screws in conjunction with

cement in six tibial components to help fill large defects

[42, 44, 46], and the keel was cemented.

We evaluated all patients preoperatively, at 6 months,

and at 1, 3, 5, 7, 10, 12, 15, and 17 years after surgery,

when available. Patient evaluation spanned an average of

7.9 ± 4.9 years (range, 2.0–17.4 years). Radiographs were

taken 2 months postoperatively and at every subsequent

followup. Radiographs were evaluated at followup by the

performing surgeon, who was not blinded, for varus-valgus

alignment and occurrence of radiolucent lines. Primary

evaluation of osteolysis, using the definition given by

Peters et al. [37], was performed after the study period by

two of the authors (PMF, ATF) involved in the study who

were not blinded to patient identification; a secondary

detailed evaluation of possible osteolysis was performed by

another author (MAR), who also was not blinded to patient

identification. Failure was defined as revision of the femoral

or tibial component for reasons other than infection.

We performed statistical analysis using SAS statistical

software (SAS Institute, Inc, Cary, NC). Survivorship rates

were obtained with Kaplan-Meier survival analysis [25]

with failure defined as revision of the tibial or femoral

component.

Results

Kaplan-Meier survival analysis, with failure defined as

revision of either the femoral or tibial component, found

that at 5 years, the followup survival rate was 1.0000; at 7,

10, and 12 years followup, the survival rate was 0.9926;

and at 13 years followup, the survival rate was 0.9732

(Fig. 1). Preoperative knee scores improved from an

average score of 50 to 95 at 1 year followup with similar

improvements in functional scores (Fig. 2).

During the followup period, there were five revisions of

the femoral or tibial component (2.5%), two of which were

not related to an infection (two of 201 [1.0%]). Both aseptic

revisions resulted from medial tibial collapse secondary to

loosening, and both knee systems had a well-fixed femoral

component at revision. The aseptic revisions included one

in a 70-year-old man and one in a 65-year-old woman; both

were treated primarily for osteoarthritis. The two tibial

components were in 90� coronal alignment; the overall

anatomic alignment for one knee was in 5� valgus, whereas

the other was 0�. Both patients had a pain score of 50.

There were three knees (two tibial components, dis-

cussed previously, and one femur) that were considered

radiographically loose. The loose femoral component, in a

62-year-old man treated for osteoarthritis, did not require

revision; the overall alignment was 4� valgus and 87�coronal tibial alignment. The patient had a pain score of 50.

Although there were radiographic signs of loosening, there

was no change in alignment or migration of the prostheses.

At final followup, we found radiolucencies adjacent to

the femoral component in 15 of 194 knees (7.7%). Seven

radiolucencies were found in Zone 1, three in Zone 2, five

in Zone 3, one in Zone 4, two in Zone 5, and zero in

Zone 6. One hundred twenty-five of 176 knees had no

radiolucency at 1 year followup (71.0%), 117 of 136 had

no radiolucency at 3 years (86.0%), 78 of 87 had

no radiolucency at 5 years (89.7%), 54 of 59 had no

radiolucency at 10 years (91.5%), and 11 of 12 had no

radiolucency at 15 years (91.7%). Radiolucencies greater

than 2 mm at earlier followup, typically found around the

anterior or posterior femoral flanges, did not increase in

size or compromise the implant; all such lucencies did not

progress into adjacent zones.

Volume 466, Number 5, May 2008 Hybrid TKA 1205

123

On primary radiographic evaluation, we found nine

osteolytic lesions in eight of 201 knees (4.0%), but only

one of these nine lesions (in 0.5% of 201 knees) was

determined to possibly be wear osteolysis after secondary

evaluation; the other eight were small, medial, and non-

progressive. Two lesions were found surrounding a femoral

component, whereas the other seven were found in the

tibia. One femoral lesion was located adjacent to the

anterior flange with the other adjacent to the posterior

flange; these were determined to be related to poor

coaptation of the femoral flanges, and not polyethylene

wear, on secondary evaluation. All seven tibial lesions

were found in the medial tibial plateau. Six of these

appeared within 5 mm of the edge of the plateau; they first

appeared at 6 months followup and were nonprogressive;

thus, they were deemed nonosteolytic at secondary evalu-

ation. The area of concern for osteolysis in the one knee

with possible osteolysis after secondary evaluation was

noted at 3 years followup; the area became more promi-

nent, but it did not expand during the 15-year followup

Fig. 1 Kaplan-Meier survivor-

ship analysis shows 97.3%

survival at 13 years.

3 years

Average Knee Society Scores for Hybrid Fixation (n=201 knees)

0

10

20

30

40

50

60

70

80

90

100

Knee Score 52 83 93 95 96 89 87

Function Score 50 80 88 86 78 81 79

Pain Score 30 46 48 48 49 47 49

Walk Score 20 43 47 46 47 45 44

Stairs Score 29 38 41 41 35 39 39

Preoperative 6 months 1 year 5 years 7 years 10 years

Fig. 2 Average knee society

scores for hybrid fixation

(n = 201 knees) are shown.

1206 Faris et al. Clinical Orthopaedics and Related Research

123

period. One knee had two lesions that were visualized, one

in the medial tibia and one in the anterior femur but both

were deemed nonosteolytic. All patients with apparent

osteolysis determined at primary evaluation, with the

exception of those who had revision surgery, had a pain

score of 50.

Three supracondylar femoral fractures occurred in the

study group. These fractures, which appeared near the

distal third of the right femur, were treated with Rush rods;

all healed sufficiently. We performed three revision

arthroplasties secondary to infection in two patients within

2 years after the index surgery; these were revised with

modular Insall-Burstein constrained prostheses (Zimmer,

Warsaw, IN). Seven manipulations and three lateral

releases were performed. Other operations included seven

manipulations, three lateral releases, and one patellar

button excision.

Discussion

Cementless fixation in TKA was developed to negate the

problems associated with cemented TKA; however, in light

of the mixed results associated with cementless TKA [11,

12, 13, 17, 19, 20, 27, 39, 40], hybrid fixation was put forth

as an alternative. In initial studies [28, 30, 49, 58], this

method showed success rates comparable with those of the

cemented femoral Miller-Galante and PFC components;

however, the studies relied on short followup and stressed

further study was warranted. Campbell et al. [6] cited 10

revisions among 65 PFC implants and 84.6% survivorship

at 8 years; these findings led them to conclude hybrid

fixation should be abandoned. On seeing these results and

reports [22, 24, 29, 34] suggesting increased success rates

could result from patient selection, we decided to examine

data concerning our center’s experience with hybrid TKAs.

One limitation of this study was the reliance on standard

radiographs to observe osteolysis [23, 35]. However, the

same two technicians took all the radiographs and their

techniques are the same. Moreover, the scarcity of revi-

sions in this study group suggests possible unobserved

osteolysis did not complicate the integrity of the implants.

Previous studies [15, 20, 23, 26, 37] have found an

increased incidence of osteolysis in cementless TKAs

surrounding tibial and femoral components. Specifically,

one study [37] found a 16% occurrence of osteolysis sur-

rounding tibial screws in cementless TKA, and another

[20] found tibial osteolysis in 24 of 113 knees (21%) and

femoral osteolysis in 20 knees (18%). Osteolysis was found

in fewer knees in the current study, in only one of 201

hybrid TKAs after secondary evaluation. Two knees in the

group of 201 (1.0%) showed potential osteolysis around the

cementless femoral component; however, they were

deemed to be a result of failed coaptation of the femoral

flanges because Zones 2, 3, 4, and 6 showed femoral

ingrowth. We believe the overall decreased occurrence of

osteolysis is influenced by the monoblock tibial component

with compression-molded polyethylene, which has been

shown to have decreased wear characteristics [43].

Numerous evaluations of implant designs and fixation

methods [1, 7, 12, 51, 52] have noted the constant but

variable prevalence of radiolucent lines surrounding TKA

components. Lucencies have been found in at least one

zone adjacent to 18 of 55 (32.7%) [12] and five of 58

(8.6%) [51] cementless femoral components in cementless

TKA in groups followed for an average 10 and 11 years,

respectively. Two of the 55 were considered radiographi-

cally loose, whereas none of the 58 was loose at followup.

In our study, we found no radiolucencies at final followup

in 179 of 194 knees (92.3%), with incidence of radiolu-

cency decreasing with each subsequent followup. Only one

femoral component, which did not require revision, was

deemed to be loose at clinical and radiographic followups.

Comparisons among fixation techniques in primary

TKAs have been produced in studies using databases with

greater than 5700 knee arthroplasties [17, 19, 39, 40]. In

two of these reports [19, 40], such comparisons included

the survival rates of cemented, cementless, and hybrid

TKAs. Both found the survivorship of cemented compo-

nents to be superior to the latter two methods, with

cemented implants having success rates of 99% and 92%,

respectively (Table 1). These findings give credence to

cemented fixation’s distinction as the gold standard against

which all other fixation methods are compared. However,

hybrid fixation has consistently shown more success than

cementless techniques, as seen by the 97.3% 13-year suc-

cess rate found in the current study. This is partly

attributable to the improved surgical procedure and

continued, but tempered, evolution of components.

Hybrid TKA has shown good short-term and intermediate-

term results. Although cemented fixation has consistently

had excellent survival rates, careful selection of patients

based on component fit may increase survivorship seen in

hybrid fixation. Further study, especially analysis of greater

than 15-year survival, is warranted and would add consid-

erably to the debate concerning the optimal method of

fixation in primary TKA.

Table 1. Comparison of hybrid TKA results

Study Hybrid

Survival (%) Number

Rand et al., 2003 [40] (10 years) 84 172

Gioe et al., 2004 [19] (11 years) 93.2 837

Faris et al., 2008 (current study) (13 years) 97.3 201


123

Acknowledgments We thank Matthew Brunsman for statistical

analysis and graphics design.

References

1. Arora J, Ogden AC. Osteolysis in a surface-cemented, primary,

modular Freeman-Samuelson total knee replacement. J BoneJoint Surg Br. 2005;87:1502–1506.

2. Bauer GC. What price progress? Failed innovations of the knee

prosthesis. Acta Orthop Scand. 1992;63:245–246.

3. Berry DJ, Wold LE, Rand JA. Extensive osteolysis around an

aseptic, stable, uncemented total knee replacement. Clin OrthopRelat Res. 1993;293:204–207.

4. Bozic KJ, Kinder J, Menegini M, Zurakowski D, Rosenberg AG,

Galante JO. Implant survivorship and complication rates after

total knee arthroplasty with a third-generation cemented system:

5 to 8 years followup. Clin Orthop Relat Res. 2005;430:117–124.

5. Bulstrode CJ, Murray DW, Carr AJ, Pynsent PB, Carter SR.

Designer hips: don’t let your patient become a fashion victim.

BMJ. 1993;306:732–733.

6. Campbell MD, Duffy GP, Trousdale RT. Femoral component

failure in hybrid total knee arthroplasty. Clin Orthop Relat Res.1998;356:58–65.

7. Carlsson A, Bjorkman A, Besjakov J, Onsten I. Cemented tibial

component fixation performs better than cementless fixation: a

randomized radiostereometric study comparing porous-coated,

hydroxyapatite-coated and cemented tibial components over

5 years. Acta Orthop. 2005;76:362–369.

8. Collier JP, Mayor MB, Surprenant VA, Dauphinais LA,

Surprenant HP, Jensen RE, Chae JC, Spector M, Shortkroff S,

Sledge CB, et al. Advances in implant-bone interface. InstrCourse Lect. 1991;40:89–113.

9. Collier MB, Engh CA Jr, McAuley JP, Ginn SD, Engh GA.

Osteolysis after total knee arthroplasty: influence of tibial base-

plate surface finish and sterilization of polyethylene insert. J BoneJoint Surg Am. 2005;87:2702–2708.

10. Conditt MA, Thompson MT, Usrey MM, Ismaily SK, Noble PC.

Backside wear of polyethylene tibial inserts: mechanism and

magnitude of material loss. J Bone Joint Surg Am. 2005;87:

326–331.

11. Cook SD, Thomas KA, Haddad RJ Jr. Histologic analysis of

retrieved human porous-coated total joint components. ClinOrthop Relat Res. 1988;234:90–101.

12. Duffy GP, Berry DJ, Rand JA. Cement versus cementless fixation

in total knee arthroplasty. Clin Orthop Relat Res. 1998;356:

66–72.

13. Duffy GP, Murray BE, Trousdale RR. Hybrid total knee arthro-

plasty: analysis of component failures at an average of 15 years. JArthroplasty. 2007;22:1112–1115.

14. Engh GA, Dwyer KA, Hanes CK. Polyethylene wear of metal-

backed tibial components in total and unicompartmental knee

prostheses. J Bone Joint Surg Br. 1992;74:9–17.

15. Engh GA, Parks NL, Ammeen DJ. Tibial osteolysis in cementless

total knee arthroplasty: a review of 25 cases treated with and

without tibial component revision. Clin Orthop Relat Res.1994;309:33–43.

16. Ezzet KA, Garcia R, Barrack RL. Effect of component fixation

method on osteolysis in total knee arthroplasty. Clin Orthop RelatRes. 1995;321:86–91.

17. Furnes O, Espehaug B, Lie SA, Furnes O, Havelin LI. Early

failures among 7,174 primary total knee replacements: a follow-

up study from the Norwegian Arthroplasty Register 1994–2000.

Acta Orthop Scand. 2002;73:117–129.

18. Gioe TJ, Bowman KR. A randomized comparison of all-poly-

ethylene and metal-backed tibial components. Clin Orthop RelatRes. 2000;380:108–115.

19. Gioe TJ, Killeen KK, Grimm K, Mehle S, Scheltema K. Why are

total knee replacements revised?: analysis of early revision in a

community knee implant registry. Clin Orthop Relat Res.2004;428:100–106.

20. Goldberg VM, Kraay M. The outcome of the cementless tibialcomponent: a minimum 14-year clinical evaluation. Clin OrthopRelat Res. 2004;428:214–220.

21. Goodfellow J. Editorials. Knee prostheses—one step forward,

two steps back. J Bone Joint Surg Br. 1992;74:1–2.

22. Hsu RW, Tsai YH, Huang TJ, Chang JC. Hybrid total knee

arthroplasty: a 3- to 6-year outcome analysis. J Formos MedAssoc. 1998;97:410–415.

23. Huang CH, Ma HM, Liau JJ, Ho FY, Cheng CK. Osteolysis in

failed total knee arthroplasty: a comparison of mobile-bearing

and fixed-bearing knees. J Bone Joint Surg Am. 2002;84:

2224–2229.

24. Illgen R, Tueting J, Enright T, Schreibman K, McBeath A, Heiner

J. Hybrid total knee arthroplasty: a retrospective analysis of

clinical and radiographic outcomes at average 10 years follow-

up. J Arthroplasty. 2004;19(7 suppl 2):95–100.

25. Kaplan EL, Meier P. Nonparametric estimation from incomplete


26. Kilgus DJ, Funahashi TT, Campbell PA. Massive femoral oste-

olysis and early disintegration of a polyethylene-bearing surface

of a total knee replacement: a case report. J Bone Joint Surg Am.1992;74:770–774.

27. Kim YH, Oh JH, Oh SH. Osteolysis around cementless porous-

coated anatomic knee prostheses. J Bone Joint Surg Br.1995;77:236–241.

28. Kobs JK, Lachiewicz PF. Hybrid total knee arthroplasty: two- to

five-year results using the Miller-Galante prosthesis. Clin OrthopRelat Res. 1993;286:78–87.

29. Konig A, Kirschner S, Walther M, Eisert M, Eulert J. Hybrid total

knee arthroplasty. Arch Orthop Trauma Surg. 1998;118:66–69.

30. Kraay MJ, Meyers SA, Goldberg VM, Figgie HE II, Conroy PA.

‘‘Hybrid’’ total knee arthroplasty with the Miller-Galante pros-

thesis: a prospective clinical and roentgenographic evaluation.


31. Lachiewicz PF, Soileau ES. The rates of osteolysis and loosening

associated with a modular posterior stabilized knee replacement:

results at 5–14 years. J Bone Joint Surg Am. 2004;86:525–530.

32. Lewis P, Rorabeck CH, Bourne RB, Devane P. Posteromedial

tibial polyethylene failure in total knee replacements. Clin OrthopRelat Res. 1994;299:11–17.

33. Li MG, Nilsson KG. The effect of the preoperative bone quality

on the fixation of the tibial component in total knee arthroplasty.


34. Mitsui H. Hybrid total knee arthroplasties in rheumatoid arthritis.

Bull Hosp Jt Dis. 1993;53:19–20.

35. Miura H, Matsuda S, Okazaki K, Kawano T, Kawamura H,

Iwamoto Y. Validity of an oblique posterior condylar radio-

graphic view for revision total knee arthroplasty. J Bone JointSurg Br. 2005;87:1643–1646.

36. O’Rourke MR, Callaghan JJ, Goetz DD, Sullivan PM, Johnston RC.

Osteolysis associated with a cemented modular posterior-cruciate-

substituting total knee design: five to eight-year follow-up. J BoneJoint Surg Am. 2002;84:1362–1371.

37. Peters PC Jr, Engh GA, Dwyer KA, Vinh TN. Osteolysis after

total knee arthroplasty without cement. J Bone Joint Surg Am.1992;74:864–876.

38. Puloske SK, McCalden RW, MacDonald SJ, Rorabeck CH,

Bourne RB. Tibial post wear in posterior stabilized total knee

1208 Faris et al. Clinical Orthopaedics and Related Research

123

arthroplasty: an unrecognized source of polyethylene debris.


39. Rand JA, Ilstrup DM. Survivorship analysis of total knee

arthroplasty: cumulative rates of survival of 9200 total knee

arthroplasties. J Bone Joint Surg Am. 1991;73:397–409.

40. Rand JA, Trousdale RT, Ilstrup DM, Harmsen WS. Factors

affecting the durability of primary total knee prostheses. J BoneJoint Surg Am. 2003;85:259–265.

41. Rao AR, Engh GA, Collier MB, Lounici S. Tibial interface wear

in retrieved total knee components and correlations with modular

insert motion. J Bone Joint Surg Am. 2002;84:1849–1855.

42. Ritter MA. Screw and cement fixation of large defects in total

knee arthroplasty. J Arthroplasty. 1986;1:125–129.

43. Ritter MA, Berend ME, Meding JB, Keating EM, Faris PM,

Crites BM. Long-term follow-up of Anatomic Graduated Com-

ponents posterior cruciate-retaining total knee replacement. ClinOrthop Relat Res. 2001;388:51–57.

44. Ritter MA, Harty LD. Medial screws and cement: a possible

mechanical augmentation in total knee arthroplasty. J Arthro-plasty. 2004;19:587–589.

45. Ritter MA, Herbst SA, Keating EM, Faris PM, Meding JB. Long-

term survival analysis of a posterior-cruciate-retaining total

condylar total knee arthroplasty. Clin Orthop Relat Res.1994;309:136–145.

46. Ritter MA, Keating EM, Faris PM. Screw and cement fixation of

large defects in total knee arthroplasty a sequel. J Arthroplasty.1993;8:63–65.

47. Robinson EJ, Mulliken BD, Bourne RB, Rorabeck CH, Alvarez C.

Catastrophic osteolysis in total knee replacement: a report of 17

cases. Clin Orthop Relat Res. 1995;321:98–105.

48. Rodriguez JA, Baez N, Rasquinha V, Ranawat CS. Metal-backed

and all-polyethylene tibial components in total knee replacement.


49. Rorabeck CH, Bourne RB, Lewis PL, Nott L. The Miller-Galante

knee prosthesis for the treatment of osteoarthrosis: a comparison

of the results of partial fixation with cement and fixation without

any cement. J Bone Joint Surg Am. 1993;75:402–408.

50. Schmalzried TP, Callaghan JJ. Current concepts review: wear in

total hip and knee replacements. J Bone Joint Surg Am.1999;81:115–136.

51. Schrøder HM, Berthelsen A, Hassani G, Hansen EB, Solgaard S.

Cementless porous-coated total knee arthroplasty: 10-year

results in a consecutive series. J Arthroplasty. 2001;16:

559–567.

52. Smith S, Naima VS, Freeman MA. The natural history of tibial

radiolucent lines in a proximally cemented stemmed total knee


53. Tanner MG, Whiteside LA, White SE. Effect of polyethylene

quality on wear in total knee arthroplasty. Clin Orthop Relat Res.1995;317:83–88.

54. Vigorita VJ, Minkowitz B, Dichiara JF, Higham PA. A his-

tomorphometric and histologic analysis of the implant interface

in five successful, autopsy-retrieved, noncemented porous-

coated knee arthroplasties. Clin Orthop Relat Res. 1993;293:

211–218.

55. Wasielewski RC, Galante JO, Leighty RM, Natarajan RN,

Rosenberg AG. Wear patterns on retrieved polyethylene tibial

inserts and their relationship to technical considerations during

total knee arthroplasty. Clin Orthop Relat Res. 1994;299:31–43.

56. Wasielewski RC, Parks N, Williams SI, Surprenant H, Collier JP,

Engh G. Tibia insert undersurface as a contributing source of

polyethylene wear debris. Clin Orthop Relat Res. 1997;345:53–

59.

57. Whiteside LA. Effect of porous-coating configuration on tibial

osteolysis after total knee arthroplasty. Clin Orthop Relat Res.1995;321:92–97.

58. Wright RJ, Lima J, Scott RD, Thornhill TS. Two- to four-year

results of posterior cruciate-sparing condylar total knee arthro-

plasty with an uncemented femoral component. Clin OrthopRelat Res. 1990;260:80–86.


123

MULTIMEDIA ARTICLE

Vascular Management in Rotationplasty

Craig R. Mahoney MD, Curtis W. Hartman MD,

Pamela J. Simon RN, B. Timothy Baxter MD,

James R. Neff MD

Received: 22 February 2007 / Accepted: 18 February 2008 / Published online: 18 March 2008


Abstract The Van Nes rotationplasty is a useful limb-

preserving procedure for skeletally immature patients with

distal femoral or proximal tibial malignancy. The vascular

supply to the lower limb either must be maintained and

rotated or transected and reanastomosed. We asked whe-

ther there would be any difference in the ankle brachial

index or complication rate for the two methods of vascular

management. Vessels were resected with the tumor in

seven patients and preserved and rotated in nine patients.

One amputation occurred in the group in which the vessels

were preserved. Four patients died secondary to metastatic

disease diagnosed preoperatively. The most recent ankle

brachial indices were 0.96 and 0.82 for the posterior tibial

and dorsalis pedis arteries, respectively, in the

reconstructed group. The ankle brachial indices were 0.98

and 0.96 for the posterior tibial and dorsalis pedis arteries,

respectively, in the rotated group. Outcomes appear similar

using both methods of vascular management and one

should not hesitate to perform an en bloc resection when

there is a question of vascular involvement.

Level of Evidence: Level III, therapeutic study. See the


of evidence.

Introduction

Borggreve [4] first described rotationplasty in 1930 as a

treatment for limb shortening and knee ankylosis second-

ary to tuberculosis. Van Nes, in the 1950s, popularized this

procedure for correcting c the location of the tumor and

necessary bone resection. From the late 1970s to the

present, the procedure has been popularized as a limb-

preserving procedure for skeletally immature patients with

distal femoral or proximal tibial sarcomas [18, 29]. There

are numerous physical benefits to rotationplasty when

compared with above-knee amputation. Cammisa et al. [6]

compared the energy cost of ambulation in above-knee

amputees with that of patients with a rotationplasty. They

found ambulation by patients after rotationplasty required

38% of maximum aerobic capacity whereas above-knee

amputees required 46% [6]. Rotationplasty maintains a

functioning joint at the level of the knee. This results in a

more efficient gait pattern and decreased oxygen con-

sumption [2, 6, 29].

However, numerous complications have been reported

with this procedure, including nonunion, malunion, local

recurrence, compartment syndrome, superficial infection,

and deep infection [2, 6, 9, 13, 19]. One of the most serious

James R. Neff—Deceased.









Electronic supplementary material The online version of thisarticle (doi:10.1007/s11999-008-0197-4) contains supplementarymaterial, which is available to authorized users.

C. R. Mahoney, C. W. Hartman, P. J. Simon,

B. T. Baxter, J. R. Neff

The Department of Orthopaedic Surgery and Rehabilitation,

University of Nebraska Medical Center, Omaha, NE, USA

C. R. Mahoney (&)

Iowa Orthopaedic Center, 411 Laurel Street, Suite 3300,

Des Moines, IA 50314, USA


123


DOI 10.1007/s11999-008-0197-4

http://dx.doi.org/10.1007/s11999-008-0197-4

potential complications involves vascular compromise of

the reconstructed limb [11, 17, 20–22, 27, 32, 33].

Currently, two methods of vascular management are

reported. Patients may be treated by primary transection

and reanastomosis, sparing only the sciatic nerve, when a

tumor is suspected to involve the major vessels. This

approach eliminates loops of redundant artery and vein and

allows potentially improved resection margins. One report

suggests resection of the vessels is obligatory when per-

forming rotationplasty for tumors of the distal femur [35].

Alternatively, major vascular structures can be retained as

dictated by tumor involvement, response to chemotherapy,

and the ability to provide an adequate vascular bed distally.

The vascular structures when mobilized are externally

rotated 180� with the lower leg and looped with the sciatic

nerve. Reports of complications in this group include

pseudoaneurysm and prolonged distal ischemia eventually

requiring vascular reconstruction [3]. Reported complica-

tions in the anastomosis group include thrombosis at the

anastomosis, requiring vascular revision [9, 11, 17, 20, 21,

27, 32]. Currently, there is no consensus regarding whether

one of the approaches results in a higher rate of

complications.

We asked whether the ankle brachial index (ABI) or

complication rate between the two groups would differ

with the two methods of vascular management for

rotationplasty.


We retrospectively reviewed 15 patients (10 boys, five

girls) ranging in age from 7 to 13 years, with an average

age of 11.5 years, who underwent rotationplasty between

April 1991 and May 1998. We resected the distal superfi-

cial femoral and popliteal vessels with the tumor in seven

patients (Group A). In the remaining eight patients, the

vessels were mobilized for rotation without transection

(Group B). All seven patients in Group A had distal fem-

oral tumors managed with a Type A1 rotationplasty as

described by Winkelmann [35]. Five patients in Group B

had proximal tibial tumors managed with a Type A2

rotationplasty [35]. Three patients in Group B had distal

femoral tumors and were managed with a modified Type

A1 rotationplasty in that the vessels were not transected

[35]. Fourteen patients had osteosarcoma and one patient

had synovial sarcoma. The patient with synovial sarcoma

underwent rotationplasty as a salvage procedure to avoid

above-knee amputation after an invasive Aspergillus

infection developed after her initial tumor resection. All

tumors were Stage IIB [10] at the time of initial evaluation.

At the time of surgery, three patients had evidence of

metastatic disease. Four patients died, all secondary to their

sarcomas, at an average of 46 months (range, 28–

72 months) after their surgery. No living patient was lost to

followup. The 15 patients were seen at a minimum fol-

lowup of 28 months (mean, 95 months; range, 28–

165 months).

Preoperative evaluation consisted of a history and

physical examination, routine hematologic studies, routine

radiographs and MRI of the involved extremity, and

computerized axial tomography of the chest. Vascular

studies included a limited arteriogram and a duplex scan of

the deep and superficial venous systems. These studies

were used to assess the extent of the tumor involvement

and to plan the surgical procedure and vascular recon-

struction. A biopsy-proven diagnosis was established in all

patients preoperatively. We reviewed all radiographic data

with a musculoskeletal radiologist (CWW), a vascular

surgeon (BTB), and an orthopaedic oncologist (JRN).

All patients with osteosarcoma had completed a mini-

mum of three courses of neoadjuvant chemotherapy before

the anticipated surgical procedure. Patients typically com-

pleted chemotherapy 2 to 4 weeks before surgery.

Hematologic parameters were followed closely by the

pediatric oncology team and were normal at the time of

surgery.

Patients with tumors showing maintenance of an other-

wise normal fat plane between the sciatic nerve and the

vessels were judged candidates to maintain continuity of

the vessels. Patients having deviation of the vessels but

maintenance of a normal fat plane also were presumed

candidates to maintain vascular continuity. Patients with

tumors showing the absence of a normal circumferential fat

plane or encasement were considered candidates for vas-

cular resection in continuity with the resection specimen to

provide a minimum of a wide margin [10]. In all cases, the

sciatic or tibial and peroneal nerves had to be uninvolved

for a patient to remain a candidate for rotationplasty. The

surgical approach was based on the approach described by

Winkelmann [35] for Types A1 and A2 rotationplasties.

The initial portion of the operation concerned the devel-

opment of appropriate flaps and planes of dissection to

adequately expose the peroneal nerve and sciatic nerve

(Fig. 1). When appropriate, the vessels were mobilized,

preserving the normal fat plane and keeping them isolated

from the tumor. When vascular involvement was antici-

pated, the plane of dissection remained outside the vessels,

thereby maintaining a wide margin of resection (Fig. 2).

The average time to complete the surgery was 10.0 hours

in Group A and 8.1 hours in Group B. During the case and

postoperatively, a pulse oximeter was placed on the great

toe and monitored closely (Fig. 3). Dextran (0.25 mL/kg/

hour) was started at the end of the procedure and continued

for 2 days to prevent thrombus of the venous anastomosis.

To minimize swelling that can result from venous

Volume 466, Number 5, May 2008 Vascular Management in Rotationplasty 1211

123

hypertension, the extremity was carefully dressed with a

circumferential dressing, keeping the toes exposed for

monitoring, and it was continuously elevated. Aspirin,

70 mg once daily, was initiated after the dextran was dis-

continued and continued until discharge from the hospital

for 6 months.

Chemotherapy typically was resumed 2 to 4 weeks

postoperatively when hematologic parameters had returned

to normal. All patients had been familiarized with the

expected cosmetic and functional outcome either by per-

sonal interaction with other patients or using videotapes of

interviews with other patients.

Patients were seen in followup by the operating surgeon

(JRN) at 2 weeks and then monthly for 3 months. Fol-

lowup was more frequent for patients with wound

complications. An ABI was obtained when the wounds

were healed. Patients typically were seen every 3 months

for the first year, every 4 months for the second and third

years, every 6 months for the fourth and fifth years, and on

a yearly basis thereafter. Routine radiographs of the

involved extremity were obtained at each followup to

evaluate the osteotomy site. Metastatic surveillance inclu-

ded a computed tomographic scan of the chest at each

followup and an annual radionuclide bone scan.

The differences in the ABI between the two groups were

determined using Student’s t test with the level of signifi-

cance set at p \ 0.05. Survival was determined by

calculating the percent of patients living at 5 years

followup.

Results

Four patients died, all secondary to their sarcomas, at an

average of 46 months after their surgery. Three deceased

patients were in Group A and one was in Group B. Two of

these patients were known to have systemic disease before

their operation. Of the remaining patients, 10 have no

evidence of residual neoplastic disease. One patient has

evidence of metastatic disease 39 months after surgery.

There have been no local recurrences. The average 5-year

survival rate for the entire cohort was 81%. The 5-year

survival rate for Group A was 71%, and the 5-year survival

rate for Group B was 89%.

The mean ABIs for both groups for the posterior tibial

and dorsalis pedis arteries were similar preoperatively and

just over 2 months postoperatively (Table 1). The most

recent ABIs for Group A at an average of 23 months

postoperatively and Group B at an average of nearly

8 months also were similar (Table 2). The mean change

from the preoperative to postoperative ABIs for both

arteries in both groups was similar (Table 3), as was mean

change from preoperative to final values (Table 4).

Fig. 1 The initial portion of the operation concerns dissection and

mobilization of the sciatic nerve. The nerve is localized by isolating

the common peroneal nerve and dissecting proximally.

Fig. 2 Vascular shunts are used to maintain perfusion of the distal

extremity during resection of the mass. After the resection is

completed, the respective artery and vein are repaired by end-to-

end anastomoses.

Fig. 3 A pulse oximeter is used on the distal portion of the ipsilateral

extremity throughout the entire procedure with maintenance of

oxygen saturation greater than 90%.

1212 Mahoney et al. Clinical Orthopaedics and Related Research

123

Duplex scanning was performed in two of the patients

who had reconstruction during their routine followup.

Notably, there was no evidence of intimal hyperplasia of

the anastomosis.

There were 12 complications (five in Group A and

seven in Group B) requiring an additional 36 operations

(18 in both groups) in eight patients. Nineteen of the

operations were performed on two patients. One patient in

Group B experienced vascular insufficiency after dis-

charge from the hospital. On return for the first

postoperative visit, examination in the clinic revealed a

largely necrotic, nonunited limb. Further inspection in the

operating room confirmed the findings and the decision

was made to amputate. Two patients, one from each

group, required vascular exploration within 24 hours of

the operation secondary to venous congestion in the first

and arterial thrombosis in the second. Both of these

patients eventually required split-thickness skin grafting

for necrotic areas around their respective wounds. Two of

the patients in Group A had infections requiring irrigation

and debridement. One patient initially was treated for

synovial sarcoma with soft tissue resection and a medial

gastrocnemius flap. Postoperatively, the wound became

infected with Aspergillus, and despite numerous debrid-

ements, it remained infected. The limb was salvaged with

a rotationplasty. The second patient had a postoperative

infection and twice underwent irrigation and debridement

to aid wound healing. This patient ultimately required

hardware removal to achieve wound healing. The

remaining additional operations were for soft tissue cov-

erage secondary to wound-healing complications. These

were equally divided between the two groups.

Discussion

Two methods are available for management of the vascular

structures during a rotationplasty. These involve transec-

tion and reanastomosis of the vessels or retaining and

rotating the vessels with the leg. It is not clear if one

method results in superior outcomes. We asked whether the

two methods of vascular management differ regarding ABI

and rate of complications.

Two limitations of this study include the retrospective

nature and the small sample size. A retrospective study

design cannot be randomized and can be subject to bias.

With a small variable cohort, one should exercise caution

when generalizing the results.

The ABI is a well-described tool to indirectly measure

the adequacy of arterial circulation of the lower extremity

[24]. We used the ABI to evaluate the health of the vas-

cular system with two methods of vascular management.

Although the mean preoperative to postoperative changes

in ABI were similar in Group A, there was a trend toward a

lower ABI in the postoperative period, which partially

recovered with time. This likely was attributable to a

considerable decline in the ABI of two patients during the

early postoperative period. We cannot be certain of the

reasons for these findings, but we presume they were

related to swelling around the anastomosis. Only one

patient with a noticeable change in the ABI had a com-

plication. All other complications were in patients with

normal ABIs. A review of the literature finds other reports

of this method of vascular management. Sidiropoulos et al.

[31] reported finding no vascular complications in a series

of 34 patients managed with vascular resection and rean-

astomosis. They recommend this method of vascular

Table 1. Mean change in ankle brachial index

Group/Artery Preoperative Postoperative p Value

Group A

Posterior tibial 0.96 (0.89–1.00) 0.80 (0.64–1.05)* 0.28

Dorsalis pedis 0.98 (0.93–1.00) 0.57 (0.00–1.13)* 0.27

Group B

Posterior tibial 1.03 (0.93–1.10) 1.00 (0.78–1.31)� 0.09

Dorsalis pedis 0.97 (0.91–1.00) 0.97 (0.81–1.22)� 0.09

* 2.4 months postoperatively; �7.2 months postoperatively.

Table 2. Mean change in ankle brachial index

Group/Artery Preoperative Last p Value

Group A

Posterior tibial 0.96 (0.89–1.00) 0.96 (0.64–1.35)* 0.17

Dorsalis pedis 0.98 (0.93–1.00) 0.82 (0.00–1.13)* 0.27

Group B

Posterior tibial 1.03 (0.93–1.10) 0.98 (0.93–1.31)� 0.17

Dorsalis pedis 0.97 (0.91–1.00) 0.96 (0.81–1.22)� 0.16

* 23 months postoperatively; �7.7 months postoperatively.

Table 3. Mean change in preoperative to postoperative ankle bra-

chial index

Artery Group A Group B p Value

Posterior tibial 0.11 0.19 0.48

Dorsalis pedis 0.07 0.22 0.10

Table 4. Mean change in preoperative to final ankle brachial index

Artery Group A Group B p Value

Posterior tibial 0.26 0.10 0.24

Dorsalis pedis 0.43 0.12 0.27


123

management because of the improved resection margins,

surgical time, and low rate of complications. We found no

difference in complication rate between the two methods

but did find the vascular reconstruction took slightly more

time to perform.

Duplex ultrasound was performed in two patients to

evaluate the anastomosis for intimal hyperplasia after a

substantial interval decrease in the ABI. Surprisingly, we

did not observe a single case of hyperplasia. We postulate

the perioperative chemotherapy may have inhibited the

cellular proliferation required for hyperplasia. This

hypothesis is supported by the experience of using drug-

eluting stents to prevent restenosis after percutaneous

intervention for coronary artery disease [7, 26, 30].

We did experience some wound-healing problems at the

site of the rotation. The rate and type of complications we

found were similar to those described in other reports of

limb-sparing surgery [12, 14]. It could be theorized the

wound complications were secondary to a decrease in the

peripheral blood flow to the skin resulting from our

vascular ligation and reanastomosis; however, patients had

wound-healing problems in the group without shunting

procedures as well. Furthermore, the problems encountered

occurred in earlier cases, indicating a possible learning

curve associated with the procedure, an idea both senior

authors (BTB, JRN) support.

Several authors have reported using rotationplasty as a

successful treatment option for a failed limb salvage pro-

cedure, albeit with higher complication rates than primary

rotationplasty [5, 15]. The only patient in our cohort who

did not have osteosarcoma underwent rotationplasty after

failure of the primary resection for synovial sarcoma. After

the rotationplasty, the patient had no additional

complications.

There are some drawbacks to the rotationplasty. There is

a long and intensive period of physical therapy that should

be completed to ensure the limb is functional. This requires

commitment from not only the patient but also the patient’s

family because nearly all of these patients are juveniles.

Much has been written about the self-image of these

Fig. 4A–C A patient is shown

57 months after rotationplasty (A)wearing his prosthesis, (B) sitting

and (C) standing without his

prosthesis. He is clinically and

radiographically free of disease.

His wound healed with no skin

loss and his prosthesis is well

fitting and highly functional. He is

extremely active and enjoys inline

skating and bicycle riding (Vid-

eos 1 and 2, Supplemental

Website Materials; supplemental

materials are available with the

online version of CORR).


123

patients after they have their surgeries [25]. It is no doubt

hard to undergo major surgery for an illness, especially a

serious illness like cancer, only to have the residual be an

extremity that is deformed and initially not functional

(Fig. 4). However, published reports suggest patients are

well adjusted (in terms of SF-36 mental health scores) to

the final outcome [1, 16]. One concern more recently has

been the long postoperative hospital stay compared with

amputation. In the age of managed care, prolonged hospital

stays may become harder to justify; however, it is our

opinion that a patient’s well-being should never be com-

promised secondary to cost. Finally, the surgeon must

consider, if the rotationplasty fails, the patient will be left

with a considerably shorter residual limb than if transfe-

moral amputation had been the primary procedure.

Reconstruction with an expandable endoprosthesis could

be considered an alternative option for many of these

patients. Patients with intraarticular extension of the tumor

and those with failed resection of a synovial sarcoma were

not candidates for an expandable prosthesis. In addition,

numerous orthopaedic oncologists, including the senior

author (JRN), have expressed concern regarding the

reported long-term durability and revision rates of the

expandable prosthetic reconstructions [8, 28, 29].

We evaluated two methods of vascular management

with the Van Nes rotationplasty and were unable to show a

difference in the ABI or rate of complications between the

two methods of vascular management. From this, we

conclude resection of the vessels with reanastomosis is a

surgically sound alternative to coiling of the vessels when

the tumor dictates en bloc vascular resection.

Acknowledgments We thank Dr. Craig Walker for assistance in

interpretation of the MRIs, Kerby Selmer for assistance with the

patient database, and Dr. Kaleb Michaud for assistance with the

statistical analysis.

References

1. Akahane T, Shimizu T, Isobe K, Yoshimura Y, Fujioka F, Kato

H. Evaluation of postoperative general quality of life for patients

with osteosarcoma around the knee joint. J Pediatr Orthop B.

2007;16:269–272.

2. Alman BA, Krajbich JI, Hubbard S. Proximal femoral focal

deficiency: results of rotationplasty and Syme amputation. J BoneJoint Surg Am. 1995;77:1876–1882.

3. Blewitt N, Pooley J, Berridge D, Chamberlain JC. Pseudoaneu-

rysm of the superficial femoral artery: an unusual complication

following rotationplasty. Clin Orthop Relat Res. 1994;306:171–

174.

4. Borggreve J. Kniegelenkseratz durch das in der Beinlangsachse

um 180 Degree gedrehte Fussgelenk. Arch Orthop Unfall Chir.

1930;28:175.

5. Brigman BE, Kumagai SG, McGuire MH. Rotationplasty after

failed limb-sparing tumor surgery: a report of two cases. ClinOrthop Relat Res. 2003;415:254–260.

6. Cammisa FP Jr, Glasser DB, Otis JC, Kroll MA, Lane JM, Healey

JH. The Van Nes tibial rotationplasty: a functionally viable

reconstructive procedure in children who have a tumor of the distal

end of the femur. J Bone Joint Surg Am. 1990;72:1541–1547.

7. Degertekin M, Regar E, Tanabe K, Smits PC, van der Giessen

WJ, Carlier SG, de Feyter P, Vos J, Foley DP, Ligthart JM,

Popma JJ, Serruys PW. Sirolimus-eluting stent for treatment of

complex in-stent restenosis: the first clinical experience. J AmColl Cardiol. 2003;41:184–189.

8. Eckardt JJ, Safran MR, Eilber FR, Rosen G, Kabo JM. Expand-

able endoprosthetic reconstruction of the skeletally immature

after malignant bone tumor resection. Clin Orthop Relat Res.

1993;297:188–202.

9. Eilber FR, Morton DL, Eckardt J, Grant T, Weisenburger T.

Limb salvage for skeletal soft tissue sarcomas: multidisciplinary

preoperative therapy. Cancer. 1984;53:2579–2584.

10. Enneking WF. A system of staging musculoskeletal neoplasms.


11. Fortner JG, Kim DK, Shiu MH. Limb-preserving vascular sur-

gery for malignant tumors of the lower extremity. Arch Surg.

1977;112:391–394.

12. Futani H, Minamizaki T, Nishimoto Y, Abe S, Yabe H, Ueda T.

Long-term follow-up after limb salvage in skeletally immature

children with a primary malignant tumor of the distal end of the

femur. J Bone Joint Surg Am. 2006;88:595–603.

13. Gottsauner-Wolf F, Kotz R, Knahr K, Kristen H, Ritschl P, Salzer

M. Rotationplasty for limb salvage in the treatment of malignant

tumors at the knee: a follow-up study of seventy patients. J BoneJoint Surg Am. 1991;73:1365–1375.

14. Hanlon M, Krajbich JI. Rotationplasty in skeletally immature

patients: long-term followup results. Clin Orthop Relat Res.

1999;358:75–82.

15. Hillmann A, Gosheger G, Hoffmann C, Ozaki T, Winkelmann W.

Rotationplasty: surgical treatment modality after failed limb

salvage procedure. Arch Orthop Trauma Surg. 2000;120:555–

558.

16. Hopyan S, Tan JW, Graham HK, Torode IP. Function and upright

time following limb salvage, amputation, and rotationplasty for

pediatric sarcoma of bone. J Pediatr Orthop. 2006;26:405–408.

17. Imparato AM, Roses DF, Frances KC, Lewis MM. Major vas-

cular reconstruction for limb salvage in patients with soft tissue

and skeletal sarcomas of the extremities. Surg Gynecol Obstet.1978;147:891–896.

18. Jacobs PA. Limb salvage and rotationplasty for osteosarcoma in

children. Clin Orthop Relat Res. 1984;188:217–222.

19. Karakousis CP, Emrich LJ, Rao U, Krishnamsetty RM. Feasi-

bility of limb salvage and survival in soft tissue sarcomas.

Cancer. 1986;57:484–491.

20. Kawai A, Hashizume H, Inoue H, Uchida H, Sano S. Vascular

reconstruction in limb salvage operation for soft tissue tumors of

the extremities. Clin Orthop Relat Res. 1996;332:215–222.

21. Koperna T, Teleky B, Vogl S, Windhager R, Kainberger F,

Schatz KD, Kotz R, Polterauer P. Vascular reconstruction for

limb salvage in sarcoma of the lower extremity. Arch Surg.

1996;131:1103–1107; discussion 1108.

22. Krajbich JI. Modified Van Nes rotationplasty in the treatment of

malignant neoplasms in the lower extremities of children. ClinOrthop Relat Res. 1991;262:74–77.

23. Krajbich JI, Carrol NC. Van Nes rotationplasty with segmental

limb resection. Clin Orthop Relat Res. 1990;256:7–13.

24. McGee SR, Boyko EJ. Physical examination and chronic lower-

extremity ischemia: a critical review. Arch Intern Med.

1998;158:1357–1364.

25. Merkel KD, Gebhardt M, Springfield DS. Rotationplasty as a

reconstructive operation after tumor resection. Clin Orthop RelatRes. 1991;270:231–236.


123

26. Morice MC, Serruys PW, Sousa JE, Fajadet J, Ban Hayashi E,

Perin M, Colombo A, Schuler G, Barragan P, Guagliumi G,

Molnar F, Falotico R, RAVEL Study Group. RAndomized study

with the sirolimus-coated Bx VElocity balloon-expandable stent

in the treatment of patients with de novo native coronary artery

lesions. A randomized comparison of a sirolimus-eluting stent

with a standard stent for coronary revascularization. N Engl JMed. 2002;346:1773–1780.

27. Nambisan RN, Karakousis CP. Vascular reconstruction for limb

salvage in soft tissue sarcomas. Surgery. 1987;101:668–677.

28. Neel MD, Wilkins RM, Rao BN, Kelly CM. Early multicenter

experience with a noninvasive expandable prosthesis. Clin Ort-hop Relat Res. 2003;415:72–81.

29. Rougraff BT, Simon MA, Kneisl JS, Greenberg DB, Mankin HJ.

Limb salvage compared with amputation for osteosarcoma of the

distal end of the femur: a long-term oncological, functional, and

quality-of-life study. J Bone Joint Surg Am. 1994;76:649–656.

30. Serruys PW, Degertekin M, Tanabe K, Abizaid A, Sousa JE,

Colombo A, Guagliumi G, Wijns W, Lindeboom WK, Ligthart J,

de Feyter PJ, Morice MC, RAVEL Study Group. Intravascular

ultrasound findings in the multicenter, randomized, double-blind

RAVEL (RAndomized study with the sirolimus-eluting VElocity

balloon-expandable stent in the treatment of patients with de

novo native coronary artery lesions) trial. Circulation.

2002;106:798–803.

31. Sidiropoulos A, Tjan TD, Soeparwata R, Wuismann P,

Winkelmann W, Scheld HH. Reconstructive vascular surgery in

rotationplasty for malignant tumors of the femur. Int Angiol.1994;13:327–330.

32. Steed DL, Peitzman AB, Webster MW Jr, Ramasastry SS,

Goodman MA. Limb sparing operations for sarcomas of the

extremities involving critical arterial circulation. Surg GynecolObstet. 1987;164:493–498.

33. Taminiau AH, Arndt JW, van Bockel JH, Steenhoff JR, Pauwels

EK. Evaluation of the lymph flow with lymphoscintigraphy after

rotationplasty for the treatment of bone tumors. J Bone Joint SurgAm. 1992;74:101–105.

34. Torode IP, Gillespie R. Rotationplasty of the lower limb for

congenital defects of the femur. J Bone Joint Surg Br.

1983;65:569–573.

35. Winkelmann WW. Rotationplasty. Orthop Clin North Am.

1996;27:503–523.


123

ORIGINAL ARTICLE

Late Results of Absorbable Pin Fixation in the Treatmentof Radial Head Fractures

Panagiotis K. Givissis MD, PhD, Panagiotis D. Symeonidis MD,

Konstantinos T. Ditsios MD, PhD, Panagiotis S. Dionellis MD,

Anastasios G. Christodoulou MD, PhD

Received: 27 February 2007 / Accepted: 15 January 2008 / Published online: 4 March 2008


Abstract The use of bioabsorbable pins with prolonged

degradation periods for fracture fixation has raised con-

cerns about adverse soft tissue reactions, including

seromas, discharging sinuses, or osteolytic changes. We

asked whether bioabsorbable pins of self-reinforced poly-

lactic acid polymer used in radial head fractures resulted in

such reactions. We retrospectively reviewed 21 patients

followed a minimum of 36 months (mean, 81 months;

range, 36–136 months). There were nine Mason II, 10

Mason III, and two Mason IV fractures, which were eval-

uated clinically and radiographically. All fractures healed

well with no radiographic signs of osteolysis. The mean

Mayo Elbow Performance score was 93.8 (range, 20–100),

which is comparable to the outcome of historical groups

with radial head arthroplasty. The mean range of flexion of

the elbow was 9� to 132�, with 79� pronation and 77�supination. The grip strength of the operated arm was not

affected in comparison to the contralateral arm (mean

range, 38.6 versus 40.9 kg). No material-related adverse

effects were observed during and beyond the degradation

period. Our data suggest concerns about soft tissue or bony

reactions from these materials in radial head fractures are

not justified.



of evidence.

Introduction

The best method for treating displaced radial head fractures

in adults remains controversial [6, 7, 12]. The decision

regarding whether the fractured head is salvageable by

means of internal fixation is largely based on subjective

criteria, including the surgeon’s experience and preference

and the equipment available. Whereas radial head

replacement is gaining popularity, there is little doubt a

salvageable and properly fixed radial head provides the

best option for a long-term functional outcome [2, 7, 15].

Various metallic implants are being used for operative

fixation of radial head fractures, including minifragment

screws, Kirschner wires, Herbert screws, and miniplates

[10, 13, 19]. However, during the last two decades, bio-

absorbable pins have been introduced to treat radial head

fractures [9, 21, 26]. Their widespread acceptance has been

hampered partly by reports regarding soft tissue reactions

during the fast degradation process and suboptimal

mechanical properties of these implants [4, 24]. Second-

generation implants composed of self-reinforced (SR)

poly-L-lactic acid (PLLA) with improved strength and a

slower degradation rate were intended to eliminate these

drawbacks and apparently did so [22, 24, 25].

Nevertheless, the prolonged degradation period of the

new implants has raised continuing concerns regarding









P. K. Givissis, P. D. Symeonidis, K. T. Ditsios,

P. S. Dionellis, A. G. Christodoulou

First Orthopaedic Department, Aristotle University of

Thessaloniki ‘‘G Papanikolaou’’ Hospital, Thessaloniki, Greece

P. K. Givissis (&)

9, Papanikolaou Street, Panorama, Mail Box 215, 55210

Thessaloniki, Greece


123


DOI 10.1007/s11999-008-0134-6

whether the adverse soft tissue reactions of these materials

are in fact not diminished but rather take longer to appear

[3]. The strength of SR-PLLA rods decreases to the level of

cancellous bone in 36 weeks, but total loss of implant mass

takes much longer [11, 30]. Remnants of SR-PLLA plates

have been detected as long as 5 years after fixation of

mandibular osteotomies in sheep [28]. This necessitates

clinical studies with a long followup [4, 23].

Furthermore, such studies need to focus on the clinical

outcome of comminuted radial head fractures in particular.

Recently published series underline the substantial con-

troversy regarding the role of open reduction internal

fixation (ORIF) versus arthroplasty for Mason Type III and

Type IV fractures [15, 27]. Although some authors con-

sider severe comminution an absolute indication for

replacement of the radial head, advocates of the ORIF

claim favorable clinical outcomes regardless of the frac-

ture’s complexity [6, 29].

We asked whether adverse reactions, such as seroma

formation, discharging sinuses, or osteolytic reactions,

would occur during and beyond the material’s degradation

period. We then asked whether patients would achieve

reasonable functional scores and whether function scores

related to fracture type (Mason classification [16]), age, or

length of followup.


From a group of 68 patients admitted with closed radial

head fractures, we retrospectively reviewed 25 selected

patients treated with ORIF with absorbable pins from

September 1995 until February 2004. We included only

Grades II to IV fractures according to the McKee and

Jupiter modification [17] of the Mason classification [16]

and surgery in the first 48 hours after the traumatic event.

We excluded 23 patients for whom we judged salvage of

the radial head by internal fixation was impractical.

Another 20 patients were treated by other means of ORIF

(screws, Kirschner wires, miniplates) and also were

excluded from the study. Two of the 25 patients were lost

to followup, leaving 23 for evaluation. There were 12 men

and nine women with an average age at the time of surgery

of 37.8 years (range, 18–78 years; Table 1). All fractures

were secured with the use of SR-PLLA pins (SmartPin1;

formerly Bionx Implants Oy, now ConMed Livantec

Biomaterials Ltd, Tampere, Finland). The clinical outcome

was assessed and compared with two historical groups

using radial head arthroplasty [2, 18]. The minimum

followup was 36 months (median, 97 months; range,

36–136 months).

All operations were performed by the senior author

(PKG). With the patient supine, under axillary block or

general anesthesia, and the use of a pneumatic tourniquet, a

straight lateral 5- to 6-cm incision was made over the radial

head and through a modified Kocher approach and the

fracture was identified. We reduced the major fragments

with the aid of the convex surface of a McDonald instru-

ment and temporarily secured them with miniclamps.

Smaller fragments were reduced and compressed in posi-

tion manually. We used pronation/supination maneuvers

during the reduction process. The fractures were fixed by

two to five predrilled pins (Fig. 1). When the fracture

included the head only, we inserted the pins parallel to the

joint line. When the fracture included the subcapital region,

additional pins were inserted obliquely to the axis of the

joint line. In one case, we removed the comminuted head

from the surgical site, fixed it ex situ with bioabsorbable

pins, and reinserted and attached it to the radial neck with

long (40-mm length) pins in an oblique direction. Any

protruding part of the pins was cut flat at the bone level

with a Number 15 blade. We fixed the major fragments

with 1.5- to 2.0-mm pins of 20- to 30-mm length. Smaller

fragments were either fixed with 1.1-mm pins or packed

manually. Stability and range of motion were tested in-

traoperatively. When present, concomitant lateral ligament

injuries were repaired primarily with bone anchors. The

wound was closed in layers over a drain and we obtained a

postoperative radiograph.

Postoperatively, an above-elbow posterior splint was

applied for up to 2 weeks followed by early mobilization.

A strengthening program was initiated 4 weeks postoper-

atively, including active-assisted and active free weights

and wall pulley exercises.

We performed complete clinical and radiographic

evaluations in 21 of the 23 patients; two patients were

interviewed over the telephone. Patients were interviewed

and examined by one of two independent observers (PDS,

PSD) who did not participate in any of the operations. All

possible adverse effects and complications were recorded.

We evaluated the functional outcome according to the

Mayo Elbow Performance score [20]. This continuous

score combines four criteria: pain, motion, stability, and

function of the affected elbow. The ranges of motion of

the affected and contralateral elbow also were recorded

separately. Grip strengths of the affected and the contra-

lateral arm were measured with a hydraulic hand

dynamometer (Jamar1; Nex Gen Ergonomics Inc,

Quebec, Canada).

We (PKG, AGC) retrospectively reclassified the inju-

ries; in case of discrepancy, final assessment was based on

concurrence. In four of the 25 cases, some of the radio-

graphs were of poor quality or missing from the patients’

files. The radiographic evaluation included plain radio-

graphs in anteroposterior and lateral views in all patients

(Fig. 2).

1218 Givissis et al. Clinical Orthopaedics and Related Research

123

Categorical variables were presented with frequencies

and percentages. Continuous variables were summarized

with means and 95% confidence intervals and with median

and interquartile ranges whenever the data were not nor-

mally distributed. The grip strengths of the affected and the

normal elbow were compared with the Wilcoxon signed-

rank test for paired samples. Data of two published series

of patients with radial head fractures treated with arthro-

plasty (titanium prosthesis and metal radial heads) were

extracted and compared with data from our sample of

patients [2, 18].

We evaluated the association of categorical variables

(gender distribution and Mason type between groups) with

the chi square test or Fisher’s exact test when the expected

marginal cell count was less than five. Differences in

clinical scores and in variables on range of motion between

groups (Mason II and Mason III to IV fracture types) were

assessed with either Student’s t test for unpaired samples or

the Mann-Whitney U test whenever the variables deviated

from normality; tests were two-tailed. The age and

followup times of the two groups were similar. Analyses

were conducted using SPSS 14 (SPSS Inc, Chicago, IL).

Results

We observed no early or late occurrences of clinically

evident seroma formation, discharging sinus over the

fracture site, or osteolytic changes of the radial head in any

patient. For 15 of the 21 patients, the followup exceeded

5 years, which is the maximum degradation period of the

specific implant.

The median Mayo Elbow Performance score was 93.8

(range, 20–100; Table 1). Three patients with a score of 85

had mild pain on activity. The mean range of flexion of the

elbow was 9� to 132�, with 79� pronation and 77� supi-

nation. The grip strength of the surgically treated arm was

not affected in comparison to the contralateral arm (mean

range, 38.6 versus 40.9 kg). One patient with a poor result

had a fixed flexion deformity resulting from a complete

Table 1. Demographic data, radiographic classification, measurements, and recorded complications

Patient number Gender Age

(years)

Followup

(months)

Mason

type

Mayo

score

Flexion

(degrees)

Pronation/

supination

(degrees)

Grip strength

(affected/normal)

(kg)

Complications

1 Male 19 70 II 95 5–115 80/50 45/50 Supination restriction

2 Male 47 53 II 100 0–140 85/80 54/53 Superficial infection

3 Male 32 63 III 100 0–145 45/90 35/57 Pronation restriction

4 Female 21 46 III 85 30–125 80/60 22/25

5 Female 65 106 IV 100 10–125 65/70 25/30

6 Female 65 39 III 85 10–135 90/80 20/19

7 Male 23 136 II 100 0–120 80/70 54/57

8 Female 18 79 IV 85 20–130 80/65 50/48

9 Male 40 97 III 100 0–118 90/90 51/55

10 Female 55 50 III 100 10–135 85/80 45/40

11 Male 22 100 III 100 0–140 80/80 45/46

12 Female 19 118 III 100 0–150 90/90 23/20

13 Male 25 66 III 100 0–135 80/80 55/58

14 Male 61 120 III 100 0–140 80/80 36/29

15 Female 40 61 II 100 0–145 80/80 35/40

16 Male 30 119 II 100 0–135 80/80 44/25

17 Female 45 97 II 100 0–130 80/80 24/30

18 Male 38 36 II 100 0–140 80/80 55/55

19 Male 28 36 II 20 95–100 70/65 40/55 Medial heterotopic

ossification, stiffness

20 Male 24 118 II 100 0–142 90/90 50/52

21 Female 78 104 III 100 15–125 70/75 18/20

Mean 37.86 81.62 93.81 9.29–131.90 79.05–76.90 38.57/40.90

Standard deviation 17.99 32.10 17.74 21.29–11.96 10.20–10.43 12.98/14.16

Median 38 97 100 0–125 80–80 44/45

Minimum, maximum 18, 78 36–136 20, 100 0, 95–100, 150 45, 90–50, 90 18, 55/19, 58

Volume 466, Number 5, May 2008 Late Results of Absorbable Pin Fixation 1219

123

bony bridge of heterotopic ossification at the medial side of

the elbow despite the full pronation/supination range of

motion. He was offered and accepted soft tissue release and

removal of the heterotopic ossification with improvement

of the range of motion from 30� to 120�. No other patient

underwent a second operation. The two patients inter-

viewed over the telephone reported no pain or alteration of

their activities resulting from the fracture.

Fracture severity did not correlate with clinical outcome

(Table 1). The median Mayo score was 100 for Mason II

and Mason III to IV fracture type groups. Range of motion

was similar for the Mason II and Mason III-IV groups

(mean flexion 130� versus 134�, respectively). Pronation

and supination were also similar (Table 2).

We identified no major complications. One patient had a

superficial postoperative infection resulting from Staphy-

lococcus epidermidis, which was treated successfully with

oral antibiotics. One patient had residual moderate insta-

bility. Two cases of radiographically apparent heterotopic

ossification were seen, one over the annular ligament

without any functional impairment and another over the

medial aspect of the elbow with a fixed flexion contracture

(mentioned above). The latter patient had not adhered to

the routine rehabilitation protocol, having prolonged the

immobilization period arbitrarily followed by aggressive

physiotherapy. On the postoperative films of four patients,

we observed a step-off between the fragments of as much

as 1.5 mm although the patients appeared to have no

clinical sequelae.

Discussion

Qualities of an ideal fixation material include adequate

strength and rigidity, lack of adverse reactions, lack of

interference with bone healing, lack of visibility and pal-

pability, and avoidance of an implant removal operation.

Early reports of adverse effects in fracture fixation from the

use of bioabsorbable materials mainly composed of poly-

glycolide acid (PGA) have led to the development of new

implants with a longer degradation period, such as the SR-

PLLA. However, this has raised additional concerns

regarding the possible late occurrence of such reactions.

We therefore asked whether adverse reactions, such as

seroma formation, discharging sinuses, or osteolytic reac-

tions, would occur during and beyond the material’s

degradation period.

We did not have a control group with which we could

compare functional outcomes of alternative approaches in

the long term. Rather, we compared our results with pub-

lished results of historical groups in which the same type of

fractures was treated and the same score was used for

assessment of elbow function. Another limitation is the

inclusion of Mason Type II fractures in our study group.

According to some studies, these injuries may yield a good

clinical outcome by nonoperative treatment [1, 31] or

delayed head excision in selected patients [5]. However,

we agree with Morrey [19] that because today’s patients

demand a greater degree of function, internal fixation of

radial head fractures is being widely used for Type II

fractures. Moreover, a mismatch between radiographic and

intraoperative evaluations of these fractures, the latter

always being more severe, was noted in some of our cases.

Regardless, we found fracture severity did not correlate

Fig. 1A–B (A) This intraoperative figure shows drilling of the radial

head after reduction of the fracture. (B) The SR-PLLA SmartPin1 is

being inserted in the radial head.


123

Fig. 2A–D (A) An anteroposterior radiograph shows a Mason Type

III fracture of the radial head. (B) The lateral radiograph of the same

patient shows the fracture’s comminution. (C) A postoperative

radiograph obtained at the final followup shows successful

reconstruction of the radial head. (D) A postoperative lateral

radiograph shows fracture union and satisfactory alignment of the

radiohumeral joint.

Table 2. Comparison of Mason II and Mason III to IV groups

Parameter Mason II (n = 9) Mason III–IV (n = 12) p Value

Age (years)* 32.67 (24.87–40.47) 41.75 (27.91–55.59) 0.221�

Followup (months)* 80.67 (51.59–109.74) 82.33 (64.02–100.65) 0.910�

Flexion (degrees)* 129.67 (118.08–141.25) 133.58 (127.63–139.53) 0.472�

Loss of extension (degrees)� 0 (0–2.5) 5 (0–13.75) 0.255§

Pronation (degrees)� 80.0 (80.0–82.50) 80.0 (72.50–88.75) 0.972§

Supination (degrees)* 75.00 (65.99–84.01) 78.33 (72.23–84.44) 0.483�

Mayo score (points)� 100 (97.50–100) 100 (88.75–100) 0.883§

* Values expressed as means, with 95% confidence intervals in parentheses; �values expressed as medians, with interquartile ranges in

parentheses; �Student’s t test; §Mann-Whitney U test.


123

with outcome in our series and this agrees with the study by

Koslowsky et al. [15].

Previous studies suggest, among the various clinical

applications of bioabsorbable implant for fracture fixation,

their use in radial head fractures seems to have the most

benign clinical course. Bostman and Pihlajamaki [4]

reviewed 2528 patients in whom such implants were used

in more than 20 applications. They report patients with

radial head fractures had the lowest adverse reaction in

their series (0.3%), which is in conformity with our series.

This has been partly attributed to an inverse association

between vascularity of the local tissues and the implant’s

reaction rate. Recently, a prospective, randomized study

was published [8] in which bioabsorbable polylactide

implants were compared with standard metal fixation for

treatment of displaced radial head fractures. The authors

report equally satisfactory results for both methods; how-

ever, their followup is limited to 2 years, whereas material-

related foreign body reactions can emerge as late as 4 or

5 years after the original surgery for fracture fixation [3, 4].

Our data confirm these favorable results until and beyond

the complete absorption of this implant. Another bioab-

sorbable material that has been used is PGA [9, 21]. This

material lacks a methyl group, which makes it hydrophilic

and thus more susceptible to hydrolysis and faster degra-

dation than polylactide, usually within 6 months after

insertion [24]. It has been reported to have a high incidence

of soft tissue reactions varying from 2.0% to 46.7%, which

created skepticism regarding its clinical application [4].

We are unaware of reports of delayed adverse effects

from using SR-PLLA pins. Polylactic acid is a derivative of

cyclic diesters of lactic acid from which it has been pro-

duced by ring-opening polymerization resulting in a poly-

alpha-hydroxy derivative of the original acid. The methyl

group makes polylactic acid hydrophobic and is thus

resistant to hydrolysis [22]. Its mechanical in vitro degra-

dation time is 9 months, and animal studies show complete

resorption of SR-PLLA implants within 5 years [8, 14].

Table 4. Comparison of absorbable pin fixation and metal radial head (historical controls)

Parameter Absorbable pin fixation (n = 12) Metal radial heads (n = 9) p Value

Gender 1.000�

Males 7 (58.3%) 5 (55.6%)

Females 5 (41.7%) 4 (44.4%)

Mason type 0.331�

III 10 (83.3%) 5 (55.6%)

IV 2 (16.7%) 4 (44.4%)

Age (years)* 41.75 (27.91–55.59) 56.11 (49.37–62.85) 0.056§

Followup (months)* 82.33 (64.01–100.65) 38.78 (32.36–45.19) \ 0.001§

Flexion (degrees)* 133.58 (127.63–139.53) 140.00 (131.16–148.84) 0.175§

Loss of extension (degrees)� 5.00 (0–13.75) 8.00 (2.00–15.50) 0.312k

Pronation (degrees)� 80.00 (72.50–88.75) 84.00 (73.00–87.50) 0.829k

Supination (degrees)* 78.33 (72.23–84.44) 71.67 (64.23–79.10) 0.135§

Mayo score (points)� 100 (88.75–100) 83.00 (64.50–85.00) 0.001k


parentheses; �Fisher’s exact test; §Student’s t-test; kMann-Whitney U test.

Table 3. Comparison of absorbable pin fixation and titanium prosthesis (historical controls)

Parameter Absorbable pin fixation (n = 10) Titanium prosthesis (n = 16) p Value

Gender 1.000�

Males 5 (50.0%) 8 (50.0%)

Females 5 (50.0%) 8 (50.0%)

Age (years)* 41.80 (26.50–57.10) 44.94 (37.23–52.65) 0.658§

Followup (months)* 80.30 (58.28–102.32) 33.69 (27.42–39.95) 0.001§

Flexion (degrees)* 134.80 (127.79–141.81) 108.94 (86.42–131.45) 0.031§

Mayo score (points)� 100 (96.25–100) 87.50 (80.00–98.75) 0.012k


parentheses; �chi square test; §Student’s t test; kMann-Whitney U test.


123

The SR technique strengthens the polymer and gives it

metal-like mechanical properties without influencing the

degradation process.

Our data using an absorbable pin fixation group suggest

favorable outcomes compared with use of a titanium

prosthesis in Mason Type III radial head fractures

(Tables 3, 4) [2, 18]. The followup was longer in our

absorbable pin fixation group than in the reported arthro-

plasty groups. Compared with the study by Ashwood et al.

[2], flexion and Mayo score were greater in the absorbable

pin fixation group than in the titanium prosthesis group.

Compared with the study by Moro et al. [18], there were no

differences between the two groups with respect to flexion,

loss of extension, supination, or pronation. However, the

Mayo score was greater in our absorbable pin fixation

group than in the titanium prosthesis group.

We consider the midterm outcome of internal fixation of

displaced radial head and neck fractures with PLLA pins

satisfactory in our series. This was documented by a

combination of subjective and objective clinical criteria,

such as pain, range of motion, alignment, stability, and grip

strength of the affected arm.

Our results were superior to those of published series in

which the comminuted fractures were treated with metallic

replacement [2, 18]. Although a recent comparative study

favors the bipolar radial head prosthesis versus ORIF for

treatment of Mason Type III fractures, the followup is

rather short for definite conclusions [27]. The preferential

use of either ORIF or replacement for comminuted radial

head fractures continues to cause debate and controversy.

Whereas the exact clinical and radiographic criteria that

dictate the decision for a head sacrifice have not yet been

established [29], some authors believe, even in commi-

nuted fractures, an initial attempt for internal fixation

should be made; we agree with this concept [6, 12, 15]. In

any case, the surgeon should be prepared for any operation,

including radial head sacrifice or replacement, and the final

decision should be made intraoperatively.

The use of bioabsorbable pins in the treatment of radial

head fractures has yielded satisfactory midterm clinical and

radiographic outcomes. Concerns about soft tissue reac-

tions from the use of these materials in radial head fractures

are not justified according to our results, having overcome

the maximum degradation period.

Acknowledgments We thank Bettina Haidich for assistance with

statistical analysis of the data.

References

1. Akesson T, Herbertsson P, Josefsson PO, Hasserius R, Besjakov

J, Karlsson MK. Primary nonoperative treatment of moderately

displaced two-part fractures of the radial head. J Bone Joint SurgAm. 2006;88:1909–1914.

2. Ashwood N, Bain GI, Unni R. Management of Mason type-III

radial head fractures with a titanium prosthesis, ligament repair,

and early mobilization. J Bone Joint Surg Am. 2004;86:274–280.

3. Bostman O, Pihlajamaki H. Clinical biocompatibility of biode-

gradable orthopaedic implants for internal fixation: a review.

Biomaterials. 2000;21:2615–2621.

4. Bostman OM, Pihlajamaki HK. Adverse tissue reactions to bio-

absorbable fixation devices. Clin Orthop Relat Res. 2000;371:

216–227.

5. Broberg MA, Morrey BF. Results of delayed excision of the

radial head after fracture. J Bone Joint Surg Am. 1986;68:669–

674.

6. Esser RD, Davis S, Taavao T. Fractures of the radial head treated

by internal fixation: late results in 26 cases. J Orthop Trauma.1995;9:318–323.

7. Furry KL, Clinkscales CM. Comminuted fractures of the radial

head: arthroplasty versus internal fixation. Clin Orthop Relat Res.1998;353:40–52.

8. Helling HJ, Prokop A, Schmid HU, Nagel M, Lilienthal J, Rehm

KE. Biodegradable implants versus standard metal fixation for

displaced radial head fractures: a prospective, randomized, mul-

ticenter study. J Shoulder Elbow Surg. 2006;15:479–485.

9. Hirvensalo E, Bostman O, Rokkanen P. Absorbable polyglyco-

lide pins in fixation of displaced fractures of the radial head. ArchOrthop Trauma Surg. 1990;109:258–261.

10. Hotchkiss RN. Displaced fractures of the radial head: internal

fixation or excision? J Am Acad Orthop Surg. 1997;5:1–10.

11. Hughes TB. Bioabsorbable implants in the treatment of hand

fractures: an update. Clin Orthop Relat Res. 2006;445:169–174.

12. Ikeda M, Sugiyama K, Kang C, Takagaki T, Oka Y. Comminuted

fractures of the radial head: comparison of resection and internal

fixation. Surgical technique. J Bone Joint Surg Am.2006;88(suppl 1 pt 1):11–23.

13. Josten C, Korner J, Lill H. Radiuskopfchenfrakturen In: Josten C,

Lill H, eds. Ellenbogen Verletzungen: Biomechanik, Diagnose,Therapie. Heidelberg, Germany: Steinkopf Verlag; 1997:137–149.

14. Jukkala-Partio K, Pohjonen T, Laitinen O, Partio EK, Vasenius J,

Toivonen T, Kinnunen J, Tormala P, Rokkanen P. Biodegrada-

tion and strength retention of poly-L-lactide screws in vivo: an

experimental long-term study in sheep. Ann Chir Gynaecol.2001;90:219–224.

15. Koslowsky TC, Mader K, Gausepohl T, Pennig D. Reconstruc-

tion of Mason type-III and type-IV radial head fractures with a

new fixation device: 23 patients followed 1–4 years. Acta Orthop.2007;78:151–156.

16. Mason ML. Some observations on fractures of the head of the

radius with a review of one hundred cases. Br J Surg.1954;42:123–132.

17. McKee MD, Jupiter JB. A contemporary approach to the man-

agement of complex fractures of the distal humerus and their

sequelae. Hand Clin. 1994;10:479–494.

18. Moro JK, Werier J, MacDermid JC, Patterson SD, King GJ.

Arthroplasty with a metal radial head for unreconstructible

fractures of the radial head. J Bone Joint Surg Am. 2001;83:

1201–1211.

19. Morrey BF. Radial head fracture. In: Morrey BF, ed. The Elbow andits Disorders. 3rd ed. Philadelphia, PA: Saunders; 2000:341–364.

20. Morrey BF, Adams RA. Semiconstrained arthroplasty for the

treatment of rheumatoid arthritis of the elbow. J Bone Joint SurgAm. 1992;74:479–490.

21. Pelto K, Hirvensalo E, Bostman O, Rokkanen P. Treatment of

radial head fractures with absorbable polyglycolide pins: a study

on the security of the fixation in 38 cases. J Orthop Trauma.1994;8:94–98.

22. Peltoniemi HH, Hallikainen D, Toivonen T, Helevirta P, Waris T.

SR-PLLA and SR-PGA miniscrews: biodegradation and tissue


123

reactions in the calvarium and dura mater. J CraniomaxillofacSurg. 1999;27:42–50.

23. Prokop A, Jubel A, Hahn U, Dietershagen M, Bleidistel M, Peters

C, Hofl A, Rehm KE. A comparative radiological assessment of

polylactide pins over 3 years in vivo. Biomaterials. 2005;26:

4129–4138.

24. Prokop A, Jubel A, Helling HJ, Eibach T, Peters C, Baldus SE,

Rehm KE. Soft tissue reactions of different biodegradable poly-

lactide implants. Biomaterials. 2004;25:259–267.

25. Prokop A, Jubel A, Helling HJ, Udomkaewkanjana C, Brochha-

gen HG, Rehm KE. [New biodegradable polylactide implants

(Polypin-C) in therapy for radial head fractures] [in German].

Chirurg. 2002;73:997–1004.

26. Rehm KE, Helling HJ, Gatzka C. [New developments in the

application of resorbable implants] [in German]. Orthopade.1997;26:489–497.

27. Ruan HJ, Fan CY, Liu JJ, Zeng BF. A comparative study of

internal fixation and prosthesis replacement for radial head

fractures of Mason type III. Int Orthop. 2007 Oct 16 [Epub ahead

of print].

28. Suuronen R, Pohjonen T, Hietanen J, Lindqvist C. A 5-year in

vitro and in vivo study of the biodegradation of polylactide

plates. J Oral Maxillofac Surg. 1998;56:604–614; discussion

614–605.

29. Tejwani NC, Mehta H. Fractures of the radial head and neck:

current concepts in management. J Am Acad Orthop Surg.2007;15:380–387.

30. Waris E, Ashammakhi N, Kaarela O, Raatikainen T, Vasenius J.

Use of bioabsorbable osteofixation devices in the hand. J HandSurg Br. 2004;29:590–598.

31. Weseley MS, Barenfeld PA, Eisenstein AL. Closed treatment of

isolated radial head fractures. J Trauma. 1983;23:36–39.


123

ORIGINAL ARTICLE

Are Inflatable Nails an Alternative to Interlocked Nailsin Tibial Fractures?

Jesper Blomquist MD, Odd J. Lundberg Ing,

Nils R. Gjerdet DDS, PhD, Anders Mølster MD, PhD

Received: 17 September 2007 / Accepted: 30 January 2008 / Published online: 26 February 2008


Abstract Recently developed inflatable nails avoid

reaming and interlocking screws in tibial fractures and

reflect a new principle for stabilization of long bone frac-

tures. We asked if the bending stiffness, rotational rigidity,

or play (looseness of rotation) differed between an inflat-

able versus large-diameter reamed interlocked nails, and

whether the maximal torque to failure of the two bone-

implant constructs differed. In a cadaveric model, we

compared the biomechanical properties with those of an

interlocked nail in eight pairs of fractured tibial bones.

Bending stiffness, rotational rigidity, play (looseness in

rotation), and torsional strength within 20� rotation were

investigated using a biaxial servohydraulic testing system.

For all biomechanical variables, we found a large

interindividual variance between the pairs attributable to

bone quality (osteoporosis) for both fixation methods. The

inflatable nail had a higher bending stiffness, with a mean

difference of 58 N/mm, and a lower torsional strength,

with a mean difference of 13.5 Nm, compared with the

locked nail. During torsional testing we noted slippage

between the inflatable nail and bone. We observed no

differences in play or rotational rigidity. Given the lower

torsional strength we recommend caution with weight-

bearing until there are signs of fracture consolidation.

Introduction

Tibial fractures are the most common of the long bone

fractures with an annual incidence of two tibial shaft

fractures per 1000 individuals [1]. The choice of treatment

depends on fracture location, displacement, comminution,

soft tissue condition, and local tradition, but for displaced

shaft fractures in the adult, some studies recommend

reamed intramedullary nailing as the preferred method [1,

12, 15].

The reamed intramedullary nail provides biomechanical

advantages through its central placement, large diameter,

and locking screws that secure rotation and length. A small

incision for nail entry away from the fracture reduces the

risk of infection, and autotransplantation of bone through

reaming promotes bone healing [8]. The procedure has a

union rate greater than 95% for closed fractures in

numerous clinical studies [7]. The technique, however, is

not without disadvantages and complications. At many

centers, the procedure requires 60 to 100 minutes of sur-

gery [10, 20]. Fluoroscopy use during distal locking with a

free-hand technique puts surgeons at risk of exposing their

hands in the radiation field [20]. Complications are








J. Blomquist (&)

Department of Surgery, Haraldsplass Deaconess Hospital,

Ulriksdal 8, 5009 Bergen, Norway


J. Blomquist, A. Mølster

Department of Surgical Sciences, University of Bergen, Bergen,

Norway

O. J. Lundberg, N. R. Gjerdet

Department of Oral Sciences–Dental Biomaterials,

University of Bergen, Bergen, Norway

A. Mølster

Department of Orthopaedics, Haukeland University Hospital,

Bergen, Norway

123


DOI 10.1007/s11999-008-0169-8

common, with complication rates as much as 58% [16] and

reoperation rates as much as 35% [3, 11].

Inflatable nails are a relatively new device for intra-

medullary fixation of long bone fractures without reaming

or locking screws [6]. The implant allows fast, minimal

invasive and stable internal fixation for long bone fractures.

The interface between bone and implant differs radically

from traditional nails and is expected to have a different

effect on fracture stability and biology. Good clinical

results have been reported for this device for humeral and

tibial fractures [3, 6, 9, 13, 25], with only one case report of

a complication directly related to the implant [23]. One

humerus cadaveric study compared an inflatable with a

conventional intramedullary nail and the investigators

observed higher bending stiffness but lower rotational

stiffness related to the funnel-shaped intramedullary canal

of the humerus [5]. For the proximal femur, the inflatable

implant consists of an inflatable nail and an inflatable peg

for the femoral neck. When tested mechanically in a

cadaver model, the implant had similar results for pull-out

and a superior torsional stability, compared with a standard

hip lag screw [24].

We asked whether the bending stiffness, rotational

rigidity, or play (looseness of rotation) differed between

inflatable versus large-diameter reamed interlocked nails,

and whether the maximal torque to failure of the two bone-

implant constructs differed.


In a cadaveric fracture model, we tested the bone-implant

construct for the inflatable nail compared with a traditional

interlocked nail. Eight pairs of tibia were used, with one

type of implant placed randomly at each side, and paired

comparisons were made.

The inflatable implant is based on an expandable,

stainless-steel tube with four reinforcement bars, a conical

distal end, and a one-way valve in the proximal part

(Fixion1 IM Nail; Disc-O-Tech Medical Technologies

Ltd, Herzliya, Israel). The nail is introduced in an unex-

panded state into the medullary canal without reaming and

without guide wire. By means of a hydraulic pump with a

screw piston, saline is delivered into the nail to inflate it

until a pressure of 50 to 70 bar is reached (Fig. 1A). This

will increase its diameter until the reinforcement bars

connect with the walls of the medullary cavity and lock to

the bone. The 8.5-mm nail can expand to a maximum of

13.5 mm and the 10-mm nail to 16 mm.

The interlocked tibia nail is made of stainless steel (Grosse

& Kempf1; Stryker Osteosynthesis, Kiel, Germany). It

is an unslotted nail with holes for two proximal and two

distal static interlocking screws of 4.6-mm thread diameter

and 3.8-mm core diameter (Fig. 1B). The most commonly

used nail diameter in the tibia is 10 to 11 mm. This design

of reamed interlocked nails is well documented in long-

term clinical [7] and in biomechanical studies [21].

Eight pairs of human tibiae were obtained from fresh

cadavers and frozen immediately after excision. The

donors (five female, three male) ranged in age from 55 to

92 years (mean, 74.8 years). Patients with a history of bone

disease or tibial fractures were excluded. Each pair was

fixed by one inflatable and one interlocked nail, respec-

tively, evenly distributed between the left and right sides.

Before use, they were thawed at room temperature for

approximately 12 hours and kept moist in saline until use.

A 1-cm transverse saw cut from the front was placed at the

anatomic longitudinal midpoint of the bone, and then

bending was applied by manual force in flexion in the

sagittal plane until fracture, causing a short oblique fracture

line in all cases.

The bone was placed in a clamp in reduced position.

When using the locked nails, the bone was opened at the

midpoint between the tibial tuberosity and the tibial pla-

teau, and a guide was introduced. Reaming was performed

up to 11 mm. This provided at least 4 cm of bone contact

on either side of the fracture. A 10-mm locked nail was

used in all preparations. The locking screws (two in each

end) were placed through both bone cortices with a jig. The

inflatable nails were inserted through a similar opening;

8.5-mm nails were used. The unexpanded nail could be

fully inserted without reaming in all instances. The pump

then was connected to the valve, and the pump handle was

rotated until the pressure reached 60 bar. By manual testing,

the osteosynthesis appeared stable, which confirmed pro-

per expansion of the nail. Radiographs were taken to

confirm the nails were properly placed in the medullary

Fig. 1A–B (A) The Grosse & Kempf1 interlocked nail system and

(B) the Fixion1 inflatable nail system are shown.

1226 Blomquist et al. Clinical Orthopaedics and Related Research

123

cavity and the interlocking screws were within the holes of

the nail (Fig. 2).

Bending stiffness was first assessed by mounting the

specimens in a mediolateral position in a four-point testing

rig with 220 mm between the outer rollers and 35 mm

between the inner rollers. The two inner rollers were

connected with an axis centered over the fracture to ensure

equal loading on both sides of the fracture (Fig. 3). An

axial compression force was applied by a biaxial servo-

hydraulic testing machine (859 Minibionix1 II; MTS Corp,

Indianapolis, IN) at a speed of 0.2 mm per second until

3 mm of deformation was reached and then returned to

0 mm. The stiffness was calculated from the slope of the

curve. The deformation was small and within the elastic

region, so that we observed no visual structural changes.

Thereafter, both ends of the bones were embedded in

methylmethacrylate cement, but not including the locking

screws. The entry hole in the proximal tibia for the nail was

filled with a soft silicone material before embedding to

prevent direct contact between the implant and the cement.

The embedded ends of the specimens were mounted in the

testing machine. Axial traction of 20 N was applied

(Fig. 4). A moment then was imposed, starting at zero until

reaching 1 Nm. This is less than 10% of the failure load

and represents a load that does not cause gross structural

changes. Then the rotational direction was changed until a

moment of -1 Nm was reached. The rotational speed was

0.1 Nm per second. Moment and rotational angle were

recorded continuously by the software. From the resulting

Fig. 2A–D (A, B) Anteroposterior and (C, D) lateral radiographs

show the prepared specimens with the inserted nails (A, C:

interlocked nail; B, D: inflatable nail) before mechanical testing.

Fig. 3 The setup for four-point testing of bending stiffness is shown.

Fig. 4 A specimen loaded in the servohydraulic biaxial testing

machine for measurement of play, torsional rigidity, and maximal

rotational strength is shown.

Volume 466, Number 5, May 2008 Inflatable Versus Interlocked Nail in Tibia 1227

123

curves, the torsional rigidity was calculated as the slope

between 1 Nm and -1 Nm (Fig. 5). The play (the

unconstrained rotation) was defined as the offset in angle

between the curves obtained in the opposite directions. The

offset angle was calculated from the points corresponding

to 0.25 Nm and -0.25 Nm to avoid uncertainty in the

region of zero moment (Fig. 5). In two specimens, the

measurements of play and initial torsional rigidity were

missed. Thereafter, a rotational force was applied at a

speed of 0.5� per second for 60� or until the construct

failed. The highest moment before reaching 20� rotation

was defined as the overall torsional strength of the con-

struct (Fig. 6). During the latter testing procedure, a

compressive axial load of 150 N was applied, assumed to

simulate the force from muscle tone and soft tissue resis-

tance in a nonweightbearing situation.

Mean differences for each pair were calculated for all

mechanical variables and paired comparisons for the two

nails were analyzed by the one-sample t test of differences,

using SPSS statistical software (SPSS Inc, Chicago, IL).

We calculated statistical power post hoc for the different

variables.

Results

We observed a large interindividual variation for the

mechanical results. The inflatable nail had a higher

(p = 0.02) bending stiffness than the locked nail, with a

mean of 280.8 N/mm and 222.7 N/mm, respectively. We

found no differences in initial torsional rigidity and play

between the two types of nails. We observed a large scatter

for those two parameters in the group of interlocked nails

(Fig. 7). For torsional rigidity, power analysis revealed an

effect size of 4.51 Nm per degree would be needed to

obtain a difference at 80% power, whereas the observed

difference was only 0.08 Nm per degree. The corre-

sponding values for play were a needed effect size of 2.22�at 80% power and an observed difference of 0.77

(Table 1).

During testing of torsional strength, all interlocked nail-

bone constructs failed by fracture of the bone through the

distal locking screw holes. The hydraulic nail-bone con-

structs failed initially by slippage between the nail and

bone. At higher deformations, the initial fracture site

developed new fracture lines in most of the specimens

(Fig. 8). The rotational strength for the inflatable nail was

lower (p = 0.05) than that for the interlocked nail, with

12.6 Nm and 26.1 Nm peak moments, respectively, before

reaching 20� rotation.

Discussion

Recently developed inflatable nails avoid reaming and

interlocking screws in tibial fractures and reflect a new

principle for stabilization of long bone fractures. These

nails have been used clinically in the humerus and tibia

with some success [3, 6, 9, 13, 25]. We asked if the

bending stiffness, rotational rigidity, or play (looseness of

rotation) differed between an inflatable versus large-

diameter reamed interlocked nails, and whether the maxi-

mal torque to failure of the two bone-implant constructs

differed.

It is difficult to fully mimic the mechanical forces in the

clinical situation with the combined effects of canal pres-

sure from the osteosynthesis, muscular axial compression

forces, friction in the fracture, and soft tissue resistance.

We opposed the tendency of elongation/separation of

fragments by the obliquity of the fracture during rotation in

the unlocked hydraulic nail construct by application of

Fig. 5 A typical curve for calculation of play and rotational rigidity

is shown.

Fig. 6 A typical curve for calculation of maximal rotational strength,

defined as maximal moment before 20� deformation, is shown.

GK = interlocked nail; FX = inflatable nail.


123

axial load. The amount of resistance in vivo is not known,

but we have estimated the value in a nonweightbearing

situation to 150 N. In vivo, the axial forces will increase

and tend to separate fragments axially, with increased

rotational force. We used an oblique fracture, which gives

increased resistance to rotation by the obliqueness of the

fracture line, and the more subtle irregularities of a frac-

ture, which results in a great increase of friction compared

with osteotomies [22]. This model is considered more

similar to the most frequent types of low-energy clinical

tibial shaft fractures. A more comminuted fracture with low

intrinsic axial and rotational stability would be, in our

opinion, less suitable for stabilization by a nail without

interlocking screws. The data may also be influenced by

bone quality, which we did not determine. However, these

influences would be limited by the paired study design.

Bending stiffness, rotational rigidity, and play influence

the healing environment for a diaphyseal fracture. We

found a 25% higher mean bending stiffness in the

inflatable nail. We presume this relates to better contact

between the implant and the walls of the medullary canal

and a stiffer implant. We have not performed tests of the

implant alone and therefore cannot differentiate between

these factors.

We assume the rotational play indicates an instability

that can occur during normal clinical loading, even without

weightbearing. Play will induce shearing movements in the

initial healing phase that can prevent or delay fracture

Fig. 7A–D Results of biome-

chanical testing show interindivi-

dual variance in terms of (A)

bending stiffness, (B) rotational

rigidity, (C) play, and (D) maxi-

mal rotational strength. GK =

interlocked nail; FX = inflatable

nail. Arrows indicate mean in all

figures.

Table 1. Biomechanical testing results of an interlocking intramedullary nail and an inflatable nail

Biomechanical test Interlocking

nail (GK)

Expandable

nail (FX)

Paired difference

(GK - FX) (p value)

Median paired

ratio (GK/FX)

Bending stiffness (N/mm)(n = 8) 222.7 (169.5–275.9) 280.8 (224.7–336.8) -58.1 (-103.5–12.6) (p = 0.02) 1.2

Rotational rigidity (Nm/degree)(n = 6) 2.72 (0.07–5.37) 2.80 (1.62–3.97) -0.08 (-3.22–3.07) (p = 0.95) 1.7

Play (degrees)(n = 6) 1.15 (-0.24–2.54) 0.38 (0.12–0.64) 0.77 (-0.77–2.32) (p = 0.26) 1.8

Maximum rotational strength (Nm)(n = 8) 26.1 (14.3–37.9) 12.6 (8.1–17.1) 13.49 (-0.08–27.05) (p = 0.05) 0.4

Values are expressed as means, with confidence intervals in parentheses.


123

consolidation as reported in animal models [2, 18]. We

found no differences in play, but the scatter of the results

was higher with the interlocked nail (Fig. 6). We observed

the same pattern for rotational rigidity and maximal rota-

tional strength. Owing to what we considered a high effect

size, we found a difference between the implants for

maximal rotational strength. The scatter suggests the

interlocked nail system may be more technique and oper-

ator sensitive, and more influenced by bone quality. The

high scatter is to some degree compensated for by the use

of paired comparison. However, a higher number or a more

homogenous selection of specimens could have revealed

differences not detected in this study.

The maximum torque before fracture for intact tibia

cadaver bones is in the order of 100 Nm [17]. Our findings

of torsional strength of 13 Nm for the inflatable nail and

26 Nm for the interlocked nail are, in relation to intact

tibiae, quite low. In this study, we used the 8.5-mm

inflatable nail with expanding capacity up to 13.5 mm. The

larger-diameter nail (10 mm with expansion to 16 mm)

might have resulted in improved mechanical properties.

However, the manufacturer recommends using the large

diameter only for an isthmus diameter greater than 12 mm,

and reaming of the opposite side resulted in good cortical

contact at lower diameters in all specimens.

The theoretical basis for the inflatable implant is that

expansion of the nail results in high pressure against the

inner wall of the medullary cavity and an extended area of

contact, both contributing to high frictional forces between

bone and nail. At the same time, the larger diameter of the

nail increases the area and polar moment of inertia,

increasing the torsional and bending resistance of the nail by

a factor of 4. The absence of locking screws may imply

immediate full dynamization of the fracture postoperatively.

Mechanical testing by Blum et al. [5] of the inflatable

nail in the humerus revealed a lower torsional stiffness for

humeral bones with a funnel-shaped medullary cavity than

for bones with a well-defined isthmus. A transverse oste-

otomy fracture model was used, with a gap of 3 mm. Thus,

there is no friction at the fracture site, and with a funnel-

shaped medullary cavity and without soft tissue, there is

virtually no resistance to rotation with the inflatable nail.

We found the same relatively low rotational strength for

the inflatable nail in our tibial model, with a well defined

isthmus and a fracture type with a high inherent rotational

stability and good contact between the fragments.

This new concept of nail construction using a hydraulic

inflatable nail, inserted in an unexpanded condition, has

provided good results in certain diaphyseal fractures of

long bones [3, 9, 13, 25]. The clinical data, however, are

somewhat limited, with only one controlled study pub-

lished [3]. The inflatable nail had a shorter duration of

surgery and fewer reoperations and rehospitalizations

compared with an interlocking intramedullary nail

(Mathys, Bettlach, Switzerland). The control nail in that

study was an unreamed nail, which would affect the out-

come negatively compared with a large-diameter reamed

nail, according to several studies [4, 7, 8]. Intuitively, and

as suggested by our data and that of Blum et al. [5], the

weak link of an inflatable nail without locking screws

would be control of rotation, whereas the ability to fill out

the intramedullary canal diameter would give good control

of shear and bending forces. None of the clinical studies

report malrotation with inflatable nails used in the tibia

[3, 9, 13, 25]. This is in accordance with most studies of tibia

fractures treated with conventional intramedullary nailing.

However, in two studies where malrotation was specifically

examined, malrotation greater than 10� was reported in more

than 20% of the patients treated with a conventional intra-

medullary nail, which suggests malrotation often is

underreported and difficult to assess clinically [14, 19].

The values for torsional strength of approximately

15 Nm for the hydraulic nailing still means withstanding

up to 60 N at the forefoot, which we consider sufficient for

controlled weightbearing. The tested nail-bone consisted of

isolated tibiae, whereas in clinical situations soft tissue and

the presence of the fibula will influence, and probably

increase, the stability, especially in rotation. Our

Fig. 8A–B Specimens after rotational testing to failure for (A) the

interlocked nail and (B) the inflatable nail are shown.


123

experimental design using axial compression force will add

stability but we suspect does not fully compensate for the

lack of the surrounding tissue.

The hydraulic nail, in contrast to the locked nail,

depends on intrinsic stability in the fracture. Based on the

current results, we recommend restricting its use to

diaphyseal fractures with greater than 50% contact between

the main fragments, and weightbearing should be recom-

mended with caution until there are signs of fracture

consolidation. However, as the procedure is fast and pro-

vides good results in clinical studies, clinical use in

selected cases may be warranted.

Acknowledgments We thank Stein Atle Lie, PhD, Department of

Health, University Research Bergen, for assistance in the statistical

analysis.

References

1. Alho A, Benterud JG, Høgevold HE, Ekeland A, Stromsøe K.

Comparison of functional bracing and locked intramedullary

nailing in the treatment of displaced tibial shaft fractures. ClinOrthop Relat Res. 1992;277:243–250.

2. Augat P, Burger J, Schorlemmer S, Henke T, Peraus M, Claes L.

Shear movement at the fracture site delays healing in a diaphyseal

fracture model. J Orthop Res. 2003;21:1011–1017.

3. Ben-Galim P, Rosenblatt Y, Parnes N, Dekel S, Steinberg EL.

Intramedullary fixation of tibial shaft fractures using an

expandable nail. Clin Orthop Relat Res. 2007;455:234–240.

4. Blachut PA, O’Brien PJ, Meek RN, Broekhuyse HM. Interlocking

intramedullary nailing with and without reaming for the treatment

of closed fractures of the tibial shaft: a prospective, randomized


5. Blum J, Karagul G, Sternstein W, Rommens PM. Bending and

torsional stiffness in cadaver humeri fixed with a self-locking

expandable or interlocking nail system: a mechanical study.

J Orthop Trauma. 2005;19:535–542.

6. Capelli RM, Galmarini V, Molinari GP, De Amicis A. The Fixion

expansion nail in the surgical treatment of diaphyseal fractures of

the humerus and tibia: our experience. Chir Organi Mov.

2003;88:57–64.

7. Court-Brown CM. Reamed intramedullary tibial nailing: an over-

view and analysis of 1106 cases. J Orthop Trauma. 2004;18:96–101.

8. Finkemeier CG, Schmidt AH, Kyle RF, Templeman DC, Varecka

TF. A prospective, randomized study of intramedullary nails

inserted with and without reaming for the treatment of open and

closed fractures of the tibial shaft. J Orthop Trauma.

2000;14:187–193.

9. Franck WM, Olivieri M, Jannasch O, Hennig FF. An expandable

nailing system for the management of pathological humerus

fractures. Arch Orthop Trauma Surg. 2002;122:400–405.

10. Gugala Z, Nana A, Lindsey RW. Tibial intramedullary nail distal

interlocking screw placement: comparison of the free-hand versus

distally-based targeting device techniques. Injury. 2001;32(suppl

4):SD21–SD25.

11. Harris I, Lyons M. Reoperation rate in diaphyseal tibia fractures.

ANZ J Surg. 2005;75:1041–1044.

12. Hooper GJ, Keddell RG, Penny ID. Conservative management or

closed nailing for tibial shaft fractures: a randomised prospective

trial. J Bone Joint Surg Br. 1991;73:83–85.

13. Jovanovic A, Pirpiris M, Semirli H, Doig SG. Fixion nails for

humeral fractures. Injury. 2004;35:1140–1142.

14. Kahn KM, Beals RK. Malrotation after locked intramedullary

tibial nailing: three case reports and review of the literature.

J Trauma. 2002;53:549–552.

15. Karladani AH, Granhed H, Edshage B, Jerre R, Styf J. Displaced

tibial shaft fractures: a prospective randomized study of closed

intramedullary nailing versus cast treatment in 53 patients. ActaOrthop Scand. 2000;71:160–167.

16. Koval KJ, Clapper MF, Brumback RJ, Ellison PS Jr, Poka A,

Bathon GH, Burgess AR. Complications of reamed intramedul-

lary nailing of the tibia. J Orthop Trauma. 1991;5:184–189.

17. Martens M, van Audekercke R, de Meester P, Mulier JC. The

mechanical characteristics of the long bones of the lower

extremity in torsional loading. J Biomech. 1980;13:667–676.

18. Mølster AO. Effects of rotational instability on healing of

femoral osteotomies in the rat. Acta Orthop Scand. 1984;55:

632–636.

19. Puloski S, Romano C, Buckley R, Powell J. Rotational mala-

lignment of the tibia following reamed intramedullary nail

fixation. J Orthop Trauma. 2004;18:397–402.

20. Sanders R, Koval KJ, DiPasquale T, Schmelling G, Stenzler S,

Ross E. Exposure of the orthopaedic surgeon to radiation. J BoneJoint Surg Am. 1993;75:326–330.

21. Schandelmaier P, Krettek C, Tscherne H. Biomechanical study of

nine different tibia locking nails. J Orthop Trauma. 1996;10:37–

44.

22. Seligson D, Byrt W, Hogan M, Pope M. The mechanical basis for

the combined use of internal and external fixation by direct

measurement of fracture gap motion (abstract). 2nd InternationalSymposium on Internal Fixation of Fractures. Lyon, France:

Faculte Medecine Alexis Carrel; 1982:166–167.

23. Smith MG, Canty SJ, Khan SA. Fixion: an inflatable or deflatable

nail? Injury. 2004;35:329–331.

24. Steinberg EL, Blumberg N, Dekel S. The Fixion proximal femur

nailing system: biomechanical properties of the nail and a

cadaveric study. J Biomech. 2005;38:63–68.

25. Steinberg EL, Geller DS, Yacoubian SV, Shasha N, Dekel S,

Lorich DG. Intramedullary fixation of tibial shaft fractures using

an expandable nail: early results of 54 acute tibial shaft fractures.

J Orthop Trauma. 2006;20:303–309.


123

ORIGINAL ARTICLE

Pause Insertions During Cyclic In Vivo Loading Affect BoneHealing

Michael J. Gardner MD, Benjamin F. Ricciardi BS,

Timothy M. Wright PhD, Mathias P. Bostrom MD,

Marjolein C. H. van der Meulen PhD



Abstract Fracture repair is influenced by the mechanical

environment, particularly when cyclic loads are applied

across the fracture site. However, the specific mechanical

loading parameters that accelerate fracture healing are

unknown. Intact bone adaptation studies show enhanced

bone formation with pauses inserted between loading

cycles. We hypothesized pause-inserted noninvasive

external loading to mouse tibial fractures would lead to

accelerated healing. Eighty mice underwent tibial osteoto-

mies with intramedullary stabilization and were divided

into four loading protocol groups: (1) repetitive loading

(100 cycles, 1 Hz); (2) pause/time-equivalent (10 cycles,

0.1 Hz); (3) pause/cycle-equivalent (100 cycles, 0.1 Hz);

and (4) no load control. Loading was applied daily for

2 weeks. Healing was assessed using histology, biome-

chanical bending tests, and microcomputed tomography.

The pause-inserted, cycle-equivalent group had a greater

percentage of osteoid present in the callus cross-sectional

area compared with no-load controls, indicating more

advanced early healing. The pause-inserted, cycle-equiva-

lent group had a failure moment and stiffness that were 37%

and 31% higher than the controls, respectively. All three

loaded groups had smaller overall mineralized callus vol-

umes than the control group, also indicating more advanced

healing. At an early stage of fracture healing, pause-inserted

loading led to more histologically advanced healing.

Introduction

Numerous characteristics of the mechanical environment

directly affect the subsequent course of fracture healing.

The magnitude of the applied load across the fracture site,

the size of the fracture gap, the relative fracture motion and

resulting strain, and the timing of mechanical intervention

all impact healing [1, 7, 11, 12, 18]. Cyclic compression

applied at an appropriate time, rate, and magnitude across

the fracture site potentiates healing, leading to earlier and

more advanced callus formation [6, 7, 11, 12, 18, 20, 22,

30]. Early dynamization of external fixation also leads to

accelerated healing compared with rigid fixation [6–8, 20].

Conversely, the beneficial healing effects of intermittent

loading across a fracture are negated when superimposed

on static compression [2, 3, 13, 24, 35].

Innovative loading parameter variations cause dramatic

increases in bone formation in intact bone [26, 28, 31].

Cyclic compressive loads applied with a pause between

each cycle are more osteogenic than repetitive, continuous

cyclic loads [23, 26, 31]. An increased duration of

One or more of the authors have received funding from the

Orthopaedic Trauma Association (MJG), the Orthopaedic Research

and Education Foundation (MJG), and NIH Musculoskeletal Core

Center P30AR046121 (TMW, MCHvdM).




M. J. Gardner (&)

Department of Orthopaedic Surgery, Harborview Medical

Center, 325 9th Ave, Box 359798, Seattle, WA 98104, USA


B. F. Ricciardi, T. M. Wright

Laboratory for Biomedical Mechanics and Materials, Hospital

for Special Surgery, New York, NY, USA

M. P. Bostrom

Department of Orthopaedic Surgery, Hospital for Special

Surgery, New York, NY, USA

M. C. H. van der Meulen

Department of Mechanical and Aerospace Engineering, Cornell

University, Ithaca, NY, USA

123


DOI 10.1007/s11999-008-0155-1

repetitive cyclic loading does not lead to proportional

increases in bone mass, presumably because cellular sen-

sitivity to the mechanical stimulus diminishes quickly once

an initial threshold for a response has been exceeded [10,

26, 29, 33]. For example, in a rat jumping model, the

femoral compressive force in rats that jumped five times a

day led to considerable bone hypertrophy compared with

controls, but when jumps were increased to 100 per day, no

additional increase occurred [33]. The cellular sensitivity

to load can be recovered, however, as seen in studies in

which loading sessions were separated into discrete tem-

poral bouts [5, 16].

Accelerating fracture repair through mechanical inter-

vention is a potentially noninvasive treatment supplement.

Although used clinically in one trial [22], this approach has

not become a standard treatment method, partly because

the ideal loading parameters have not been fully defined.

Previously, we showed that repetitive cyclic noninvasive

loading without pause insertions in the loading regimens

led to improved fracture healing after 2 weeks in a mouse

tibial fracture model [18].

We hypothesized insertion of pauses in the loading

waveform would lead to improvements in fracture healing

compared with healing of nonloaded and repetitively loa-

ded fractures, specifically in the early phases of healing.


To address our hypothesis, we divided 80 C57Bl/J6 12-

week-old male mice (Jackson Laboratories, Bar Harbor,

ME; body weight 29 ± 2 g) into four groups (n = 20 per

group). After tibial osteotomy creation, stabilization, and

loading, the animals were euthanized by carbon dioxide

inhalation. The experimental hind limbs were disarticulated

at the hip, the tibiae were dissected free of soft tissue, and

the intramedullary pin was removed. All specimens except

those designated for histologic sectioning were frozen in

moist gauze at -20�C in preparation for mechanical anal-

ysis and microcomputed tomographic imaging.

All mice underwent surgical osteotomy and intramed-

ullary nailing of the left tibia as described previously [18].

In three of the groups, cyclic compression was applied to

the ends of the tibia with a noninvasive external loading

device (Fig. 1) [17]. Daily loading was begun after a 4-day

fracture consolidation period to allow for stabilization of

the hematoma and early angiogenesis [19, 34] and con-

tinued for 5 days per week for 2 weeks. One group had 100

load cycles applied daily at a rate of 1 Hz. A second group

had a 9-second pause inserted between each load such that

each load-pause cycle was 10 seconds. This loading con-

tinued for 10 cycles and was the time-equivalent

(100 seconds) of the first group but with one-tenth the

number of cycles. A third group also had a 9-second pause

inserted between loads, but continued for 100 cycles at

0.1 Hz (1000 seconds), which was the cycle equivalent of

the repetitive loading group (Fig. 2). All loading was

applied with the mice under general anesthesia with a tri-

angle waveform with a peak load amplitude of 1 N and a

preload of 0.5 N. In a fourth (control) group, mice under-

went surgical osteotomy and intramedullary stabilization

and were placed in the loading device daily but without any

load application. A pre-hoc power analysis determined that

10 mice per group, plus an additional five specimens for

histologic analysis, would provide greater than 80% power

to detect a difference in biomechanical and microcomputed

tomography parameters of 1.2 times the pooled standard

deviation using a one-factor analysis of variance design

(alpha, 0.05). Our protocol had prior approval of our

Institutional Animal Care and Use Committee.

With the animal under general anesthesia, an incision

was made over the dorsal aspect of the knee, and a 25-

gauge needle was used to bore a hole in the proximal tibia.

An oscillating saw was used to create a transverse osteot-

omy 5 mm distal to the patellar tendon insertion. The

fragments were held in alignment, and a 27-gauge needle

was inserted across the osteotomy into the distal fragment

and cut to the appropriate length. All fibulas were verified

as intact postoperatively using radiography. Buprenorphine

was administered ad libitum for pain relief; no nonsteroidal

antiinflammatory medications were used to avoid phar-

macologic interference with fracture healing. All mice

were allowed full, unrestricted cage activity after surgery.

The animals did not favor the nonoperated limb starting on

the first postoperative day.

The formation of mineralized tissue at the fracture

site was assessed by quantitative microcomputed tomog-

raphy (micro-CT) (MS-8 Small Specimen Scanner; GE

Fig. 1 The external loading device consists of titanium plates that

cup the calcaneus and femoral condyles. The actuator is driven by a

function generator, an amplifier, and an electromagnetic coil to apply

loads across the stabilized fracture.

Volume 466, Number 5, May 2008 Pause-inserted Fracture Loading 1233

123

Healthcare, formerly EVS Corp, Ontario, Canada). The

tibiae were placed in a saline-filled scan tube and scanned

at 80 V and 80 lA. Each scan included a phantom con-

taining air, saline, and an SB-3 bone analog (1.18 g/cc) for

calibration of image Hounsfield units to tissue mineral

density in milligrams per centimeter. Reconstruction of the

individual projections to CT volume data was accom-

plished with a modified Parker algorithm [15, 25] with an

isotropic voxel resolution of 24 lm.

To distinguish mineralized tissue from marrow, water,

and unmineralized callus, microCT images were threshol-

ded using 25% of the mineral attenuation value of the

cortical bone determined for each specimen. Regional

analyses of the thresholded scans were performed using the

system software (MicroView; GE Healthcare Technologies,

Waukesha, WI). To characterize calluses globally and

locally, two volumes of interest were selected. First, a best-

fit volume around the entire callus was used to determine

the total mineralized callus volume, a slightly different

method than has been used previously [18]. An elliptic

cylinder, 1 mm in height, was centered at the osteotomy site

and used to determine callus mineral density and content.

Care was taken to ensure this section did not contain a

cortical overlap that would affect density measurements.

Bone tissue from five specimens from each group

underwent histologic analysis. Immediately after harvesting

and dissection, the bones were preserved in 10% phosphate-

buffered formalin for 2 days at 4� C. After formalin fixa-

tion, samples were washed overnight in running water,

dehydrated through alcohol at 70%, cleared in xylene, and

embedded in methyl methacrylate [14]. Calcified tissues

were then sectioned longitudinally at 5- to 7-lm thickness

along the extramedullary portion of the callus. Sectioning

was performed with a tungsten carbide blade on a micro-

tome (Reichert-Jung Ultracut E; Leica Microsystems,

Wetzlar, Germany). Nine sections were subsequently

stained with von Kossa to evaluate the mineralized tissue

and with Goldner’s trichrome to evaluate the osteoid

deposition. Measurements were taken at x40 magnification.

The percentage of mineralized tissue and osteoid at the

osteotomy site was quantified by a blinded investigator

(BFR) using a BioQuant morphometric analysis system

(Bioquant, Nashville, TN). Because of the early time

studied, no attempt was made to quantify trabecular mor-

phology or other indicators of advanced bone formation.

Rather, we considered advanced histologic healing to be the

presence of more osteoid and total mineralized tissue.

All remaining specimens from each group (n = 7–9)

were tested to failure using four-point bending on an

electromagnetic-based load frame (EnduraTEC ELF 3200;

Bose Corp, Minnetonka, MN). Tibiae were placed with the

flat anteromedial surface on the lower supports, which were

set 8.4 mm apart; the upper load points were set 3.5 mm

apart. Displacement was applied at 0.033 mm per second

until failure occurred. The bending moment to failure

(Nmm) and stiffness (Nmm2) were calculated from the

load-deflection curves and the dimensions between the

loading points. Contralateral intact bones were not tested.

We calculated the mean and standard deviation of the

percent osteoid, percent mineralized tissue, bone mineral

density, bone mineral content, bone volume, callus volume,

failure moment, and stiffness for each group. One-way

analysis of variance tests, followed by Bonferroni post hoc

tests, were used to compare differences among the means

of each variable tested for each group using a p value \0.05 (PASS 6.0; NCSS, Kaysville, UT). The number of

mice per group was based on a power analysis performed

before the experiment.

Results

Histologically, the cycle-equivalent pause-inserted group

(Fig. 3A) had a greater (p = 0.015) percentage of osteoid

present in the callus compared with controls (Fig. 3B),

indicating a more advanced early healing process. The

Fig. 2 A plot of the waveforms

for the loaded groups is shown.

The two pause-inserted loading

groups had a 9-second pause

between each load application

with cyclic loading continuing

for either 100 or 1000 seconds.

1234 Gardner et al. Clinical Orthopaedics and Related Research

123

percentage of mineralized callus tissue was similar

between the groups (Fig. 4).

All three loaded groups had smaller mineralized callus

volumes than the control group (Fig. 5). Additional mea-

surements of callus characteristics such as bone mineral

density, bone mineral content, and total bone volume were

similar between the groups.

Bending strength and stiffness were similar across the

treatment groups. (Fig. 6; Table 1).

Discussion

Directed mechanical stimulation of fracture healing may be

a potent treatment supplement in difficult fractures. To

become potentially clinically useful, however, the specific

loading parameters which optimize osteogenesis must be

further defined. The insertion of pauses into mechanical

loading regimens is particularly osteogenic in intact bone,

and the purpose of this study was to determine the effect of

pause-inserted loading on fracture healing. After 2 weeks

of healing, we found histologic evidence that pause-

Fig. 3A–B (A) Examples of a histologic specimen after trichrome

staining and microcomputed tomography scans from the cycle-

equivalent pause-inserted group are shown. The area staining positive

for osteoid in the lower portion of the callus is highlighted in red

(Magnification, 912.5). (B) Examples of a histologic specimen after

trichrome staining and microcomputed tomography scans from the

control group are shown. The area staining positive for osteoid in the

lower portion of the callus is highlighted in red (Magnification,

912.5). The histology showed more osteoid in the pause-inserted

group, and calluses appeared radiographically more advanced.

Fig. 4 The percentage of osteoid relative to total callus tissue area in

the pause-inserted cycle-equivalent group was greater (p = 0.015)

than the control group. No considerable differences were found in

callus mineralization among groups. Means and standard deviations

are shown.

Fig. 5 All three loaded groups had smaller callus volumes than the

control group as measured by microcomputed tomography. Means

and standard deviations are shown.


123

inserted loading accelerates the fracture healing process

compared with controls.

This study had limitations. Most notably, we studied

only one healing time. Although this time period was

chosen for the specific purpose of analyzing early healing

differences resulting from loading, this choice was none-

theless somewhat arbitrary, and different results may occur

at later stages of healing. Our microCT and mechanical

testing data showed larger variability than observed pre-

viously [18], contributing to the lack of considerable

effects despite an appropriate power calculation as part of

the planning for this experiment. Reasons for this are

unclear, but may have been partly attributable to technical

error with testing, and the biomechanical results should be

interpreted with caution. Another limitation was the exact

strains at the osteotomy site were unknown. The curvature

of the mouse tibia induces bending moments that produce

compressive and tensile strains at the fracture site. Strains

induced at the middiaphysis with loading have been char-

acterized for intact tibia of mice using this loading device

[9, 17], but the strains that occur with loading across a

stabilized osteotomy in this model are unknown.

The specimens with 100 cycles of daily pause-inserted

loading had histologic evidence of accelerated fracture

healing compared with controls. This group, together with

Fig. 6 The biomechanical parameters tested, failure bending moment

and stiffness, were similar between the groups. Means and standard

deviations are shown.

Table 1. Groupwise comparisons of bone healing

Variable Group

Control Repetitive

loading

Pause-inserted,

time-equivalent

Pause-inserted,

cycle-equivalent

Percent osteoid 13.0 19.4 17.4 24.8*

SD 5.0 5.8 5.3 1.9

Number 5 5 5 5

Percent mineralized tissue 25.0 26.8 32.5 31.8

SD 1.7 7.0 9.1 7.8

Number 5 5 5 5

BMD (mg/cm3) 473.80 491.84 488.26 519.24

SD 41.87 64.59 55.96 75.74

Number 16 14 15 16

BMC (mg) 2.38 2.07 2.29 2.23

SD 0.37 0.51 0.73 0.53

Number 16 14 15 16

Bone volume (cm3) 4.40 3.72 4.16 3.87

SD 0.81 0.93 1.42 0.86

Number 16 14 15 16

Callus volume (cm3) 0.035 0.024* 0.026* 0.026*

SD 0.010 0.007 0.010 0.008

Number 16 14 15 16

Failure moment (N-mm) 16.7 18.4 20.4 22.8

SD 6.9 5.2 7.4 9.5

Number 8 7 9 9

Stiffness (N-mm2) 741.4 719.4 776.1 974.7

SD 312.6 223.8 311.3 463.5

Number 8 7 9 9

* p \ 0.05 versus control; SD = standard deviation; BMD = bone mineral density; BMC = bone mineral content.


123

the other loaded groups, also had a smaller mineralized

callus volume. In general, fracture callus increases in size

before complete calcification and remodeling, which then

leads to a decrease in size. Thus, the smaller size coupled

with increased osteoid in our study may support the

advanced stage of healing afforded by loading.

Substantial data suggest specific loading regimens in

intact bone induce increased bone formation [23, 26–28,

31]. Although fracture repair mechanisms are clearly more

complex than intact bone adaptation, the mechanisms

involved in periosteal osteoblast proliferation in intact bone

are important in fracture healing as well, and activation of a

mechanically induced response may similarly result in

increased bone formation. In a noninvasive mouse tibia

cantilever bending model, a low-magnitude force applied

for 100 cycles daily was minimally osteogenic, whereas the

same load applied for 10 cycles daily with 10-second

pauses between cycles was a potent stimulant of bone

formation [31]. In a similar study loading the rat ulna, a 14-

second pause between individual load cycles led to a

greater response than insertion of shorter pauses [26].

The overall effect from pause-inserted loading during

fracture healing was modest, but present nonetheless. We

found no mechanical differences among the pause-inserted

and repetitively loaded groups despite observing consid-

erably greater strength using the same repetitive loading

protocol previously [18]. Perhaps the beneficial effects of

pause insertions over repetitive loading results from satu-

ration of the continuous cyclic protocol after a set number

of cycles [31, 32]. Based on our data, the 100-cycle/1-Hz

repetitive loading protocol may not saturate the mechano-

sensitivity of the healing tissue. Superimposing externally

applied load on routine weightbearing, as was the case in

this study, also may lessen the effect of load augmentation

[36].

We chose the 2-week loading period to determine the

differences in the early healing phase. Concordantly,

healing appeared at an accelerated stage in the cycle-

equivalent pause-inserted group as indicated by increased

osteoid deposition. This time in the healing process may

have been before substantial mineralization [4, 21],

accounting for the lack of differences in von Kossa staining

or microCT-based bone mineral content and density.

Considerably smaller mineralized callus size with applied

loading was measured by microCT compared with con-

trols. The smaller size of calluses in the loaded groups may

reflect early organization of the healing callus tissue.

We found axial loading of the fractured mouse tibia with

pauses inserted may lead to acceleration of bone healing

compared with nonloaded controls in the early phases. We

suspect the increased osteoid deposition after pause-inser-

ted loading would likely lead to increased mineral

deposition and earlier fracture consolidation in the later

phases. Additional studies will be required to evaluate the

effects of loading and pause insertions at later times.

Acknowledgments We thank Jonathan Zelken, Alexia Hernandez,

and Xu Yang for technical assistance.

References

1. Aro HT, Chao EY. Bone-healing patterns affected by loading,

fracture fragment stability, fracture type, and fracture site com-

pression. Clin Orthop Relat Res. 1993;293:8–17.

2. Carter DR, Blenman PR, Beaupre GS. Correlations between

mechanical stress history and tissue differentiation in initial

fracture healing. J Orthop Res. 1988;6:736–748.

3. Chao EYS, Inoue N, Elias JJ, Aro H. Enhancement of fracture

healing by mechanical and surgical intervention. Clin OrthopRelat Res. 1998;355(suppl):S163–178.

4. Cheung KM, Kaluarachi K, Andrew G, Lu W, Chan D,

Cheah KS. An externally fixed femoral fracture model for mice.

J Orthop Res. 2003;21:685–690.

5. Chow JW, Jagger CJ, Chambers TJ Characterization of osteo-

genic response to mechanical stimulation in cancellous bone of

rat caudal vertebrae. Am J Physiol. 1993;265:E340–347.

6. Claes LE, Heigele CA. Magnitudes of local stress and strain

along bony surfaces predict the course and type of fracture

healing. J Biomech. 1999;32:255–266.

7. Claes LE, Heigele CA, Neidlinger-Wilke C, Kaspar D, Seidl W,

Margevicius KJ, Augat P. Effects of mechanical factors on

the fracture healing process. Clin Orthop Relat Res. 1998;

355(suppl):S132–147.

8. Claes LE, Wilke HJ, Augat P, Rubenacker S, Margevicius KJ.

Effect of dynamization on gap healing of diaphyseal fractures

under external fixation. Clin Biomech (Bristol, Avon).1995;10:227–234.

9. Connelly JT, Fritton JC, van der Meulen MCH. Simulation of

in vivo loading in the tibia of the C57BL/6 mouse. Trans OrthopRes Soc. 2003;28:0409.

10. Cullen DM, Smith RT, Akhter MP. Bone-loading response varies

with strain magnitude and cycle number. J Appl Physiol.2001;91:1971–1976.

11. Duda GN, Sollmann M, Sporrer S, Hoffmann JE, Kassi JP,

Khodadadyan C, Raschle M. Interfragmentary motion in tibial

osteotomies stabilized with ring fixators. Clin Orthop Relat Res.

2002;396:163–172.

12. Egger EL, Gottsauner-Wolf F, Palmer J, Aro HT, Chao EY.

Effects of axial dynamization on bone healing. J Trauma.

1993;34:185–192.

13. Ehrlich PJ, Lanyon LE. Mechanical strain and bone cell function:

a review. Osteoporos Int. 2002;13:688–700.

14. Erben RG. Embedding of bone samples in methylmethacrylate:

an improved method suitable for bone histomorphometry, histo-

chemistry, and immunohistochemistry. J Histochem Cytochem.

1997;45:307–313.

15. Feldkamp LA, Goldstein SA, Parfitt AM, Jesion G, Kleerekoper M.

The direct examination of three-dimensional bone architecture

in vitro by computed tomography. J Bone Miner Res. 1989;4:3–11.

16. Forwood MR, Turner CH. The response of rat tibiae to incre-

mental bouts of mechanical loading: a quantum concept for bone

formation. Bone. 1994;15:603–609.

17. Fritton JC, Myers ER, Wright TM, van der Meulen MC. Loading

induces site-specific increases in mineral content assessed by

microcomputed tomography of the mouse tibia. Bone. 2005;36:

1030–1038.


123

18. Gardner MJ, van der Meulen MC, Demetrakopoulos D, Wright

TM, Myers ER, Bostrom MP. In vivo cyclic axial compression

affects bone healing in the mouse tibia. J Orthop Res.

2006;24:1679–1686.

19. Goodship AE, Cunningham JL, Kenwright J. Strain rate and

timing of stimulation in mechanical modulation of fracture

healing. Clin Orthop Relat Res. 1998;355(suppl):S105–115.

20. Goodship AE, Kenwright J. The influence of induced micro-

movement upon the healing of experimental tibial fractures.


21. Hiltunen A, Aro HT, Vuorio E. Regulation of extracellular matrix

genes during fracture healing in mice. Clin Orthop Relat Res.

1993;297:23–27.

22. Kenwright J, Richardson JB, Cunningham JL, White SH,

Goodship AE, Adams MA, Magnussen PA, Newman JH. Axial

movement and tibial fractures: a controlled randomised trial of

treatment. J Bone Joint Surg Br. 1991;73:654–659.

23. LaMothe JM, Zernicke RF. Rest insertion combined with high-

frequency loading enhances osteogenesis. J Appl Physiol.2004;96:1788–1793.

24. Lanyon LE, Rubin CT. Static vs dynamic loads as an influence on

bone remodelling. J Biomech. 1984;17:897–905.

25. Parker DL. Optimal short scan convolution reconstruction for

fanbeam CT. Med Phys. 1982;9:254–257.

26. Robling AG, Burr DB, Turner CH. Recovery periods restore

mechanosensitivity to dynamically loaded bone. J Exp Biol.2001;204:3389–3399.

27. Robling AG, Hinant FM, Burr DB, Turner CH. Improved bone

structure and strength after long-term mechanical loading is

greatest if loading is separated into short bouts. J Bone MinerRes. 2002;17:1545–1554.

28. Robling AG, Hinant FM, Burr DB, Turner CH. Shorter, more

frequent mechanical loading sessions enhance bone mass. MedSci Sports Exerc. 2002;34:196–202.

29. Rubin CT, Lanyon LE. Regulation of bone formation by applied

dynamic loads. J Bone Joint Surg Am. 1984;66:397–402.

30. Sarmiento A, Schaeffer JF, Beckerman L, Latta LL, Enis JE.

Fracture healing in rat femora as affected by functional weight-

bearing. J Bone Joint Surg Am. 1977;59:369–375.

31. Srinivasan S, Weimer DA, Agans SC, Bain SD, Gross TS. Low-

magnitude mechanical loading becomes osteogenic when rest is

inserted between each load cycle. J Bone Miner Res. 2002;17:

1613–1620.

32. Turner CH. Three rules for bone adaptation to mechanical stim-

uli. Bone. 1998;23:399–407.

33. Umemura Y, Ishiko T, Yamauchi T, Kurono M, Mashiko S. Five

jumps per day increase bone mass and breaking force in rats.

J Bone Miner Res. 1997;12:1480–1485.

34. Wallace AL, Draper ER, Strachan RK, McCarthy ID, Hughes SP.

The vascular response to fracture micromovement. Clin OrthopRelat Res. 1994;301:281–290.

35. White AA 3rd, Panjabi MM, Southwick WO. Effects of com-

pression and cyclical loading on fracture healing: a quantitative

biomechanical study. J Biomech. 1977;10:233–239.

36. Wolf S, Janousek A, Pfeil J, Veith W, Haas F, Duda G, Claes L.

The effects of external mechanical stimulation on the healing of

diaphyseal osteotomies fixed by flexible external fixation. ClinBiomech (Bristol, Avon). 1998;13:359–364.


123

ORIGINAL ARTICLE

Four Weeks of Mobility After 8 Weeks of Immobility Failsto Restore Normal Motion

A Preliminary Study

Guy Trudel MD, Jian Zhou BSc, Hans K. Uhthoff MD,

Odette Laneuville PhD

Received: 25 July 2007 / Accepted: 5 February 2008 / Published online: 26 February 2008


Abstract Prolonged immobilization reduces passive range

of motion of joints creating joint contractures. Whether and

to what extent these iatrogenic contractures can be reduced is

unknown. We raised three questions using an animal model:

What degree of contracture remains at the end of a defined

remobilization period? Do contractures in sham-operated

and immobilized joints differ? What is the contribution of

the posterior knee capsule in limiting knee extension? We

immobilized one knee of 11 adult male rats in flexion to

induce a joint contracture; 10 control animals underwent a

sham operation. After 8 weeks, the internal fixation device

was removed, and the animals were allowed to resume

unrestricted activity for 4 weeks at the end of which the knee

range of motion was measured with standardized torques.

The mean flexion contracture was higher in the immobilized

group (51.9� ± 2.8�) than in the sham-operated group

(18.9� ± 2.1�). Eighty-eight percent of the contractures

remained in the immobilized group after dividing skin and

muscle, suggesting an important contribution of the posterior

knee capsule in limiting knee mobility. Based on our pre-

liminary study the range of motion of rat knees immobilized

for 8 weeks remained substantially reduced after a 4-week

period of unassisted remobilization.

Introduction

Motion of synovial joints is essential to maintain mobility in

their full anatomic range of motion (ROM). Immobility can

reduce passive ROM of joints [1, 6, 32], creating a joint

contracture [2, 22, 28]. Contractures diminish joint function

and lead to a reduction in patient autonomy [17, 20]. The

important role and frequent use of immobilizing procedures

to treat musculoskeletal disorders put joints at risk for

having contractures develop [1, 37]. Patients with limited

mobility and those confined to bed have multiple immo-

bility-induced joint contractures develop [7, 9, 15, 25].

A few experimental studies on immobility-induced joint

contractures suggest the timing of development of con-

tractures. In several studies an internal fixation device to

immobilize one hind limb of rats duplicated joint con-

tractures in humans, with substantial reductions in the

passive ROM [8, 12]. More recently, a time course study

over 32 weeks in rat knees immobilized at 135� flexion

caused a gradual decrease of the ROM in extension that

reached 69� after the first 8 weeks and then leveled off

[32]. The posterior capsular structures contributed to the

restriction [31, 32]. The process by which immobility

changes the mechanical properties of various articular

structures and limits joint movement is not fully under-

stood, but shortening, atrophy, and fibrosis of the posterior

capsule have been reported [1, 18, 27, 30, 33].

One or more of the authors have received funding from the Canadian

Institutes of Health Research (GT, HKU, OL) and the Canadian

Institute of Musculoskeletal Health and Arthritis (JZ).




G. Trudel, J. Zhou, H. K. Uhthoff

Bone and Joint Laboratory, University of Ottawa, Ottawa, ON,

Canada

G. Trudel

Division of Physical Medicine and Rehabilitation, University of

Ottawa, Ottawa, ON, Canada

O. Laneuville (&)

Department of Biochemistry, Microbiology and Immunology,

Faculty of Medicine, University of Ottawa, 451 Smyth Road,

Ottawa, ON, Canada K1H 8M5


123


DOI 10.1007/s11999-008-0181-z

Reversibility is clinically and functionally important

for patients. Michelsson [19] used a plastic splint to

immobilize 11 rabbit knees in extension and reported a

reduction in mobility after 5 weeks that disappeared

spontaneously in most cases after the splint was removed.

But, should the immobilization last 6 to 7 weeks or

longer, there was gradual but incomplete recovery after

8 weeks of remobilization, with the contracture being

severe and permanent. Akeson et al. [4] investigated the

reversibility of immobility-induced joint contractures

using a model of rabbit knees fixed in a flexed position

using transarticular wires. Knees immobilized for 9 weeks

recovered completely 3 weeks after the fixation was

removed. We immobilized canine shoulders for 12 weeks

with a cast to create a contracture. Four weeks of remo-

bilization did not reverse the limited motion but the

limitation began to reverse after 8 weeks of remobiliza-

tion and returned to normal after 12 weeks [24]. Van

Harreveld et al. [35] enforced 8 weeks of exercise after

7 weeks of immobilization of the horse metacarpopha-

langeal joint but could not restore joint motion. Finally,

immobilization of the rat ankle for 2 weeks revealed

that treadmill running improved ROM compared with no

running [23]. The literature on reversibility of joint

contractures in animals therefore seems contradictory. The

differences likely stem in part from the variety of joints,

times and methods of immobilization, and animal species.

The development of joint contractures secondary to

immobility is gradual, and reversibility is not well

documented.

We therefore raised three questions using an animal

model: (1) What degree of contracture remains at the end

of a 4-week remobilization period? (2) Do contractures in

sham-operated and immobilized joints differ? (3) What is

the contribution of the posterior knee capsule in limiting

knee extension?


We immobilized the knees of 11 adult Sprague Dawley rats

(300–350 g) in 135� flexion for 8 weeks then remobilized

the knees for 4 weeks. Ten similar rats with sham surgery

but no immobilization served as controls. All rats were

obtained from one source (Charles River Laboratories, St

Constant, Quebec, Canada) and housed individually in

standard cages. At the end of 8 weeks we removed the

fixation devices (experimental animals) and sham screws

(control animals) and allowed free activity (unassisted

remobilization) for 4 weeks. We then sacrificed the ani-

mals and measured knee motion. The contribution of

the posterior knee capsule in limiting joint motion was

determined by sectioning all skin and posterior muscles.

We immobilized the knees of the 11 experimental rats in

135� flexion using an internal system consisting of a Del-

rin1 plate (DuPont Engineering Polymers, Wilmington,

DE) secured with one screw to the proximal femur and one

screw to the distal tibia. The course of the plate was such

that it passed laterally between the peronei and lateral

gastrocnemius muscles at the leg and medial to the tensor

fasciae lata at the thigh without violating the knee. Details

of the surgical protocol and a description of the immobi-

lization system were published previously [32]. The knees

of 10 rats (control group) underwent similar surgery with

the insertion of two screws but not the plate.

Postoperatively the rats were allowed free activity in

individual cages for 8 weeks. At the end of the 8-week

period, the immobilized and control groups underwent

limited surgery to remove the plate and/or screws and then

were returned to their cages for a 4-week period of unre-

stricted activity in their cages. We defined remobilization

as this 4-week period of spontaneous active mobilization

after discontinuation of immobilization.

At the end of the 4-week remobilization period, the

animals were euthanized with carbon dioxide exposure

using a protocol approved by our animal ethics committee.

Joint ROM was measured immediately with a graded

spring-loaded goniometer (arthrometer) adapted to the rat

knee [29]. The arthrometer measured the joint angles

reached at two torque values: 667 g/cm (Torque 1) and

1060 g/cm (Torque 2). The motion in extension was

measured on the operated knee and the contralateral knee.

The angular displacement of the operated leg, immobilized

or sham, was reported as the mean lack of ROM in

extension (ie, an flexion contracture). The mean joint

contracture was calculated by subtracting the ROM miss-

ing to reach full extension of the operated leg from the

measurement taken from the contralateral leg (Fig. 1). To

elucidate the contribution of the posterior knee capsule in

limiting knee ROM, all skin and muscles crossing the knee

were divided with a scalpel and the ROM measurement

repeated. The contribution of the posterior knee capsule in

limiting knee extension was calculated by the lack of ROM

after division of skin and transarticular muscles.

In humans, the knee extends to 0�. A knee flexion

contracture is defined by the number of degrees missing to

full extension. In normal Sprague Dawley rats, the knee

does not reach full extension, possibly owing to the

habitual knee flexion posture. Therefore, to report knee

flexion contracture, we subtracted the lack of extension of

the contralateral knee from the lack of extension of the

surgically treated knee for the immobilized and the control

animals.

All data were expressed as mean ± standard error of the

mean. Lack of extension was compared between the

immobilized and sham-operated groups using an unpaired

1240 Trudel et al. Clinical Orthopaedics and Related Research

123

t test. In both groups, the ROM was compared with that of

the contralateral knee using paired t tests. For contracture,

an unpaired t test was used to compare the means of the

immobilized and control animals. We used a post hoc

Bonferroni correction for multiple comparisons. The data

were stored and analyzed using SPSS 15.0 (SPSS Inc,

Chicago, IL).

Results

The mean flexion contracture after remobilization was

51.9� ± 2.8� in the immobilized knees and 18.9� ± 2.1� in

the sham-operated knees at Torque 1 (Table 1, muscle on).

The immobilized group lacked 41.9� ± 3.0� extension

while the sham-operated group lacked 9.8� ± 2.4� at

Torque 2 (Table 1, muscle on).

The contracture was greater (p \ 0.05) in the immobi-

lized group (51.9� ± 2.8�) than in the sham-operated group

(18.9� ± 2.1�) (Table 1). The contracture also was greater

(p \ 0.05) in the immobilized legs than in their contralat-

eral legs (21.1� ± 2.9�) at both torques (Table 1).

Immobilized legs also lacked more (p \ 0.05) ROM in

extension than contralateral legs at both torques (Torque 1:

21.1� ± 2.9�; Torque 2: 10.3� ± 2.3�). Range of motion

measurements of the surgically treated and contralateral

legs in the sham-operated group were similar (Table 1).

Most (88% of the limitation at Torque 1 and 83% of the

limitation at Torque 2) of the contracture remained after

dividing the skin and transarticular muscles (Table 1).

Similarly, the knee flexion contracture remained in the

immobilized group after division of skin and muscle at

both torque values (Fig. 1).

Discussion

Prolonged immobilization reduces passive ROM of joints

creating joint contractures. Whether and to what extent

these iatrogenic contractures can be reduced is not clearly

A B

Torque 2

0

5

10

15

20

25

30

35

40

Muscle On Muscle Off

Kn

eeF

lexi

on

Co

ntr

actu

re(d

egre

e)

* **

*

Torque 1

0

5

10

15

20

25

30

35

40

Muscle On Muscle Off

Kn

eeF

lexi

on

Co

ntr

actu

re(d

egre

e)

Immobilized Sham Immobilized Sham

Fig. 1A–B Knee flexion contractures caused by 8 weeks of immo-

bilization were not reversed by 4 weeks of remobilization.

Contractures are calculated as the ROM lacking in extension of the

surgically treated knee (sham or immobilized group) minus the ROM

lacking in extension of the contralateral knee (sham or immobilized

group) (data presented in Table 1) at two torque values: (A) Torque

1 = 667 g/cm and (B) Torque 2 = 1060 g/cm. Muscle on refers to

results calculated from data on the intact knee; muscle off refers to

results calculated from data on the knee after the skin and

transarticular muscles were removed. Error bars represent standard

error of the mean. * = p B 0.05 between immobilized and sham-

operated groups.

Table 1. Range of motion in extension of rat knees*

Group Number of joints Mean lack of knee extension ± SEM (�)

Torque 1 Torque 2

Muscle on Muscle off� Muscle on Muscle off

Experimental

Immobilized 11 51.9 ± 2.8 45.6 ± 2.7 41.9 ± 3.0 34.7 ± 2.9

Contralateral 11 21.1 ± 2.9� 15.2 ± 2.5� 10.3 ± 2.3� 6.5 ± 2.3�

Control

Sham-operated 8 18.9 ± 2.1� 15.4 ± 1.4� 9.8 ± 2.4� 6.3 ± 2.0�

Contralateral 8 17.6 ± 2.7� 11.5 ± 2.4� 6.9 ± 2.0� 2.8 ± 2.5�

* Range of motion measurements correspond to the angular displacement missing to reach complete extension (0�) at the knee; Torque

1 = 667 g/cm; Torque 2 = 1060 g/cm; �the muscle off procedure isolated the posterior joint capsule as the tissue limiting knee ROM;�p \ 0.05; SEM = standard error of the mean.

Volume 466, Number 5, May 2008 Partial Reversibility of Joint Contractures 1241

123

known from the few published studies. We therefore raised

three questions using an animal model: (1) What degree of

contracture remains at the end of a defined remobilization

period? (2) Do contractures in sham-operated and immo-

bilized joints differ? (3) What is the contribution of the

posterior knee capsule in limiting knee extension?

Given the single time point and number of animals, we

considered this a preliminary study and therefore did not

perform a power analysis. Additional studies would be

required to fully characterize the response to remobiliza-

tion, and we cannot say whether the contractures are

permanent. We first tested animals for combined arthro-

genic and myogenic restriction (muscle on) at both torque

values and then for arthrogenic restriction only (muscle

off) at both torque values. In the first series of testing, the

posterior capsule and other arthrogenic structures may

have been damaged beyond their elastic properties. This

limitation would underestimate the restriction imposed by

the capsular component of the knee.

Using the model of knee immobility, we previously

documented a contracture after 8 weeks of immobility

with a ROM of 69� before sectioning skin and transartic-

ular muscles [32]. The current data show 4 weeks of

remobilization did not restore normal joint mobility and

there was a residual 42� extension contracture at Torque 1.

Most of the limitation in knee ROM remained after divi-

sion of skin and muscles. Sectioning of the posterior knee

capsule eliminated all resistance to knee extension [31].

Therefore we concluded the posterior capsule of the knee

caused the major limitation to knee extension after

immobilization and remobilization.

In previous reports on the reversibility of immobility-

induced joint contractures (Table 2), five studies used a

protocol of remobilization not complemented with exercise

or stretching and resulted in a lack of complete revers-

ibility [10, 14, 19, 34, 35]. Of those five studies of

unassisted remobilization, only one study reported both

measurements of angular displacement and statistical

analysis [14]. Similar to ours, that study reported incom-

plete reversibility of joint contractures secondary to

immobility [14]. However, the duration of the remobili-

zation period influenced the reversibility according to two

studies [4, 24]: joint contractures were reversible after long

periods of remobilization but irreversible after short peri-

ods although ROM measurements [24] and statistical

analysis [4, 24] were not reported in those studies. Our data

on remobilization after 8 weeks of immobility provide

evidence for the lack of reversibility at 4 weeks.

Many anatomic structures potentially limit mobility of

the knee. They include skin, bone, muscle, tendons, liga-

ments, and capsule. Published studies on the response of

those structures to immobility is available except for the

capsule. Although muscle fibers have plasticity for Ta

ble

2.

Lit

erat

ure

on

rev

ersi

bil

ity

of

imm

ob

ilit

y-i

nd

uce

djo

int

con

trac

ture

s

Stu

dy

An

imal

join

tIm

mo

bil

izat

ion

syst

emR

emo

bil

izat

ion

Ran

ge

of

mo

tio

n

(mea

sure

dat

the

end

of

rem

ob

iliz

atio

n)

Nu

mb

erS

tati

stic

sR

ever

sib

le

Mic

hel

sso

n[1

9]

Rab

bit

kn

eeE

xte

nsi

on

pla

ster

,5

wee

ks

No

tas

sist

ed8

wee

ks

No

11

No

No

Ak

eso

net

al.

[4]

Rab

bit

kn

eeF

lex

ion

inte

rnal

,9

wee

ks

No

tas

sist

ed1

,2,3

,6,9

wee

ks

Yes

25

No

No

:1

,2

,3

wee

ks

Yes

:6

,9

wee

ks

Fin

ster

bu

shan

dF

ried

man

[10]

Rab

bit

kn

eeF

lex

ion

cast

,2

wee

ks

6w

eek

sN

ot

assi

sted

6,

8m

on

ths

No

22

No

No

Hil

deb

ran

det

al.

[14]

Rab

bit

kn

eeF

lex

ion

8w

eek

sN

ot

assi

sted

8,

16

,3

2w

eek

sY

es2

8Y

esN

o

Usu

ba

etal

.[3

4]

Rat

kn

eeF

lex

ion

inte

rnal

,4

0d

ays

Str

etch

ing

4w

eek

sY

es5

3Y

esN

o

Sak

akim

aet

al.

[23

]R

atan

kle

Fle

xio

nca

st,

2w

eek

sE

xer

cise

6w

eek

sY

es3

9Y

esN

o:

wit

ho

ut

exer

cise

Yes

:w

ith

exer

cise

Sch

oll

mei

eret

al.

[24

]C

anin

esh

ou

lder

Cas

t,1

2w

eek

sN

ot

assi

sted

4,

8,

12

wee

ks

No

10

No

No

:4

,8

wee

ks

Yes

:1

2w

eek

s

Van

Har

rev

eld

etal

.[3

5]

Ho

rse

met

acar

po

-

ph

alan

gea

l

Cas

t,7

wee

ks

Ex

erci

se2

wee

ks

Yes

5N

oN

o


123

adaptive lengthening [26, 37], intrafascicular endomysium

and intramuscular septa and perimysium, composed of

dense connective fascia, may be more resistant to rees-

tablishment of their previous length [1]. This also applies

to tendons and ligaments [3, 5, 11, 13, 16, 21, 36, 38, 39].

Our data suggest a possible role of the capsule and intra-

articular ligaments of the knee in the contracture. The

capsular changes, synovial villi adhesion, synovial short-

ening, and atrophy were not amenable to spontaneous

recovery after 4 weeks of remobilization [27, 30]. A tem-

poral study to evaluate the duration of the immobilization

period leading to irreversible joint contractures would

provide the rationale to develop a protocol for timely

clinical intervention. The incomplete reversibility of joint

contractures underscores the need for active preventive

action on immobile joints.

Range of motion of rat knees immobilized for 8 weeks

remains substantially reduced after a 4-week period of

unassisted remobilization. The posterior knee capsule was

the primary structure restricting ROM.

Acknowledgments We thank Julie Courchesne for assistance with

these experiments.

References

1. Akeson WH, Amiel D, Abel MF, Garfin SR, Woo SL. Effects of

immobilization on joints. Clin Orthop Relat Res. 1987;219:28–

37.

2. Akeson WH, Amiel D, Woo SL. Immobility effects on synovial

joints: the pathomechanics of joint contracture. Biorheology.

1980;17:95–110.

3. Akeson WH, Woo SL, Amiel D, Coutts RD, Daniel D. The

connective tissue response to immobility: biochemical changes in

periarticular connective tissue of the immobilized rabbit knee.


4. Akeson WH, Woo SL, Amiel D, Doty DH. Rapid recovery from

contractures in rabbit hindlimbs: a correlative biomechanical and

biochemical study. Clin Orthop Relat Res. 1977;122:359–365.

5. Amiel D, Woo SL, Harwood FL, Akeson WH. The effect of

immobilization on collagen turnover in connective tissue: a bio-

chemical-biomechanical correlation. Acta Orthop Scand. 1982;

53:325–332.

6. Brandt KD. Response of joint structures to inactivity and to

reloading after immobilization. Arthritis Rheum. 2003;49:267–

271.

7. Clavet H, Hebert P, Fergusson D, Doucette S, Trudel G. Joint

contractures following prolonged stays in the intensive care unit.

CMAJ. 2008, DOI: 10.1503/cmaj.071054.

8. Evans EB, Eggers GW, Butler JK, Blumel J. Experimental

immobilization and remobilization of rat knee joints. J Bone JointSurg Am.1960;42:737–758.

9. Fergusson D, Hutton B, Drodge A. The epidemiology of major

joint contractures: a systematic review of the literature. ClinOrthop Relat Res. 2007;456:22–29.

10. Finsterbush A, Friedman B. Reversibility of joint changes pro-

duced by immobilization in rabbits. Clin Orthop Relat Res.

1975;111:290–298.

11. Frank C, MacFarlane B, Edwards P, Rangayyan R, Liu ZQ,

Walsh S, Bray R. A quantitative analysis of matrix alignment in

ligament scars: a comparison of movement versus immobilization

in an immature rabbit model. J Orthop Res. 1991;9:219–227.

12. Furlow LT Jr, Peacock EE Jr. Effect of beta-aminopropionitrile

on joint stiffness in the rat. Ann Surg. 1967;165:442–447.

13. Harper J, Amiel D, Harper E. Collagenases from periarticular

ligaments and tendons: enzyme levels during the development of

joint contractures. Matrix. 1989;9:200–205.

14. Hildebrand KA, Sutherland C, Zhang M. Rabbit knee model of

post-traumatic joint contractures: the long-term natural history

of motion loss and myofibroblasts. J Orthop Res. 2004;22:

313–320.

15. Kagaya H, Sharma M, Kobetic R, Marsolais EB. Ankle, knee,

and hip moments during standing with and without joint con-

tractures: simulation study for functional electrical stimulation.

Am J Phys Med Rehabil. 1998;77:49–54.

16. Karpakka J, Vaananen K, Virtanen P, Savolainen J, Orava S,

Takala TE. The effects of remobilization and exercise on colla-

gen biosynthesis in rat tendon. Acta Physiol Scand. 1990;139:

139–145.

17. Leblebici B, Adam M, Bagis S, Tarim AM, Noyan T, Akman

MN, Haberal MA. Quality of life after burn injury: the impact of

joint contracture. J Burn Care Res. 2006;27:864–868.

18. Matsumoto F, Trudel G, Uhthoff H. High collagen type I and low

collagen type III levels in knee joint contracture: an immuno-

histochemical study with histological correlate. Acta OrthopScand. 2002;73:335–343.

19. Michelsson JE. Thickness of the rabbit knee during and after

immobilization. IRCS Med Sci Connect Tissue Skin Bone PatholSurg Transplant. 1979;7:36.

20. Morris PE. Moving our critically ill patients: mobility barriers

and benefits. Crit Care Clin. 2007;23:1–20.

21. Noyes FR. Functional properties of knee ligaments and altera-

tions induced by immobilization. Clin Orthop Relat Res.

1977;123:210–242.

22. Perry J. Contractures: a historical perspective. Clin Orthop RelatRes. 1987;219:8–14.

23. Sakakima H, Yoshida Y, Sakae K, Morimoto N. Different fre-

quency treadmill running in immobilization-induced muscle

atrophy and joint contracture of rats. Scand J Med Sci Sports.

2004;14:186–192.

24. Schollmeier G, Sarker K, Fukuhara K, Uhthoff HK. Structural

and functional changes in the canine shoulder after cessation of

immobilization. Clin Orthop Relat Res. 1996;323:310–315.

25. Souren LE, Franssen EH, Reisberg B. Contractures and loss of

function in patients with Alzheimer’s disease. J Am Geriatr Soc.

1995;43:650–655.

26. Tabary JC, Tabary C, Tardieu C, Tardieu G, Goldspink G.

Physiological and structural changes in the cat’s soleus muscle

due to immobilization at different lengths by plaster casts.

J Physiol. 1972;224:231–244.

27. Trudel G, Jabi M, Uhthoff H. Localized and adaptive synoviocyte

proliferation characteristics in rat knee joint contractures sec-

ondary to immobility. Arch Phys Med Rehabil. 2003;84:1350–

1356.

28. Trudel G, Laneuville O, Uhthoff HK. Joint contractures: editorial

comment. Clin Orthop Relat Res. 2007;456:2.

29. Trudel G, O’Neill PA, Goudreau LA. A mechanical arthrometer

to measure knee joint contracture in rats. IEEE Trans Rehab Eng.

2000;8:149–155.

30. Trudel G, Seki M, Uhthoff HK. Synovial adhesions are more

important than pannus proliferation in the pathogenesis of knee

joint contracture after immobilization: an experimental investi-

gation in the rat. J Rheumatol. 2000;27:351–357.

Volume 466, Number 5, May 2008 Partial Reversibility of Joint Contractures 1243

123

http://dx.doi.org/10.1503/cmaj.071054

31. Trudel G, Uhthoff HK. Contractures secondary to immobility: is

the restriction articular or muscular? An experimental longitu-

dinal study in the rat knee. Arch Phys Med Rehabil. 2000;81:

6–13.

32. Trudel G, Uhthoff HK, Brown M. Extent and direction of joint

motion limitation after prolonged immobility: an experimental

study in the rat. Arch Phys Med Rehabil. 1999;80:1542–1547.

33. Trudel G, Uhthoff HK, Laneuville O. Prothrombin gene expres-

sion in articular cartilage with a putative role in cartilage

degeneration secondary to joint immobility. J Rheumatol. 2005;

32:1547–1555.

34. Usuba M, Akai M, Shirasaki BS, Miyakawa S. Experimental joint

contracture correction with low torque: long duration repeated

stretching. Clin Orthop Relat Res. 2007;456:70–78.

35. Van Harreveld PD, Lillich JD, Kawcak CE, Gaughan EM,

Mclaughlin RM, Debowes RM. Clinical evaluation of the effects

of immobilization followed by remobilization and exercise on the

metacarpophalangeal joint in horse. Am J Vet Res. 2002;63:282–

288.

36. Walsh S, Frank C, Hart D. Immobilization alters cell metabolism

in an immature ligament. Clin Orthop Relat Res. 1992;277:277–

288.

37. Winkelman C. Inactivity and inflammation in the critically ill

patients. Crit Care Clin. 2007;23:21–34.

38. Woo SL, Gomez MA, Inoue M, Akeson WH. New experimental

procedures to evaluate the biomechanical properties of healing

canine medial collateral ligaments. J Orthop Res. 1987;5:425–

432.

39. Woo SL, Gomez MA, Sites TJ, Newton PO, Orlando CA, Akeson

WH. The biomechanical and morphological changes in the

medial collateral ligament of rabbit after immobilization and

remobilization. J Bone Joint Surg Am. 1987;69:1200–1211.


123

ORIGINAL ARTICLE

Readability of Online Patient Education MaterialsFrom the AAOS Web Site

Sanjeev Sabharwal MD, Sameer Badarudeen MBBS,

Shebna Unes Kunju MBBS

Received: 6 February 2008 / Accepted: 15 February 2008 / Published online: 7 March 2008


Abstract One of the goals of the American Academy of

Orthopaedic Surgeons (AAOS) is to disseminate patient

education materials that suit the readability skills of the

patient population. According to standard guidelines from

healthcare organizations, the readability of patient educa-

tion materials should be no higher than the sixth-grade

level. We hypothesized the readability level of patient

education materials available on the AAOS Web site would

be higher than the recommended grade level, regardless

when the material was available online. Readability scores

of all articles from the AAOS Internet-based patient

information Web site, ‘‘Your Orthopaedic Connection,’’

were determined using the Flesch-Kincaid grade formula.

The mean Flesch-Kincaid grade level of the 426 unique

articles was 10.43. Only 10 (2%) of the articles had the

recommended readability level of sixth grade or lower. The

readability of the articles did not change with time. Our

findings suggest the majority of the patient education

materials available on the AAOS Web site had readability

scores that may be too difficult for comprehension by a

substantial portion of the patient population.

Introduction

In 2000, the American Academy of Orthopaedic Surgeons

(AAOS) introduced the Internet-based patient education

database, ‘‘Your Orthopaedic Connection [3].’’ Every day

more than 35,000 people visit this Web site to access

education materials on diverse orthopaedic conditions [2]

(oral communication, Jim Ogale, AAOS Web site staff,

June 6, 2007). The goal of this Web site is to enhance

patient-physician communication by providing validated

and up-to-date information about various orthopaedic

conditions in a way that is ‘‘sensitive to diversity and

readability and to strengthen the bond between physicians

and patients [24].’’

Readability of a text is the reading comprehension level

a person must have to understand the written material and

is an important determinant of a person’s ability to com-

prehend health information [1, 14, 38]. The Flesch-Kincaid

(FK) grade formula is one of the most commonly used

tools to assess the readability of written materials in terms

of the academic grade [1, 14]. A higher FK grade level of a

text indicates a greater level of difficulty to read and

comprehend the material and thus requires more advanced

reading skills than would be required of a text with a lower

FK grade level. Organizations like the National Institutes

of Health, the National Work Group on Cancer and Health,

and the American Medical Association have recommended

the readability of patient education materials should be no

higher than the sixth-grade level [15, 34, 35]. The average

readability of the US adult population is at the eight-grade

level [18]. However, several studies suggest the readability

of patient education materials in most medical specialties is

beyond these recommended levels [1, 14, 18, 34]. We

recently assessed the readability scores of patient education

materials that were available at the AAOS and Pediatric





S. Sabharwal (&), S. Badarudeen, S. Unes Kunju

Department of Orthopedics, University of Medicine and

Dentistry of New Jersey–New Jersey Medical School,

Doctor’s Office Center, 90 Bergen Street, Suite 7300, Newark,

NJ 07103, USA


123


DOI 10.1007/s11999-008-0193-8

Orthopaedic Society of North America (POSNA) Web

sites, pertaining exclusively to pediatric orthopaedic con-

ditions [5]. Only 2% of the articles available in 2007 had a

FK readability score of the sixth grade level or less. It is

unknown whether there is a trend toward greater read-

ability on these two sites, but if the readability of articles

remains high over a period of time, it would suggest lack of

awareness of the importance of readability in the ortho-

paedic community.

Based on the cited reports of relatively high reading

levels of patient education material, we hypothesized the

readability level of the majority of patient education

materials available on the AAOS Web site would be higher

than the recommended FK grade level of sixth grade. We

then asked whether there was a trend toward lower read-

ability scores of articles available on the Web site with

time. Finally, we asked whether the variability of the

readability level of articles would differ between subject

categories in the patient education Web site.


We searched the patient education database, ‘‘Your

Orthopaedic Connection,’’ of the AAOS Web site [3]

during April 2007 and downloaded all 663 patient edu-

cation articles. Materials had been created between

September 1999 and July 2006. We excluded articles

written in a language other than English. We noted the

subject category of each article and the date of the last

update and saved the text as a separate Microsoft1

Word1 (Microsoft Corp, Redmond, WA) document. The

text was copied as plain text format to avoid HTML tags

[30]. Any information related to Web page navigation,

copyright notices, postal addresses, phone numbers, uni-

form resource locaters (URLs), disclaimers, date stamps,

author information, citations, references, feedback ques-

tionnaires, or hyperlinks were omitted. Followup editing

was performed as recommended by Flesch and others

[19, 21] by removing decimal points from numbers and

colons and semicolons in sentences. The FK grade for-

mula is best suited for text arranged in a paragraph as

opposed to list format [32]. A running passage containing

a minimum of 35 words was defined as a paragraph. To

get the most representative sample, similar to methods

adopted by other researchers, the three longest paragraphs

of each patient education article were selected [1, 17].

Our Institutional Review Board granted a waiver for the

study.

There were 663 articles grouped under 21 subject cat-

egories in the AAOS patient information Web site, ‘‘Your

Orthopaedic Connection [3].’’ Forty of these articles were

in Spanish and thus excluded from the study. Of the

remaining 623 articles, 573 articles in 19 subject categories

met the study’s inclusion criteria. Of the 573 articles, 147

were listed in more than one subject category, resulting in

426 unique articles.

The FK grade level of readability was assessed using

Microsoft1 Office Word1 software (2003 Service Pack 2;

Microsoft Corp). The built-in tool to measure readability is

disabled by default, and the user has to enable it by

sequentially selecting the commands ‘‘Tools,’’ ‘‘Options,’’

‘‘Spelling and Grammar,’’ and then enabling the option

‘‘Show readability statistics’’ followed by clicking on the

icon for ‘‘Spelling and Grammar’’ from the tool bar. The

underlying formula for determining the FK grade level is as

follows [21, 27]: (0.39 9 average number of words per

sentence) + (11.8 9 average number of syllables per

word) – 15.59.

The same individual (SUK) calculated all FK grade

levels. Interobserver reliability was assessed by calculating

the intraclass correlation coefficient using 30 randomly

selected articles that were graded by another individual

(SB). An intraclass correlation coefficient of 0 to 0.24

reflects poor correlation; 0.25 to 0.49, low; 0.50 to 0.69,

fair; 0.7 to 0.89, good; and 0.9 to 1.0, excellent [33]. The

intraclass correlation coefficient for assessing FK grade

level was 0.96, indicating excellent interobserver

reliability.

The mean and 95% confidence interval values of the FK

grade level were calculated. Using descriptive statistics and

analysis of variance, the readability grade scores of articles

grouped under different subject categories were analyzed.

A two-sample t test was used to compare the FK grade for

articles in each subject category against the rest of the

articles. The Pearson correlation coefficient (r) was calcu-

lated to study the relationship of the FK grade of articles

with the date when the latest version of the article was

available online. Statistical analysis was performed using

the SAS1 software (Version 9.1; SAS Institute Inc, Cary,

NC).

Results

The majority (98%) of the 426 unique articles on the

patient education Web site had readability scores that were

higher than the sixth-grade level. Only 10 articles (2%) had

the recommended readability level of the sixth-grade level

or less [15, 34, 35]. The mean FK grade level of the 426

articles was 10.4 (95% confidence interval, 10.2–10.6).

Moreover, 85% of the articles had readability above the

eighth-grade level (Fig. 1).

The readability level did not change with time

(r = 0.0003) (Fig. 2). Thus the readability of articles

remained high throughout the entire period.

1246 Sabharwal et al. Clinical Orthopaedics and Related Research

123

Although none of the 19 subcategories of articles

achieved a mean FK grade level of sixth or lower

(Table 1), we found substantial variation in the readability

scores among the patient education articles in different

subcategories. The FK grades of articles in the Hand and

Foot sections were lower (p = 0.001 and p = 0.028,

respectively), indicating easier readability, whereas the FK

grades of articles in the General Information and Patient

Stories categories were higher (p = 0.006 and p \ 0.001,

respectively) than the remaining articles.

Discussion

There is increasing concern regarding the disparity

between the readability levels of patient education mate-

rials available online and the reading skills of the target

population [1, 14, 18]. Based on our review of the literature

and our recent report dealing exclusively with the read-

ability scores of online pediatric orthopaedic materials [5],

the readability of medical information is higher than

generally recommended. Based on this literature we

hypothesized the readability level of the majority of patient

education materials available on the AAOS Web site,

‘‘Your Orthopaedic Connection [3]’’ would be higher than

the recommended FK grade level of sixth grade. We then

asked whether there was a trend toward lower readability

scores of articles available on the Web site with time.

Finally, we asked whether the variability of the readability

level of articles would differ between subject categories in

the patient education Web site.

We note several limitations in our study. First, there is

an inherent weakness in the assessment of readability of

health-related text using the FK grade level because this

tool relies solely on the number of syllables in a word and

the number of words in a sentence [19]; the number of

syllables may not accurately reflect reading level. In the

field of medicine, the unfamiliarity of nonprofessionals to

medical terms, even if they are short, such as ‘‘lupus,’’

‘‘physis,’’ and ‘‘colon,’’ can lead to underestimation of the

reading skills required to fully comprehend medical liter-

ature with the use of the FK grading system [23]. Although

Fig. 1 The distribution of FK readability grades of 426 unique

articles that were available at the AAOS patient education Web site,

‘‘Your Orthopaedic Connection,’’ [3] is illustrated.

Fig. 2 A scatterplot displays the lack of relationship of the FK grade

of the online articles with the date when the latest version of the

article was available online. Pearson correlation coefficient

r = 0.0003 (n = 426).

Table 1. Flesch-Kincaid grade level of AAOS patient education

articles (n = 573) in 19 subject categories

Subject categories Number

of articles

Flesch-Kincaid grade level p Value

Mean 95% confidence

interval

Arm 13 9.8 9.0–10.7 0.346

Arthritis 22 10.8 10.2–11.3 0.146

Children 48 10.1 9.7–10.5 0.191

Foot* 41 9.9 9.4–10.3 0.028

General

information**

61 10.9 10.5–11.2 0.006

Hand* 32 9.7 9.3–10.1 0.001

Hip 26 10.4 9.7–11.0 0.99

Injury prevention 64 10.0 9.3–10.7 0.23

Joint replacement 28 10.8 10.0–11.7 0.212

Knee 34 10.9 10.4–11.5 0.101

Neck 7 9.9 8.9–10.9 0.549

Osteoporosis 11 10.9 9.2–12.6 0.373

Patient stories** 33 11.9 11.4–12.4 \ 0.001

Patient-centered

care

15 11.3 9.8–12.7 0.086

Shoulder 21 10.2 9.5–11.0 0.78

Sports/exercise 68 9.8 9.0–10.5 0.083

Spine 22 10.0 9.1–10.9 0.421

Tumors 12 9.6 8.7–10.4 0.172

Women’s health 15 10.9 9.8–12.0 0.307

p value refers to the t test comparing each subject category with the

remaining articles; *mean FK grade level was significantly lower than

the remaining articles; **mean FK grade significantly higher than the

remaining articles.

Volume 466, Number 5, May 2008 Readability of Patient Education Materials 1247

123

comprehension of a given material may be enhanced by the

addition of illustrative figures, improved layout, and

appropriate use of font size and color [34], the FK grading

tool does not assess these features. Other instruments such

as the Suitability Assessment of Materials (SAM), a rela-

tively new tool, can assess these factors to measure the

comprehensibility of patient education materials [7, 18, 25,

37]. However, SAM is not as validated as the FK grade

score, is more time-consuming [18], and is ‘‘inherently

subjective [37].’’ Furthermore, the scoring system by SAM

is not based on grades and thus is incompatible with the

recommendations by healthcare organizations [18]. Sec-

ond, we did not directly assess the reading skills of our

patient population. There are many validated tools avail-

able to assess the reading skills of a given population.

These include the Wide Range Achievement Test, Rapid

Estimate of Adult Literacy in Medicine, and the Test of

Functional Health Literacy in Adults [10]. However, in the

context of the current study, because the patient education

materials available through the AAOS Web site are avail-

able in the public domain and do not have a definite target

population, trying to match the reading level of these

materials to the reading skills of our patient population may

be irrelevant. Third, we excluded articles that were avail-

able in a language other than English. Given that 41% of

the people who are visiting the AAOS Web site are from

countries where English is not the primary language, the

need to make patient education articles easier to read is

even more imperative [2]. Fourth, we did not assess the

entire text of the articles on the Web site, but only the

longest three paragraphs. We presume these would reflect

the entire article. Finally, we limited our assessment of

readability of orthopaedic patient education materials to

one Web site. Patients and their caretakers may access

more than one Web site to gain additional insight into their

orthopaedic ailments. Nevertheless, we believe our study is

relevant because orthopaedic surgeons often direct their

patients to the AAOS Web site to find accurate, peer-

reviewed, and up-to-date information. The Web site reach

as measured by number of daily unique visitors of more

than 35,000 adds further credibility to our sample selection

[2] (oral communication, Jim Ogale, AAOS Web site staff,

June 6, 2007).

Numerous authors report patients seeking orthopaedic

care extensively use the Internet as a resource for patient

education [8, 9, 13, 28]. Access to the Internet and its use to

obtain health information are increasing globally at a rapid

pace. One study reported three of every four patients

attending an orthopaedic clinic have access to the Internet

[13]. The Pew Research Center report found, in 2006 alone,

more than 100 million people in the United States searched

the Internet to find health information about diseases from

which they or their relatives and friends suffer [20].

However, patient education materials available on the

Internet may not have the appropriate reading level for the

average person. A survey conducted in a pediatric ortho-

paedic outpatient clinic reported 2.3 of the respondents

believed the health information available on the Internet

was ‘‘too technical [4].’’ However, the authors did not

assess the issue of readability. Our findings highlight the

need for orthopaedic surgeons and educators to recognize

the concept of readability while preparing and reviewing

health education materials for their patients. Although only

2% of the English articles on the AAOS Web site had

readability at the sixth-grade level or lower, creating

musculoskeletal education articles with easier readability

for patients seems attainable.

A recent national adult literacy survey found 40 million

people in the adult US population have literacy skills

equivalent to less than the fifth-grade level and another

50 million have reading skills between the sixth- and

eighth-grade levels [29, 36]. Reading grade level is distinct

from the last academic grade achieved in schools and

colleges. Patients read approximately five grades lower

than their highest attained academic grade [26, 31]. The

reason for this difference between academic grade and

reading level may be multifactorial and possibly related to

a flaw in the education system and the fact that a sub-

stantial portion of the patient population belong to the

lower socioeconomic status [18]. Health literacy is the best

predictor of an individual’s health status [38]. It is defined

as the ‘‘degree to which individuals have the capacity to

obtain, process and understand health information and

services needed to make appropriate health decisions [29,

36].’’ Low health literacy is associated with poor health

status, increased hospitalization rate, poor compliance to

treatment, missed appointments, and increased healthcare

expenditure [6, 10, 18, 34, 36].

The improved access to the Internet is making the online

population increasingly similar to the general population

[20]. The fact that 33% of the ‘‘online health seekers’’ had

only a high school diploma or less education [20] adds

further proof to this assumption. Recently, a national sur-

vey found 20% of adults with ‘‘below basic health

literacy’’’ are getting their health information from the

Internet [29]. Some studies also suggest even people with

good literacy skills prefer materials written in simpler

format and low grade level [16, 37]. Furthermore, surgeons

often are using patient education handouts printed from

Web pages for their patients, and thus the readability level

of Internet-based health information materials should serve

the needs of all segments of society [23]. Although the data

regarding readability skills of Internet users are lacking,

most researchers use readability standards of the general

patient population to assess the readability of online

materials [11, 12, 16, 22, 23, 30, 37].


123

Readability of patient education materials can be

assessed readily using the FK grade formula, with a rela-

tively simple set of keystroke instructions and software

available on most personal computers. The FK grade for-

mula originally was developed for the US military in the

early 1970s [27]. Since then, this instrument has been

extensively validated and researched [14, 21, 31]. The

advent of computers and software capable of automating

the calculation has made the formula relatively simple,

quick, and intuitive [14, 21, 31] and within the reach of

almost every healthcare worker. As established in our

study, the FK grade formula has very high interobserver

reliability. Our findings support the hypothesis that the

readability of patient education materials in the AAOS

patient education database would be higher than the rec-

ommended level. In addition, we found the readability

scores of the text did not improve with time. These findings

may reflect the lack of awareness regarding the concept of

readability in the orthopaedic community. Moreover, in a

recent study [5], despite using a smaller and distinct set of

online patient education materials dealing exclusively with

pediatric orthopaedic conditions, we arrived at a similar

conclusion with only 2% of the articles having readability

scores of the sixth grade level or less. The method used in

that study [5] also was different, in that the entire text was

subject to the FK formula as opposed to assessing the

readability score based on the longest three paragraphs, as

in the current study.

In addition to the FK grade level available on the

Microsoft1 Office software, there are other software

packages, such as Corel1 WordPerfect1 Office X3

(Corel Corp, Ottawa, Ontario, Canada), Readability Cal-

culations (Micro Power and Light Co, Dallas, TX),

Readability Studio 1.1 (Oleander Solutions, Vandalia,

OH), and InText (Social Science Consulting, Rudolstadt,

Germany) [35], that have readability assessment tools.

However, we believe the readability score of a given text

should not be the sole criterion to develop patient edu-

cation materials. The ‘‘Living word vocabulary’’ contains

approximately 43,000 words arranged in various grade

levels of complexity and can be used to substitute diffi-

cult words [15, 31]. To allow improved comprehension

by a larger segment of the society, simpler words can

replace complex medical jargon. A list of lay terms that

can be used instead of medical terms can be found at the

following Web sites: http://uuhsc.utah.edu/pated/authors/

substitute2.html and http://plainlanguage.gov/howto/word

suggestions/index.cfm [15]. Detailed instructions on

making more comprehensible patient education literature

are available through the American Medical Association

[38].

Ensuring patients receive education materials they can

understand is the responsibility of physicians, professional

organizations, and healthcare institutions [15]. Our find-

ings suggest a substantial portion of the patient education

articles available at the patient education library of the

AAOS Web site have readability scores that are higher

than the sixth-grade level. These findings suggest the

online material presented may be too difficult for com-

prehension by a substantial portion of the patient

population. To enhance the patient-physician dialogue,

orthopaedic educators should attempt to keep the read-

ability level of the patient education materials at a FK

grade level of sixth grade or lower. Such measures will

help accomplish the goal of the AAOS Web site of

‘‘improving the communication between orthopaedic sur-

geons and their patients’’ [24] and positively influence the

health outcome of our patients.

Acknowledgments We acknowledge the contributions of Caixia

Zhao, MD, and Emily McClemens, PA-C, in preparation of this

manuscript.

References

1. Albright J, de Guzman C, Acebo P, Paiva D, Faulkner M,

Swanson J. Readability of patient education materials: implica-

tions for clinical practice. Appl Nurs Res. 1996;9:139–143.

2. Alexa1 the Web Information Company. Available at: http://

www.alexa.com/data/details/traffic_details?q=orthoinfo.org&url=

orthoinfo.org/ Accessed June 4, 2007.

3. American Academy of Orthopaedic Surgeons. Your orthopaedic

connection. Available at: http://orthoinfo.aaos.org/all.cfm.

Accessed February 6, 2007.

4. Aslam N, Bowyer D, Wainwright A, Theologis T, Benson M.

Evaluation of Internet use by paediatric orthopaedic outpatients

and the quality of information available. J Pediatr Orthop B.

2005;14:129–133.

5. Badarudeen S, Sabharwal S. Readability of patient education

materials from the American Academy of Orthopaedic Surgeons

and Pediatric Orthopaedic Society of North America Web sites.


6. Baker DW, Parker RM, Williams MV, Clark WS, Nurss J. The

relationship of patient reading ability to self-reported health and

use of health services. Am J Public Health. 1997;87:1027–1030.

7. Bass L. Health literacy: implications for teaching the adult

patient. J Infus Nurs. 2005;28:15–22.

8. Beall MS 3rd, Beall MS Jr, Greenfield ML, Biermann JS. Patient

Internet use in a community outpatient orthopaedic practice. IowaOrthop J. 2002;22:103–107.

9. Beall MS 3rd, Golladay GJ, Greenfield ML, Hensinger RN,

Biermann JS. Use of the Internet by pediatric orthopaedic out-

patients. J Pediatr Orthop. 2002;22:261–264.

10. Berkman ND, DeWalt DA, Pignone MP, Sheridan SL, Lohr KN,

Lux L, Sutton SF, Swinson T, Bonito AJ. Literacy, Health Out-comes: Evidence Report. Rockville, MD: Agency for Healthcare

Research and Quality/US Department of Health and Human

Services; 2004.

11. Berland GK, Elliott MN, Morales LS, Algazy JI, Kravitz RL,

Broder MS, Kanouse DE, Munoz JA, Puyol JA, Lara M, Watkins

KE, Yang H, McGlynn EA. Health information on the Internet:

accessibility, quality, and readability in English and Spanish.

JAMA. 2001;285:2612–2621.

Volume 466, Number 5, May 2008 Readability of Patient Education Materials 1249

123

http://uuhsc.utah.edu/pated/authors/substitute2.html

http://uuhsc.utah.edu/pated/authors/substitute2.html

http://plainlanguage.gov/howto/wordsuggestions/index.cfm

http://plainlanguage.gov/howto/wordsuggestions/index.cfm

http://www.alexa.com/data/details/traffic_details?q=orthoinfo.org&url=orthoinfo.org/



http://orthoinfo.aaos.org/all.cfm

12. Boulos MN. British internet-derived patient information on dia-

betes mellitus: is it readable? Diabetes Technol Ther.

2005;7:528–535.

13. Brooks BA. Using the Internet for patient education. OrthopNurs. 2001;20:69–77.

14. Cooley ME, Moriarty H, Berger MS, Selm-Orr D, Coyle B, Short

T. Patient literacy and the readability of written cancer educa-

tional materials. Oncol Nurs Forum. 1995;22:1345–1351.

15. Cotugna N, Vickery CE, Carpenter-Haefele KM. Evaluation of

literacy level of patient education pages in health-related jour-

nals. J Community Health. 2005;30:213–219.

16. D’Alessandro DM, Kingsley P, Johnson-West J. The readability

of pediatric patient education materials on the World Wide Web.

Arch Pediatr Adolesc Med. 2001;155:807–812.

17. Davis TC, Mayeaux EJ, Fredrickson D, Bocchini JA Jr, Jackson

RH, Murphy PW. Reading ability of parents compared with

reading level of pediatric patient education materials. Pediatrics.

1994;93:460–468.

18. Doak CC, Doak LG, Root JH. Teaching Patients With LowLiteracy Skills. 2nd ed. Philadelphia, PA: JB Lippincott; 1996.

19. Flesch RF. How to Write Plain English: A Book for Lawyers,Consumers. 1st ed. New York, NY: Barnes and Noble; 1981.

20. Fox S. Online Health Search 2006: Report. Washington, DC:

Pew Internet and American Life Project; 2006.

21. Friedman DB, Hoffman-Goetz L. A systematic review of read-

ability and comprehension instruments used for print and web-

based cancer information. Health Educ Behav. 2006;33:352–373.

22. Friedman DB, Hoffman-Goetz L, Arocha JF. Readability of

cancer information on the Internet. J Cancer Educ. 2004;19:117–

122.

23. Graber MA, Roller CM, Kaeble B. Readability levels of patient

education material on the World Wide Web. J Fam Pract.1999;48:58–61.

24. Hirsch SA. Academy introduces Web-based medical education

for fellows and patients. J Bone Joint Surg Am. 2000;82:1665–

1667.

25. Hoffmann T, McKenna K. Analysis of stroke patients’ and ca-

rers’ reading ability and the content and design of written

materials: recommendations for improving written stroke infor-

mation. Patient Educ Couns. 2006;60:286–293.

26. Jackson RH, Davis TC, Bairnsfather LE, George RB, Crouch

MA, Gault H. Patient reading ability: an overlooked problem in

health care. South Med J. 1991;84:1172–1175.

27. Kincaid JP, Fishburne RP, Rogers RL, Chissom BS. Derivation ofNew Readability Formulas (Automated Readability Index, FogCount, and Flesch Reading Ease Formula) for Navy EnlistedPersonnel: Report. Millington, TN: Research Branch, Naval

Technical Training Command; 1975.

28. Krempec J, Hall J, Biermann JS. Internet use by patients in

orthopaedic surgery. Iowa Orthop J. 2003;23:80–82.

29. Kutner M, Greenburg E, Jin Y, Paulsen C. The Health Literacy ofAmerica’s Adults: Results from the 2003 National Assessment ofAdult Literacy. Washington, DC: National Center for Education

Statistics; 2006.

30. Lewiecki EM, Rudolph LA, Kiebzak GM, Chavez JR, Thorpe

BM. Assessment of osteoporosis-website quality. OsteoporosisInt. 2006;17:741–752.

31. Ley P, Florio T. The use of readability formulas in health care.

Psychol Health Med. 1996;1:7–28.

32. Mosenthal PB, Kirsch IS. A new measure of assessing document

complexity: the PMOSE/IKIRSCH Document Readability For-

mula. J Adolesc Adult Lit. 1998;41:638–657.

33. Munro BH. Correlation. Statistical Methods for Health CareResearch. 5th ed. Philadelphia, PA: Lippincott-Raven; 2005:239–

258.

34. Murero M, D’Ancona G, Karamanoukian H. Use of the Internet

by patients before and after cardiac surgery: telephone survey.

J Med Internet Res. 2001;3:E27.

35. National Institutes of Health. MedlinePlus: How to write easy to

read health materials. Available at: http://www.nlm.nih.gov/

medlineplus/etr.html. Accessed May 1, 2007.

36. Nielsen-Bohlman L, Panzer AM, Kindig DA. Health Literacy: APrescription to End Confusion. Washington, DC: Institute of

Medicine, National Academies Press; 2004.

37. Wallace LS, Turner LW, Ballard JE, Keenum AJ, Weiss BD.

Evaluation of Web-based osteoporosis educational materials.

J Womens Health. 2005;14:936–945.

38. Weiss BD. Health Literacy: A Manual for Clinicians. Chicago,

IL: American Medical Association, American Medical Founda-

tion; 2003.


123

http://www.nlm.nih.gov/medlineplus/etr.html

http://www.nlm.nih.gov/medlineplus/etr.html

CASE REPORT

Case Report

Parachordoma of Soft Tissues of the Arm

Jonathan Clabeaux MD, Leonard Hojnowski MD,

Alfredo Valente MD, Timothy A. Damron MD

Received: 7 August 2007 / Accepted: 8 January 2008 / Published online: 25 January 2008


Abstract Parachordoma, or myoepithelioma, is a very

rare tumor histologically resembling chordoma but occur-

ring in the nonaxial soft tissues. It typically has an indolent

nature, with occasional late recurrence and even rare

metastases. Review of existing literature reveals a male

predilection, with the tumor typically occurring in the

fourth decade of life in the lower extremity. It typically is

managed with wide resection. We report the case of a 60-

year-old woman with a right distal upper arm parachord-

oma treated with wide resection of the tumor.

Introduction

Parachordoma, also known as myoepithelioma, is an

extremely rare soft tissue tumor that histologically resem-

bles chordoma of the axial skeleton in a nonaxial location.

Fewer than 50 cases are reported in the English literature

[14]. The first description is credited to Laskowski in 1951

[4], who initially labeled it chordoma periphericum.

Dabska [4] later renamed it parachordoma and published

the largest initial case series of 10 cases in 1977. Para-

chordoma is a soft tissue tumor characterized by an

indolent nature, slow growth, occasional late recurrence,

rare metastases, and at least two reported fatalities. Histo-

logically, it resembles chordoma with a wider variation in

appearance. We report the current case to increase aware-

ness of this unusual soft tissue tumor.

Case Report

A 60-year-old right-hand–dominant woman presented with

a soft tissue mass in the posteromedial aspect of her right

distal arm of 3 months’ duration. She denied any trauma to

that area but stated the mass had slowly enlarged. She

denied any pain, numbness, or tingling in the distal

extremity. She also denied fevers, chills, weight loss, loss

of energy, and loss of appetite but did have some occa-

sional night sweats. She had a history of localized thyroid

cancer in 1989 treated with thyroidectomy. She denied any

lumps or bumps elsewhere.

Physical examination revealed a healthy-appearing

woman with a palpable, firm, deep, slightly warm mass

over the posteromedial aspect of her distal right arm that

measured approximately 7 cm proximodistal by 4 cm

mediolateral. Tinel’s test was negative, and there was no

bruit, thrill, or tenderness to palpation over the mass.

The initial radiographic studies included plain radio-

graphs and MRI of the extremity. The radiographs showed

a slight soft tissue density at the posteromedial aspect of

the arm without any evidence of periosteal reaction or


(eg, consultancies, stock ownership, equity interest, patent/licensing,



Each author certifies that his or her institution has approved or waived

approval for the reporting of this case and that all investigations were


J. Clabeaux, T. A. Damron (&)

Department of Orthopedic Surgery, Upstate Medical University,

Suite #130, 550 Harrison Street, Syracuse, NY 13202, USA


L. Hojnowski

Department of Radiology, Upstate Medical University, Syracuse,

NY, USA

A. Valente

Department of Pathology, Upstate Medical University, Syracuse,

NY, USA

123


DOI 10.1007/s11999-008-0125-7

calcification in the mass (Fig. 1). Magnetic resonance

imaging revealed a complex, heterogeneous, deeply situ-

ated intramuscular soft tissue mass adjacent and posterior

to the neurovascular bundle on the medial aspect of the arm

in the triceps muscle belly. The mass was predominantly

dark with heterogeneity on the T1-weighted images

(Fig. 2A) and bright with some heterogeneity on

T2-weighted images (Fig. 2B). There was minimal soft

tissue edema surrounding the mass. There was no bony

involvement and no periosteal reaction, but it did appear to

abut the humerus medially.

The nonspecific MRI features of the deep, large heter-

ogeneous soft tissue mass yielded a broad differential

diagnosis, including benign and malignant entities such as

malignant fibrous histiocytoma, fibrosarcoma, and even

metastatic disease. Tissue for pathologic examination was

obtained through a Tru-Cut core needle (Travenol Labo-

ratories, Inc, Deerfield, IL) biopsy in the office. Staging

studies, which included computed tomographic scans of the

chest, abdomen, and pelvis, were negative for the presence

of metastases. Laboratory values were all within normal

limits, including a leukocyte count of 6000, erythrocyte

sedimentation rate of 15 mm/hour, and C-reactive protein

less than 0.5.

The Tru-Cut needle biopsy specimen revealed a tumor

composed of nests and cords of cells with eosinophilic and

vacuolated cytoplasm and relatively uniform round to oval

nuclei. The cells were embedded in a myxoid and hyaline

stroma and separated by broad fibrous septa (Fig. 3). Foci

of recent and remote hemorrhage were present, but necrosis

was not identified. In addition, there was a low mitotic rate

not exceeding one mitosis per 20 high-power fields

(Fig. 4).

Differential diagnosis for these histologic findings

included parachordoma, extraskeletal myxoid chondrosar-

coma, and chordoma. Immunohistochemistry revealed

expression of the cytokeratin CAM5.2 and S-100 protein

by tumor cells with negative staining for cytokeratins AE1/

AE3, cytokeratin 19, epithelial membrane antigen (EMA),

muscle-specific actin, desmin, and carcinoembryonic anti-

gen (CEA). An alcian blue stain was strongly positive in

the stroma, with marked reduction of the staining after

hyaluronidase digestion. The diffuse CAM5.2 and S-100

expression is an immunophenotype not seen in extraskel-

etal myxoid chondrosarcoma, although negative

cytokeratin 19 and CEA with hyaluronidase digestion of

the matrix favored parachordoma rather than chordoma.

Because extraskeletal myxoid chondrosarcomas are char-

acterized by the balanced chromosomal translocation

t(9;22)(q22;q12), with the breakpoint involving the EWS

gene on chromosome 22q12 and the CHN gene on 9q22,

fluorescence in situ hybridization studies for the detection

of the EWSR1 gene break-apart rearrangement were per-

formed, and the results were negative.

The patient underwent wide resection of the tumor

2 weeks later. A curvilinear incision was made on the

posteromedial aspect of the arm, which included excision

of the biopsy tract. The ulnar nerve was identified and

protected during the entire procedure. The mass was

removed en bloc with negative intraoperative frozen sec-

tion margins. She experienced some mild numbness along

her small finger and the ulnar border of the ring finger but

full abduction strength. The final pathologic results also

were consistent with parachordoma. There has been no

recurrence to date during the past 3 months of followup.

Discussion

Parachordoma (or myoepithelioma) is a rare soft tissue

tumor first described by Laskowski and then renamed by

Dabska [4] in 1977. The differential diagnosis often

includes extraskeletal myxoid chondrosarcoma, and this

was considered in the pathologic differential diagnosis inFig. 1 A plain radiograph of the elbow and distal arm shows only a

nonmineralized soft tissue shadow.

1252 Clabeaux et al. Clinical Orthopaedics and Related Research

123

the current case [8]. Parachordoma originally was believed

to be a chordoma occurring in nonaxial sites, but more

recent work suggests it has a distinct immunohistochemical

profile [6]. Presently, parachordoma is considered a unique

entity [14].

Light microscopic features of parachordoma include

cells in clusters, nodules, whorls, and a pseudoglandular

formation of rounded cells in a focally myxoid stroma

separated by fibrous tissue [6]. In general, nuclei are bland,

mitotic figures are rare, and there is no necrosis or vascular

invasion. The tumor is circumscribed but not encapsulated.

Parachordoma is composed of three cell types, spe-

cifically epithelioid cells, smaller glomoid cells, and

spindle cells [8]. All lesions have a population of cells

with vacuolated cytoplasm resembling the physaliferous

cells found in chordomas. Parachordoma and chordoma

differ further in their expression of immunophenotypes.

Both tumors show immunohistochemical evidence of

positivity with CAM5.2 (which recognizes cytokeratins

8/18), EMA, vimentin, and S-100. However, reactivity to

Type IV collagen is much stronger in parachordoma,

whereas chordoma expresses CK1/10 and CK19 most of

Fig. 2A–B Sagittal MRI of the distal upper arm soft tissue mass shows a (A) heterogeneous dark signal on the T1-weighted image and a (B)

heterogeneous bright signal on the T2-weighted image.

Fig. 3 A low-power photomicrograph of the tumor shows multino-

dular masses separated by broad collagen bands (Stain, hematoxylin

and eosin; original magnification, 920).

Fig. 4 A high-power magnification with tumor cells shows vacuo-

lated cytoplasm and lack of considerable nuclear atypia (Stain,

hematoxylin and eosin; original magnification, 9400).

Volume 466, Number 5, May 2008 Parachordoma of Soft Tissues of the Arm 1253

123

the time. In contrast to chordoma, the matrix of para-

chordoma is abolished by hyaluronidase predigestion.

Additionally, fluorescence in situ hybridization for the

EWSR1 gene break-apart rearrangement is positive in

extraskeletal myxoid chondrosarcoma but not in

parachordoma.

Table 1. Clinical findings of parachordoma case reports

Authors (Year) Age (years) Gender Site Recurrence Metastasis Fatal

Dabska [4] (1977) 47 Female Ankle 7 years No No

52 Male Knee No No No

18 Male Thigh No No No

12 Male Arm No No No

29 Female Back 12 years No No

50 Female Groin No No No

22 Female Forearm No No No

25 Male Femur Unknown Unknown No

28 Female Finger 2 years No No

62 Male Ilium No No No

Povysil and Matejovsky [19] (1985) Unknown Unknown Tibia Unknown Unknown No

Enzinger and Weiss [5] (1988) 53 Male Back Unknown Unknown No

Miettinen et al. [17] (1992) 67 Female Popliteal No Metastasis Fatal

Ishida et al. [12] (1993) 19 Female Calf 1 year No No

Shin et al. [22] (1994) 4 Male Unknown Unknown Unknown No

8 Male Unknown Unknown Unknown No


13 Male Knee Unknown Unknown No


20 Female Calf Unknown Unknown No

Hirokawa et al. [10] (1994) 43 Male Buttock No No No

Sangueza and White [20] (1994) 25 Male Finger Unknown Unknown No

Carstens [3] (1995) 42 Male Buttock 6 months Metastasis Fatal

Niezabitowski et al. [18] (1995) 45 Female Palm 3 months No No

Carlen [2] (1996) 45 Female Leg Unknown Unknown No

Karabela et al. [13] (1996) 86 Female Pelvis No No No

Fisher and Miettinen [7] (1997) 23 Male Thigh Unknown Unknown No

25 Female Triceps No No No

53 Male Back No No No

14 Male Wrist Unknown Unknown No

Limon et al. [16] (1998) 52 Female Chest 2 years Metastasis Fatal

Imlay et al. [11] (1998) 13 Male Thigh No No No

25 Female Forearm Yes No No

Tihy et al. [23] (1998) 7 Female Nares No No No

Folpe et al. [8] (1999) 42 Female Forearm No No No

7 Female Buttock Unknown Unknown No

45 Male Chest No No No

38 Male Deltoid No No No

30 Female Thigh No No No

62 Male Thigh No No No

Koh et al. [15] (2000) 64 Male Tibia Recurrence No No

Separovic et al. [21] (2001) 20 Female Hand No No No

Hemalatha et al. [9] (2003) 24 Male Knee No No No

Abe et al. [1] (2003) 68 Male Calf No Metastasis Fatal

Kinoshita and Yasoshima [14] (2007) 60 Male Calf Unknown Metastasis Fatal


123

The existing English literature reveals 45 cases of

parachordomas [1–23]. Two of these previously reported

cases have somewhat ambiguous pathology that may be

more consistent with chordoma, rather than parachordoma

[3, 17]. A review of the studies reveals parachordoma has a

slight male predilection, with 25 of 44 (56.8%) docu-

mented cases occurring in males and 19 of 44 (43.2%)

cases occurring in females (Table 1). The average age of

the patients is 34.4 years (range, 4–86 years). Of the case

reports that mentioned location, the lower extremity was

the most common location, with 21 of 41 (51.2%) cases

occurring there. Eleven cases occurred in the upper

extremity (26.8%). Eight (19.5%) cases occurred in the

thorax, trunk, or pelvis. One case occurred in the nares

(2.5%).

Parachordoma is considered a slow-growing tumor of an

indolent, less aggressive nature than chordoma. There has

been reported late recurrence in nine of 45 cases anywhere

from 3 months to 12 years later [7, 14, 15]. However, it is

difficult to extrapolate a recurrence rate from these num-

bers because many patients in the case reports were not

followed for a sufficiently long time. Furthermore, most

studies do not mention if adequate margins were obtained.

In our case, intraoperative frozen section and final patho-

logic review showed negative margins. The possibility of a

late recurrence of disease is something that should be

considered when following a patient with parachordoma.

There have been five reported cases of metastases from

parachordoma. The first report by Miettinen et al. [17]

describes a ‘‘chordoma-like’’ sarcoma in a 67-year-old

woman with metastatic disease to the lung who died of the

disease 11 months after presentation. However, the path-

ologic features were more consistent with chordoma than

parachordoma. Carstens [3] described a metastatic case

arising in the buttocks with widespread disease, with death

resulting 14 months later after local recurrence. However,

again, the pathology was more like chordoma than para-

chordoma. These two studies were included previously in

the parachordoma literature, but, given the inconsistent

nature of the pathology, we believe they should be

discounted.

Limon et al. [16] illustrated a case of lymph node

metastases from a chest wall parachordoma. The metastatic

cells were described as being more cellular and pleomor-

phic. The fourth metastatic case by Abe et al. [1] reported

multiple metastases in a 68-year-old man with a confirmed

parachordoma originating in the calf. The patient eventu-

ally died 32 months after surgery from disease despite

below-knee amputation, radiotherapy, and chemotherapy.

The most recent report of metastatic disease is from

Kinoshita and Yasoshima [14]. The patient was a 60-year-

old man with primary parachordoma in his left calf who

died 4 months after surgery from lung and brain metastases.

The case presented here, a 60-year-old woman with a

parachordoma of the right humerus, adds to the literature

involving this rare tumor. Parachordoma generally is con-

sidered a benign tumor with few metastases. However,

review of the literature shows there have been at least two

confirmed deaths from metastatic parachordoma. Possibly,

parachordoma should be thought of as a potentially

aggressive low-grade sarcoma. Given this, we performed

wide excision of the mass and will continue to follow the

patient with routine imaging studies as we would for a

patient with a soft tissue sarcoma. To clarify the behavior

of this rare tumor, long-term followup studies are needed.

Acknowledgments We thank Julie Davila for assistance with

preparation of this manuscript.

References

1. Abe S, Imamura T, Harasawa A, Ishida T, Unno K, Tateishi A,

Tokizaki T, Yorikawa J, Matsushita T. Parachordoma with

multiple metastases. J Comput Assist Tomogr. 2003;27:634–638.

2. Carlen B. Diagnostic value of electron microscopy in rare

malignant musculoskeletal tumors. Ups J Med Sci. 1996;101:

69–85.

3. Carstens PH. Chordoid tumor: a light, electron microscopic,

and immunohistochemical study. Ultrastruct Pathol. 1995;19:

291–295.

4. Dabska M. Parachordoma: a new clinicopathologic entity.

Cancer. 1977;40:1586–1592.

5. Enzinger FM, Weiss SW. Extraskeletal myxoid chondrosarcoma.

In: Gay SM, ed. Soft Tissue Tumors. St Louis, MO: CV Mosby;

1988:868.

6. Fisher C. Parachordoma exists—but what is it? Adv Anat Pathol.2000;7:141–148.

7. Fisher C, Miettinen M. Parachordoma: a clinicopathologic and

immunohistochemical study of four cases of an unusual soft tis-

sue neoplasm. Ann Diagn Pathol. 1997;1:3–10.

8. Folpe AL, Agoff SN, Willis J, Weiss SW. Parachordoma is

immunohistochemically and cytogenetically distinct from axial

chordoma and extraskeletal myxoid chondrosarcoma. Am J SurgPathol. 1999;23:1059–1067.

9. Hemalatha AL, Srinivasa MR, Parshwanath HA. Parachordoma

of tibia: a case report. Indian J Pathol Microbiol. 2003;46:

454–455.

10. Hirokawa M, Manabe T, Sugihara K. Parachordoma of the but-

tock: an immunohistochemical case study and review. Jpn J ClinOncol. 1994;24:336–339.

11. Imlay SP, Argenyi ZB, Stone MS, McCollough ML, Henghold

WB. Cutaneous parachordoma: a light microscopic and immu-

nohistochemical report of two cases and review of the literature.

J Cutan Pathol. 1998;25:279–284.

12. Ishida T, Oda H, Oka T, Imamura T, Machinami R. Parachord-

oma: an ultrastructural and immunohistochemical study.

Virchows Arch A Pathol Anat Histopathol. 1993;422:239–245.

13. Karabela-Bouropoulou V, Skourtas C, Liapi-Avgeri G, Mahaira

H. Parachordoma: a case report of a very rare soft tissue tumor.

Pathol Res Pract. 1996;192:972–978; discussion 979–981.

14. Kinoshita G, Yasoshima H. Case report: fatal parachordoma.

J Orthop Sci. 2007;12:101–106.

15. Koh JS, Chung JH, Lee SY, Cho KJ. Parachordoma of the tibia:

report of a rare case. Pathol Res Pract. 2000;196:269–273.

Volume 466, Number 5, May 2008 Parachordoma of Soft Tissues of the Arm 1255

123

16. Limon J, Babinska M, Denis A, Rys J, Niezabitowski A. Para-

chordoma: a rare sarcoma with clonal chromosomal changes.

Cancer Genet Cytogenet. 1998;102:78–80.

17. Miettinen M, Gannon FH, Lackman R. Chordomalike soft tissue

sarcoma in the leg: a light and electron microscopic and immu-

nohistochemical study. Ultrastruct Pathol. 1992;16:577–586.

18. Niezabitowski A, Limon J, Wasilewska A. Parachordoma: a

clinicopathologic, immunohistochemical, electron microscopic,

flow cytometric, and cytogenetic study. Gen Diagn Pathol.1995;141:49–55.

19. Povysil C, Matejovsky Z. A comparative ultrastructural study of

chondrosarcoma, chordoid sarcoma, chordoma, and chordoma

periphericum. Pathol Res Pract. 1985;179:546–559.

20. Sangueza OP, White CR. Parachordoma. Am J Dermatopathol.1994;16:185–188.

21. Separovic R, Glumbic I, Pigac B, Separovic V, Kruslin B.

Parachordoma: a case report. Tumori. 2001;87:207–210.

22. Shin HJ, Mackay B, Ichinose H, Ayala AG, Romsdahl MM.

Parachordoma. Ultrastruct Pathol. 1994;18:249–256.

23. Tihy F, Scott P, Russo P, Champagne M, Tabet JC, Lemieux N.

Cytogenetic analysis of a parachordoma. Cancer Genet Cytoge-net. 1998;105:14–19.


123

CASE REPORT

Case Report

Nonoperative Treatment of an Unstable Jefferson Fracture Using a Cervical Collar

Brian M. Haus MD, Mitchel B. Harris MD



Abstract The treatment of unstable burst fractures of the

atlas (Jefferson fractures) is controversial. Unstable Jef-

ferson fractures have been managed successfully with

either immobilization, typically halo traction or halo vest,

or surgery. We report a patient with an unstable Jefferson

fracture treated nonoperatively with a cervical collar, fre-

quent clinical examinations, and flexion-extension

radiographs. Twelve months after treatment, the patient

achieved painless union of his fracture. The successful

treatment confirms prior studies reporting unstable Jeffer-

son fractures have been treated nonoperatively. The

outcome challenges the clinical relevance of treatment

algorithms that rely on the ‘‘rules of Spence’’ to guide

treatment of unstable Jefferson fractures and illustrates

instability may not necessarily be present in patients with

considerable lateral mass widening. Additionally, it

emphasizes a more reliable way of assessing C1–C2 sta-

bility in unstable Jefferson fractures is by measuring the

presence and extent of anterior subluxation on lateral

flexion and extension views.

Introduction

Burst fractures of the atlas (Jefferson fractures) occur when

an axial force is transmitted across the occipital-cervical

junction, causing the atlas to be compressed between the

angulated articular surface of the axis and the occipital

condyles. The impact forces cause an outward spread of the

lateral masses of C1. The resulting four-part atlas fracture,

with two in the posterior arch and two in the anterior arch,

is classically referred to as the Jefferson fracture [20]. Most

are relatively stable and not associated with neurologic

deficits and can be treated by external immobilization with

satisfactory outcomes. Unstable Jefferson fractures reflect a

more severe injury of the atlas that occur when the trans-

verse ligament is also ruptured secondary to the extent of

spread of the C1 arch. These fractures are more difficult to

treat because of the atlantoaxial instability. Many surgeons

recommend operative stabilization of these unstable Jef-

ferson fractures.

We present a patient with an unstable Jefferson fracture

who was successfully treated nonoperatively with a cervi-

cal collar. At 12 months’ followup, he had achieved

painless healing of C1 with ankylosis of C1–C2 with

resumption of full premorbid activities.

Case Report

A 62-year-old man slipped and struck the back of his neck.

He denied loss of consciousness and reported only neck

pain. The day after the injury, he noted a change in his

voice, transient chest tingling, and the inability to lift his

head off his chest.

He delayed medical evaluation until 5 days later when

he presented to his chiropractor. The patient’s chiropractor

Each author certifies that he has no commercial associations (eg,




Each author certifies that his institution has approved the reporting of

this case report, that all investigations were conducted in conformity

with ethical principles of research, and that a waiver of informed

consent was obtained.

B. M. Haus (&), M. B. Harris

Department of Orthopaedic Surgery, Brigham and Women’s

Hospital, 75 Francis Street, Boston, MA 02115, USA


123


DOI 10.1007/s11999-008-0143-5

obtained radiographs of the patient’s neck (Fig. 1A) that

were interpreted as normal. The chiropractor then per-

formed a manipulation on his cervical spine.

Postmanipulation, the patient reported nausea and his wife

described his color as ‘‘ashen’’.

He returned to his chiropractor the next day. Before

performing another manipulation, the chiropractor obtained

another open-mouth view of the patient’s cervical spine

(Fig. 1B). The chiropractor identified the C1 fracture, and

the patient ultimately was transferred to our hospital for

evaluation.

On examination, he was hesitant to flex and extend his

neck. His neck was nontender and he was neurologically

intact. Plain films showed a 14-mm overlap of the C1-C2

lateral masses, confirming the diagnosis of an unstable

Jefferson fracture (Fig. 1B). Coronal views confirmed

separation of the lateral masses (Fig. 2A) and axial views

showed a bony avulsion suggesting transverse ligament

rupture (Fig. 2B). Because he had been walking without a

cervical orthosis before his presentation, active flexion and

extension films were attempted. The films showed no

motion between C1 and C2 with an atlantodens interval of

3 mm. There was no movement identified between the

occiput and the posterior arch of C1.

The radiographs and computed tomographic scans

were reviewed with the patient. The unstable nature of

his fracture was described and he was offered immobili-

zation in a halo vest or surgical stabilization as treatment

options. The patient was opposed to both options. There-

fore, he was given a Miami J Cervical CollarTM (Jerome

Medical, Moorestown, NJ) and observed with monthly

clinical examinations, quarterly computed tomographic

scans, and flexion-extension views at 6 months and 1 year

postinjury.

Fig. 1A–B (A) An inadequate

open-mouth anteroposterior view

was taken 5 days after the injury.

(B) A repeat open-mouth anter-

oposterior view taken 6 days

after the injury shows 14 mm of

bilateral offset of the lateral

masses, indicating an unstable

Jefferson fracture.

Fig. 2A–B (A) A computed

tomographic scan in the coronal

plane reveals 12-mm lateral mass

separation, confirming the diag-

nosis of an unstable Jefferson

fracture. (B) A computed tomo-

graphic scan in the plane of C1

shows the four fractures of the

ring, two anterior and two pos-

terior. Avulsion of the transverse

ligament is evident on the right.

1258 Haus and Harris Clinical Orthopaedics and Related Research

123

At 3 months’ followup, the patient was encouraged to

mobilize his neck as tolerated and was gradually weaned

from wearing the collar. Examination revealed he was

able to flex his neck within three fingerbreadths of his

chest with extension to neutral only. He laterally rotated

his neck 20� bilaterally. His neck was stiff. Motor testing

remained normal. Computed tomographic scans showed

evidence of healing of the posterior arch on the left

with 11-mm overlap of the C1-C2 lateral masses.

Flexion-extension films showed no motion across the

occipitocervical junction and no increase in the atlanto-

dens interval.

At his 1-year followup, the patient had discontinued

wearing the collar and continued to be pain-free. Exami-

nation revealed he had extension to neutral only, 30� lateral

neck rotation bilaterally, and flexion to within two finger-

breadths of his chest. A lateral flexion-extension

radiograph and computed tomographic scan showed com-

plete healing of C1, ankylosis at C1-C2, and no evidence of

C1-C2 subluxation (Figs. 3, 4).

Fig. 3A–B Computed tomo-

graphic scans in the (A) axial

and (B) coronal planes show

progression of healing of the C1

Jefferson fracture with partial

bony fusion along the left ante-

rior, right anterior, and left

posterior rings. There is a mild

shift of C1 to the left and mild

deformation of the atlas ring.

There is evidence of transverse

ligament calcification.

Fig. 4A–B Lateral (A) flexion

and (B) extension views of the

cervical spine taken at the 1-year

followup reveal a healed poster-

ior arch of the C1 fracture. The

atlantodens interval is preserved,

confirming stability at C1-C2 on

flexion and extension. A minimal

degree of flexion-extension is

evident by the interval between

the skull and the posterior arch of

C1.

Volume 466, Number 5, May 2008 Management of Unstable Jefferson Fractures 1259

123

Discussion

Stability at C1-C2 is maintained primarily by the transverse

ligament. With considerable axial loading, separation of

the lateral masses can occur, and the transverse ligament

can be torn. Based on the clinical and radiographic

assessments of Spence et al. [19] in cadavers, transverse

ligament rupture occurs with lateral mass separation less

than 6.9 mm. Jefferson fractures with torn transverse lig-

aments are inherently unstable and referred to as unstable

Jefferson fractures. Instability at the atlantoaxial joint and

subsequent subluxation can occur with unprotected flexion

and extension movements. The degree of subluxation is

observed on flexion-extension views by a change in the

atlantodens interval; an interval greater than 2 to 3 mm in

adults is deemed abnormal.

Although there is agreement regarding treatment of

stable Jefferson fractures [6, 10, 11, 21], management of

unstable Jefferson fractures remains controversial. Suc-

cessful treatment of unstable Jefferson fractures should

preserve rotation at the atlantoaxial joint and maintain

alignment to allow healing of the atlas. Unstable Jefferson

fractures have been treated successfully with immobiliza-

tion with halo traction or vest and surgery. Treatment with

a cervical collar is not the standard of treatment because it

is presumed a collar would not sufficiently limit motion to

prevent subluxation or allow healing.

Many authors argue most unstable Jefferson fractures

heal satisfactorily with immobilization in halo traction or

vest without surgery [5, 6, 9, 12, 13, 21]. Advocates of

treatment with a halo vest argue it provides traction to

align the splayed lateral masses through ligamentotaxis

and reduces any impaction below C1-C2, thereby pre-

venting subluxation and promoting healing. Critics of

nonoperative immobilization cite high rates of nonunion

and persistent posttraumatic pain as reasons to instead

perform surgical stabilization [4, 20]. Several authors

recommend initial immobilization for 8 weeks in a halo

vest followed by C1-C2 fusion to stabilize the joint once

the residual instability is documented through flexion-

extension studies [16, 18]. Hein et al. [7] advocate

immediate surgical stabilization, warning that repair of

the dislocation after long-term immobilization can cause

irreversible incongruence of the atlantoaxial joint fol-

lowed by arthrosis and increasing neck pain. Kesterson

et al. [8] recommend primary occipitocervical stabiliza-

tion of Jefferson fractures; however, others recommend

transfacet screw fixation at C1-C2 to maintain motion

between the occiput and C1. Ruf et al. [17] preserved C1-

C2 rotation, obtained anatomic reconstruction of the atlas,

and achieved bony fusion using transoral reduction and

osteosynthesis of C1. McGuire and Harkey [15]

recommend primary stabilization using the Magerl trans-

facet screw technique [14].

Our case report underscores many important points

regarding the treatment of unstable Jefferson fractures.

First, the rules of Spence [19] may not correlate directly to

C1-C2 stability. Historic treatment algorithms have relied

on the radiographic distinction to establish stability at the

atlantoaxial joint and to guide treatment. However, rupture

of the transverse ligament does not definitively imply C1-

C2 instability exists. As Dickman [1] discussed, the most

reliable way of assessing C1-C2 stability in unstable Jef-

ferson fractures is by measuring the extent of anterior

subluxation on lateral flexion and extension views. The

patient in our case report had considerable lateral mass

widening (14 mm) with evidence of an avulsion of the

transverse ligament. However, on serial flexion-extension

radiographs, he showed only 3 mm of atlantoaxial sepa-

ration (Figs. 1, 2). In this patient, it is likely the residual

stability is provided by intact alar ligaments and/or portions

of facet capsules, and scarring of the avulsed transverse

ligament. Protective immobilization with a cervical collar

produced adequate long-term stability to enable bony

fusion of the atlas fracture.

This case report also supports prior studies that

emphasized the importance of examining the type of

transverse ligament fracture when making the decision to

pursue surgical intervention. Dickman et al. [2, 3] classi-

fied transverse ligament injuries into two main types, which

have two distinctly different treatment outcomes. Type I

injuries are intrasubstance ruptures of the transverse liga-

ment that are incapable of healing and because of

instability are believed by most to require surgery. Type II

injuries are avulsions of the transverse ligament on the C1

lateral mass that can heal if the fracture is immobilized

nonoperatively. Although the study was limited to isolated

injuries of the transverse ligament, its principles can be

applied to treatment of Jefferson fractures with transverse

ligament disruption. Our case report suggests avulsion

fractures of the transverse ligament can be sufficiently

stabilized by a cervical collar to allow union of the atlas

fracture and healing of the avulsion (Figs. 3, 4).

Although our single case obviously cannot justify

treatment of all unstable Jefferson fractures with a cervical

collar, it does show instability may not necessarily be

present in patients with considerable lateral mass widening.

In our patient, either the cervical collar limited his motion

sufficiently in flexion-extension to allow scarring of the

ligament or the spread of the lateral masses of C1 did not

alter the integrity of the transverse ligament. In patients

with unstable Jefferson fractures who are opposed to sur-

gery, we believe it is important to observe clinical

instability before recommending surgical stabilization.

1260 Haus and Harris Clinical Orthopaedics and Related Research

123

References

1. Dickman CA. Letters. Spine. 2004;29:2196.

2. Dickman CA, Greene KA, Sonntag VK. Injuries involving the

transverse atlantal ligament: classification and treatment guide-

lines based upon experience with 39 injuries. Neurosurgery.

1996;38:44–50.

3. Dickman CA, Hadley MN, Browner C, Sonntag VK. Neurosur-

gical management of acute atlas-axis fractures: a review of 25

cases. J Neurosurg. 1989;70:45–49.

4. Guiot B, Fessler RG. Complex atlantoaxial fractures. J Neuro-surg. 1999;91:139–143.

5. Hadley MN, Dickman CA, Browner CM, Sonntag VK. Acute

traumatic atlas fractures: management and long-term outcome.

Neurosurgery. 1988;23:31–35.

6. Han SY, Witten DM, Mussleman JP. Jefferson fractures of the

atlas: report of six cases. J Neurosurg. 1976;44:368–371.

7. Hein C, Richter HP, Rath SA. Atlantoaxial screw fixation for the

treatment of isolated and combined unstable Jefferson fractures:

experiences with 8 patients. Acta Neurochir (Wein). 2002;144:

1187–1192.

8. Kesterson L, Benzel E, Orrison W, Coleman J. Evaluation and

treatment of atlas burst fractures (Jefferson fractures). J Neuro-surg. 1991;75:213–220.

9. Koch RA, Nickel VL. The halo vest: an evaluation of motion and

forces across the neck. Spine. 1978;3:103–107.

10. Landellis CD, Van Peteghem PK. Fractures of the atlas: classi-

fication, treatment and morbidity. Spine. 1988;13:450–452.

11. Lee TT, Green BA, Petrin DR. Treatment of stable burst fracture

of the atlas (Jefferson fracture) with rigid cervical collar. Spine.

1998;23:1963–1967.

12. Levine AM, Edwards CC. Treatment of injuries in the C1-C2

complex. Orthop Clin North Am. 1986;17:31–44.

13. Levine AM, Edwards CC. Fractures of the atlas. J Bone JointSurg Am. 1991;73:680–691.

14. Magerl F, Seemann PS. Stable posterior fusion of the atlas and

axis by transarticular screw fixation. In: Weidner PA, ed. Cer-vical Spine. New York, NY: Springer-Verlag; 1987:322–327.

15. McGuire RA Jr, Harkey HL. Primary treatment of unstable Jef-

ferson’s fractures. J Spinal Disord. 1995;8:233–236.

16. O’Brien JJ, Butterfield WL, Gossling HR. Jefferson fracture with

disruption of the transverse ligament: a case report. Clin OrthopRelat Res. 1977;126:135–138.

17. Ruf M, Melcher R, Harms J. Transoral reduction and osteosyn-

thesis C1 as a function-preserving option in the treatment of

unstable Jefferson fractures. Spine. 2004;29:823–827.

18. Schlicke LH, Callahan RA. A rational approach to burst fractures

of the atlas. Clin Orthop Relat Res. 1981;154:18–21.

19. Spence KF Jr, Decker S, Sell KW. Bursting atlantal fracture

associated with rupture of the transverse ligament. J Bone JointSurg Am. 1970;52:543–549.

20. Vieweg U, Meyer B, Schramm J. Differential treatment in acute

upper cervical spine injuries: a critical review of a single-insti-

tution series. Surg Neurol. 2000;54:203–210; discussion 201–

211.

21. Zimmerman E, Grant J, Vise WM, Yashon D, Hunt WE. Treat-

ment of Jefferson fracture with a halo apparatus: report of two

cases. J Neurosurg. 1976;44:372–375.

Volume 466, Number 5, May 2008 Management of Unstable Jefferson Fractures 1261

123

ORTHOPAEDIC � RADIOLOGY � PATHOLOGY CONFERENCE

Knee Lesion in a 62-year-old Woman

Aditya V. Maheshwari MD, Carlos A. Muro-Cacho MD,

H. Thomas Temple MD

Published online: 8 February 2008


History and Physical Examination

A 62-year-old woman presented for evaluation of a knee

contusion sustained approximately 2 weeks previously.

Her pain had decreased considerably since the injury, and

at the time of presentation, she had neither pain nor

swelling. Several years earlier, she had sustained a trau-

matic fracture of the right pubic and ischial rami, which

resulted in intermittent radicular pain to her right leg. She

denied any constitutional symptoms and her medical his-

tory was noncontributory.

The general physical examination was unremarkable.

Point tenderness with no discrete palpable mass was

noticed on the posterior aspect of her knee, adjacent to the

medial femoral epicondyle. Neither warmth nor erythema

was detected, and there was no palpable inguinal or pop-

liteal lymphadenopathy. Examination of the knee showed

no effusion. There was full painless range of motion with

no ligamentous instability or joint line tenderness. The rest

of her musculoskeletal examination was normal. The lab-

oratory workup was unremarkable.

Because of the concerning radiographic features (Fig. 1),

computed tomography (CT) scans (Fig. 2) and magnetic

resonance (MR) images (Figs. 3, 4) were obtained.

Based on clinical history, physical examination, labo-

ratory tests, and imaging studies, what is the differential

diagnosis?

Imaging Interpretation

Anteroposterior (Fig. 1A) and lateral (Fig. 1B) radiographs

showed an area of cortical irregularity at the posterior

aspect of the medial femoral condyle, associated with a

partially mineralized soft tissue mass. On CT (Fig. 2), the

soft tissue mass measured 3.0 9 3.0 9 2.5 cm and was

contiguous with the posteromedial cortex at the origin of

the medial gastrocnemius head. It had an attenuation sim-

ilar to that of adjacent skeletal muscle, with scattered areas

of mineralization. On MRI, the lesion had hyperintense

signal on gradient echo (Fig. 3A) and intermediate signal

on proton density-weighted (Fig. 3B) sagittal images. On

axial images, the somewhat lobular mass was directly

contiguous with the femur but did not invade it, with

normal underlying marrow signal (Fig. 3C). The mass

demonstrated heterogeneous enhancement on postgadolin-

ium images (Fig. 4). Degenerative changes in the medial

meniscus, a popliteal cyst, and a joint effusion were also

noted.

Each author certifies that he has no commercial associations (eg,


arrangement, etc) that might pose a conflict of interest in connection


Each author certifies that his institution has approved the reporting of

this case report, that all investigations were conducted in conformity

with ethical principles of research, and that informed consent was

obtained.

A. V. Maheshwari, H. T. Temple

Division of Musculoskeletal Oncology, Department of

Orthopedics, University of Miami Miller School of Medicine,

Miami, FL, USA

A. V. Maheshwari (&)

Cedars Medical Center, 1400 NW 12th Avenue, Suite 4036,

4th floor, East Building, Miami, FL 33136, USA

e-mail: [email protected];

[email protected]

C. A. Muro-Cacho

Division of Musculoskeletal Oncology, Department of

Pathology, University of Miami Miller School of Medicine,

Miami, FL, USA

123


DOI 10.1007/s11999-008-0135-5

Differential Diagnosis

Parosteal/periosteal (surface) osteosarcoma

Other surface tumors, including juxtacortical chondro-

sarcoma, osteochondroma, and periosteal chondroma

Soft tissue sarcoma

Myositis ossificans

Distal femoral cortical irregularity

Florid reactive periostitis and bizarre parosteal osteo-

chondromatous proliferation (Nora’s lesion)

The patient underwent a CT-guided needle biopsy,

which showed a cytologically bland fibrous proliferation.

To mitigate potential sampling error, an open biopsy was

performed and the histology of the lesion was studied

(Fig. 5).

Based on the clinical history, physical examination, lab-

oratory studies, radiographic images, and histologic picture,

what is the diagnosis and how should this lesion be treated?

Histology Interpretation

The material consisted of multiple, tan-grey, soft tissue

fragments measuring 8.0 9 6.0 9 3.0 mm in aggregate.

Microscopically, there was a hypocellular, fibroblastic

proliferation associated with fragments of tendon, fibro-

cartilage, and focal myxoid areas of dissecting collagen

fibers. There was no cellular atypia or mitoses (Fig. 5).

Diagnosis

Distal femoral cortical irregularity.

Discussion and Treatment

The diagnosis of distal femoral cortical irregularity was

based on its location (distal medial femur) and supporting

histologic features, despite the worrisome atypical radio-

graphic features. The diagnosis was further supported by

the lack of additional progression after 7 years’ followup.

Usually, distal femoral cortical irregularity differs from

malignant tumors by the absence of a soft tissue mass, the

preservation of soft tissue planes, the absence of periosteal

reaction, and the lack of associated warmth or local ten-

derness on physical examination [21]. Histologically, the

absence of mitotic activity and pleomorphism will help

distinguish it from sarcomas. Sarcomas of bone exhibit

greater cellularity with plump hyperchromatic nuclei,

nuclear and cellular pleomorphism, and increased mitotic

activity. These differences, together with knowledge of

radiographic variation, should make the diagnosis appar-

ent. Serial radiographs can be very beneficial. Fibrous

cortical defect is characteristically present near the meta-

diaphysis of long bones. It is eccentric in bone, has a

geographic ‘‘soap bubble’’ appearance, and erodes the

cortex from within, whereas the avulsive cortical irregu-

larity erodes the external surface of the bone. A fibrous

cortical defect is generally an isolated osseous lesion

without a soft tissue component. It tends to migrate more

proximally with growth [25]. Histologically, the two enti-

ties are distinct, as the fibrous cortical defect has a whirling

spindled pattern of growth with giant cells and hemosid-

erin-rich macrophages. Osteochondroma has a typical

Fig. 2 A CT scan shows a 3.0- 9 3.0- 9 2.5-cm soft tissue mass

(arrow) that is contiguous with the posteromedial cortex at the origin

of the medial head of the gastrocnemius. The attenuation coefficient

of the lesion is similar to adjacent skeletal muscle, with scattered

areas of mineralization and no organization (zonation).

Fig. 1A–B (A) Anteroposterior and (B) lateral radiographs show an

area of cortical irregularity at the posterior aspect of medial femoral

condyle, associated with a partially mineralized soft tissue mass

(arrows).

Volume 466, Number 5, May 2008 Knee Lesion in a 62-year-old Woman 1263

123

cartilage cap with enchondral ossification. The lack of

cortical and medullary continuity between the mass and the

adjacent bone excludes the diagnosis of osteochondroma.

Florid reactive periostitis commonly affects the digits of

the hands and feet of adolescents and young adults. Clin-

ically, there is a history of gradually progressive swelling,

erythema, and pain or a painful mass in the affected part

and approximately 50% of patients have a history of

trauma. There is mature and immature osteoid and woven

bone, cartilage, or a mix of chondroid, osteoid, and myxoid

elements with frequent multinucleated giant cells. They

show intense uptake on bone scan and may also show zonal

maturation of the tissues similar to that observed in myo-

sitis ossificans. It is thought to progress to bizarre parosteal

osteochondromatous proliferation, an entity also common

in hands and feet. Bizarre parosteal osteochondromatous

proliferation has a cartilaginous cap covering a bone stalk

with areas of ossification attached to the cortex by a broad

base; cortical erosion or corticomedullary continuity is not

present. Periosteal chondromas typically show external

cortical saucerization and a thick periosteal reaction (but-

tressing) with or without mineralized chondroid matrix.

Since its first description by Kimmelstiel and Rapp [13]

in 1951 as ‘‘periosteal desmoid,’’ this lesion has also been

called cortical desmoid, avulsive cortical irregularity,

subperiosteal dermoid, subperiosteal abrasion, cortical

abrasion, subperiosteal cortical defect, parosteal or juxta-

cortical desmoid, medial distal metaphyseal femoral

irregularity, or fibrous metaphyseal defect [1–4, 8, 9, 11–

15, 20–27]. This is a benign entity that may have an

atypical and aggressive appearance or a focal geographic

Fig. 3A–C MRI shows the lesion (arrows) having (A) hyperintense

signal on gradient echo (TR 800, TE 15) and (B) intermediate signal on

proton density-weighted (TR 2442, TE 15) sagittal images. (C) An

axial image (TR 5000, TE 21.7) shows the mass has a lobular

morphology and is contiguous with the femur but does not appear to

invade it, with normal underlying marrow signal. A blooming artifact

(predominant low signal) can be seen on (A) and (B) (arrowheads) in an

area corresponding to an area of mineralization on radiographs and CT.

Fig. 4 A postgadolinium contrast axial MR image (TR 550, TE 9)

shows heterogeneous enhancement of the mass (arrow), with no

enhancement of adjoining bone or soft tissue.

1264 Maheshwari et al. Clinical Orthopaedics and Related Research

123

radiolucency within the posterior cortex of medial femoral

condyle. It typically occurs between the ages of 3 to

17 years, with a peak incidence at 10 to 15 years, and has

been reported in 11.5% of boys and 3.6% of girls [21]. At

epiphyseal closure, the irregularity decreases in size and

often disappears, although it may persist into adulthood [7,

9, 13, 20, 27], as documented in one report in a 57-year-old

man [17]. Suh et al. [23] also found distal femoral cortical

irregularities in 44 of 100 knee MRIs (mostly adults) and

divided them into concave (four cases with cortical con-

cavity), convex (36 cases with cortical convexities), and

divergent (four cases with wide and split cortex). The

lesion is often asymptomatic, producing no palpable mass,

pain, or swelling and has a benign course [8, 9, 16, 19].

Consequently, they are frequently an incidental finding

when radiographs are reviewed for unrelated conditions or

knee trauma as in our patient [7, 9].

The etiology is uncertain and controversial. Some [21]

consider it a developmental anomaly while others consider

it an earlier phase of the more common fibrocortical defect

[4, 7]. Most lesions can be related to chronic traction or

avulsive injury at the insertion of the extensor aspect of the

adductor magus [2, 5, 9, 14, 20] or to the origin of the

medial head of the gastrocnemius [7, 17, 20, 23, 26] and

plantaris muscles [7]. Some authors, however, have not

found tendinous attachments at this location [4, 21, 27]. In

addition to the strong muscle pull exerted in this area,

intense bone remodeling occurs simultaneously during

periods of rapid skeletal growth. The cortex of the bone is

consequently weakened, and the excessive mechanical

stress that occurs at this site is believed to produce mi-

croavulsions of the cortical bone that elicit a hypervascular

and fibroblastic response, which in turn stimulates osteo-

clastic activity and bone resorption [5]. It is postulated this

lesion is a fibroblastic periosteal response resulting in

periosteal new bone formation on the surface and con-

comitant cortical osteoclastic bone resorption. If bone

formation prevails, soft tissue mineralization is evident

radiographically. If the fibroblastic reaction is predomi-

nant, a cortical defect is seen. In contrast, Young et al. [27]

found the lesion indistinguishable from an osteochon-

droma, with a layer of cartilage and an underlying

fibroblastic layer. Resnick and Greenway [20] classified

them as excavations or proliferative cortical irregularities

and found thickened periosteum with fibrous connective

tissue in the proliferative cortical irregularity. Marek [16]

has described the lesion as a ‘‘cork in the bottle,’’ with part

of the mass within the bone and part outside bone. The

morphologic features are reminiscent of a reactive process

rather than a neoplastic one. The wide variation in the

nomenclature of these lesions reflects differences in hist-

opathologic interpretation [8].

Although most common at the posteromedial aspect of

the medial femoral condyle, similar lesions have been

documented in the humerus, tibia, fibula, radius, metatar-

sal, metacarpal, and even distal phalanx [5, 24], all sites of

strong tendon insertions. A proximal humeral lesion at the

insertion of the pectoralis major has been described as a

‘‘ringman’s shoulder,’’ occurring primarily in gymnasts

[10]. The femoral lesion is best demonstrated radiograph-

ically with the knee in 20� to 45� of external rotation [9].

The involved area is typically 1 to 2 cm in length, occa-

sionally with reactive bone formation extending into the

soft tissue [9]. Examination of both knees is recommended

since the lesion is frequently bilateral (up to 35%) [21, 26].

Additional imaging is sometimes required to differentiate

this benign process from malignant bone and soft tissue

tumors and, thus, CT and MRI are important imaging tools

to ascertain anatomic relationship, bone destruction, and

soft tissue involvement [22, 23, 26]. Technetium bone

scintigraphy generally reveals no uptake in the area of

irregularity, although this negative finding may be masked

Fig. 5A–B Photomicrographs show (A) hypocellular fibroblastic

proliferation with no cellular atypia or mitosis and (B) focal myxoid

areas of dissecting collagen fibers (Stain, hematoxylin and eosin;

original magnification, 9200).

Volume 466, Number 5, May 2008 Knee Lesion in a 62-year-old Woman 1265

123

by the proximity of a growing epiphysis in children, a

degenerative joint in the elderly [6, 24], or concomitant

pathologic conditions such as osteomyelitis and lymphoma

[6]. There is also a report of a stress fracture that simulated

a distal femoral cortical irregularity radiographically and

was differentiated by a bone scan, MRI, and histopatho-

logic findings [18]. Single-photon emission CT imaging of

the knee will show increased uptake [12].

The distal femur is a common site of developmental

anomalies and primary bone tumors [21]. Whether or not a

particular radiograph is interpreted as a normal variant

depends on the clinical situation (patient age and location),

the degree of cortical irregularity, the radiographic pro-

jection, and the experience of the radiologist and the

orthopaedist interpreting the data [9]. Thus, as one gains

familiarity with this variant, there is less likelihood of

performing an unnecessary biopsy [9]. Six of seven cases

(85.7%) in the study of Craigen et al. [8] were diagnosed

primarily as malignant tumors and five (71.4%) underwent

a biopsy. A biopsy may even result in a false-positive

diagnosis of malignancy [24]. Therefore, recognition of

this benign lesion is important, as it could easily be mis-

taken for a malignant change and unnecessary surgery may

be performed. Amputation has been reported because of

confusion with a malignant process [13].

Although a biopsy is not recommended for this lesion,

the patient described herein underwent biopsy twice.

Advanced age, the location at the posteromedial distal

femur, point tenderness, and an associated soft tissue mass

with mineralization, along with cortical irregularity and

mild periosteal reactive changes, were worrisome for

malignancy. Because of the atypical clinical and radio-

graphic features, concerns were expressed about the

adequacy of the CT-guided biopsy material. This diag-

nostic uncertainty and concern over sampling error led to

an open biopsy. This biopsy confirmed the diagnosis of a

distal femoral cortical irregularity, and observation was

recommended, along with the judicious use of antiinflam-

matory medications. The patient remains asymptomatic at

7 years’ followup, with no evidence of disease progression.

References

1. Allen DH. A variation of diaphyseal development which simu-

lates the roentgen appearance of primary neoplasms of bone. AmJ Roentgenol Radium Ther Nucl Med. 1953;69:940–943.

2. Barnes GR Jr, Gwinn JL. Distal irregularities of the femur sim-

ulating malignancy. Am J Roentgenol Radium Ther Nucl Med.

1974;122:180–185.

3. Bernasek TL, Sim FH, Wold LE, Beabout JW, Shives TC, Dunitz SJ.

Avulsive cortical irregularities. Orthopedics. 1987;10:1423–1425.

4. Brower AC, Culver JE Jr, Keats TE. Histological nature of the

cortical irregularity of the medial posterior distal femoral

metaphysis in children. Radiology. 1971;99:389–392.

5. Bufkin WJ. The avulsive cortical irregularity. Am J RoentgenolRadium Ther Nucl Med. 1971;112:487–492.

6. Burrows PE, Greenberg ID, Reed MH. The distal femoral defect:

technetium-99 m pyrophosphate bone scan results. J Can AssocRadiol. 1982;33:91–93.

7. Caffey J. On fibrous defects in cortical walls of growing tubular

bones: their radiologic appearance, structure, prevalence, natural

course, and diagnostic significance. Adv Pediatr. 1955;7:13–51.

8. Craigen MA, Bennet GC, MacKenzie JR, Reid R. Symptomatic

cortical irregularities of the distal femur simulating malignancy.


9. Dunham WK, Marcus NW, Enneking WF, Haun C. Develop-

mental defects of the distal femoral metaphysis. J Bone JointSurg Am. 1980;62:801–806.

10. Fulton MN, Albright JP, El-Khoury GY. Cortical desmoid-like

lesion of the proximal humerus and its occurrence in gymnasts

(ringman’s shoulder lesion). Am J Sports Med. 1979;7:57–61.

11. Hatcher CH. The pathogenesis of localized fibrous lesions in the

metaphyses of long bones. Ann Surg. 1945;122:1016–1030.

12. Jung C, Choi YY, Cho S, Park KC. Symptomatic cortical desmoids

detected on knee SPECT. Clin Nucl Med. 2002;27:437–438.

13. Kimmelstiel P, Rapp IR. Cortical defect due to periosteal

desmoids. Bull Hosp Joint Dis. 1951;12:286–297.

14. Kirkpatrick JA, Wilkinson RH. Case report 52: post-traumatic

fibrous tissue lesion distal end of femur-parosteal (juxtacortical)

desmoid. Skeletal Radiol. 1978;2:189–190.

15. Kreis WR, Hensinger RN. Irregularity of the distal femoral

metaphysis simulating malignancy: case report. J Bone Joint SurgAm. 1977;59:38.

16. Marek F. Fibrous cortical defect (periosteal desmoid). Bull HospJoint Dis. 1955;16:77–87.

17. Pennes DR, Braunstein EM, Glazer GM. Computed tomography

of cortical desmoid. Skeletal Radiol. 1984;12:40–42.

18. Pistolesi GF, Caudana R, D’Attoma N, Residori E, Pregarz M.

Case report 686: stress fracture at distal end of femur simulating

‘‘periosteal desmoid’’. Skeletal Radiol. 1991;20:454–457.

19. Prentice AI. Variations on the fibrous cortical defect. Clin Radiol.1974;25:531–533.

20. Resnick D, Greenway G. Distal femoral cortical defects, irregu-

larities, and excavations. Radiology. 1982;143:345–354.

21. Simon H. Medial distal metaphyseal femoral irregularity in

children. Radiology. 1968;90:258–260.

22. Sklar DH, Phillips JJ, Lachman RS. Case report 683: distal

metaphyseal femoral defect (cortical desmoid; distal femoral

cortical irregularity). Skeletal Radiol. 1991;20:394–396.

23. Suh JS, Cho JH, Shin KH, Won JH, Park SJ, Shin DH, Kim SJ,

Lee HY. MR appearance of distal femoral cortical irregularity

(cortical desmoid). J Comput Assist Tomogr. 1996;20:328–332.

24. Velchik MG, Heyman S, Makler PT Jr, Goldstein HA, Alavi A.

Bone scintigraphy: differentiating benign cortical irregularity of

the distal femur from malignancy. J Nucl Med. 1984;25:72–74.

25. Verdonk PC, Verstraete K, Verdonk R. Distal femoral cortical

irregularity in a 13-year old boy: a case report. Acta Orthop Belg.

2003;69:377–381.

26. Yamazaki T, Maruoka S, Takahashi S, Saito H, Takase K, Na-

kamura M, Sakamoto K. MR findings of avulsive cortical

irregularity of the distal femur. Skeletal Radiol. 1995;24:43–46.

27. Young DW, Nogrady MB, Dunbar JS, Wiglesworth FW. Benign

cortical irregularities in the distal femur of children. J Can AssocRadiol. 1972;23:107–115.

1266 Maheshwari et al. Clinical Orthopaedics and Related Research

123

Lumbosacral Fusion: The Mortised TransfacetMethod by Use of the Vibrating Electric Sawfor Circular Bone BlocksEarl D. McBride MD, Howard B. Shorbe MD CORR 1958;12:268–275

Reliably achieving spinefusion has been a problemsince fusion was first descri-

bed by Russell Hibbs of the NewYork Orthopaedic Hospital in 1911[1]. Since that time, many dozens, ifnot hundreds of techniques havebeen proposed. PubMed lists over1700 articles on the topic since 1935,many of which relate to techniques,and these 1700 articles undoubtedlyreflect the tip of the iceberg. Thereasons for performing a spine fusionhave also varied and been greatlyrefined over the last century, and thesuccess rates have varied depending,in addition to other factors, on boththe reasons for the fusion and thetechnique. The article we highlightthis month on lower lumbar spinefusion was published by Dr. EarlMcBride and his colleague, Dr.Howard Shorbe, both of OklahomaCity [5]. Dr. McBride had been thefounder and first President of theAssociation of Bone and Joint Sur-geons (1947) [2, 3] which organizedand has sponsored this journal sinceits inception in 1953.

McBride and Shorbe noted, ‘‘asuccessful fusion depends on whereand how the bone graft is implanted,not upon the amount of bone uti-lized’’ [5]. One of the more common

reasons for surgery at the time was aruptured disc, and they commented,‘‘Removal of the offending diskprotrusion alone is not likely torelieve the residual effects of pro-gressive arthritic erosion andligamentous weakness. How cansuch facts be ignored so com-pletely?’’ [5] Their proposal was tofuse the facet joints, which oftenwere arthritic in advance cases,using a dowel grafts cut by trephineson a vibrating saw and insertingthose grafts into similar size cylin-drical hole across the fact joints.They commented, ‘‘The nerve willnot be damaged by the saw if it isdirected properly and if correctdepth adjustment has been made’’[5]. Although mentioned in but asingle sentence, this same point hasbeen emphasized the past ten yearsor so with pedicle screws placedacross the facet joints to achieve thesame purpose: directing an implantin the proper direction requires greatskill and knowledge.

McBride and Shorbe [5] werenot uniformly successful in achiev-ing fusion: their rate of successfullumbar fusion was 91% at the L5-S1 level. When they operated ontwo levels, their rates of successwere much lower: 65% at both

levels. They noted, however, asuccessful fusion seen on a radio-graph did not necessarily correlatewith improvement of the patient:‘‘…good and fair clinical healingwas obtained in 97 percent of thetotal cases’’ [5]. They did nothave the sophisticated instrumentswe do today in assessing success,and undoubtedly a contemporaryassessment would lead to a lowerclinical success rate. Nonetheless,their finding that successful bonefusion did not predict clinical out-come is consistent with a morerecent report with the same findingin patients who had multiple backoperations and other sorts offusion [4]. Thus, their conclusion,‘‘Satisfactory clinical results offacet graft fusions have alwaysexceeded the number of casesshowing solid bony union’’ [5]likely holds today.

Richard A. Brand MDEditor-in-Chief

Clinical Orthopaedicsand Related Research

References1. Bick EM. Source Book of Orthopae-

dics. New York, NY: Hafner Publish-ing Company; 1978.

Published online: 21 March 2008� The Association of Bone and Joint Surgeons 2008

123

Clin Orthop Relat Res (2008) 466:1267–1268 / DOI 10.1007/s11999-008-0218-3

2. Derkash RS. History of the Associ-ation of Bone and Joint Surgeons.Clin Orthop Relat Res. 1997;337:306–309.

3. Earl Duwain McBride, MD: 1891 to1975. J Bone Joint Surg Am. 1976;58:287.

4. Finnegan WJ, Fenlin JM, Marvel JP,Nardini RJ, Rothman RH. Results ofsurgical intervention in the symptom-

atic multiply-operated back patient.Analysis of sixty-seven cases fol-lowed for three to seven years. JBone Joint Surg Am. 1979;61:1077–1082.

5. McBride ED, Shorbe HB. Lumbosa-cral fusion: the mortised transfacetmethod by use of the vibrating electricsaw for circular bone blocks. ClinOrthop Relat Res. 1958;12:268–275.

50 Years Ago in CORR:

Lumbosacral Fusion: The MortisedTransfacet Method by Use of theVibrating Electric Saw for Circular BoneBlocksEarl D. McBride MD, Howard B. ShorbeMD

Richard A. Brand MD

123

1268 McBride and Shorbe Clinical Orthopaedics and Related Research

surgical and molecular advances in osteonecrosis

Documents