targeting cyclin d-cdk4/6 sensitizes immune-refractory...

$: Targeting Cyclin D-CDK4/6 Sensitizes Immune-Refractory ...cancerres.aacrjournals.org/content/canres/78/10/2638.full.pdfand that NANOG mediates multiaggressive cancer phenotypes, including$
Tumor Biology and Immunology

Targeting Cyclin D-CDK4/6 SensitizesImmune-Refractory Cancer by Blocking theSCP3–NANOG AxisSe Jin Oh1,2,3, Hanbyoul Cho4,5,6, Suhyun Kim7, Kyung Hee Noh8,Kwon-Ho Song1,2,3, Hyo-Jung Lee1,2,3, Seon Rang Woo1,2,9, Suyeon Kim1,2,3,Chel Hun Choi5,10, Joon-Yong Chung4, Stephen M. Hewitt4, Jae-Hoon Kim5,6,Seungki Baek2,3, Kyung-Mi Lee2,3, Cassian Yee11,12, Hae-Chul Park7,9, andTae Woo Kim1,2,3,9

Abstract

Immunoediting caused by antitumor immunity drives tumorcells to acquire refractory phenotypes. We demonstrated previ-ously that tumor antigen–specific T cells edit these cells such thatthey become resistant to CTL killing and enrich NANOGhigh

cancer stem cell-like cells. In this study, we show that synapto-nemal complex protein 3 (SCP3), a member of the Cor1 family,is overexpressed in immunoedited cells and upregulates NANOGby hyperactivating the cyclin D1–CDK4/6 axis. The SCP3–cyclinD1–CDK4/6 axis was preserved across various types of humancancer and correlated negatively with progression-free survival

of cervical cancer patients. Targeting CDK4/6 with the inhibitorpalbociclib reversed multiaggressive phenotypes of SCP3high

immunoedited tumor cells and led to long-term control of thedisease. Collectively, our findings establish a firm molecular linkof multiaggressiveness among SCP3, NANOG, cyclin D1, andCDK4/6 and identify CDK4/6 inhibitors as actionable drugs forcontrolling SCP3high immune-refractory cancer.

Significance: These findings reveal cyclin D1-CDK4/6 inhibi-tion as an effective strategy for controlling SCP3high immune-refractroy cancer. Cancer Res; 78(10); 2638–53. �2018 AACR.

IntroductionHarnessing the immune system to detect and eliminate tumor

cells has been the central goal of anticancer immunotherapy (1).

Although immunotherapy has emerged as a potentially powerfulapproach to cancer treatment, the development of immunother-apeutic resistance limits its clinical application in cancer patients(2, 3). Among the diverse causes of resistance to immunotherapy(4, 5), the cancer immunoediting theory, defined by the phases ofelimination, equilibrium, and escape, has attracted attention as itcan explain the emergence of intrinsic or acquired resistance tonatural or artificial antitumor immunity, respectively (6). Selec-tion by immunoediting, together with clonal evolution of malig-nant cells, contributes to the generation of cancer cells that havebetter survival advantages and eventually leads to the enrich-ment of cancer cells with stem-like properties (6–10). We havepreviously shown that tumor cells are enriched with the plur-ipotency transcription factor NANOG under immune selection,and that NANOG mediates multiaggressive cancer phenotypes,including an immune resistance, stem-like phenotype andmetastasis (7, 8, 11). Notably, knockdown of NANOG causedreversal of multiaggressive phenotypes of immunoeditedtumor cells and led to long-term control of the disease, sug-gesting that blockade of the NANOG pathway could be apromising approach for immune-based cancer therapy. How-ever, pharmacologic inhibitors of NANOG are yet to be devel-oped. Therefore, an in-depth understanding of the underlyingmolecular mechanisms regulating NANOG expression is essen-tial for developing strategies to reverse the multi-aggressivephenotypes of immune-refractory tumor cells.

Mutations in BRAF, KRAS, PTEN, and/or PIK3CA are well-known tumorigenic mechanisms and drive multiaggressivecancer phenotypes through activation of various intracellularsignaling (12). Of these signaling pathways, the AKT pathway isa major contributor to intractability of cancer. Hyperactivation of

1Laboratory of Tumor Immunology, Department of Biomedical Sciences, Grad-uate School of Medicine, Korea University, Seoul, Korea. 2Department of Bio-chemistry and Molecular Biology, College of Medicine, Korea University, Seoul,Korea. 3Department of Biomedical Science, College ofMedicine, KoreaUniversity,Seoul, Korea. 4Experimental Pathology Laboratory, Laboratory of Pathology,Center for Cancer Research, National Cancer Institute, NIH, Bethesda, Maryland.5DepartmentofObstetrics andGynecology,GangnamSeveranceHospital, YonseiUniversity College of Medicine, Seoul, Republic of Korea. 6Institute of Women'sLife Medical Science, Yonsei University College of Medicine, Seoul, Republic ofKorea. 7Graduate School of Medicine, Korea University, Ansan, Gyeonggido,Republic of Korea. 8Gene Therapy Research Unit, Korea Research Institute ofBioscience and Biotechnology, Daejeon, Republic of Korea. 9TranslationalResearch Institute for Incurable Diseases, College of Medicine, Korea University,Seoul, Korea. 10Departments of Obstetrics and Gynecology, Samsung MedicalCenter, Sungkyunkwan University School of Medicine, Seoul, Republic of Korea.11Department of Melanoma Medical Oncology and Immunology, University ofTexas MD Anderson Cancer Center, Houston, Texas. 12Clinical Research Division,Fred Hutchinson Cancer Research Center, Seattle, Washington.

Note: Supplementary data for this article are available at Cancer ResearchOnline (http://cancerres.aacrjournals.org/).

S.J. Oh, H. Cho, and S. Kim contributed equally to this article.

Corrected online June 26, 2018.

CorrespondingAuthor: TaeWooKim, Laboratory of Tumor Immunology, Room319, Moonsook Medical Hall, Korea University College of Medicine, 73 Inchon-ro,Sungbuk-gu, Seoul 02841, Republic of Korea. Phone: 822-2286-1301; Fax: 822-923-0480; E-mail: [email protected]

doi: 10.1158/0008-5472.CAN-17-2325

�2018 American Association for Cancer Research.

CancerResearch

Cancer Res; 78(10) May 15, 20182638

on November 2, 2020. © 2018 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst February 6, 2018; DOI: 10.1158/0008-5472.CAN-17-2325





http://crossmark.crossref.org/dialog/?doi=10.1158/0008-5472.CAN-17-2325&domain=pdf&date_stamp=2018-6-26

http://cancerres.aacrjournals.org/



AKT, a common mediator of cell survival signals, suppressesapoptotic cell death induced by chemical, radiation andimmune agents throughmultiple intracellular signaling pathways(13–17). Typically, AKT-mediated intractable cancer phenotypesare dependent on cyclin D1, which is a representative oncogeneinvolved in AKT downstream signaling (18). AKT-driven cyclinD1 overexpression promotes uncontrolled cyclin D1–CDK4/6activation that is strongly correlated with cancer development,therapeutic resistance, as well as with poor prognosis of oral, andhead and neck squamous cell carcinomas after radiotherapyor chemo-radiotherapy (18). Notably, targeting of cyclin D1–CDK4/6 has already been shown to cause a statistically significantimprovement in progression-free survival in breast cancer(19–21). Although previous studies have demonstrated thatcyclin D1–CDK4/6 inhibition is an effective strategy to overcomeresistance to chemo- or radiotherapy (22–25), the underlyingstrategies for treatment of NANOG-mediated multiaggressivecancer, including immune resistance and stem-like phenotype,remain mostly unclear.

Synaptonemal complex protein 3 (SCP3), a member of theCor1 family, is a structural component of the synaptonemalcomplex, which mediates synapsis, pairing of homologouschromosomes during meiosis in germ cells (26). AlthoughSCP3 is expressed strictly in the testis and ovary in normaltissues, expression of SCP3 is frequently observed in varioushuman cancer cells, and it induces tumorigenesis of cervicaland lung cancer via the AKT pathway (27–29). Previously, wehave reported that SCP3 drives immune resistance to apoptosisinduced CTLs by hyperactivating AKT signaling (30). Interest-ingly, immune-refractory phenotypes caused by SCP3 are verysimilar to those caused by NANOG as it also activates the AKTpathway (31). Thus, mechanistic comprehension of a firmmolecular link between SCP3 and NANOG may present tar-getable pathways in immune-refractory tumor cells showingthe multiaggressiveness.

In this study, we demonstrate that SCP3 promotes immuneresistance and stem-like phenotypes in immunoedited cells bytranscriptionally upregulating NANOG expression via the AKT–cyclin D1–CDK4/6–E2F1 axis. The expression of the SCP3–pAKT–cyclin D1–NANOG axis is correlated with the stage of thedisease and prognosis of patients with cervical neoplasia, and it isconserved across multiple types of human cancer cells. Impor-tantly, these immune-refractory tumor cells were more sensitiveto palbociclib (PD-0332991), a CDK4/6 inhibitor for clinicalapplication due to its hyperactivation of the cyclin D1–CDK4/6axis. Therefore, we have provided the proof of the principle thatCDK4/6 inhibition is actionable for controlling SCP3high-refractory cancer, particularly in the context of CTL-mediatedimmunotherapy.

Materials and MethodsMice and cell lines

Six- to 8-week-old female NOD/SCID mice were purchasedfrom Orient-bio Animal Inc. All mice were maintained andhandled under the protocol approved by the Korea UniversityInstitutional Animal Care and Use Committee (KUIACUC-2015-282). All animal procedures were performed in accordance withrecommendations for the proper care and use of animals.

CaSki, HEK293, and MDA-MB-231 cells were obtained com-mercially (ATCC). All cell lines were obtained between 2010 and

2014, and tested for mycoplasma using Mycoplasma DetectionKit (Thermo Fisher Scientific). The identities of cell lines wereconfirmed by short tandem repeat (STR) profiling by IDEXXLaboratories Inc. and used within 6 months for testing. Thegeneration and maintenance of CaSki P0 and CaSki P3 cells hasbeen described previously (32). For the generation of the MDA-MB-231 P3 cell line (33), NOD/SCID mice were subcutaneouslyinoculated with 1� 106 MDA-MB-231 P3 cells per mouse. Sevendays following tumor challenge, mice were treated adoptivetransfer with 2� 106 MART-1–specific CTLs and IL2 (3000 units;Novartis). This regimen was repeated for three cycles. To generateCaSki-SCP3 cells, pMSCV-SCP3 plasmids were first transfectedalong with viral packaging plasmids (VSVG and Gag-pol) intoHEK239FT cells. Three days after transfection, the viral superna-tant was filtered through a 0.45-mm filter and introduced intoCaSki cells, as described previously (34).

Chemical reagentsThe following chemical reagents were used in this study:

palbociclib (Selleckchem) and cisplatin (Selleckchem).

DNA constructspMSCV/SCP3 constructs were generated with a PCR-based

strategy from a human testis cDNA library (Clontech) with thefollowing primers: SCP3 forward, 50-GCTCGAGATGGTGTCC-TCCGGAAAAAAG-30; SCP3 reverse, 50-CGAATTCAGTCTTATTG-TACCTAACTTCTCTG-30. SCP3 fragments were subcloned intothe pMSCV-puro vector (Clontech) at the XhoI and EcoRI restric-tion sites. To generate p3xFLAGCMV7.1 CAAKT, cDNA encodinghuman CA AKT was amplified from myrAKT d4-129 (Addgene)using a primer set forward 50-GAATTCCATGAGCGACGTGGC-TATTG-30; reverse 50-GGATTCGCCTCAGGCCGTGCCGC-30. Theamplified cDNA was cloned into EcoRI/BamHI restriction sites ofthe p3xFLAG CMV7.1 vector (Sigma). The AKT, cyclin D1, andcyclin D1 K112Emutants were purchased from Addgene. Finally,the promoter region of the NANOG gene was isolated by PCRfrom genomic DNA extracted from CaSki P3 cells using a pri-mer set forward 50-CCGGTACCTCTCCGGAATGGTAGTCTG-30;reverse 50- CCGGTACCTCTCCGGAATGGTAGTCTG-30. The PCRproducts were digested with KpnI and BglII and subcloned intothe KpnI/BglII restriction sites of the pGL3-Basic vector (Promega).In all cases, plasmid integrity was confirmed by DNA sequencing.To construct hsp70:egfp and hsp70:SCP3-egfp recombinantDNA, we first amplified SCP3 using a forward primer containinga B1 site (50-GGGGACAAGTTTGTACAAAAAAGCAGGCTATGG-TGTCCTCCGGAAAAAAGTATTCC-30) and reverseprimer contain-ing a B2 site (50- GGGGACCACTTTGTACAAGAAAGCTGGG TAG-AATAACATGGATTGAAGAGACTTCCG-30). The PCR product wascloned into pDONR 221 using the BP reaction of the Gatewaysystem (Invitrogen). A 50 entry clone containing a fragment of thezebrafish hsp70 promoter, a 30 entry clone containing the mcherry,and Tol2 destination vector were provided by Chi-Bin Chien(Department of Neurobiology and Anatomy, University of UtahMedical Center, Salt Lake City, Utah; ref. 35). The MultisiteGateway LR reactions were performed using LR II clonase(Invitrogen) according to the manufacturer's recommendations.

Site-directed mutagenesisThe QuikChange Site-directed Mutagenesis Kit (Stratagene) was

used according to the manufacturer's instructions. To generatemutations in the E2F1-binding site of the NANOG promoter

SCP3 Axis Is a Therapeutic Strategy for Refractory Cancer

www.aacrjournals.org Cancer Res; 78(10) May 15, 2018 2639




region, the following primers were used: E1 forward 50-CCTTGTTTCACATCAAGCAATACTGGTCGAGTCTTTGCATTGTG-30; reverse 50-CACAATGCAAAGACTCGACCAGTATTGCTTGATGT-GAAACAAGG-30, E2 forward 50- GCTAAAGAGCCAGAGGGAG-CAAGCCAGAAGTCGAC-30; reverse50-GTCGACTTCTGGCTTGCT-CCCTCTGGCTCTTTAGC-30. Thermal cycling conditions for PCRwere 95�C for 5minutes; 18 cycles of 95�C for 1minutes, and 64�Cfor 1 minutes, and 68�C for 15 minutes. PCR products weredigested with DpnI at 37�C for 1 hour and transformed intoXL10-Gold ultracompetent bacterial cells. Mutations were con-firmed by DNA sequencing.

siRNA constructsSynthetic siRNAs specific for GFP, SCP3, NANOG were pur-

chased from Bioneer; nonspecific GFP, 50- GCAUCAAGGUGAA-CUUCAA-30 (sense), 50-UUGAAGUUCACCUUGAUGC-30 (anti-sense); SCP3 #1 50-CAGUUAUAUGAGCAGUUCAUAAA-30

(sense); 50- UUUAUGUUCUGCUCAUAUAACUG-30 (antisense);SCP3 #2 50-GAGACUAGAAAUGUAUACCAAGG-30 (sense);50-CCUUGGUAUACAUUUCUAGUCUC-30 (antisense); SCP3#3 50-GUGCAGAAUAUGCUGGAAGGAGU-30 (sense); 50-ACUC-CUUCCAGCAUAUUCUGCAC-30 (antisense); NANOG, 50- GCA-ACCAGACCUGGAACAA-30 (sense), 50-UUGUUCCAGGUCUG-GUUGC-30 (antisense). For AKT (#001014431.1) and cyclin D1(#053056.2), predesigned siRNAs were purchased commerciallyfrom Bioneer. siRNAwas transfected in vitro into 6-well plates at adose of 200 pmol per well using Lipofectamine 2000 (Invitrogen)according to the manufacturer's instructions.

Real-time quantitative RT-PCRTotal RNA was isolated using the RNeasy Micro kit (Qiagen),

and the cDNAs were synthesized by using reverse transcriptase(RT) using the iScript cDNA Synthesis Kit (Bio-Rad), according tothe manufacturer's recommended protocol. Real-time quantita-tive PCRwas performedusing iQSYBRGreen Supermix (Bio-Rad)with specific primers on a CFX96 real-time PCR detection system.All real-time quantitative PCR experiments were performed intriplicate and quantification cycle (Cq) values were determinedusing Bio-Rad CFX96 Manager 3.0 software. Relative quantifica-tionsof themRNA levelswere performedusing the comparativeCt

method with b-ACTIN as the reference gene. Fold change wascalculated relative to the expression level ofmRNA in control cells.Primers were purchased from Bioneer; NANOG 50-TGACTTCCA-CATGAGCGTGG-30 (forward); 50-GCTCCTATTGTCCCTCGTGC-30 (reverse), NANOG promoter E1 region (�1372 � �1253) 50-TCTCCGGAATGGTAGTCTGA-30 (forward); 50- GCTCCCACA-CAAGCTGACT-30 (reverse), NANOG promoter E2 region(�958��854) 50- TGGGCACGGAGTAGTCTTGA -30 (forward);50- ATCCCTCCTCCCAGGTAGTC -30 (reverse).

Luciferase assayFor luciferase assay, as described previously (7), cells were

maintained in RPMI with 10% FBS and seeded at 1 � 105

cells/well in 12-well plates 1 day prior to the assay. The reporterconstructs, pGL3 basic, pGL3-NANOG, or pGL3-NANOG E2F1Mut together with pCMV-b-Gal, an internal control for transfec-tion efficiency, were cotransfected into CaSki cells using Lipofec-tamine 2000 (Invitrogen). After 24 hours, cells were washed withPBS and lysed with Cell Culture Lysis Reagent (Promega). Lucif-erase activity was measured with a Turner Biosystems TD-20/20luminometer after addition of 40 mL of luciferase assay reagent

(Promega). b-Galactosidase activity wasmeasured with a uQuantmicroplate reader (BioTek) at 570 nm wavelength after additionof b-galactosidase assay reagent containing 1 mmol/L chlorophe-nol red b-d-galactopyranoside substrate (Roche). Relative lucif-erase activity was normalized to the b-galactosidase activity in thecell lysate and was calculated as an average of three independentexperiments.

CTL assayFor in vitro CTL assays, tumor cells were harvested by trypsini-

zation,washedoncewithDMEM(Hyclone) containing 0.1%FBS,resuspended, and labeled in 1 mL 0.1% FBS containing DMEMand 10 mmol/L CFSE (carboxyfluorescein diacetate succinimidylester, Molecular Probes). The suspended cells were incubated for10minutes in a 37�C incubatorwith 5%CO2. After collection, theCFSE-labeled cells were resuspended in 10 mg/mL MART-1 pep-tide containing 1-mL DMEM. After 1 hour, CFSE-labeled cellswere incubated for 4 hours with an MART-1–specific CD8þ T-cellline at an E/T ratio of 1:1. After incubation for 4 hours at 37�C, thefrequency of apoptotic cells was determined by stainingwith anti-active caspase-3 antibody and performing flow cytometry asdescribed previously (34). To display data at the single-cell level,the representative flow cytometric data was shown to dot plot.

In vivo tumorigenicity assayCells were harvested by trypsin treatment and then washed and

resuspended in Opti-MEM. NOD/SCID mice were subcutaneouslyinjected with 104 or 105 cells. Tumor formation was monitoredevery twodays. After 12 days, tumor tissuewas excised andweighed.

Chromatin immunoprecipitation and quantitative ChIP assaysThe ChIP kit (Millipore) was employed according to the man-

ufacturer's instructions and chromatin immunoprecipitation(ChIP) assay was performed as described previously (7). Briefly,cells (1� 107 per assay) were bathed in 1% formaldehyde (SigmaAldrich) at 25�C for 10 minutes for cross-linking of proteins toDNA and then lysed in SDS buffer containing protease inhibitor.DNA was sheared into 0.2–1 kb fragments by sonication using aSonic Dismembrator Model 500 (Thermo Fisher Scientific).Immunoprecipitation was carried out by incubation with 1 mg ofanti-E2F1 and anti-pRB (Cell Signaling Technology) antibody ormouse IgG (Upstate Biotechnology) for 16 hours. To reverse theprotein–DNA crosslinks, the immunoprecipitated sample andinput were incubated at 65�C overnight. After reversal of cross-linking, DNA fragmentswere purified using spin columns (UpstateBiotechnology). The region flanking the E2F1-binding sites in theNANOG promoter region was amplified and the PCR productwas resolved on a 2% agarose gel containing ethidium bromideand visualized under ultraviolet light. For quantitative ChIP(qChIP) assay, DNA immunoprecipitated by mouse IgG, E2F1and pRB was quantified by real-time qPCR using iQ SYBR GreenSuper Mix with CFX96 Real-Time PCR detection system as describ-ed above. Each samplewas assayed in triplicate, and the amount ofprecipitatedDNAwas calculated as the percentage of input sample.

Zebrafish line and maintenanceWild-type AB zebrafish of either sex were used in this study.

The fish were maintained at 28�C and the embryos were collectedby means of mating of adult fish. Embryos were raised in theE3 embryo medium and staged according to hours postfertiliza-tion (hpf).

Oh et al.

Cancer Res; 78(10) May 15, 2018 Cancer Research2640




Injection and HSP inductionFor ectopic induction, 20–30 pg of hsp70:egfp and hsp70:

SCP3-egfp DNA constructs were injected into 1–2 cell-stageembryos each. To induce the expression of egfp alone andSCP3-egfp, we raised the injected embryos at 28.5�C, transferredthem to EM at 39�C for 30 minutes at 22-hpf and continuedincubation at 28.5�C.We then screened for EGFPfluorescence andfixed the embryos at specific stages.

IHC and fluorescent in situ RNA hybridizationHeat-shocked embryos were fixed using 4% paraformaldehyde

overnight. For IHC, we used the following primary antibodies:rabbit anti-phopho-akt T308 (1:250, Cell Signaling Technology)andmouse anti-cyclinD1 (1:200, Cell Signaling Technology). Forfluorescent detection of antibody labeling, we used Alexa Fluor568 goat anti-rabbit, anti-mouse (1:500, Molecular Probes).Fluorescent in situ RNA hybridization was performed using TSAPLUS Cy3 kit (Perkin Elmer) as described previously (36). Weused the following primers to generate probes for nanog: forward:50-ATGGCGGACTGGAAGATGCC-30 reverse: 50-ACAGCAAAGT-TATTCCTTTAGTTGCC-30. Fluorescence images were collectedusing a Zeiss LSM 510 laser scanning confocal microscope. Wequantified the number of EGFPþCy3þ cells throughout the wholezebrafish trunk. All data are displayed graphically as the mean �SEM and comparisons of two groups were made using anunpaired Student t test. Mean values were considered statisticallysignificant when P < 0.05.

Tissue samples and IHCTissue specimens were prospectively collected from patients

who were admitted to Gangnam Severance Hospital between1996 and 2010. Some of the paraffin blocks were provided bythe Korea Gynecologic Cancer Bank through Bio & MedicalTechnology Development Program of the Ministry of Education,Science and Technology, Korea (NRF-2012M3A9B8021800). Tis-sue microarrays (TMA) constructed from 608 patients with pri-mary invasive cervical cancer after cervical intraepithelial neopla-sia (CIN), have been described previously (37). All procedureswere conducted in accordance with the Declaration of Helsinki.Tissue samples and medical records were collected from patientswho providedwritten informed consent. This studywas approvedby the Institutional ReviewBoardofGangnamSeveranceHospital(approval no. #3-2010-0030; Seoul, South Korea) and it wasadditionally approved by the Office of Human Subjects Researchat the NIH. For IHC, TMA sections were cut to 5 mm thickness,followed by deparaffinization with xylene and rehydrationthrough a graded ethanol series. Antigen retrieval was performedin heat-activated antigen retrieval pH 9.0 (Dako). Endogenousperoxidase activity was quenched with 3% H2O2 for 10 minutes.The sections were incubated overnight at 4�C with rabbit mono-clonal anti-cyclinD1 antibodies (Thermo Scientific; Clone SP4) at1:100 dilution. Subsequently, antigen–antibody reaction wasdetected by a standard ABC protocol using EnVisionþ Dual LinkSystem-HRP (Dako) and visualized using 3,3-diaminobenzidinesubstrate for 10 minutes. TMA sections were lightly counter-stained with hematoxylin and then examined by light microsco-py. Negative controls including immunoglobulin G (IgG) andsubstitution of primary antibody with TBS were concurrentlyperformed, and the TMA included appropriate positive controltissues. SCP3, pAKT, and NANOG protein expressions werepreviously evaluated in the same cohort (7, 27, 37). The stained

TMA sections were digitized using the high resolution opticalscanner NanoZoomer 2.0 HT (Hamamatsu Photonics K.K.).Digital analysis of the stained sections was performed using thesoftware Visiopharm Integrator System v6.5.0.2303 (VIS; Visio-pharm). After training the systembydigitally "painting" examplesof the nucleus in the image, an algorithm for nuclei-specific signalselection was manually designed. The cytoplasm was furtherdefined by outlining the defined nucleus. DAB intensity in eachdefined image was used for quantification, andwas categorized asfollows: 0 ¼ negative, 1 ¼ weak, 2 ¼ moderate, and 3 ¼ strong.The overall immunostaining score was calculated by multiplyingthe staining intensity with the percentage of positive cells (pos-sible range 0–300).

Tumor treatment experimentsNOD/SCIDmicewere inoculated subcutaneously with 1� 106

MDA-MB-231 P3 cells per mouse. Seven days following tumorchallenge, palbociclib (100mg/kg) in lactate buffer or vehicle wasadministered via the oral route. The following day after palboci-clib treatment, mice received adoptive transfer with 2 � 106

MART-1–specific CTLs. This treatment regimen was repeated forthree cycles. Mice were monitored for tumor burden and survivalfor 21 and 79 days after challenge, respectively.

Statistical analysisAll data are representative of at least three separate experiments.

Individual data pointswere compared by two-tailed Student t test.For IHC data, statistical analysis was performed using R softwareversion 3.1.2. TheMann–WhitneyU test was used to compare theprotein expressions between groups. The c2 test was used to assessthe associations between molecular markers. Survival distribu-tions were estimated using the Kaplan–Meier method with thelog-rank test. A Cox proportional hazards model was created toidentify independent predictors of survival. In all cases, P < 0.05was considered statistically significant.

ResultsImmune selection imposed by antigen-specific CTLs causesSCP3 enrichment in immunoedited tumor cells with stem-likeproperties

We previously established a highly immunoedited tumor cellline, CaSki P3, which was generated from its immune-susceptibleparental cell line, CaSki P0, through 3 rounds of in vitro selectionby mixing CaSki P0 cells pulsed with a MART-1 peptide togetherwith MART-1–specific CTLs. For generation of negative control,those pulsedwith an irrelevant NY-ESO-1 peptide under the sameconditions were termed CaSki N3 (32). Previously, we reportedthat the X-linked lymphocyte-regulated protein pM1 (XLR) genewasupregulated during immune selection (30). Therefore,wefirstassessed the expression of its human counterpart SCP3 in CaSkicells at different roundsof immune selection (P0 toP3) and founda stepwise increase in SCP3 expression from P0 to P3 (Fig. 1A).After selection, the SCP3protein level was 7-fold higher in P3 cellsthan in P0 cells (Fig. 1A). The overall increase in SCP3 expressionin the P3 cell line was likely due to enrichment of SCP3þ cells, asopposed to upregulation of SCP3, as the frequency of SCP3þ cellsrose from around 9% in the P0 cell line to around 95% in the P3cell line (10-fold enrichment; Fig. 1B). On the other hand, therewas no significant increase of SCP3 levels in tumor cells underselection with an irrelevant peptide (N1 to N3; Fig. 1B). We next






Oh et al.





questioned the effect of SCP3 on CTL-mediated cytotoxicity. Toexplore this possibility, we performed the in vitro CTL assay.Compared with SCP3� cells, SCP3þ cells showed a decreasednumber of CTL-mediated apoptotic cells (Fig. 1C). Thus, antigen-specific T-cell–mediated immune selection depletes tumor cellslacking SCP3 and enriches tumor cells containing SCP3, suggest-ing that SCP3 could confer a survival advantage under theimmune selection pressure imposed by antigen-specific CTLs.

To further investigate the role of SCP3 in immune-resistanceand stem-like property, we treated P3 cells with siRNA-targetingSCP3 (siSCP3 #1, siSCP3 #2, or siSCP3 #3) or siRNA-targetingGFP (siGFP) control and measured the protein level of the relat-ed signature molecules that were screened in previous studies(7, 27, 30). The transfection of siSCP3s decreased the levels ofantiapoptotic molecules [MCL-1 (7), BCL-2, and BCL-xL (30)]and cell-cycle molecules (cyclin D1 and cyclin A; ref. 7) andincreased the p21 (7) level in the P3 cell line (Fig. 1D). Consistentwith these changes in protein levels, all of siSCP3s-treated cellscontained more apoptotic cells whenmixed with MART1-specificCTLs or liposomal delivery of granzyme B, proliferated moreslowly, formed fewer spheres, and showed reduced in vitro andin vivo tumorigenic stem-like properties, compared with siGFP-transfected cells (Fig. 1E–J). Conversely, the SCP3 gene-trans-duced P0 cells phenocopied the P3 cells (Supplementary Fig.S1A–S1G). Thus, SCP3 provides a survival advantage and tumor-igenic potentials to immunoedited tumor cells.

It is conceivable that SCP3 expression in tumor cells influencesthe antigen-processing or the antigen presentation pathway,which could account for decreased sensitivity to lysis by CTLs.Therefore, we assessed MHC class I (HLA-A2) expression in P0cells transduced with an empty vector or SCP3 and the presen-tation of MART-1 peptide through the MHC class I to MART-1–specific CD8þ T cells. We found that both MHC class I expressionand presentation of MART-1 peptide to MART-1–specific CD8þ Tcells were virtually identical regardless of the SCP3 expressionstatus in tumor cells, demonstrating that SCP3 in tumor cells doesnot influence MHC class I expression or its antigen presentationby tumor cells (Supplementary Fig. S2A).

We next tested the possibility that SCP3 expression in tumorcells may alter the function or survival of antigen-specific CTLs.We found that there was no difference in CTL effector cytokine(IFNg) production, or survival of MART-1–specific CTLs mixedwith MART-1-loaded tumor cells regardless of SCP3 expression(Supplementary Figs. S2B and S3A). Taken together, we concludethat SCP3 expression makes tumor cells stem-like as well asimpervious to apoptotic death by CTLs, but it does not affect theintrinsic functional capacity of CTLs.

SCP3 induces both immune-resistant and stem-like phenotypesby upregulating NANOG expression

Under immune selection, we have previously demonstratedthat NANOG builds a bridge between emergence of a stem-likestate and resistance to CTL killing (38). Therefore, we decided toinvestigate the functional inter-relationship between SCP3 andNANOG. For this, we first addressed the coexistence of SCP3 andNANOG in immunoedited cells using flow cytometry analysis(Fig. 2A). The percentage of SCP3 and NANOG double-positivecells was approximately 80% in P3 cells, and interestingly, thefrequency of SCP3 and NANOG double-positive cells was 9-foldhigher than in P0 cells, but there was no difference in theNANOGþ/SCP3þ ratio regardless of immunoediting with a rel-evant peptide (P3) or an irrelevant peptide (N3). These findingssuggest that immune selection increases the percentage of SCP3andNANOGdouble-positive cells anddepletes cells lacking SCP3or NANOG. Then, we questioned whether there is an inter-relationship between SCP3 andNANOG inP3 cells after knockingdown with siRNAs. Interestingly, delivery of siSCP3 into P3 cellsreduced theNANOGexpression bymore than 5-fold. Conversely,ectopic introduction of SCP3 into P0 cells increased the NANOGexpression bymore than 3-fold (Fig. 2B). In contrast, NANOGdidnot affect SCP3 expression (Fig. 2C). These data demonstrate thatSCP3 is one of the upstream regulators of NANOG in tumor cells.

Next, we further questioned whether NANOG is a key inter-mediator for the SCP3-induced immune resistant and stem-likephenotypes. To address this, we treated SCP3-transduced P0 cells(CaSki SCP3) with siNANOG or siGFP control (Fig. 2D). siNA-NOG-CaSki SCP3 cells showed a drastic change in the level ofsignature proteins, such as MCL-1, cyclin A, and p21. But, therewas no significant difference in BCL-2, BCL-xL, and cyclin D1expression levels. Consistently, the silencing of NANOG in CaSkiSCP3 cells increased susceptiblility to MART-1 specific CTLs andshowed reduced in vitro sphere-forming capacity compared withsiGFP-CaSki SCP3 cells (Fig. 2E and F). Thus, our results indicatethat NANOG plays an essential role in multi-intractable proper-ties of SCP3high immunoedited tumor cells

SCP3 promotes an immune-resistant and stem-like phenotypein immunoedited tumor cells through AKT/cyclin D1–CDK4/6signaling

We next sought to determine the mechanism by which SCP3confers NANOG-dependent survival advantage as well as a stem-like phenotype. We previously reported that SCP3 activates AKTsignaling (27, 30). Other authors have shown that hyperactiva-tion of AKT stimulates the transcription of NANOG in mouseembryonic stem cells (31). To explore the possibility that SCP3

Figure 1.Immune selection imposed by tumor-specific CTLs enriches SCP3 in immunoedited tumor cells with stem-like properties. A, Top, quantification of SCP3expression in tumor cells at different stages of immune selection (P0 to P3). Parallel stageswithout selection are labeled as N1 to N3. Bottom, representative westernblot images. B, Top, representative images of flow cytometry analysis of SCP3þ tumor cells. Bottom, quantification of the frequency of SCP3þ tumor cells.C, Flow cytometry analysis of the frequency of apoptotic (active caspase-3þ) cells with or without SCP3 in the MART-1 peptide–pulsed cells after incubation withMART-1–specific CTLs at a 1:0.1 ratio for 16 hours. D–J, CaSki P3 cells were transfected with siGFP, siSCP3 #1 siSCP3 #2, or siSCP3 #3. D,Western blot analysis of theexpression of SCP3, MCL-1, BCL-2, BCL-xL, cyclin D1, cyclin A, and p21. b-Actin was used as an internal loading control. E, Flow cytometry analysis of activecaspase-3þ cells in theMART-1 peptide–pulsed cells after incubationwithMART-1–specific CTLs at a 1:1 ratio for 4 hours. F, Flow cytometry analysis of active caspase-3þ cells in the cells after intracellular delivery of granzyme B. G, Growth rate of siGFP-versus siSCP3s-treated P3 cells. Cells were harvested at the indicatedtime and counted after Trypan blue staining to exclude dead cells. H, Sphere-forming capacity of these cells. Original magnification, �40. I, In vivo tumorigenicityof siGFP versus siSCP3 #1–treated P3 cells. P3 cells were transfected with siGFP or siSCP3 #1. After 16 hours, the cells were subcutaneously inoculated atindicated doses into 5 mice per group. J, Tumor formation was monitored every two days. At 12 days after injection, tumor burden of 104 cells was excisedand weighed. A and D, Numbers below blots indicate the expression as measured by fold change. A–J, Graphs represent three independent experimentsperformed in triplicate. Error bars, mean � SD; n ¼ 3. � , P < 0.01; �� , P < 0.005; �� , P < 0.001.






upregulates NANOG by hyperactivating AKT, we treated CaSkiSCP3 cells with siAKT or siGFP control (Fig. 3A). Surprisingly, wefound that AKTknockdowndrastically reduced theNANOGlevelsin CaSki SCP3 cells. Moreover, siAKT-treated CaSki SCP3 cellscontained almost 3-fold more apoptotic cells after CTL killing,and 4-fold fewer spheres compared with siGFP-transfected CaSki

SCP3 cells (Fig. 3B and C). Thus, our data indicate that SCP3mediates the multi-intractability of tumor cells via the AKT–NANOG axis.

We next aimed to elucidate the process by which the AKTpathway induces NANOG expression. Accumulating evidencehas demonstrated that the AKT–cyclin D1 signal axis is a crucial

Figure 2.

SCP3 induces resistance to CTL-mediated cytotoxicity and stem-like phenotypes by upregulating NANOG expression. A, Top, representative images of flowcytometry analysis of SCP3þ and NANOGþ tumor cells. Middle, quantification of the frequency of NANOGþ tumor cells in SCP3þ tumor cells. Bottom, quantificationof the frequency of SCP3þ NANOGþ tumor cells. N.S., nonsignificant. B and C, Western blot analysis of SCP3 and NANOG expression. CaSki P3 cells weretransfected with siGFP, siSCP3, or siNANOG. CaSki P0 cells were stably transfected with empty vector (no insert), FLAG-SCP3, or NANOG cDNA. b-Actin wasused as an internal loading control. D–F, CaSki-SCP3 cells were transfected with siGFP or siNANOG. D,Western blot analysis of the expression of NANOG, MCL-1,BCL-2, BCL-xL, cyclin A, cyclin D1, and p21. b-Actin was used as an internal loading control. Numbers below blots indicate the expression as measured byfold change. E, Flow cytometry analysis of the frequency of apoptotic (active caspase-3þ) cells in the MART-1 peptide–pulsed cells after incubation withMART-1–specific CTLs at a 1:0.1 ratio for 16 hours. F, Flow cytometry analysis of frequency of apoptotic (active caspase-3þ) cells in the cells after intracellulardelivery of granzyme B. B–D, Numbers below blots indicate the expression as measured by fold change. A, E, and F, Graphs represent three independentexperiments performed in triplicate. Error bars, mean � SD; n ¼ 3. � , P < 0.01; �� , P < 0.001.

Oh et al.





Figure 3.

SCP3 promotes an immune-resistant and stem-like phenotype in tumor cells through pAKT–cyclin D1–CDK4/6 signaling. A–C, CaSki-SCP3 cells weretransfected with siGFP or siAKT. D–F, CaSki-SCP3 cells were transfected with siGFP or siCCND1. G–I, CaSki P0 cells were transfected with empty vector (no insert),FLAG-cyclin D1 WT, or FLAG-cyclin D1 MT (K112E). A, D, and G, The expression and activation status of total AKT, pAKT, p-pRB NANOG, MCL-1, cyclin A,cyclin D1, and p21 was assessed by immunoblotting. b-Actin was used as an internal loading control. Numbers below blots indicate the expression as measuredby fold change. B, E, and H, Flow cytometry analysis of active caspase-3þ cells in the MART-1 peptide–pulsed cells after incubation with MART-1–specific CTLsat a 1:1 ratio for 4 hours (isotype control staining is indicated by solid gray regions; anti-active caspase-3 staining is indicated by the solid black regions).C, F, and I, Sphere-forming capacity of these cells. Original magnification, �40. B, C, E, F, H, and I, Graphs represent three independent experiments performedin triplicate. Error bars, mean � SD; n ¼ 3. � , P < 0.01; �� , P < 0.005; �� , P < 0.001. N.S., nonsignificant.






contributor to conventional therapeutic resistance, including che-mo-, radio-, and immunotherapy along with the maintenanceand survival of cancer stem cells (CSC; refs. 18, 22–24). To verifythe role of cyclin D1 in AKT-mediated NANOG upregulation inSCP3high cells, we used siRNA to knockdown cyclin D1 (siCCND1)in CaSki SCP3 cells. siCCND1-treated CaSki SCP3 cells showedchange more than two times in the related signature moleculeswithout alteration of AKT phosphorylation (Fig. 3D). Consistently,these cells were more susceptible to CTL killing and less able toform in vitro spheres compared with control (Fig. 3E and F).

Because deregulated cyclin D1 acts in cancer separated cyclin-dependent kinase (CDK) 4 or 6 dependent and independentfunctions (18), we questioned whether cyclin D1 exerts its effectsvia CDK 4/6 in immunoedited cells. To estimate this, we used amutant form of cyclin D1 K112 (MT-cyclin D1) that could notbind to CDK4 or CDK6 (39). P0 cells transfected with MT-cyclinD1, in contrast to those transfectedwithwild-type (WT) cyclinD1,failed to show markedly increased phosphorylation of pRBor change in the expression levels of NANOG, MCL-1, cyclin A,or p21 (Fig. 3G). Moreover, while addition of WT-cyclin D1improved the resistance to CTL killing and accelerated thesphere-forming capacity of P0 cells, MT-cyclin D1 had no impacton these parameters (Fig. 3H and I). Thus, our findings indicatethat SCP3 could use the pAKT-cyclin D1-CDK4/6 functional axisto upregulate NANOG expression.

SCP3 transcriptionally upregulates NANOG via the cyclin D1–CDK4/6/E2F1 axis

To further explore the connection between cyclin D1–CDK4/6and NANOG at the transcriptional level, we performed qRT-PCRto measure the mRNA level of NANOG after transfection ofsiCCND1 or siGFP in CaSki SCP3 cells. As shown in Fig. 4A,siCCND1-treated CaSki SCP3 cells have three times less NANOGmRNA than siGFP-treated CaSki SCP3 cells, suggesting that SCP3transcriptionally upregulates NANOG via the cyclin D1–CDK4/6axis. As cyclin D1–CDK4/6 regulates multiple gene expressionthat is pivotal for apoptosis and self-renewal through E2F1transcriptional function (18), we further questioned whethercyclin D1–CDK4/6 regulates NANOG expression throughE2F1-mediated transcriptional function in CaSki SCP3 cells. Toaddress this, we generated a reporter construct involving theluciferase gene under the control of either a wild-type NANOGpromoter (WT-NANOG pro) or aNANOG promoter in which thetwo sites of E2F1-binding elements have been mutated (E1 Mut-NANOG pro, E2 Mut-NANOG pro, and E1,E2 Mut-NANOGpro; Fig. 4B). Luciferase assay displayed that luciferase expressionfrom WT-NANOG pro was significantly more robust in CaSki-SCP3 cells than in CaSki-no insert cells, and the increased levelswere reversed upon cyclin D1 silencing. Importantly, among theCaSki-SCP3 cells, the expression of luciferase stronger from WT-NANOG pro was more than that from E1 Mut-NANOG pro, E2Mut-NANOGpro, or E1,E2Mut-NANOGpro (Fig. 4C). In turn,weperformed a chromatin immunoprecipitation (ChIP) assay usinganti-E2F1 or anti-pRB antibody to confirm the finding that SCP3regulates E2F1binding or E2F1–pRB interactionwith theNANOGpromoter via the cyclinD1–CDK4/6 axis. ChIP-qPCR showed thatSCP3 expression caused loss of pRB occupancy at the promoterregion ofNANOG, and this pRB occupancy was reversed by cyclinD1 knockdown (Fig. 4D). In contrast to this observation, therewas no change in E2F1 occupancy at theNANOGpromoter regionin siGFP-CaSki-SCP3 cells compared with siGFP-CaSki no insert

or siCCND1-CaSki SCP3 cells (Fig. 4D), suggesting that SCP3regulates the E2F1–pRB interaction with the NANOG promotervia cyclin D1–CDK4/6. Consistently, siE2F1-treated CaSki SCP3cells showed decrease more than three times in NANOG proteinand mRNA expression compared with control (Fig. 4E and F).Taken together, our data demonstrate that SCP3 upregulatesNANOG transcription in an E2F1-dependent manner via theCDK4/6–pRB axis.

Ectopic expression of SCP3 can activate the pAKT–cyclin D1–NANOG axis in zebrafish

Although SCP3 drives immune resistance and stem-like prop-erties through the pAKT–cyclin D1–NANOG pathway in a cancercell line, it is not clear whether SCP3 has a similar function innormal cells. Thus, we tested whether ectopic expression of SCP3activates the pAKT–cyclin D1–NANOG pathway in zebrafishembryo. For ectopic expression of SCP3, we first generatedrecombinant DNA constructs that express EGFP (hsp70:EGFP)alone or SCP3-EGFP fusion protein (hsp70: SCP3-EGFP) underthe control of HSP70 promoter (Fig. 5A). We next injectedrecombinant plasmid DNA encoding hsp70:EGFP or hsp70:SCP3-EGFP into one-cell stage of zebrafish embryos. Injectedembryos were heat-shocked at 22 hours postfertilization (hpf),and after a recovery period, they were fixed and labeled withantibodies against p-AKT (T308) and cyclin D1. Consistent withour in vitro results, embryos injected with SCP3-EGFP showed anincreased number of phospho-AKT–expressing cells comparedwith the control embryos injected with hsp70:EGFP (Fig. 5B). Wenext examined the expression of cyclin D1 using IHC with anti-cyclinD1antibody in these embryos and found that cyclinD1wasexpressed 5 timesmore in the embryos injectedwith hsp70:SCP3-EGFP compared with embryos injected with hsp70:EGFP (Fig. 5Cand D). To investigate the transcriptional control of NANOG bySCP3, we conducted FISH with a NANOG RNA probe in theembryos heatshocked after injection of hsp70:EGFP or hsp70:SCP3-EGFP. We found that NANOG mRNA expression wasobserved in SCP3-EGFP–expressing cells but not in EGFP-expres-sing cells (Fig. 5D). Taken together, these data indicate that ectopicexpression of SCP3 can activate the pAKT–cyclin D1–NANOGpathway in the zebrafish embryos.

The SCP3–pAKT–cyclin D1–NANOG axis in tumor cellscorrelates with the stage and prognosis of cervical cancer

We have previously reported that high expression of SCP3,pAKT, or NANOG was correlated with poor prognosis of cervicalcarcinoma (7, 27). Here, we evaluated cyclin D1 expression byIHC in the same patient population and further analyzed itsrelationship with SCP3, pAKT, or NANOG in the developmentand progression of cervical cancer. For this analysis, we reeval-uated NANOG and SCP3 protein expression using VISv6.5.0.2303 (Visiopharm; Supplementary Table S1). Cyclin D1expression was increased during tumor progression from normaltissue to cancer (P < 0.001, Fig. 6A). Furthermore, the correlationbetween expressions of SCP3 and pAKT, cyclin D1, or NANOGwas assessed in cervical neoplasia specimens. SCP3 expressionwas positively correlated with the expression of pAKT, cyclin D1,or NANOG (c2; P ¼ 0.018, P ¼ 0.023, and P ¼ 0.003,respectively; Fig. 6B). We next examined the relationship of eachprotein expression with patient's survival outcomes. Kaplan–Meier plots demonstrated that patients with combined SCP3þ/cyclin D1þ/NANOGþ and SCP3þ/pAKTþ/cyclin D1þ/NANOGþ

Oh et al.





expression showed significantly worse overall survival (meansurvival time; 108 months vs. 166 months, P ¼ 0.005 and 93months vs. 165 months, P ¼ 0.001, respectively) than the otherpatients (Fig. 6C). The Cox proportional hazards model revealedthat a combination of high SCP3, pAKT, cyclin D1, and NANOGexpression was a positive independent positive prognostic factorfor overall survival [HR ¼ 7.58 (2.36–24.36), P ¼ 0.001; Sup-plementary Table S2]. These results suggest that SCP3-pAKT-cyclin D1-NANOG expression is correlated, and the SCP3 axishas a prognostic value in cervical cancer patients.

The SCP3–pAKT–cyclin D1–NANOG axis is conserved acrossvarious human cancer types

Wenext decided to confirm the presence of the SCP3 axis acrossmultiple human cancer cell lines. Prior to that, we establishedanother immunoedited P3 model using MART-1þ MDA-MB-231cells (termed MDA-MB-231 P0 cells) through 3 rounds of in vivoselection with an adoptive transfer of human MART-1–specificCTLs (clone KKM; ref. 33). We found a positive correlationbetween SCP3 and NANOG expression (Supplementary Fig.S4A and S4B). To investigate the phenotypic effects of the

Figure 4.

SCP3 transcriptionally upregulatesNANOG expression via the cyclinD1–CDK4/6–E2F1 axis. A, C, and D,CaSki-no insert or CaSki-SCP3 cellswere transfected with siGFP orsiCCND1. A, NANOG mRNA expressionwas analyzed by qRT-PCR. B, Diagramof the NANOG promoter regioncontaining the E2F1-binding element. Inthe mutant construct, the guanineresidues in the E2F1-binding site werereplaced with adenine residues toreduce E2F1 binding. Indicated arrowspresent the ChIP amplicon. C, Left,diagram of plasmids encoding wild-type (WT), E1 mutant (E1 Mut), E2mutant (E2 Mut), E1 and E2 mutant (E1,E2mutant)NANOGpromoter (nt�1419toþ159) cloned into pGL3 basic vectorcontaining the luciferase gene. Right,luciferase enxymatic assay in CaSki-noinsert-siGFP, CaSki-SCP3-siGFP, orCaSki-SCP3-siCCND1 transfected withthe indicated plasmid. D, Relativeoccupancy of E2F1 and pRB in theNANOG promoters was assessed byqChIP analysis. TheChIPdata representIP values for each region's relative ratioto the input. E and F, CaSki-SCP3 cellswere transfected with siRNA-targetingGFP or E2F1. E,Western blot analysis ofthe expression of E2F1 and NANOG.b-Actin was used as an internal loadingcontrol. Numbers below blots indicatethe expression as measured by foldchange. F, Quantitative RT-PCRanalysis of NANOG mRNA expression.A, C, D, and F, Graphs represent threeindependent experiments performed intriplicate. Error bars, mean� SD; n¼ 3.� , P < 0.01; N.S., nonsignificant.






SCP3–NANOG axis in different types of cancer, we selected sixrepresentative cells, SCP3high cells; HCT116, 526mel, and MDA-MB-231 P3 and SCP3low cells; HEK293, A375, andMDA-MB-231P0 and performed biochemical and functional assays. Knock-

down of SCP3 substantially decreased the expression of the SCP3axis signature molecules, such as p-AKT, cyclin D1, p-pRB,NANOG, MCL-1, and cyclin A, but it increased the expression ofp21 across all tested lines (Supplementary Fig. S4C). Consistently,

Figure 5.

Ectopic expression of hSCP3 increases phosphorylated AKT, cyclin D1, and NANOG expression in zebrafish. A, Diagram of the expression vector; hsp70:EGFP andhsp70:SCP3-EGFP. B–D, All images are lateral views of the spinal cord of zebrafish embryo, with anterior to the left and dorsal to the top. B, Whole-mountimmunofluorescence with anti-p-AKT (T308) in EGFP- or SCP3-EGFP–expressing zebrafish embryo. Scale bar, 20 mm. Graph represents quantification of thenumber of p-AKT(T308)þEGFPþ cells (P < 0.05, n ¼ 6). C, Whole-mount immunofluorescence of 30 hpf EGFP- or SCP3-EGFP–expressing zebrafish embryowith anti-cyclin D1. Bottom, high magnification images of the boxed areas in top panels. Scale bar, 50 mm. Graph represents quantification of the number of cyclinD1þEGFPþ cells (P < 0.01, n ¼ 7). D, Whole-mount FISH of 24 hpf EGFP- or SCP3-EGFP–expressing zebrafish embryo with nanog RNA probe. Bottom, highmagnification images of the boxed areas in top panels. Scale bar, 50 mm. Graph represents quantification of the number of nanogþ EGFPþ cells (P < 0.005, n¼ 5). Allarrows indicate double-positive cells. � , P < 0.01; �� , P < 0.005.

Oh et al.





Figure 6.

The SCP3–pAKT–cyclin D1–NANOG axis in tumor cells correlates with the stage and prognosis of cervical cancer. A, IHC staining of cyclin D1 was performedon a tissue microarray. High magnification images are shown in inset. Scale bar, 250 mm. CIN, cervival intraepithelial neoplasia; LG-CIN, low-grade CIN;HG-CIN, high-grade CIN.B, SCP3 score values were comparedwith pAKT, cyclin D1, and NANOG values using c2 test. SCP3 expressionwas positively correlated withpAKT, cyclin D1, or NANOG expression (c2 test; P¼ 0.018, P¼ 0.023, and P¼ 0.003, respectively). C, Patients with combined SCP3þ/pAKTþ/cyclin D1þ/NANOGþ

expression showed significantly worse overall survival (mean survival time; 93 months, P ¼ 0.001) than patients with SCP3�, pAKT�, cyclin D1�, or NANOG�

expression (mean 165 months). Cut-off values of SCP3, pAKT, cyclin D1, and NANOG were 181, 194, 59, and 160, respectively.






the siSCP3-treated tumor cells were more susceptible to CTLkilling and dampened sphere-forming capacity compared withsiGFP-treated tumor cells (Supplementary Fig. S4D and S4E).Conversely, ectopic expression of SCP3 in SCP3low cells success-fully reproduced the expression tendency of the relatedmoleculesas well as the immune-resistant and stem-like phenotype (Sup-plementary Fig. S4F–S4H). Altogether, these findings establishthat functional properties of the SCP3–pAKT–cyclinD1–NANOGaxis are conserved across multiple types of cancer.

Inhibition of cyclin D1–CDK4/6 leads to sensitization of animmune-refractory tumor in a preclinical cancer model

Although data presented in this study demonstrate that target-ing of the SCP3 axis could be a promising approach for reversingimmune-refractory properties of cancer, pharmacologic inhibi-tors of SCP3 are yet to be developed. Small-molecule inhibitors ofCDK4/6, a main inter-mediator of the SCP3-NANOG cascade,such as palbociclib (PD0332991), have been used for treatingcancer patients (19–21). Therefore, to address the clinical appli-cability of palbociclib for controlling SCP3high immune-refractorycancer, we first measured the viability of CaSki-SCP3 cells after invitro treatmentwithpalbociclib.Wealsoused cisplatin as a controlfor non-SCP3–dependent cancer drug. Interestingly, palbociclibwas relatively more effective in CaSki-SCP3 cells than in CaSki-noinsert cells, indicating that SCP3 could be a cause of sensitizationto palbociclib. In contrast, the conventional drug cisplatin dis-played opposite phenomena (Supplementary Fig. S5A and S5B).Consistently, CaSki P3 cells with SCP3high were also sensitive topalbociclib compared with CaSki P0 cells (Supplementary Fig.S5C). These data suggest that targeting cyclin D1-CDK4/6 couldreverse the SCP3-mediated multiaggressive phenotypes.

We further evaluated the preclinical therapeutic value of target-ing cyclin D1–CDK4/6 using the immunoedited breast cancermodel, MDA-MB-231 P3. The phenotypic and molecular signa-ture properties of MDA-MB-231 P3 cells were consistent withthose of CaSki P3 cells (Supplementary Fig. S4C–S4E), andMDA-MB-231 P3 cells were more susceptible to palbociclib than MDA-MB-231 P0 cells, and palbociclib sensitivity in MDA-MB-231 P3cells was reduced by knockdown of SCP3 (Fig. 7A). We nextinoculated MDA-MB-231 P3 cells into NOD/SCID mice, and 7days later, we administered by gavage palbociclib or vehicle byoral gavage for three days. Ten days after tumor challenge, micereceived MART-1–specific CTLs in accordance with the scheduledescribed in Fig. 7B. Treatmentwith palbociclib showed a remark-able therapeutic effect, and, when combined with adoptive trans-fer, the tumor was highly smaller in terms of size and weight thanthe tumor receiving either treatment alone (Fig. 7C–E). Impor-tantly, 100% of mice that were treated with both palbociclib andadoptive transfer survived, even 60 days after tumor challenge; incontrast, all animals in the other groups had died by then (Fig.7D). In agreement with the in vitro results of this study, we foundreduced expressions of p-pRB, NANOG, MCL-1, and cyclin A,along with elevated expression of p21 without alteration of cyclinD1-CDK4/6 upstreammolecules, such as SCP3, p-AKT, and cyclinD1after palbociclib treatment (Fig. 7F).Wenext examinedMART-1–specific CTLs infiltration into the tumor through CFSE-labeledCTLs prior to adoptive transfer, and assessed the frequency ofCFSEþ cells inside the tumor following transfer. Palbociclib-treated mice showed no statistically significant differences fromvehicle-treatedmice (Fig. 7G). However, the CTLs-mediated cyto-toxic effect, which indicated the percentage of apoptotic tumor

cells, was more exceptional after palbociclib treatment than aftervehicle treatment (Fig. 7H). Interestingly, there was no differencein the CTL-mediated cytotoxic effect inmice administered vehiclewith or without adoptive transfer, suggesting that MDA-MB-231P3 cellswere resistant to immune-mediated control because of thepresence of the SCP3–NANOGaxis (Fig. 7H). Taken together, ourdata demonstrate that inhibition of cyclinD1–CDK4/6 representsan attractive, extensively available strategy for the control ofSCP3high intractable human cancer, either as a sole modality orsynergistically, as part of an immune-based therapy.

DiscussionEmergence of a stem-like state in the tumor and adaptation to

host immune defenses have become determined as hallmarks ofcancer, accountable in large part for disease progression and recur-rence in patients (40). Thus, future cancer therapy should aim toovercome both of these major obstacles. Currently, however, themolecular cues that bring about either a stem-like state or immuneadaptation remain wrapped in mystery (38). We recently demon-strated thatCTL-mediated immune selectiondrives the evolutionoftumor cells toward a stem-like state and that the stem-like statearises via NANOG, which is a master transcription factor thatinduces highly refractory cells that are present in diverse tumortypes and play a central role in tumorigenesis, malignant progres-sion, and resistance to conventional therapies (41). Thus, strategiesthat incapacitate NANOG could overcome multiaggressive prop-erties of relapsed or refractory cancer cells, such as immunoeditedtumor cells. In this study, to discover clinically actionable pharma-cologic agents for NANOG targeting, we research the regulatorymechanism of NANOG. As a result of our efforts, we found thatSCP3, as a novel upstream regulator of NANOG, has unprecedent-ed biological functions in hyperactivating cyclin D1–CDK4/6throughpAKT, thereby upregulatingNANOG; this confirmsSCP30srole in driving NANOG-dependent cancer refractoriness by influ-encing a major molecular defect in the disease. This mechanismrepresents a conceivable tumor-targeting strategy.

On the basis of our screen of a panel of human cancer lines,SCP3 overexpression is quite common of human cancer and thebiochemical and functional properties of SCP3–pAKT–cyclinD1–CDK4/6–NANOG signaling axis conserved across multipletype of cancer (Supplementary Fig. S4). Notably, consistent withour previous reports (27–29), our results in Fig. 6 clearly dem-onstrate that about 61.4% cervical cancers are positive for SCP3,and SCP3 overexpression was positively correlated with AKTactivation, cyclin D1, and NANOG expression. The SCP3 molec-ular axis is significantly correlated with the progression of cervicalcarcinogenesis from low-grade CIN to high-grade CIN to cancer(Supplementary Table S1, P < 0.001), and increases according toseverity of cervical lesions. Moreover, the degree of the SCP3molecular axis is correlatedwith advanced disease stage andworseprognosis in patients. These finding demonstrate that SCP3 over-expression could partially account for NANOG overexpression invarious cancer types and provide important insights into themechanisms underlying pAKT–cyclin D1–CDK4/6 pathwayderegulation in various cancer types.

As the SCP3 axis has been implied as a central channel for thedevelopment of NANOG-dependent multiaggressive phenotypesin various relapsed or refractory cancer cells, including immu-noedited tumor cells, the SCP3 axis could be an actionable targetto incapacitateNANOG-dependent cancer refractoriness.Of these


Oh et al.




Figure 7.

Inhibition of CDK4/6 leads to sensitization of an immune-refractory tumor in a preclinical cancer model. A, MDA-MB-231 P0 and P3 cells were transfectedwith siGFP or siSCP3. After 16 hours, cells were treated with the indicated concentration of palbociclib or cisplatin for 48 hours. Cell viability was measured by livecell counting using Trypan blue. B, Schematic of the therapy regimen in mice implanted with MDA-MB-231 P3 cells. Tumor growth (C) and survival (D) of miceinoculated with MDA-MB-231 P3 cells treated with the indicated reagents (5 mice/group). E, Tumor mass in mice at 25 days after challenge. F, Western blotanalysis of SCP3, pAKT, cyclin D1- p-pRB, NANOG, MCL-1, cyclin A, cyclin D1, and p21 expression in mice administered vehicle or palbociclib, with or withoutadoptive transfer of MART-1–specific CTLs. G, Flow cytometry analysis of the frequency of CFSE-labeled MART-1–specific CTLs in the tumors of mice that receivedadoptive transfer.H, The frequency of apoptotic cells in the tumors of vehicle- or palbociclib-treatedmice, with or without adoptive transfer of MART-1–specific CTL.Error bars, mean � SD; n ¼ 5. � , P < 0.01; �� , P < 0.005; �� , P < 0.001. N.S., nonsignificant.






targets, accumulating reports have demonstrated that CDK4/6targeting can eradicate chemo- or radioresistant CSC-like tumorcells that is hyperactivated the pAKT–cyclin D1–CDK4/6 pathway(22–24). However, in the case of immunotherapy, there has beenno reported use of the inhibitor. Indeed, recently, a literatureproposed the possibility of combination of CDK4/6 inhibitorswith T-cell–based immunotherapy by preservation of T cells thatcan be stimulated with existing immune checkpoint inhibitors(42). As demonstrated in this study, targetingCDK4/6 could be aneffective strategy to control immunoedited tumor cells, and alsothe one that has provided a strong rationale for targeting ofSCP3high or NANOGhigh CSC-like refractory cancer cells.

On the basis of the finding of early-phase trials, three CDK4/6inhibitors, such as abemaciclib, ribociclib, and palbociclib, haveemerged as agents with promising anticancer activity and man-ageable toxicity;/a phase III trial of each drug is currently inprogress. Of these agents, palbociclib has advanced furthesttowards the clinic, having acquired accelerated approval from theFDA in 2015, with crucial phase III data available in the case ofhormone receptor-positive, advanced-stage breast cancer, a dis-ease in which signaling of the cyclin D1–CDK4/6 axis is known tobe critical. However, enlarging the application of palbociclibbeyond ER-positive breast cancer is challenging, and will likelyneed biomarkers that predict a clinical response, and the appli-cation of combination therapies so as to optimize CDK4/6targeting (43). Interestingly, our findings also facilitate a deeperunderstanding of the recent literature. In our study, palbociclibinhibited tumor growth in xenograft of the SCP3high immune-refractory breast tumor bearingmice and prolonged their survival.Tumor sample analysis indicated that palbociclib ablated theNANOG expression levels. Notably, a combination of palbociclibwith adoptive transfer of CTLs resulted in robust antitumor effectsand survival benefits against SCP3high immune-refractory tumorcells. Thus, these studies recapitulated the relationships amongSCP3, AKT, cyclin D1-CDK4/6, and NANOG in vivo. Takentogether, our data show that inhibition of CDK4/6 axis representsan attractive, widely applicable strategy for the control of variousSCP3high-refractory human cancer, either as a sole modality or,synergistically, as part of an immune-based therapy.

There are a variety of causes that can activate cyclin D1–CDK4/6.Activating mutations in BRAF, KRAS, and/or, PIK3CA are well-known tumorigenic mechanisms and may predict response totreatment of cancer (12). It is known that human cancersbearing mutated those genes do not respond to conventionaltherapies well (12, 44, 45). Our data show that AKT pathwayhas a positive impact on cyclin D1–CDK4/6 activation. BecauseBRAF, KRAS, and PIK3CA are upstream regulator of this path-way, its mutations can activate AKT pathway to intensify cyclin

D1–CDK4/6 axis, which in turn upregulates NANOG expressionto cause therapeutic resistance and stem cell–like proliferativepotentials. Thus, worse prognosis with conventional therapies incancer harboring BRAF, KRAS, and PIK3CAmutation can, at leastin part, be due to hyperactivation of AKT–cyclin D1–CDK4/6–NANOG axis. Taken together, the hyperactivation of this axiscaused by upregulation of SCP3 or BRAF, KRAS, and PIK3CAmutation could lead to acquisition of resistance to conventionalcancer therapies. Consequently, the SCP3 axis could be used as apredictor for prognosis.

In this study, we identified that SCP3þ tumor cells enriched byimmune selection confer preferential NANOG expression via theAKT-cyclin D1–CDK4/6–E2F1 axis (Supplementary Fig. S6). Inthis process, theSCP3axis inducesNANOG-drivenmultiaggressivephenotypes. Despite its pivotal role in promoting NANOG-drivenmultiaggressive features, the SCP3 axis also plays the key role of avulnerability factor by acting as the Achilles' heel, potentiallyleading to the decline of tumors, if it is selectively targeted.Therefore, blockade of the SCP3 axis using CDK4/6 inhibitorscould be a promising therapeutic approach and an actionablestrategy for controlling SCP3high relapsed or refractory cancer.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: S.J. Oh, K.H. Noh, K.-H. Song, H.-C. Park, T.W. KimDevelopment of methodology: S.J. Oh, K.H. Noh, H.-J. Lee, H.-C. Park,T.W. KimAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): S.J. Oh, H. Cho, S. Kim, C.H. Choi, J.-Y. Chung,S.M. Hewitt, J.-H. KimAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): S.J. Oh, H. Cho, K.-H. Song, S.R. Woo, S. Kim,C.H. Choi, J.-Y. Chung, S.M. Hewitt, J.-H. Kim, T.W. KimWriting, review, and/or revision of the manuscript: S.J. Oh, H. Cho, S. Kim,S. Kim, J.-Y. Chung, S.M. Hewitt, K.-M. Lee, C. Yee, T.W. KimAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): S.J. Oh, H.-J. Lee, S. Kim, S. Baek, T.W. KimStudy supervision: J.-H. Kim, T.W. Kim

AcknowledgmentsThis workwas supported by funding from theNational Research Foundation

of Korea (2013M3A9D3045881 and 2017R1A2A1A17069818 to T.W. Kim).

The costs of publication of this article were defrayed in part by the paymentof page charges. This article must therefore be hereby marked advertisementin accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received August 1, 2017; revised December 27, 2017; accepted February 2,2018; published first February 6, 2018.

References1. Yang Y. Cancer immunotherapy: harnessing the immune system to battle

cancer. J Clin Invest 2015;125:3335–7.2. Perica K, Varela JC, OelkeM, Schneck J. Adoptive T cell immunotherapy for

cancer. Rambam Maimonides Med J 2015;6:e0004.3. Sharma P, Hu-Lieskovan S, Wargo JA, Ribas A. Primary, adaptive, and

acquired resistance to cancer immunotherapy. Cell 2017;168:707–23.4. Gajewski TF, Meng Y, Blank C, Brown I, Kacha A, Kline J, et al. Immune

resistance orchestrated by the tumor microenvironment. Immunol Rev2006;213:131–45.

5. Ribas A. Adaptive immune resistance: how cancer protects from immuneattack. Cancer Discov 2015;5:915–9.

6. Schreiber RD, Old LJ, Smyth MJ. Cancer immunoediting: integrating immu-nity's roles in cancer suppression and promotion. Science 2011;331:1565–70.

7. Noh KH, Kim BW, Song KH, ChoH, Lee YH, Kim JH, et al. Nanog signalingin cancer promotes stem-like phenotype and immune evasion. J Clin Invest2012;122:4077–93.

8. Noh KH, Lee YH, Jeon JH, Kang TH, Mao CP, Wu TC, et al. Cancervaccination drives Nanog-dependent evolution of tumor cells toward animmune-resistant and stem-like phenotype. Cancer Res 2012;72:1717–27.

9. Schurch C, Riether C, AmreinMA, Ochsenbein AF. Cytotoxic T cells induceproliferation of chronic myeloid leukemia stem cells by secreting interfer-on-gamma. J Exp Med 2013;210:605–21.

Oh et al.





10. Akalay I, Janji B, Hasmim M, Noman MZ, Andre F, De Cremoux P, et al.Epithelial-to-mesenchymal transition and autophagy induction in breastcarcinoma promote escape from T-cell-mediated lysis. Cancer Res 2013;73:2418–27.

11. Lee HJ, Noh KH, Lee YH, Song KH, Oh SJ, Kim SY, et al. NANOG signalingpromotes metastatic capability of immunoedited tumor cells. Clin ExpMetastasis 2015;32:429–39.

12. Fleuren ED, Zhang L,Wu J, Daly RJ. The kinome `at large' in cancer. Nat RevCancer 2016;16:83–98.

13. Engelman JA, Luo J, Cantley LC. The evolution of phosphatidylinositol 3-kinases as regulators of growth and metabolism. Nat Rev Genet 2006;7:606–19.

14. Hanker AB, Pfefferle AD, Balko JM, Kuba MG, Young CD, Sanchez V, et al.Mutant PIK3CA accelerates HER2-driven transgenicmammary tumors andinduces resistance to combinations of anti-HER2 therapies. Proc Natl AcadSci U S A 2013;110:14372–7.

15. Katso R,OkkenhaugK, AhmadiK,White S, Timms J,WaterfieldMD.Cellularfunction of phosphoinositide 3-kinases: implications for development,homeostasis, and cancer. Annu Rev Cell Dev Biol 2001;17:615–75.

16. Miller TW, Hennessy BT, Gonzalez-Angulo AM, Fox EM,Mills GB, ChenH,et al. Hyperactivation of phosphatidylinositol-3 kinase promotes escapefrom hormone dependence in estrogen receptor-positive human breastcancer. J Clin Invest 2010;120:2406–13.

17. Wang LE, Ma H, Hale KS, Yin M, Meyer LA, Liu H, et al. Roles of geneticvariants in the PI3K andRAS/RAFpathways in susceptibility to endometrialcancer and clinical outcomes. J Cancer Res Clin Oncol 2012;138:377–85.

18. Musgrove EA, Caldon CE, Barraclough J, Stone A, Sutherland RL. Cyclin Das a therapeutic target in cancer. Nat Rev Cancer 2011;11:558–72.

19. Ozaki A, Tanimoto T, Saji S. Palbociclib in hormone-receptor-positiveadvanced breast cancer. N Engl J Med 2015;373:1672–3.

20. Walker AJ,WedamS, Amiri-Kordestani L, Bloomquist E, Tang S, Sridhara R,et al. FDA approval of palbociclib in combination with fulvestrant for thetreatment of hormone receptor-positive, HER2-negative metastatic breastcancer. Clin Cancer Res 2016;22:4968–72.

21. Finn RS, Martin M, Rugo HS, Jones S, Im SA, Gelmon K, et al. Palbocicliband letrozole in advanced breast cancer. N Engl J Med 2016;375:1925–36.

22. Shimura T, Noma N, Oikawa T, Ochiai Y, Kakuda S, Kuwahara Y, et al.Activation of the AKT/Cyclin D1/Cdk4 survival signaling pathway inradioresistant cancer stem cells. Oncogenesis 2012;1:e12.

23. Vora SR, Juric D, Kim N, Mino-Kenudson M, Huynh T, Costa C, et al. CDK4/6 inhibitors sensitize PIK3CA mutant breast cancer to PI3K inhibitors.Cancer Cell 2014;26:136–49.

24. Goel S, Wang Q,Watt AC, Tolaney SM, Dillon DA, Li W, et al. Overcomingtherapeutic resistance in HER2-positive breast cancers with CDK4/6 inhi-bitors. Cancer Cell 2016;29:255–69.

25. Gross S, Rahal R, Stransky N, Lengauer C, Hoeflich KP. Targeting cancerwith kinase inhibitors. J Clin Invest 2015;125:1780–9.

26. Yuan L, Liu JG, Zhao J, Brundell E, Daneholt B, Hoog C. The murine SCP3gene is required for synaptonemal complex assembly, chromosome syn-apsis, and male fertility. Mol Cell 2000;5:73–83.

27. Cho H, Noh KH, Chung JY, Takikita M, Chung EJ, Kim BW, et al. Synap-tonemal complex protein 3 is a prognostic marker in cervical cancer. PLoSOne 2014;9:e98712.

28. KitanoH,Chung JY,NohKH, Lee YH, KimTW, Lee SH, et al. Synaptonemalcomplex protein 3 is associated with lymphangiogenesis in non-small celllung cancer patients with lymph node metastasis. J Transl Med 2017;15:138.

29. Chung JY, Kitano H, Takikita M, Cho H, Noh KH, Kim TW, et al. Synapto-nemal complex protein 3 as a novel prognostic marker in early stage non-small cell lung cancer. Hum Pathol 2013;44:472–9.

30. Kang TH, Noh KH, Kim JH, Bae HC, Lin KY, Monie A, et al. Ectopicexpression of X-linked lymphocyte-regulated protein pM1 renders tumorcells resistant to antitumor immunity. Cancer Res 2010;70:3062–70.

31. Niwa H, Ogawa K, Shimosato D, Adachi K. A parallel circuit of LIFsignalling pathways maintains pluripotency of mouse ES cells. Nature2009;460:118–22.

32. Lee YH, Bae HC, Noh KH, Song KH, Ye SK, Mao CP, et al. Gain of HIF-1alpha under normoxia in cancer mediates immune adaptation throughthe AKT/ERK and VEGFA axes. Clin Cancer Res 2015;21:1438–46.

33. Song KH, Choi CH, Lee HJ, Oh SJ, Woo SR, Hong SO, et al. HDAC1upregulation by NANOG promotes multidrug resistance and a stem-like phenotype in immune edited tumor cells. Cancer Res 2017;77:5039–53.

34. Noh KH, Kang TH, Kim JH, Pai SI, Lin KY, Hung CF, et al. Activation of Aktas a mechanism for tumor immune evasion. Mol Ther 2009;17:439–47.

35. Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS,et al. The Tol2kit: a multisite gateway-based construction kit for Tol2transposon transgenesis constructs. Dev Dyn 2007;236:3088–99.

36. Brend T, Holley SA. Zebrafish whole mount high-resolution doublefluorescent in situ hybridization. J Vis Exp 2009;25. doi: 10.3791/1229.

37. Lee MS, Jeong MH, Lee HW, Han HJ, Ko A, Hewitt SM, et al. PI3K/AKTactivation induces PTEN ubiquitination and destabilization acceleratingtumourigenesis. Nat Commun 2015;6:7769.

38. Mao CP, Wu T, Song KH, Kim TW. Immune-mediated tumor evolution:Nanog links the emergence of a stem like cancer cell state and immuneevasion. Oncoimmunology 2014;3:e947871.

39. Baker GL, Landis MW, Hinds PW. Multiple functions of D-type cyclins canantagonize pRb-mediated suppression of proliferation. Cell Cycle 2005;4:330–8.

40. Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. Cell2011;144:646–74.

41. Chen CL, Uthaya KumarDB, Punj V, Xu J, Sher L, Tahara SM, et al. NANOGmetabolically reprograms tumor-initiating stem-like cells through tumor-igenic changes in oxidative phosphorylation and fatty acid metabolism.Cell Metab 2016;23:206–19.

42. Kalu NN, Johnson FM. Do CDK4/6 inhibitors have potential as targetedtherapeutics for squamous cell cancers? Expert Opin Investig Drugs2017;26:207–17.

43. O'Leary B, Finn RS, Turner NC. Treating cancer with selective CDK4/6inhibitors. Nat Rev Clin Oncol 2016;13:417–30.

44. Holderfield M, Deuker MM, McCormick F, McMahon M. Targeting RAFkinases for cancer therapy: BRAF-mutatedmelanoma and beyond. Nat RevCancer 2014;14:455–67.

45. Misale S, Di Nicolantonio F, Sartore-Bianchi A, Siena S, Bardelli A.Resistance to anti-EGFR therapy in colorectal cancer: from heterogeneityto convergent evolution. Cancer Discov 2014;4:1269–80.






Correction

Correction: Targeting Cyclin D-CDK4/6Sensitizes Immune-refractory Cancer byBlocking the SCP3-NANOG AxisIn the original version of this article (1), labels are missing for Fig. 1A and B. Figure 1now has the appropriate labels. This error has been corrected in the recent onlineHTML and PDF versions of the article. The authors regret this error.

Reference1. Oh SJ, Cho H, Kim S, Noh KH, Song K, Lee H, et al. Targeting Cyclin D-CDK4/6 sensitizes immune-

refractory cancer by blocking the SCP3-NANOG axis. Cancer Res 2018;78:2638–53.

Published online July 16, 2018.doi: 10.1158/0008-5472.CAN-18-1671�2018 American Association for Cancer Research.

CancerResearch

Cancer Res; 78(14) July 15, 20184098

http://crossmark.crossref.org/dialog/?doi=10.1158/0008-5472.CAN-18-1671&domain=pdf&date_stamp=2018-6-28

2018;78:2638-2653. Published OnlineFirst February 6, 2018.Cancer Res Se Jin Oh, Hanbyoul Cho, Suhyun Kim, et al.

NANOG Axis−by Blocking the SCP3 Targeting Cyclin D-CDK4/6 Sensitizes Immune-Refractory Cancer

Updated version

10.1158/0008-5472.CAN-17-2325doi:

Access the most recent version of this article at:

Material

Supplementary

http://cancerres.aacrjournals.org/content/suppl/2018/02/06/0008-5472.CAN-17-2325.DC1 http://cancerres.aacrjournals.org/content/suppl/2018/04/05/0008-5472.CAN-17-2325.DC2

Access the most recent supplemental material at:

Cited articles

http://cancerres.aacrjournals.org/content/78/10/2638.full#ref-list-1

This article cites 44 articles, 11 of which you can access for free at:

Citing articles

http://cancerres.aacrjournals.org/content/78/10/2638.full#related-urls

This article has been cited by 2 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/78/10/2638To request permission to re-use all or part of this article, use this link



http://cancerres.aacrjournals.org/lookup/doi/10.1158/0008-5472.CAN-17-2325

http://cancerres.aacrjournals.org/content/suppl/2018/04/05/0008-5472.CAN-17-2325.DC2

http://cancerres.aacrjournals.org/content/suppl/2018/02/06/0008-5472.CAN-17-2325.DC1

http://cancerres.aacrjournals.org/content/78/10/2638.full#ref-list-1

http://cancerres.aacrjournals.org/content/78/10/2638.full#related-urls

http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://cancerres.aacrjournals.org/content/78/10/2638


targeting cyclin d-cdk4/6 sensitizes immune-refractory...

Documents