team conoscenza bioinformatics tan jian wei ~ tan fengnan

Team ConoscenzaBioinformatics

Tan Jian Wei ~ Tan Fengnan

Presentation FlowBackgroundProblemSolutionTechnical DifficultiesMilestonesQuestions

Background

Technical Difficulties Milestones Questions

Background Problem Solution

Human Genome Project◦Began 1990 – Ended at 2004◦Mapped out all of the Human

Genome Sequences◦20,000 – 25,000 “working” gene◦3.3 Billion base pairs

Adenine, Thymine, Guanine, CytosineThe base pairs will form proteins or

hormones after a process known as “Transcription”

Background Part 2



Why do we want to do that?◦We don’t actually know what this particular

gene does.• Useful gene denotes a functionality or a trait• By comparing with isolated protein, we can

find out where is exactly these genes are and does.• Example: Insulin

Insulin -> isolated from human Do a base pair match against a genome database

of a plant Find out whether the plant can be candidate to

produce a insulin substitute

Background Part 3



How do we do this?◦United States National Center For

Bioinformatics Information◦BLAST (Basic Local Alignment

Sequencing Tool)

Background Part 4



AACGTTTCCAGTCCAAATAGCTAGGC===--=== =-===-==-====== AACCGTTC TACAATTACCTAGGC

Hits(+1): 18Misses (-2): 5Gaps (existence -2, extension -1):

1 Length: 3Score = 18 * 1 + 5 * (-2) – 2 – 2 =

6

ProblemHow do we process the

information here?How do researchers make sense

out of it? E.g. 7000 recordsIs there a better way to use the

information here in a more aggregated context?

Can this information be shared among other users?



SolutionTo present the data in a way that

is relevant to the bio informatics context

Visualizing the data in a very intuitive way



Technical DifficultiesDeploying ex serverUnderstanding what the terms in

the data meanTransforming data into a useful

format for analysis◦Have to first analyze researchers’

difficulty



MilestonesWiki write up and proposalTesting current NCBI systemData cleaningBuilding Panopticon solutionDeploying EX Server



Questions



team conoscenza bioinformatics tan jian wei ~ tan fengnan

Documents