Syngas-derived medium-chain-length PHA synthesis in engineered Rhodospirillum rubrum 1

Syngas-derived mcl-PHA synthesis in R. rubrum 2

Daniel Heinrich1, Matthias Raberg1, Philipp Fricke1, Shane T. Kenny2, Laura Morales-3

Gamez2, Ramesh P. Babu2,3, Kevin E. O’Connor2, and Alexander Steinbüchel1,4 4

5

1Daniel Heinrich, Matthias Raberg, Philipp Fricke, and Alexander Steinbüchel () 6

Institut für Molekulare Mikrobiologie und Biotechnologie, Westfälische Wilhelms-Universität, Münster, Germany 7

AS: steinbu@uni-muenster.de, Tel: +49-251-8339821, Fax: +49 251 8338388 8

9

2Shane T. Kenny, Laura Morales-Gamez, Ramesh P. Babu, and Kevin E. O’Connor 10

Bioplastech Limited, Belfield Innovation Park, University College Dublin, Dublin, Ireland 11

12

3Ramesh P. Babu 13

CRANN and School of Physics, Trinity College Dublin, Dublin, Ireland 14

15

4Alexander Steinbüchel 16

Environmental Sciences Department, King Abdulaziz University, Jeddah, Saudi Arabia 17

18

Keywords: Carbon monoxide, Polyhydroxyalkanoates, PHAMCL, Polyhydroxyoctanoate, Polyhydroxydecanoate, 19

Pseudomonas putida, Rhodospirillum rubrum, Syngas. 20

1

AEM Accepted Manuscript Posted Online 12 August 2016Appl. Environ. Microbiol. doi:10.1128/AEM.01744-16Copyright © 2016, American Society for Microbiology. All Rights Reserved.

on Novem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

2

Abstract: 21

The purple non-sulfur alphaproteobacterium Rhodospirillum rubrum S1 was genetically 22

engineered to synthesize a heteropolymer of mainly 3-hydroxydecanoic acid and 3-23

hydroxyoctanoic acid [P(3HD-co-3HO)] from CO- and CO2-containing artificial syngas. For this, 24

genes from Pseudomonas putida KT2440 coding for a 3-hydroxyacyl-ACP thioesterase (phaG), a 25

medium-chain-length (MCL) fatty acid CoA-ligase (PP_0763) and a MCL PHA-synthase 26

(phaC1) were cloned and expressed under the control of the CO-inducible promoter PcooF from 27

R. rubrum S1 in a PHA-negative mutant of R. rubrum. P(3HD-co-3HO) was accumulated to up 28

to 7.1 % (wt/wt) of the cell dry weight by a recombinant mutant strain utilizing exclusively the 29

provided gaseous feedstock syngas. In addition to an increased synthesis of these medium chain-30

length PHAs (PHAMCL), enhanced gene expression through the PcooF promoter led also to an 31

increased molar fraction of 3HO in the synthesized copolymer when compared with the Plac 32

promoter, which regulated expression on the original vector. The recombinant strains were able 33

to partially degrade the polymer, and the deletion of phaZ2, which codes for a PHA-34

depolymerase most likely involved in intracellular PHA-degradation, did not reduce mobilization 35

of the accumulated polymer significantly. However, an amino acid exchange in the active site of 36

PhaZ2 led to a slight increase in PHAMCL accumulation. The accumulated polymer was isolated; 37

it exhibited an average molecular weight (Mw) of 124.3 kDa and a melting point of 49.6 °C. With 38

the metabolically engineered strains presented in this proof-of-principle study, we demonstrated 39

the synthesis of elastomeric second generation biopolymers from renewable feedstocks not 40

competing with human nutrition. 41

on Novem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

3

Importance 42

Polyhydroxyalkanoates (PHAs) are natural biodegradable polymers (biopolymers) showing 43

properties similar to commonly produced petroleum-based non-degradable polymers. The 44

utilization of cheap substrates for the microbial production of PHAs is crucial to lower the 45

production costs. Feedstock not competing with human nutrition is highly favorable. Syngas, a 46

mixture of carbon monoxide, carbon dioxide, and hydrogen can be obtained by pyrolysis of 47

organic waste and can be utilized for PHA-synthesis by several bacteria. Up to now, the 48

biosynthesis of PHAs from syngas has been limited to short-chain-length PHAs, which results in 49

a stiff and brittle material. In this study the syngas-utilizing bacterium Rhodospirillum rubrum 50

was genetically modified to synthesize a polymer, which consisted of medium-chain-length 51

constituents resulting in rubber-like material. This study reports the establishment of a microbial 52

synthesis of these so-called medium-chain-length PHAs from syngas and therefore potentially 53

extends the applications of syngas-derived PHAs. 54 on Novem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

4

Introduction 55

Biodegradable and biocompatible Polyhydroxyalkanoates (PHAs) are naturally occurring 56

polyesters, which are synthesized by various bacteria. Depending on their composition PHAs 57

present different physical and mechanical properties that can resemble those of petrochemically 58

produced conventional plastics (1). PHAs are divided into those consisting of short-chain-length 59

(3-5 carbon atoms; PHASCL) and of medium-chain-length (6-14 carbon atoms; PHAMCL) 60

hydroxyalkanoic acids, with both showing significantly different properties and thereby also 61

being suitable for different applications. PHAMCL, which are mainly synthesized by 62

pseudomonads are elastomeric rubber-like polymers with a much lower melting point than the 63

more brittle and crystalline PHASCL (2). Due to these attributes, PHAMCL expand the range of 64

applications for PHAs to elastic materials, required in the food and pharmaceutical industry (3). 65

Generally, pseudomonads are able to synthesize PHAMCL from carbon sources that they can 66

convert to acetyl coenzyme A (acetyl-CoA), which is then subjected to fatty acid de novo 67

synthesis. This pathway is linked to PHA synthesis via the 3-hydroxyacyl acyl-carrier-protein 68

(ACP) thioesterase PhaG, which in combination with a fatty acid CoA-ligase transfers the 69

hydroxyacyl moiety from ACP to CoA (4, 5). Alternatively, readily available fatty acids that are 70

metabolized to 3-hydroxyacyl-CoA through β-oxidation can be converted to a substrate for the 71

PHA polymerase PhaC. Many recent studies have focused on the efficient production of PHAMCL 72

in wild type and recombinant microorganisms from abundant and cheap carbon sources, such as 73

carbohydrates (6), fatty acids (7), or even polyethylene and aromatic compounds (8, 9). 74

Although the currently decreasing oil price results in a competitive disadvantage for the 75

production of bioplastics in comparison to petrochemically produced plastics, the rising 76

awareness for the pollution of marine and terrestrial environments by non-degradable plastics and 77

on Novem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

5

the emerging problem of the occurrence of microplastics particles, leads to a growing demand for 78

degradable biopolymers, such as PHAs (10). Additionally, the possibility to utilize industrial 79

exhaust gases and such gases arising from gasification and pyrolysis of organic waste, referred to 80

as synthesis gas (syngas), could further promote environmentally friendly and cost-efficient 81

production processes for these so called second generation biopolymers (11). The synthesis of 82

PHAs from waste gases as CO and CO2, which in addition to N2 and H2 are the major 83

components of syngas, has gained increased attention over the last decade, as it is predicted to be 84

economically feasible without competing with human energy- or food supply (12, 13). However, 85

so far only PHASCL have been synthesized from these gaseous feedstocks, as there is no known 86

microorganism capable of synthesizing PHAMCL from syngas. 87

The purple non-sulfur alphaproteobacterium Rhodospirillum rubrum is able to utilize CO and 88

CO2 and has been a host- and model organism for several studies focusing on the synthesis of 89

PHASCL, from various feedstocks (14, 15, 16). Applying the water-gas-shift reaction, R. rubrum 90

oxidizes CO with H2O to CO2 and H2 employing a carbon monoxide dehydrogenase (CODH), 91

thereby gaining energy and carbon that is channeled into the Calvin cycle via ribulose 1,5 92

bisphosphate carboxylase (17). Moreover, recent investigations have shown that other 93

carboxylases, which are specifically active when acetate assimilation is required, play a major 94

role in CO2 fixation (16). These include carboxylases of the ethylmalonyl-CoA pathway, and a 95

ferredoxin-dependent pyruvate synthase (PFOR). The wild-type of R. rubrum naturally 96

synthesizes PHASCL with varying amounts of incorporated 3-hydroxyvalerate. The aim of this 97

study was to genetically modify R. rubrum S1 to synthesize PHAMCL from syngas-derived CO 98

and CO2. For this, three genes from Pseudomonas putida KT2440 coding for a 3-hydroxyacyl-99

ACP thioesterase (phaG; 4), a medium-chain-length (MCL) fatty acid CoA-ligase (PP_0763; 5) 100

and a PHA-Synthase (phaC1; 18) were chosen for overexpression in a ΔphaC1/ΔphaC2-mutant, 101

on Novem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

6

unable to synthesize PHASCL (Fig. 1). In order to evaluate syngas mediated gene overexpression, 102

the CO-inducible PcooF-promoter (19) was implemented. It was also investigated if cells of 103

R. rubrum would be able to degrade the synthesized PHAMCL and consequently, if a mutation of 104

the predicted intracellular PHA-depolymerase PhaZ2 gene (20) would increase polymer 105

accumulation. 106

107

Materials and Methods 108

Microorganisms, plasmids and oligonucleotides 109

All applied bacterial strains, plasmids, and oligonucleotides are listed in Table 1. For routine 110

cloning, plasmids were introduced into and isolated from Escherichia coli TOP10. E. coli S17-1 111

was used for the transfer of derivatives of the suicide vector pJQ200mp18 into R. rubrum strains. 112

Cultivation of bacteria 113

Strains of E. coli were cultivated in 5 mL test tubes with lysogeny broth (LB) (21) at 37 °C and 114

an agitation of 120 rpm. Cells of R. rubrum were grown in a modified medium by Bose et al. 115

(22). Here, DL(-)malic acid was omitted, the amount of (NH4)2SO4 was reduced to 1 g L-1, and 1 116

g L-1 of yeast extract as well as 2 g L-1 of disodium succinate x 6 H2O were added to the medium. 117

Additionally, the medium contained 10 g L-1 of D(-)fructose when heterotrophic synthesis of 118

PHA in recombinant R. rubrum strains was examined. For cultivations with CO-containing gas 119

mixtures, 9.75 mg L-1 of NiCl2 was added to the medium. When necessary, gentamicin (20 µg 120

mL-1) or kanamycin (50 µg mL-1 for E. coli; 25 µg mL-1 for R. rubrum) were added to the media. 121

on Novem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

7

R. rubrum cells were cultivated anaerobically in the dark in 300 mL baffled Erlenmeyer flasks 122

containing 50 mL medium at 30°C and an agitation of 120 rpm. For cultivations with gas 123

mixtures, 300 mL baffled Duran flasks with butyl rubber plugs were applied, and the agitation 124

speed was increased to 150 rpm. To establish an artificial syngas atmosphere, flasks were flushed 125

with nitrogen, which was then evacuated and replaced by an artificial syngas-mixture containing 126

40 vol% CO, 40 vol% H2, 10 vol% CO2 and 10 vol% N2. Alternatively, flasks were filled with 127

pure CO to a concentration of 40 vol%. For this, the respective amount of nitrogen was evacuated 128

from flasks prior to the addition of CO. Gas atmospheres and kanamycin were restored after 3 129

days of cultivation. Pre-cultures were grown for 24 h in 100 ml baffled Erlenmeyer flasks with a 130

culture volume of 20 mL containing succinate as the sole carbon source in all cases. 131

Growth of R. rubrum strains was determined by measuring the optical density of the culture broth 132

at 680 nm. Cells were harvested by centrifugation at 4,000 g for 20 min. Cultivations were 133

carried out in triplicate over the course of at least two separate experiments. 134

Construction of vectors and generation of recombinant strains of E. coli and R. rubrum 135

Methods comprising the amplification, isolation and manipulation of DNA were carried out as 136

described by Sambrook et al. (21). Respective DNA fragments were amplified from genomic 137

DNA of R. rubrum S1 and P. putida KT2440 using the Phusion High-Fidelity DNA Polymerase 138

(New England Biolabs, Ipswich, MA, USA) and oligonucleotides listed in Table 1. T4 DNA 139

ligase (Thermo Scientific, Waltham, MA, USA) was applied for ligating amplified and digested 140

DNA fragments. For validation, replication and isolation of the generated constructs, chemically 141

competent E. coli TOP10 cells were transformed (23) and the resulting strains were verified by 142

colony PCR as well as isolation and digestion of the generated vectors with restriction 143

on Novem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

8

endonucleases. Applying the protocol of Aneja et al. (24), the verified hybrid plasmids were 144

transferred into strains of R. rubrum via electroporation. 145

In order to yield the expression vector pBBR1MCS-2::phaG::phaC::PP_0763, the empty 146

pBBR1MCS-2 was initially digested with HindIII and BamHI and ligated with a likewise 147

digested phaC1 fragment. An XhoI/HindIII digested phaG fragment was then inserted into the 148

corresponding site of the vector pBBR1MCS-2::phaC1, resulting in pBBR1MCS-149

2::phaG::phaC1. This construct was linearized with SpeI before ligating a SpeI-cleaved PP_0763 150

fragment. The PcooF-promoter region was inserted upstream of the three genes by ligating an 151

ApaI/XhoI fragment into the similarly digested pBBR1MCS-2::phaG::phaC::PP_0763, yielding 152

pBBR1MCS-2-PcooF::phaG::phaC1::PP_0763. 153

Site directed mutagenesis of phaZ2 in R. rubrum 154

In order to exchange cysteine at position 176 of PhaZ2R. rubrum with alanine, leading to an inactive 155

PhaZ2, miss-matched oligonucleotides (Table 1) causing a codon exchange in the respective gene 156

were applied. DNA fragments hybridizing up- and downstream of the modified codon, which 157

overlapped for 24 bp, were amplified from R. rubrum S1 genomic DNA. In a following fusion-158

PCR a single 1206 bp phaZ2-fragment containing the altered codon was amplified from the two 159

fragments. The product was cleaved with XbaI and ligated into a likewise linearized 160

pJQ200mp18. The resulting pJQ200mp18::phaZ2C176A was mobilized from E. coli S17-1 into 161

R. rubrum ΔphaC1/ΔphaC2 by conjugation via the spot agar mating technique (25). R. rubrum 162

mutants were isolated on sucrose (10% wt/vol) containing agar plates with the media composition 163

described above, but excluding yeast extract and fructose. R. rubrum 164

ΔphaC1/ΔphaC2/phaZ2C176A mutants were confirmed by sequencing of phaZ2 genes with the 165

same primers used for amplifying the fragments. 166

on Novem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

9

In an alternate approach, phaZ2R. rubrum was deleted. For this flanking regions of 403 and 635 bp 167

up- and downstream of phaZ2 were amplified by PCR, adding XbaI and PstI sites to the 168

fragments. Upon cleavage with PstI, ligation and amplification of the fused ΔphaZ2-fragment, 169

the fragment was digested with XbaI and ligated into a similarly linearized pJQ200mp18. Then, 170

deletion of phaZ2 in R. rubrum ΔphaC1/ΔphaC2 through homologous recombination was carried 171

out as described above. Marker-less gene-deletion was confirmed by PCR-analysis of the phaZ2-172

region, using internal- and flanking-primers of phaZ2 (Table 1). 173

Analysis of protein patterns 174

Cells were lysed by sonication, and the cell extract was separated from the cell debris by 175

centrifugation (10 min, 13,000 g, 4 °C). Upon measuring the protein concentration (26) 40 µg of 176

protein was mixed with denaturing buffer, incubated for 10 min at 95 °C and separated by 177

sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) according to Laemmli 178

(27) and stained with Coomassie brilliant blue R-250. 179

Isolation and Determination of PHA 180

In order to determine the PHA content of cells, 5-10 mg freeze dried cell matter were 181

methanolyzed, and the resulting methylesters were identified and quantified by gas 182

chromatography (GC) and GC-mass spectrometry as described previously (28). PHA was 183

isolated from cells with chloroform in a Soxhlet apparatus. Upon evaporation of excess 184

chloroform, PHA was precipitated in 20 volumes of ice cold methanol. The precipitate was 185

dissolved in chloroform and once more precipitated in methanol. The isolate was again dissolved 186

in chloroform and cast in a glass petri dish to dry. Hydroxyalkanoic acids were identified and 187

on Novem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

10

quantified with standards provided by Bioplastech (Dublin, IRE). For observation of PHA 188

granules under the fluorescence microscope, cells were stained with Nile red (29). 189

Characterization of PHA 190

The mass average molar mass (Mw) and the number average molar mass (Mn) of isolated PHA 191

were determined by gel permeation chromatography (GPC) with a PL gel 5 mm mixed-C + PL 192

gel column (Perkin-Elmer, Waltham, MA, USA) and a PELV 290 UV-vis detector operating at 193

254 nm. Samples were injected at a concentration of 1% (wt/vol) in volumes of 500 µL. 194

Spectroscopic grade chloroform was used as the mobile phase with a flow rate of 1.0 mL min-1. 195

Molecular weights were calculated using a standard curve, which was prepared with polystyrene 196

samples of low polydispersity. 197

Differential scanning calorimetry (DSC) was carried out to determine the melting- (Tm) and glass 198

transition temperatures (Tg) of isolated PHA. For this a Perkin Elmer (Waltham, MA, USA) 199

Pyris-Diamond Calorimeter calibrated to Indium standards was used. Samples were heated in 200

hermetically sealed aluminum pans from -90 to 100 °C at 10 °C min-1. The Tg was obtained by 201

holding the sample at 100 °C for 1 min and rapidly lowering the temperature to -90 °C. To 202

determine the Tm, samples were then reheated from -90 to 100 °C. 203

204

Results 205

PHA accumulation in cells of engineered R. rubrum strains from different feedstocks 206

As R. rubrum is capable of converting carbon monoxide and carbon dioxide to acetyl-CoA, the 207

goal was to establish a synthetic pathway from this central metabolite to PHAMCL (Fig. 1). 208

Furthermore, the natural synthesis of PHASCL in R. rubrum had to be inhibited in order to 209

on Novem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

11

synthesize solely PHAMCL in a recombinant R. rubrum strain. For this, the phaC1 and phaC2 210

genes coding for the two PHA-synthases in this bacterium, which are essential for polymerization 211

of 3-hydroxybutyryl-CoA and 3-hydroxyvaleryl-CoA, were deleted. This resulted in a 212

R. rubrum ΔphaC1/ΔphaC2 strain incapable of synthesizing PHASCL (30, 31). Applying the 213

findings of previous studies, three genes of the known PHAMCL-producer P. putida KT2440 were 214

cloned into the broad-host-range expression vector pBBR1MCS-2 and overexpressed in R. 215

rubrum ΔphaC1/ΔphaC2: (i) phaG, originally described as a 3-hydroxyacyl-acyl ACP-CoA 216

transferase (4), but recently identified as a 3-hydroxyacyl-acyl ACP thioesterase (5); (ii) the 217

PP_0763 gene, predicted to code for an MCL fatty-acid-CoA ligase (5) and (iii) phaC1, which 218

codes for a PHA-synthase with a high specificity for C6-C14 substrates (18). Additionally, a CO-219

inducible promoter from R. rubrum itself (19) was applied to potentially establish a CO-mediated 220

induction of gene expression of vector-bound heterologous genes and PHAMCL synthesis. Upon 221

cloning of the respective DNA fragments into the expression vector, R. rubrum ΔphaC1/ΔphaC2 222

was transformed with the two generated plasmids and, as a control, with the empty pBBR1MCS-223

2 vector. With the media described above, the recombinant strains were cultivated in (i) an 224

artificial syngas atmosphere resembling a possible composition of actual synthesis gas (CO, 40 225

vol%; H2, 40 vol%; CO2, 10 vol%; N2, 10 vol%), (ii) “pure” CO (CO, 40 vol%; N2, 60 vol%), or, 226

to comparably test the synthesis of PHAMCL from a heterotrophic unrelated carbon source, (iii) 227

with fructose (1% wt/vol). Additionally, the media contained 0.2% (wt/vol) of disodium 228

succinate hexahydrate, which proved to be beneficial for growth of R. rubrum under various 229

conditions without affecting PHA synthesis, as the generated strains did not synthesize any PHA 230

when only succinate was present in the media during preliminary cultivations (Fig. S1). 231

Cells of the engineered R. rubrum strains were cultivated for five days with carbon monoxide or 232

artificial syngas as described above (Fig. 2). The strain harboring the CO-inducible PcooF 233

on Novem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

12

unexpectedly showed a reduced growth with either gas composition when compared to the 234

R. rubrum ΔphaC1/ΔphaC2 strain harboring an empty vector or the strain expressing phaG, 235

phaC and PP_0763 under control of the vector-own Plac, which cannot be induced in R. rubrum, 236

but shows basal activity without induction of IPTG or lactose that cannot enter the cell. This was 237

reflected in the specific growth rates of the strain carrying pBBR1MCS-2-238

PcooF::phaG::phaC1::PP_0763 (Syngas, 0.024 h-1 ± 0.003 h-1; CO, 0.020 h-1 ± 0.004 h-1), which 239

were decreased by approximately 20% as compared to R. rubrum ΔphaC1/ΔphaC2 pBBR1MCS-240

2::phaG::phaC1::PP_0763 (Syngas, 0.029 h-1 ± 0.005 h-1; CO, 0.027 h-1 ± 0.006 h-1) and 25% 241

as compared to R. rubrum ΔphaC1/ΔphaC2 harboring the empty pBBR1MCS-2 (Syngas, 0.029 242

h-1 ± 0.003 h-1; CO, 0.030 h-1 ± 0.004 h-1). By means of an unpaired t test, the impact on growth 243

between pBBR1MCS-2-PcooF::phaG::phaC1::PP_0763 and pBBR1MCS-2 could be regarded as 244

significant (p < 0.05), at least, when pure CO was applied in the gas phase of flasks. In contrast, 245

all three strains grew similarly when cultivated with fructose as the main source of carbon (data 246

not shown). Gas chromatographic analysis revealed that the recombinant strains of R. rubrum 247

harboring the three genes of P. putida KT440 synthesized a polymer, which solely consisted of 248

MCL 3-hydroxyalkanoic acids, from all of the given unrelated carbon sources: Syngas, carbon 249

monoxide and fructose (Table 2). In contrast, R. rubrum ΔphaC1/ΔphaC2 pBBR1MCS-2 250

remained PHASCL- and PHAMCL-negative. The predominant constituents of the synthesized 251

polymer were 3-hydroxyoctanoic- (3HO) and 3-hydroxydecanoic acid (3HD). When cultivated 252

with fructose or artificial syngas, both of the strains harboring phaG, phaC1 and PP_0763 from 253

P. putida incorporated also traces of 3-hydroxyhexanoate (3HH) into the polymer, which, 254

however, accounted for less than 0.2 mol%. Although the PcooF-promoter had a negative effect on 255

the optical density, indicating slower growth when cultivated in presence of CO, the strain 256

on Novem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

13

carrying pBBR1MCS-2-PcooF::phaG::phaC1::PP_0763 showed the highest production of 257

PHAMCL under these conditions, synthesizing the heteropolymer to 6.7 % (wt/wt) of the cell dry 258

weight when cultivated in syngas atmosphere. This was a significant increase as compared to 259

cultivations of this strain with fructose or to the other strains cultivated in presence of any carbon 260

source (Table 2). Moreover, the applied PcooF affected the composition of the polymer synthesized 261

by the respective strain, as the 3HO-fraction of the accumulated poly(3HD-co-3HO) was 262

significantly increased to 42.8 mol% (Syngas) and 48.2 mol% (CO) when compared to the 263

polymer synthesized upon heterologous gene expression via the pBBR1MCS-2 standard Plac-264

promoter (Syngas, 31.8 mol% 3HO; CO, 33.5 mol% 3HO). A SDS-PAGE of samples taken from 265

syngas cultures after two days of growth showed a distinct protein spot at 29 kDa for the PcooF-266

harboring recombinant R. rubrum strain, similar to the previously purified PhaG (7). This 267

suggested a strong overexpression of phaG in this strain, as compared to the strain expressing the 268

genes under control of the Plac promoter and the strain carrying the empty vector (Fig. 3). 269

Microscopic observation of strain R. rubrum ΔphaC1/ΔphaC2 pBBR1MCS-2-270

PcooF::phaG::phaC1::PP_0763 revealed the presence of 2-4 granules in many of the cells (Fig. 4). 271

They appeared to be smaller than the 6-8 granules, which were displayed by the PHASCL-272

accumulating wild-type strain R. rubrum S1 harboring the empty vector. As expected, cells of the 273

PHASCL-negative strain R. rubrum ΔphaC1/ΔphaC2 pBBR1MCS-2 did not contain any granules. 274

Additionally, strains of R. rubrum ΔphaC1/ΔphaC2 appeared shorter than the spiral-shaped wild-275

type cells, measuring a length of approximately 4 µm in comparison to the length of 6-8 µm of 276

the wild type cells. 277

Analysis of PHAMCL degradation in engineered R. rubrum strains 278

on Novem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

14

As polymer-degradation by producing strains is crucial for the efficiency of PHA-production 279

processes, it was examined if a recombinant strain of R. rubrum was able to degrade the PHAMCL, 280

which it was genetically engineered to synthesize. Furthermore, mutageneses of the phaZ2 gene 281

in R. rubrum were carried out to study the effect of a putatively intracellular PHASCL-282

depolymerase (PhaZ2) on PHAMCL-accumulation. 283

Most probably, there are three PHA-depolymerases (PhaZ1/PhaZ2/PhaZ3) encoded in the 284

genome of R. rubrum. PhaZ1 was shown to be located in the cell´s periplasm and is unlikely 285

physically involved in in vivo PHB degradation (20). In vitro studies on the gene product of 286

phaZ3 showed that this PHA-depolymerase was specific for amorphous PHASCL but was 287

predicted to be inactive at cytoplasm-typical concentrations of divalent cations such as Mg2+ (32). 288

In contrast, PhaZ2 shows significant homologies to the well characterized intracellular PHASCL-289

depolymerase of R. eutropha (PhaZ1) and was therefore predicted to be responsible for 290

intracellular PHA-degradation in R. rubrum (20, 32, 33). Thus, phaZ2 (locus_tag: Rru_A3356) 291

was (i) chosen for deletion in R. rubrum ΔphaC1/ΔphaC2, as well as (ii) directed mutagenesis 292

leading to an amino acid exchange in the putative active site of PhaZ2. The putative active site of 293

PhaZ2R. rubrum was identified by a sequence alignment with the known PHA-depolymerase 294

PhaZ1R. eutropha, whose catalytic triad was identified by Kobayashi & Saito (34). Using the 295

BLAST algorithm (35), a catalytic triad of cysteine (C176), aspartate (D349) and histidine 296

(H382) was identified for PhaZ2R. rubrum (Fig. S2). Therefore, an exchange of cysteine for alanine 297

at amino acid position 176 would possibly inhibit the thiolyzing activity of PhaZ2 and disturb the 298

binding of potential PhaZ2-isoenzymes to the PHA granule surface, but still allow putative 299

protein-protein interactions. 300

on Novem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

15

Upon generation of the mutants R. rubrum ΔphaC1/ΔphaC2/ΔphaZ2 and R. rubrum 301

ΔphaC1/ΔphaC2/phaZ2C176A, these strains were transformed with pBBR1MCS-2-302

PcooF::phaG::phaC1::PP_0763, as this construct led to the highest amounts of synthesized 303

PHAMCL in the foregoing cultivations. To compare the PHA accumulation and degradation of the 304

generated strains with the phaZ2-wildtype genotype, the three strains were cultivated for five 305

days in artificial syngas atmosphere, which proved to be the most suitable feedstock (Table 2), as 306

described above. In order to stimulate potential degradation of synthesized polymer by limiting 307

available carbon, the syngas- was replaced by a nitrogen-atmosphere, and the cultures were 308

incubated for two additional days. The PHA contents were measured from 20 mL samples, which 309

were obtained prior to- and after the gas exchange. The three cultivated engineered strains of 310

R. rubrum grew equally and showed optical densities, which were similar to the foregoing 311

cultivations with artificial syngas (Fig. 2). GC-analyses of cell material obtained from the three 312

cultivated strains revealed that the PHAMCL contents of the recombinant strains of R. rubrum had 313

decreased over two days of carbon-limited cultivation, suggesting partial polymer degradation. In 314

the remaining polymer the fractions of 3HO and 3HD occurred in a similar ratio as in the sample 315

taken prior to carbon starvation. The deletion of phaZ2R. rubrum did not have a positive effect on 316

the accumulation of PHAMCL and did not result in a reduced degradation of the polymer, as 317

compared to the strain carrying the wild type phaZ2. Although the strain R. rubrum 318

ΔphaC1/ΔphaC2/phaZ2C176A carrying pBBR1MCS-2-PcooF::phaG::phaC1::PP_0763 319

accumulated slightly more PHA (7.1 % ± 0.5 % wt/wt of CDW) than the strain carrying the 320

wildtype phaZ2 (6.5% ± 0.3%), a significantly reduced degradation of the polymer was not 321

observed either, as approximately 21 % of the accumulated polymer was degraded within two 322

days without carbon supply (Fig. 5). This was slightly less than measured for the two other tested 323

on Novem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

16

strains harboring the plasmid (R. rubrum ΔphaC1/ΔphaC2 24%; R. rubrum 324

ΔphaC1/ΔphaC2/ΔphaZ2, 25% degradation). 325

Isolation and analysis of PHAMCL derived from syngas cultivations 326

In order to isolate PHAMCL, synthesized from CO- and CO2- containing synthesis gas, cells of the 327

strain accumulating the highest amount of PHAMCL over the course of the conducted cultivation 328

experiments was chosen. This was R. rubrum ΔphaC1/ΔphaC2/phaZ2C176A pBBR1MCS-2-329

PcooF::phaG::phaC1::PP_0763. To obtain a sufficient amount of cell mass, 50 mL cultures were 330

inoculated to an increased initial optical density of about 0.8 and again cultivated for 5 days as 331

described above. About 91 mg of synthesized polymer were isolated from 2.9 g of dried cells that 332

were harvested from a total of 3 L of culture broth. The precipitated and dried polymer appeared 333

as a gluey, rubber-like material (Fig. S3). GC-analysis confirmed the composition that was 334

previously determined from dried cell mass, as the polymer-isolate fractions were 55.6 mol% 335

3HD, 44.2 mol% 3HO and less than 0.2 mol% 3HH. GPC analysis of the isolated polymer 336

revealed a mass average molar mass (Mw) of 124.3 kDa, with a polydispersity index (PDI, Mw/ 337

number average molar mass Mn) of 2.62. Furthermore, calorimetric analysis determined a melting 338

point (Tm) of 49.6 °C and a glass transition temperature (Tg) of -41.1 °C. 339

340

Discussion 341

Despite the numerous studies pursuing the production of PHAMCL from cheap and abundant 342

carbon sources, so far no approach to utilize CO or CO2 for the microbial production of these 343

polyesters exists. The purple non-sulfur alphaproteobacterium R. rubrum presents a promising 344

candidate for this strategy, as it has comparably high CO-uptake and -utilization rates, harbors a 345

on Novem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

17

complete PHA-synthesis and -granule apparatus and is amenable to genetic modification (36-38). 346

In this study, an engineered R. rubrum strain synthesized PHAMCL up to 7.1 % (wt/wt of CDW) 347

consisting predominantly of 3-hydroxyoctanoate (3HO) and 3-hydroxydecanoate (3HD) with 348

traces of 3-hydroxyhexanoate (3HH) from an artificial syngas mixture. Expectedly, this amount 349

of synthesized PHA together with the produced biomass is less than reported in foregoing studies 350

focusing on the production of PHAMCL from heterotrophic unrelated carbon sources in 351

recombinant E. coli or various strains of Pseudomonas (4, 39-41). However, the feedstocks used 352

in these studies differ significantly from the newly applied potential waste gases in the present 353

study. A clear bottle neck for productivity arising from the basic technical setup in the cultivation 354

experiments is the low hydrostatic pressure in the applied shake flasks, which is limiting the mass 355

transfer of CO and CO2 into the liquid phase. Therefore, great potential lies in the scale up of the 356

process to a suitable bioreactor, in which hydrostatic pressure is elevated, as this would likely 357

result in an increased availability of the substrate leading to higher yield (12). Due to the 358

technical limitations of the pilot setup applied in this study, the exact percentage of available CO 359

or CO2 converted into PHA could not be determined. Cultivations comparing the PHAMCL-360

synthesis from pure CO with the syngas mixture containing CO and CO2 showed that the added 361

10% (vol/vol) of CO2 in the gas phase lead to a significant increase in accumulated polymer 362

when compared to cultivations with pure CO (Table 2). This indicated that CO2 present in syngas 363

can be more readily converted into acetyl-CoA, which is then subjected to fatty acid synthesis, 364

than CO, which has to be oxidized by the CO-dehydrogenase in R. rubrum to CO2 at first (42). 365

Recently, Revelles et al. (16) showed an upregulation of genes coding for additional 366

carboxylases, other than Rubisco, which play a major role in the fixation of CO2 in R. rubrum 367

when acetate was present in the cultivation medium, but not with malate. Therefore, the use of 368

another citric acid cycle intermediate as succinate as an auxiliary carbon source should likewise 369

on Novem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

18

not lead to an upregulation of the acetate assimilation routes ethylmalonyl-CoA pathway, or 370

acetyl-CoA carboxylation via PFOR (Fig. 1). Thus, available CO2 is likely to be assimilated via 371

the Calvin cycle, or alternatively, by a 2-oxoglutarate synthase via the reductive citric acid cycle 372

(Fig. 1; 16). Apart from that, any polymer synthesized in these cultivations resulted from CO and 373

CO2 dissolved in the media, as the recombinant strains did not synthesize any PHA from the 374

applied media, when syngas or pure CO were omitted. 375

The application of the PcooF-promoter showed that the level of heterologous expression of 376

especially phaG as indicated by the protein patterns of strains (Fig. 3) was crucial for the amount 377

of PHA-precursors, which were subtracted from fatty acid synthesis for PHA formation (Table 378

2). Interestingly, this also had an impact on the constituent fractions of the synthesized polymer 379

(Table 2), as higher quantities of PhaG molecules presumably resulted in an earlier withdrawal of 380

3-hydroxyacyl-ACP from the fatty acid de novo synthesis pathway. This may have caused the 381

increased incorporation of 3HO. The regulation of heterologous gene expression through PcooF 382

also reduced growth of the strain. As this strong promoter has been applied in genetically 383

modified R. rubrum strains without affecting growth before (43), the hampering effect might be 384

due to the considerable interaction of PhaG with the organism´s fatty acid metabolism. 385

Further cultivations with recombinant PHAMCL-producing strains of R. rubrum showed that the 386

strains were able to partially degrade the synthesized polymer (Fig. 5), regardless of a mutated 387

phaZ2R. rubrum. PhaZ2, described as an intracellular PHA-depolymerase (20), therefore likely acts 388

specifically on PHASCL, which are synthesized by the wild type of R. rubrum. The partial 389

degradation of the accumulated polymer might be attributed to the activity of a lipase present in 390

R. rubrum, as these enzymes have been shown to degrade PHAs of varying chain-lengths as well 391

(44). Nevertheless, the phaZ2C176A-mutation, leading to an amino acid exchange in the therefore 392

on Novem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

19

inactive catalytic site of the enzyme caused a slight increase in accumulated PHAMCL possibly 393

due to hitherto unknown interactions on the PHA granule surface. 394

The isolated poly(3HD-co-3HO) exhibited properties similar to those of PHA produced from 395

P. putida. The detected Mw of 124.3 kDa was in the range of the Mw of PHAMCL(-co-SCL) produced 396

by different recombinant strains in previous studies (45-48), but was lower than PHAMCL 397

commonly produced by the Pseudomonas wild type strains (2, 49). The quantities of PhaC-398

molecules, which catalyze polymerization, have shown to be related to the number of polymer 399

chains and consequently also influence the individual molecular weight of each chain. Therefore, 400

further genetic engineering leading to a reduced expression of heterologous phaC1Pp could 401

increase the Mw of the synthesized polymer (50). 402

Additional metabolic engineering, leading e. g. to an enhanced flux of acetyl-CoA, derived from 403

CO and CO2 assimilation, to fatty acid synthesis and foremost, a scale-up that optimizes the 404

cultivation conditions and increases gas-liquid mass transfer would most likely result in a higher 405

productivity of the process. Moreover, the approach of activating gene expression in the 406

recombinant R. rubrum strain with a CO-inducible promoter could be applied in a potential two-407

step process, in which an aerobic, heterotrophic cultivation phase to gain high cell density could 408

be followed by a anaerobic, syngas-mediated PHAMCL production phase. By this, the relatively 409

slow cell growth with CO or CO2 as energy- and carbon sources would be encountered. A further 410

alternative process modification might be the cultivation in the presence of light, which has 411

shown to promote growth of the phototrophic R. rubrum under varying conditions (51). However, 412

due to the intracellular accumulation of PHA, high cell density fermentation in a large vessel 413

volume is required for productivity. This, along with the need for high hydrostatic pressure to 414

on Novem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

20

maximize gas-solubility would make the use of an e.g. loop-reactor unpractical in most potential 415

scale-up approaches. 416

This study has demonstrated in principle the possibility to synthesize PHAMCL directly from the 417

renewable feedstock synthesis gas. The results presented here contribute to the goal of extending 418

the potential applications of second-generation biopolymers from toxic- (CO) and greenhouse- 419

(CO2) waste gases, which do not compete with human nutrition, by completely altering the 420

monomer composition of PHA produced by the industrially promising bacterium 421

Rhodospirillum rubrum. 422

on Novem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

21

References 423

1. Tan GYA, Chen CL, Li L, Ge L, Wang L, Razaad IMN, Li Y, Zhao L, Mo Y, Wang 424

JY. 2014. Start a research on biopolymer polyhydroxyalkanoate (PHA): A review. 425

Polymers 6:706-754. 426

2. Rai R, Keshavarz T, Roether JA, Boccaccini AR, Roy I. 2011. Medium chain length 427

polyhydroxyalkanoates, promising new biomedical materials for the future. Mater Sci Eng 428

R 72:29-47. 429

3. Tappel RC, Pan W, Bergey NS, Wang Q, Patterson IL, Ozumba OA, Matsumoto K, 430

Taguchi S, Nomura CT. 2014. Engineering Escherichia coli for improved production of 431

short-chain-length-co-medium-chain-length poly[(R)-3-hydroxyalkanoate] (SCL-co-MCL 432

PHA) Copolymers from renewable nonfatty acid feedstocks. ACS Sustain Chem Eng. 433

2:1879-1887. 434

4. Rehm BHA, Krüger N, Steinbüchel A. 1998. A new metabolic link between fatty acid de 435

Novo synthesis and polyhydroxyalkanoic acid synthesis. J Biol Chem 273:24044-24051. 436

5. Wang Q, Tappel RC, Zhu C, Nomura CT. 2012. Development of a new strategy for 437

production of medium-chain-length polyhydroxyalkanoates by recombinant Escherichia 438

coli via inexpensive non-fatty acid feedstocks. Appl Environ Microbiol 78:519-527. 439

6. Da Silva DA, Antonio RV, Rossi JM, Pena RS. 2015. Production of medium-chain-length 440

polyhydroxyalkanoate by Pseudomonas oleovorans grown in sugary cassava extract 441

supplemented with andiroba oil. Food Sci Technol 34:738-745. 442

7. Cerrone F, Choudhari SK, Davis R, Cysneiros D, O’Flaherty V, Duane G, Casey E, 443

Guzik MW, Kenny ST, Babu RP, O’Connor KE. 2014. Medium chain length 444

polyhydroxyalkanoate (mcl-PHA) production from volatile fatty acids derived from the 445

anaerobic digestion of grass. Appl Microbiol Biotechnol 98:611-620. 446

on Novem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

22

8. Guzik MW, Kenny ST, Duane GF, Casey E, Woods T, Babu RP, Nikodinovic-Runic J, 447

Murray M, O’Connor KE. 2014. Conversion of post consumer polyethylene to the 448

biodegradable polymer polyhydroxyalkanoate. Appl Microbiol Biotechnol 98:4223-4232. 449

9. Ward PG, de Roo G, O’Connor KE. 2005. Accumulation of polyhydroxyalkanoate from 450

styrene and phenylacetic acid by Pseudomonas putida CA-3. Appl Environ Microbiol 451

71:2046-2052. 452

10. Do Sul JAI, Costa MF. 2014. The present and future of microplastic pollution in the 453

marine environment. Environ Pollut 185:352-364. 454

11. Drzyzga O, Revelles O, Durante-Rodriguez G, Díaz E, Garcia JL, Prieto A. 2015. New 455

challenges for syngas fermentation: Towards production of biopolymers. J Chem Technol 456

Biot 90:1735-1751. 457

12. Choi DW, Chipman DC, Bents SC, Brown RC. 2009. A techno-economic analysis of 458

polyhydroxyalkanoate and hydrogen production from syngas fermentation of gasified 459

biomass. Appl Biochem Biotechnol 160:1032-1046. 460

13. Do YS, Smeenk J, Broer KM, Kisting CJ, Brown R, Heindel TJ, Bobik TA, DiSpirito 461

AA .2007. Growth of Rhodospirillum rubrum on synthesis gas: Conversion of CO to H2 and 462

poly-β-hydroxyalkanoate. Biotechnol Bioeng 97:279-286. 463

14. Brandl HB, Knee Jr EJ, Fuller C, Gross RA, Lenz RW. 1989. Ability of the 464

phototrophic bacterium Rhodospirillum rubrum to produce various poly(β-465

hydroxyalkanoates): potential sources for biodegradable polyesters. Appl Environ Microbiol 466

33:296-301. 467

15. Heinrich D, Raberg M, Steinbüchel A. 2015. Synthesis of poly(3-hydroxybutyrate-co-3-468

hydroxyvalerate) from unrelated carbon sources in engineered Rhodospirillum rubrum. 469

FEMS Microbiol Lett 362:fnv038. 470

on Novem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

23

16. Revelles O, Tarazona N, Garcia JL, Prieto MA. 2016. Carbon roadmap from syngas to 471

polyhydroxyalkanoates in Rhodospirillum rubrum. Environ Microbiol 18:708-720. 472

17. Kerby RL, Ludden PW, Roberts GP. 1995. Carbon monoxide-dependent growth of 473

Rhodospirillum rubrum. J Bacteriol 177:2241-2244. 474

18. Huisman GW, Wonink E, Meima R, Kazemier B, Terpstra P, Witholt B. 1991. 475

Metabolism of poly(3-hydroxyalkanoates) (PHAs) by Pseudomonas oleovorans. 476

Identification and sequences of genes and function of the encoded proteins in the synthesis 477

and degradation of PHA. J Biol Chem 266:2191-2198. 478

19. He Y, Gaal T, Karls R, Donohue TJ, Gourse RL, Roberts GP. 1999. Transcription 479

activation by CooA, the CO-sensing factor from Rhodospirillum rubrum. J Biol Chem 480

274:10840-10845. 481

20. Handrick R, Reinhardt S, Kimmig P, Jendrossek D. 2004. The “intracellular” poly(3-482

hydroxybutyrate (PHB) depolymerase of Rhodospirillum rubrum is a periplasm-located 483

protein with specificity for native PHB and with structural similarity to extracellular PHB 484

depolymerases. J Bacteriol 186:7243-7253. 485

21. Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning: A laboratory manual. Cold 486

Spring Harbor, NY: Cold spring harbor laboratory press. 487

22. Bose SK, Gest H, Ormerod JG. 1961. Light-activated hydrogenase activity in a 488

photosynthetic bacterium: A permeability phenomenon. J Biol Chem 236:13-14. 489

23. Hanahan D. 1983. Studies on transformation of Escherichia coli with plasmids. J Mol Biol 490

166:557-580. 491

24. Aneja KK, Ashby RD, Solaiman DKY. 2009. Altered composition of Ralstonia eutropha 492

poly(hydroxyalkanoate) through expression of PHA synthase from Allochromatium vinosum 493

ATCC 35206. Biotechnol Lett 31:1601-1612. 494

on Novem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

24

25. Hogrefe C, Römermann D, Friedrich B. 1984. Alcaligenes eutrophus hydrogenase genes 495

(Hox). J Bacteriol 158:43-48. 496

26. Bradford, MM. 1976. A rapid and sensitive method for the quantification of microgram-497

quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248-498

254. 499

27. Laemmli UK. 1970. Cleavage of structural proteins during the assembly of the head of 500

bacteriophage T4. Nature 227:680-685. 501

28. Timm A, Byrom D, Steinbüchel A. 1990. Formation of blends of various poly(3-502

hydroxyalkanoic acids) by a recombinant strain of Pseudomonas oleovorans. Appl 503

Microbiol Biotechnol 33:296-301. 504

29. Spiekermann P, Rehm BHA, Kalscheuer R, Baumeister D, Steinbüchel A. 1999. A 505

sensitive viable-colony staining method using Nile red for direct screening of bacteria that 506

accumulate polyhydroxyalkanoic acids and other lipid storage compounds. Arch Microbiol 507

171:73-80. 508

30. Jin H, Nikolau BJ. 2012. Role of genetic redundancy in polyhydroxyalkanoate (PHA) 509

polymerases in PHA biosynthesis in Rhodospirillum rubrum. J Bacteriol 194:5522-5529. 510

31. Klask C, Raberg M, Heinrich D, Steinbüchel A. 2015. Heterologous expression of 511

various PHA synthase genes in Rhodospirillum rubrum. Chem Biochem Eng Q 29:75-85. 512

32. Sznajder A, Jendrossek D. 2011. Biochemical characterization of a new type of 513

intracellular PHB depolymerase from Rhodospirillum rubrum with high hydrolytic activity 514

on native PHB granules. Appl Microbiol Biotechnol 89:1487-1495. 515

33. Uchino K, Saito T, Gebauer B, Jendrossek D. 2007. Isolated poly(3-hydroxybutyrate) 516

(PHB) granules are complex bacterial organelles catalyzing formation of PHB from acetyl 517

coenzyme A (CoA) and degradation of PHB to acetyl-CoA. J Bacteriol 189:8250-8256. 518

on Novem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

25

34. Kobayashi T, Saito T. 2003. Catalytic triad of intracellular poly(3-hydroxybutyrate) 519

depolymerase (PhaZ1) in Ralstonia eutropha H16. J Biosci Bioeng 96:487-492. 520

35. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. 521

1997. Gapped BLAST and PSI-BLAST: A new generation of protein database search 522

programs. Nucleic Acids Res 25:3389-3402. 523

36. Bonam D, Lehman L, Roberts GP, Ludden PW. 1989. Regulation of carbon monoxide 524

dehydrogenase and hydrogenase in Rhodospirillum rubrum: Effects of CO and oxygen on 525

synthesis and activity. J Bacteriol 171:3102-3107. 526

37. Handrick R, Reinhardt S, Schultheiss D, Reichart T, Schüler D, Jendrossek V, 527

Jendrossek D. 2004b. Unraveling the function of the Rhodospirillum rubrum activator of 528

polyhydroxybutyrate (PHB) degradation: The activator is a PHB-granule-bound protein 529

(phasin). J Bacteriol 186:2466-2475. 530

38. Younesi H, Najafpur G, Ismail KSK, Mohamed AR, Kamaruddin AH. 2007. 531

Biohydrogen production in a continuous stirred tank bioreactor from synthesis gas by 532

anaerobic photosynthetic bacterium Rhodospirillum rubrum. Bioresource Technol 99:2612-533

2619. 534

39. Agnew DE, Stevermer AK, Youngquist JT, Pfleger BF. 2012. Engineering Escherichia 535

coli for production of C12-C14 polyhydroxyalkanoates from glucose. Metab Eng 14:705-713. 536

40. Borrero-de Acuna JM, Bielecka A, Häussler S, Schobert M, Jahn M, Wittmann C, 537

Jahn D, Poblete-Castro I. 2014. Production of medium chain length polyhydroxyalkanoate 538

in metabolic flux optimized Pseudomonas putida. Microb Cell Fact 13:88. 539

41. Huijberts GNM, Eggink G, De Ward P, Huisman GW, Witholt B. 1992. Pseudomonas 540

putida KT2442 cultivated on glucose accumulates poly(3-hydroxyalkanoates) consisting of 541

saturated and unsaturated monomers. Appl Environ Microbiol 58:536-544. 542

on Novem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

26

42. Bonam D, Murrell SA, Ludden PW. 1994. Carbon monoxide dehydrogenase from 543

Rhodospirillum rubrum. J Bacteriol 159:693-699. 544

43. Jin H, Nikolau BJ. 2014. Evaluating PHA productivity of bioengineered Rhodospirillum 545

rubrum. Plos One 9:e96621. 546

44. Jaeger KE, Steinbüchel A, Jendrossek D. 1995. Substrate specificities of bacterial 547

polyhydroxyalkanoate depolymerases and lipases: Bacterial lipases hydrolyze poly(ω-548

hydroxyalkanoates). Appl Environ Microbiol 61:3113-3118. 549

45. Hokamura A, Wakida I, Miyahara Y, Tsuge T, Shiratsuchi H, Tanaka K, Matsusaki 550

H. 2015. Biosynthesis of poly(3-hydroxybutyrate-co-3-hydroxyalkanoates) by recombinant 551

Escherichia coli from glucose. J Biosci Bioeng 120:305-310. 552

46. Matsumoto K, Nakae S, Taguchi K, Matsusaki H, Seki M, Doi Y. 2001. Biosynthesis of 553

poly(3-hydroxybutyrate-co-3-hydroxyalkanoates) copolymers from sugars by recombinant 554

Ralstonia eutropha harboring the phaC1Ps and the phaGPs genes of Pseudomonas sp. 61-3. 555

Biomacromolecules 2:934-939. 556

47. Tappel RC, Pan W, Bergey, NS, Wang Q, Patterson IL, Ozumba OA, Matsumoto K, 557

Taguchi S, Nomura CT. 2014. Engineering Escherichia coli for improved production of 558

short-chain-length-co-medium-chain-length poly[(R)-3-hydroxyalkanoate] (SCL-co-MCL 559

PHA) copolymers from renewable nonfatty acid feedstocks. ACS Sustain Chem Eng 560

2:1879-1887. 561

48. Prieto MA, Kellerhals MB, Bozzatto GB, Radnovic D, Witholt B, Kessler B. 1999. 562

Engineering of stable recombinant bacteria for production of chiral medium-chain-length 563

poly-3-hydroxyalkanoates. Appl Environ Microbiol. 65:3265-3271. 564

on Novem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

27

49. Jiang X, Sun Z, Marchessault RH, Ramsay JA, Ramsay BA. 2012. Biosynthesis and 565

properties of medium-chain-length polyhydroxyalkanoates with enriched content of the 566

dominant monomer. Biomacromolecules 13:2926-2932. 567

50. Sim SJ, Snell KD, Hogan SA, Stubbe J, Rha C, Sinskey AJ. 1996. PHA synthase activity 568

controls the molecular weight and polydispersity of polyhydroxybutyrate in vivo. Nat 569

Biotechnol 15:63-67. 570

51. Najafpour, GD, Younesi H. 2007. Bioconversion of synthesis gas to hydrogen using a 571

light-dependent photosynthetic bacterium, Rhodospirillum rubrum. World J Microbiol 572

Biotechnol 23:275-284. 573

52. Simon R, Priefer U, Pühler A. 1983. A broad host range mobilization system for in vivo 574

genetic engineering: Transposon mutagenesis in Gram negative bacteria. Bio/Technology 575

1:784-791. 576

53. Esmarch E. 1887. Über die Reinkultur eines Spirillum. Zentbl Bakteriolog 1:225-230. 577

54. Molisch H. 1987. Die Purpurbakterien nach neuen Untersuchungen. Jena: Fischer, 1907:1-578

95. 579

55. Kovach ME, Elzer PH, Hill DS, Robertson GT, Farris MA, Roop II RM, Peterson KM. 580

1995. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying 581

different antiviotic-resistance casettes. Gene 166:175-176. 582

56. Quandt J, Hynes MF. 1993. Versatile suicide vectors which allow direct selection for gene 583

replacement in gram-negative bacteria. Gene 127:15-21. 584

on Novem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

28

Legends to figures 585

Fig. 1: Synthesis of PHAMCL from CO and CO2 in recombinant R. rubrum. Upon entrance of 586

both gases into the cell through the cytoplasmic membrane, carbon monoxide is oxidized 587

with water to carbon dioxide and hydrogen by the carbon monoxide dehydrogenase CODHR. 588

rubrum (). CO2 is fixed via ribulose 1,5-bisphosphate carboxylase (Rubisco; Rru_A1998; ) 589

through the Calvin cycle of which the intermediate glyceraldehyde-3-phosphate (G3P) is 590

subsequently converted to the central metabolite acetyl-CoA. Acetyl-CoA is subjected to 591

fatty acid de novo synthesis cycle. The thiolysis of 3-hydroxyacyl-ACP is catalyzed by the 3-592

hydroxyacyl-ACP thioesterase PhaGP. putida (). MCL fatty acid CoA-ligase PP_0763P. putida 593

() catalyzes the activation of free 3-hydroxy fatty acids by CoA addition. Resulting 3-594

hydroxyacyl-CoA precursors are polymerized to poly-3-hydroxyalkanoate (PHAMCL) by 595

PHA-Synthase PhaC1P.putida (). Synthesis of poly(3-hydroxybutyrate) [poly(3HB)] is 596

deactivated by the deletion of phaC1R. rubrum and phaC2R. rubrum, which code for PHASCL-597

synthases (). Additional carboxylases, which might be also involved in assimilating 598

additional CO2 (16), include a pyruvate synthase (Rru_A2398; ), a crotonyl-CoA reductase 599

(Rru_A3063; ), a propionyl-CoA carboxylase (Rru_A1943; ), and a 2-oxoglutarate 600

synthase (Rru_A2721; ). 601

602

Fig. 2: Cultivation of strains of R. rubrum ΔphaC1/ΔphaC2, harboring pBBR1MCS-2 603

(empty vector, triangles), pBBR1MCS-2::phaG::phaC1::PP_0763 (circles) or pBBR1MCS-604

2-PcooF::phaG::phaC1::PP_0763 (squares). Cells were cultivated in media modified from 605

Bose et al. (22) with an artificial syngas atmosphere of 40 vol% CO, 40 vol% H2, 10 vol% 606

CO2 and 10 vol% N2 (black) or of 40 vol% CO and 60 vol% N2 (gray) for five days. Optical 607

on Novem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

29

densities of samples, whose standard deviations are represented by error bars, were measured 608

at 680 nm. 609

610

Fig. 3: Proteins in crude extracts of cells of R. rubrum ΔphaC1/ΔphaC2, harboring 611

pBBR1MCS-2 (empty vector, A), pBBR1MCS-2::phaG::phaC1::PP_0763 (B) or 612

pBBR1MCS-2-PcooF::phaG::phaC1::PP_0763 (C). Cells were harvested after two days of 613

cultivation in media modified from Bose et al. (22) with an artificial syngas atmosphere of 614

40 vol% CO, 40 vol% H2, 10 vol% CO2 and 10 vol% N2. An amount of 40 µg of protein was 615

separated in an 11.5% (wt/vol) SDS-polyacrylamide gel and stained with Coomassie brilliant 616

blue. Molecular masses (in kDa) are indicated on the left. 617

618

Fig. 4: Polymer accumulation of R. rubrum S1 pBBR1MCS-2 (empty vector, A), R. rubrum 619

ΔphaC1/ΔphaC2 pBBR1MCS-2 (empty vector, B) and R. rubrum ΔphaC1/ΔphaC2 620

pBBR1MCS-2-PcooF::phaG::phaC1::PP_0763 (C). Cells were stained with Nile red and 621

observed with a fluorescence microscope after 3 days of cultivation in media modified from 622

Bose et al. (22) with an artificial syngas atmosphere of 40 vol% CO, 40 vol% H2, 10 vol% 623

CO2 and 10 vol% N2 applying phase contrast (left) or fluorescence microscopy (right). 624

625

Fig. 5: PHAMCL synthesis and degradation of R. rubrum ΔphaC1/ΔphaC2 (squares), 626

R. rubrum ΔphaC1/ΔphaC2/ΔphaZ2 (triangles) and R. rubrum ΔphaC1/ΔphaC2/phaZC176A 627

(circles) harboring pBBR1MCS-2-PcooF::phaG::phaC1::PP_0763. Cells were cultivated in 628

media modified from Bose et al. (22) with an artificial syngas atmosphere of 40 vol% CO, 40 629

vol% H2, 10 vol% CO2 and 10 vol% N2 for five days and for further two days in pure N2. 630

Optical densities of samples, whose standard deviations are represented by error bars, were 631

on Novem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

30

measured at 680 nm. 3HO (light gray) and 3HD (dark gray) contents were measured by GC 632

analysis of dried cell matter from samples taken after five and seven days of cultivation. 633

on Novem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Table 1: Microorganisms, plasmids, and oligonucleotides, which were used in this study. All

heterologously overexpressed genes were amplified from genomic DNA of P. putida KT2440.

The PcooF-promoter and the codon-exchanged phaZ2 were amplified from genomic DNA of

R. rubrum S1. Utilized restriction sites are underlined in the oligonucleotide sequences.

Modifications in the resulting proteins, caused by the applied oligonucleotides are in bold type.

Organisms, plasmids, or oligonucleotides Relevant characteristics or sequence (5‘3‘) Source or

reference

E. coli TOP10

F- mcrA Δ(mrr-hsdRMS-mcrBC) ϕ80lacZΔM15 ΔlacX74 nupG recA1 araD139 Δ(ara-leu)7697 galE15 galK16 rpsL(StrR)

endA1 λ-

Life Technologies (Darmstadt, D)

E. coli S17-1 recA1, thi1, hsdR17(rk-, mk+), proA, tra (pRP4) 52

R. rubrum S1 (ATCC11170) Wild type DSM467; 53, 54

R. rubrum ΔphaC1/ΔphaC2 PHA-negative deletion mutant 31

R. rubrum ΔphaC1/ΔphaC2/ ΔphaZ2 PHA-negative phaZ2 deletion mutant This study

R. rubrum

ΔphaC1/ΔphaC2/phaZ2C176A

PHA-negative deletion mutant, amino acid exchange in PhaZ2 (Position 176 cysteine alanine)

This study

pBBR1MCS-2 Kmr 55

pBBR1MCS-2-PcooF Kmr, PcooF This study

pBBR1MCS-2::phaG::phaC1::pp0763

Kmr, P. putida KT2440 phaG, phaC1 & pp0763 This study

pBBR1MCS-2-PcooF::phaG::phaC1::pp0763

Kmr, PcooF, P. putida KT2440 phaG, phaC1 & pp0763 This study

pJQ200mp18 Gmr, sacB 56

pJQ200mp18::phaZ2C176A Gmr, R. rubrum phaZ2C176A This study

on Novem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

phaG_fwd_XhoI TTCTCGAGAGGAGGGATGACATGAGGCCAGAAATCG This study

phaG_rev_HindIII CGAAGCTTTCAGATGGCAAATGCATGC This study

phaC1_fwd_HindIII CAGAAGCTTAGGAGGTCGTAGATGAGTAACAAGAAC This study

phaC1_rev_BamHI CAGGATCCTGTAACTCAACGCTCGTG This study

PP_0763_fwd_SpeI TTACTAGTAGGAGGATCCCCATGTTGCAGACACG This study

PP_0763_rev_SpeI GTACTAGTCCCGCACAATGGTTACAACGTG This study

PcooF_fwd_ApaI AAGGGCCCTGGCGCGTTCCCACCTATATGAACTGGG This study

PcooF_rev_XhoI AACTCGAGTTCGTCGCCCTTCAGACCGGG This study

C176A_us_fwd_XbaI ATATCTAGAGGCGCGTGGCCGCACACTCGGTCCATACCCTTTACACCTGTCCG This study

C176A_us_rev CGCTGGGTTGGGCAACCGCCAACAGGTGGGTATCGGG This study

C176A_ds_fwd_XbaI GTTGGCGGTTGCCCAACCCAGCGTGCCGGTGCTGAC This study

C176A_ds_rev_XbaI ATATCTAGATGGCACCGCCGCGCTCCGCTTCAAGAATGAACGCACGGACATGG This study

phaZ2_us_fwd_XbaI TCTAGAGCGGTGGCGACGAACAG This study

phaZ2_us_rev_PstI CTGCAGTTTTCGTTAGCCGCGTTCC This study

phaZ2_ds_fwd_PstI CTGCAGTTGGGAAACCAAGACGCTGAAG This study

phaZ2_ds_rev_XbaI TCTAGATGGGGATCAAGACGCAGGG This study

phaZ2_int_fwd CCTTCGGCTTTGACACCTATGTCG This study

phaZ2_int_rev CGCGCTCCGCTTCAAGAATG This study

phaZ2_flank_fwd CAGGTGATGAAGGAACAGGCG This study

phaZ2_flank_rev GCACCCAGTCGGATTTATCGG This study

on Novem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Table 2: Cell dry weight (CDW) and PHA accumulation of recombinant strains of R. rubrum

ΔphaC1/ΔphaC2 cultivated with different carbon sources. Cells were cultivated in media

modified from Bose et al. (22) with an artificial syngas atmosphere (40% CO, 40% H2, 10% CO2,

10% N2), carbon monoxide (40% CO, 60% N2), or 1% (wt/vol) of fructose. 3HO and 3HD

contents were measured by GC analysis of dried cell matter from samples taken after five days of

gas-cultivation, or two days when cultivated with fructose. Standard deviations of measurements

are indicated. N.d.: Not detected.

R. rubrum ΔphaC1/ΔphaC2

pBBR1MCS-2

Carbon source CDW

(g/L)

PHA

(wt%)

3HO

(mol%)

3HD

(mol%)

phaG::phaC1::PP_0763 Syngas mixture 1.1 ± 0.2 1.4 ± 0.3 31.8 ± 1.1 68.1 ± 1.1

Carbon

monoxide

1.0 ± 0.1 1.0 ± 0.2 33.5 ± 1.5 66.5 ± 1.5

Fructose 3.6 ± 0.2 2.4 ± 0.4 30.1 ± 0.9 69.8 ± 0.9

PcooF::phaG::phaC1::PP_0763 Syngas mixture 1.0 ± 0.0 6.7 ± 0.8 42.8 ± 1.5 57.0 ± 1.5

Carbon

monoxide

0.8 ± 0.1 4.9 ± 0.3 48.2 ± 2.8 51.8 ± 2.8

Fructose 3.5 ± 0.3 2.1 ± 0.3 31.3 ± 1.7 68.6 ± 1.7

(empty vector) Syngas mixture 1.2 ± 0.0 N.d. N.d. N.d.

Carbon

monoxide

1.1 ± 0.1 N.d. N.d. N.d.

Fructose 3.8 ± 0.1 N.d. N.d. N.d.

on Novem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

on Novem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

on Novem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

on Novem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

on Novem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

on Novem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from