the amateur footballer rd15-16, 2014
DESCRIPTION
The Amateur Footballer rd15-16, 2014TRANSCRIPT
Amateur Footballerthe
9 AUGUSTSEASON 2014 99999999999999999999 9999999999999999999999999999999 AUAUAAUAUAUAUAUAUAUUAUAUAUAUAAUAUAUAUAAUAUAUUAUAUAAUAUAAUAUUUUUUGUGUGUGUGGUGUGUUGUGUGUGGUGUGUGUUUGGUGUGUGUUGUUUGGUUGG STSSTSSSTSTSTTSTTSSSSSSSSSSTSTSSTSSSSSSSTT999999999999999999999999999999999999999999999999999 AUAUAAUAAUAUAUAUAUAAAUAUAAAAAAUAAUAUAAAAAAAAUAAAAA GGUGGGGGUGUGUGUGGGGGGUUUUGUGUGGGUGGUGUUGUGGGUGGUGUUG SSSTSSTSSTTSTSTSSSTSSSTTTSSSSTSSTSSSSSSSSSSSSESESESSESSSSESESESSESSSESESSESSSSSSESSSSSSSEEASASASASASASASASASASASASASSASASASASSASASASSASASASSASSASSASASONONONONONONONONONONONNNONONONONOONONONONOONONONOOOONONOONONOONOONNON 222222222222222222222222222222222201001010010010101000100100100001000110000001000000000100 4444444444444444444444444444SESSESSSESESSESESSESEESESSSSESSESSSSESSESSSSSSS ASASAASASASSSASASASASASASASASAASASASASASASASAASSASASASSASSSSAA ONONOONOONONONONONOONOONONOONONONOONNONONOONONOONOOONONNNNNN 222222222222222222222222222222222222010101010010101001001010101000100101010010001001010000110 4444444444444444444444444444444
VIEVIEVIEVIEVIEVIEIIVVV W MW MWWWW OREOREREROREORER PHPHPHPHHPHHPHOTOTOTOTOOTOOOO S OOOOOF LF LF LLFF ASTASTASASTTTTASTT WWEWEEWEEK’EK’EKK’S AS S AAAACTION ON ININ THEEEE VVVAVAFA FA F IPAPAAIPAPAPAPAAD AD AD ADD APPPPPPPPPPP.P.P.P.P.PPP.
Everybody needs LifeCare
Ashburton Sports Medicine ph. 9885 8961
Malvern Sports Medicine ph. 9509 8844
Prahran Sports Medicine ph. 9529 8899
Croydon Sports Medicine ph. 9725 2444
Latrobe Sports Medicine ph. 9473 8780
LEADERS IN PHYSIOTHERAPY & SPORTS MEDICINE
Official VAFA Partner
Dr Stuart Down is a Specialist Sport & Exercise Medicine (SEM) Physician based at both LifeCare Prahran and LifeCare Ashburton Sports Medicine Centres. Stuart was granted a Fellowship of the Australasian College of Sports Medicine in 2008, obtaining the coveted College Medal for most outstanding graduate in doing so.
Stuart has accrued extensive experience in the provision of medical care for elite athletes over the past decade. Stuart has worked as Medical Officer for Cricket Victoria over the past 7 years, whilst he has also provided local and overseas coverage for the Australian men’s and women’s cricket team, AIS hockey, soccer and waterpolo teams, and has provided full season AFL team medical care at both TAC and VFL levels. He has covered major events including the Melbourne Commonwealth Games, FINA World Championships and UCI World Track Cycling.
Stuart has particular interest in acute musculoskeletal injury management and
knows the importance of early diagnosis, expedited and appropriate management, and liaison with team staff - in particular when dealing with high level athletes. He lectures to allied health groups and emergency departments about ‘easily and not to be missed’ musculoskeletal injuries. Having covered such an array of sports and events over many years, Stuart has extensive experience with all types of injuries and optimal management.
Working closely with several of Melbourne’s more highly regarded musculoskeletal radiologists and orthopaedic surgeons allows Stuart to readily discuss injury diagnosis and management options, and arrange surgery rapidly if required.
DR STUART DOWNVAFA PROFILE
1THE AMATEUR FOOTBALLER 2014
Perhaps like many of you, recent events happening
around our world have made me refl ect upon
how fortunate we are in Australia. This in turn has
caused me to refl ect upon community sporting
clubs and why we at the VAFA believe they are so
important.
I have long had a fi rm belief that the contribution
that community sporting clubs make to Australia
is undervalued, or if not undervalued, then
perhaps not properly understood. In particular,
our VAFA clubs.
Take the concept of amateurism at community
sporting level. One might understand amateurism
as being about players not being paid and playing
for the love of the game. Which of course it is. But
going deeper, amateurism is also about helping
to ensure that we preserve a voluntary sector
in society. At its essence, players not competing
for money means in fact that they are acting as
volunteers every time they run out to play, doing
something necessarily without the expectation of
something in return. I would argue that this is a
signifi cant contribution to our society.
Take the simple concept of people coming
together on a Saturday to watch a game, in
particular attending Saturday club lunches, which
are such an important part of our VAFA club
community. One might understand this coming
together as a great opportunity to catch up
with people, watch a game of local football, and
support your local club. Which of course it is. But
going deeper, coming along to a club lunch on a
weekend is where people meet each other face
to face in a large group environment and where
everyone is equal. Unlike the workplace, many of
the usual hierarchies do not exist. I would argue
that this is a signifi cant contribution to our society.
Even the prospect of a sporting club struggling
at community level and achieving little success
I would argue creates signifi cant benefi t for
our community. Many would defi ne success as
having a large club, with strong numbers, where
there are many volunteers and where there are
little struggles. Which of course is a defi nition
of success. But going deeper, there is also a real
quality in being involved in a sporting club where
things do not quite work as well as they should,
where there are no complex titles and ranks, and
where it is possible to still know everyone’s name
and things are kept at a very personal level. I
would argue that this is a signifi cant contribution
to our society.
I am reminded of a very good question that
was asked of me at last year’s AGM, where some
suggestions were made about improving the
tribunal system at the VAFA. Some valid ideas were
put forward about perhaps we could resource it
more, make it more professional, even bring in a
formal video review process. These were all valid
ideas, but I could not help but wonder whether we
would be better off retaining what we currently
have, where things do not work as perfect as they
might. Perhaps by retaining some imperfection,
we continue to build tolerance, resilience and
acceptance.
Governments and elite sporting organisations
in Australia do a lot of good things to help out
community sporting clubs in Australia. However,
there is a lot more that could be done, as we
should never take for granted how lucky we are
in Australia. Hopefully a greater understanding of
some of the hidden benefi ts that sporting clubs
at community level provide to our society, some
examples of which are set out above, will aid in our
quest for more to be done.
Th e Amateur FootballerTHE JOURNAL OF THE VICTORIAN AMATEUR FOOTBALL ASSOCIATION
August 09, 2014 $3.00 Vol. 14 No. 16
UNDERVALUED ORMISUNDERSTOOD?
Michael Hazell - VAFA PresidentED
ITOR
IAL
2 THE AMATEUR FOOTBALLER 2014
Andrew Leonard @ Lennytalk
WATCH EVERY PREMIER GAME AT WWW.VAFATV.COM
It’s the most uncomfortable of subjects, talking about the teams that are struggling to win the requisite number of games. Old Trinity is on a slippery slope. At present a season that has promised so much, is unraveling just as quickly as their whirlwind re-entry to Premier commenced. Four losses in a row, has seen their three game break on fourth spot evaporate and they could now miss the fi nals. At the other end of the spectrum, De La Salle failed by just seven points to fi nd themselves a game behind eighth placed Old Brighton. The Tonners have a trip to the Dairy Bell (Rd 16) ahead of them that could likely determine who will drop. However, we cannot rule out Beaumaris either. The Sharks are on a seven game losing streak, although a strong percentage is their salvation. St Bedes/Mentone Tigers are a proud club, but their seven years in Premier is coming to a close. A premiership and two runners-up eff orts have highlighted a fantastic stay. There is not a club in the VAFA that has more fun whilst still maintaining a respect of all teams for their prowess on the fi eld. The Tigers have Blacks and Xavs away in the next fortnight, whilst their best is capable of winning these types of matches, the reality of their form in 2014 suggests otherwise.
Old Xaverians’ defeat of University Blacks has Xavs as the form team of the comp on a fi ve game win streak. Arguments can be mounted that Xavs had more to play for, and Blacks were missing key players, however every Blacks player and their coach Cameron Roberts were all disappointed to lose this match. An inaccurate 2.10 in the fi rst term from Blacks was exacerbated by at least half of those behinds being rushed by Xavs defenders. The return of Brendan Goss for his fi rst game in Xavs colours this year was a highlight for both the red and black faithful and the neutral observer. His impact was immediate when he took a contested mark to open the scoring for Xavs. Goss ended the day with fi ve goals never leaving the forward arcs. Blacks, despite their omissions, had their chances to win the game closing the gap to just a kick in the last. However the manic tackling of Xavs meant Uni were always under either real or
perceived pressure, resulting in uncharacteristic errors. Tom Napier was a solid contributor for four quarters but he was one of the few to stamp his card each term. Xavs ultimately had more contributors for longer, Murphy Ambrose, Ben Kennedy and the return of Andy Biddlecombe all-important across the duration of the match.
De La Salle have a fantastic record against Collegians, particularly so at Harry Trott. That of course is irrelevant when they couldn’t win the one game they desperately would have wanted to win. De La controlled large swathes of this game, led at every change except the critical fi nal siren. David Lowe was a much-valued inclusion for De La and his waxing with Matt Fieldsend and Jacob Gotch was paying dividends in the middle. Adrian Indovino has been one De La’s better players this year and his second goal sent De La to a 20 point lead in the middle of the third. Collegians stepped it up a notch and Taft continued his great form in the forward line this year to boot two goals in a short period – he would fi nish with six goals – and Collegians trailed by a point at the last change. From there Collegians looked like winners but De La again fl oundered chances where as the Lions kicked theirs. Lindsay Apted’s improvement this year has been stark and his consistency was rewarded with three goals for the Lions.
Old Brighton pinched memorable away win at Old Trinity that only three weeks ago they had no right to even pencil in. The Tonners can call Dan Anthony ‘the diff erence’ whenever they meet the T’s next, as his six goals were telling in the upset win. Conversely the T’s couldn’t fi nd a winning forward. Weatherson is too often forced to lead up the ground leaving no one to come out of the goal square. Furthermore, Harry Tinney’s stellar year has potentially saved Old Trinity from this kind of rut earlier than now. Old Trinity started the superior team but the Tonners responded to work their way back into the contest and after quarter time were the better side for longer periods.
ELEPHANT IN THE ROOM
PREMIER — TIPS IN BOLD (YEARS TOTAL 47/67%)
Beaumaris v Old Trinity
De La Salle v Old Xaverians
Old Brighton v Old Scotch
St Bernard’s v Collegians
University Blacks v St Bedes/Mentone Tigers
PREM
IER
3THE AMATEUR FOOTBALLER 2014
This game could still have swung Old Trinity’s way. After a strong Anthony mark, an obscure umpiring decision allowed a defender standing a metre from Anthony, to tackle him as he began his approach, a decision which astonished everyone and very nearly swung the momentum of the game. Trinity raced the ball forward and goaled. Nevertheless Old Brighton responded, Marcel Bruin and Matt Gadsen were also prominent in a win that has them eyeing off a spot at this level in 2015.
For the second consecutive week Old Scotch made an opening term statement that left their opposition in a state of fl ux. This time it was St Bedes/Mentone Tigers who felt the wrath of the Cardinals as the deluge of goals didn’t stop until their relatively subdued fi nal quarter. Mark Passador kicked another bag of six goals, but it was the overall team performance of Old Scotch that was impressive. Quarters of 6, 7 and 9 goals showed a ruthlessness born out of a costly ANZAC Day loss to the Tigers earlier this year. Pat
Kean tried his best to inspire and Michael Barnes
kicked a great goal but overall the Tigers were
never really in this. Richard Eva again produced
a quality performance and Jack Bull despite
again receiving heavy treatment was able to be
infl uential through the middle.
Andrew Merrington must enjoy the seaside. A
fortnight earlier the St Bernard’s forward bagged
fi ve goals against St Bedes/Mentone and repeated
the dose at Beaumaris last week. Another great
Beauy start was reeled in to leave the Sharks clear
by a point at the main break, before St Bernard’s
broke clear with a six goal premiership quarter.
Sullivan was again wielding infl uence for the
Snowdogs but whilst Gower and Petering were
playing well for the Sharks they couldn’t prevent
their side falling for a seventh straight week, a run
that was incidentally started when the Sharks fell
at St Bernards.
PREMIER LAST ROUND PREMIER RESERVE
St Bernards 4.2, 6.4, 12.9, 14.13 (97)Beaumaris 5.2, 6.5, 10.5, 13.5 (83)GOALS, St Bernards: A. Merrington 5, T. Gleeson 2, B. Considine 2, J. Forder 1, M. Hannan 1, C. Jones 1, R. Schroder 1, S. Fleming 1 Beaumaris: W. Manson 3, R. Cathcart 2, J. Grange 2, M. Petering 2, A. Carroll 1, B. Haynes 1, S. Braithwaite 1, W. Murton 1BEST, St Bernards: T. Sullivan, M. Hannan, A. Merrington, A. Bentick, N. Kazuro, A. SingletonBeaumaris: S. Gower, M. Petering, J. Grange, B. Haynes, M. Ensor, A. Carroll
Collegians 3.3, 6.6, 11.8, 15.10 (100)De La Salle 4.4, 6.7, 11.11, 13.15 (93)GOALS, Collegians: S. Taft 6, L. Apted 3, N. Corp 2, G. Jones 2, D. Russo 1, W. Tardif 1 De La Salle: A. Indovino 3, J. Gotch 2, D. Close 2, M. Carney 2, B. Oakley 1, T. Curry 1, D. Lowe 1, C. Haley 1BEST, Collegians: L. Apted, H. Croft, S. Taft, C. Simmons, W. Tardif, J. KamenerDe La Salle: D. Close, T. Humphrey, A. Indovino, C. Haley, D. Lowe, J. Gotch
Old Brighton 5.0, 8.4, 12.4, 13.7 (85)Old Trinity 5.5, 7.6, 8.8, 10.11 (71)GOALS, Old Brighton: D. Anthony 6, H. Cannon 2, C. King 2, O. Cavallaro 1, B. Jakobi 1, T. Skewes 1 Old Trinity: M. Kilpin 2, S. Nicolosi 2, J. Walsh 1, J. Hunt 1, B. Iezzi 1, L. Juric 1, E. Weatherson 1, B. Howell 1BEST, Old Brighton: D. Anthony, M. Bruin, M. Gadsden, L. Healy, N. Marston, T. SkewesOld Trinity: E. Weatherson, H. Tinney, H. Winter, C. Pohl, D. Wildsmith, N. Howell
Old Xaverians 3.1, 8.1, 10.3, 13.3 (81)University Blacks 2.10, 3.10, 6.14, 8.18 (66)GOALS, Old Xaverians: B. Goss 5, L. Smith 3, J. Williams 3, M. Ambrose 1, J. Anderson 1University Blacks: L. Devine 2, C. Turner 1, B. Mahon 1, B. Sheahan 1, S. Flight 1, A. Locke 1, J. Laurie 1BEST, Old Xaverians: C. Waller, E. Prowse, B. Goss, N. Wynne, J. Williams, L. SmithUniversity Blacks: B. Mahon, P. O’Rourke, A. Drysdale, J. Blake, S. Thomas, B. Sheahan
Old Scotch 6.1, 13.3, 22.7, 24.10 (154)St Bedes/Mentone Tigers 2.6, 4.12, 5.13, 9.16 (70)GOALS, Old Scotch: M. Passador 6, N. Cox 5, M. Seed 4, L. Hill 3, N. Walmsley 2, R. Wills 2, C. McDonough 1, W. Strange 1St Bedes/Mentone Tigers: T. Doherty 2, M. Barnes 2, T. Tyquin 1, C. Richards 1, P. Kean 1, B. O’Toole 1, M. Coen 1BEST, Old Scotch: R. Eva, M. Passador, N. Cox, J. Bull, R. Wills, S. ThompsonSt Bedes/Mentone Tigers: P. Kean, P. Tyquin, M. Barnes, S. D’Andrea, M. Geschke, T. Doherty
St Bernards 2.2, 5.7, 9.8, 10.8 (68)
Beaumaris 3.0, 4.0, 5.3, 8.6 (54)
GOALS, St Bernards: J. Gay 2, D. Wall 2, T. Duyndham 2, T. Russell 1, A. Boyse 1, P. Gamwell 1,
J. Manunzio 1 Beaumaris: M. Howes 3, J. Thompson 2, B. McLean 2, M. Wilson 1
BEST, St Bernards: T. Russell, B. Garth, J. Saundry, L. Madden, B. Peart, J. Manunzio
Beaumaris: T. Perkin, T. Abbott, W. Mattingley, J. Evans, S. Moore, M. Howes
Collegians 2.1, 3.3, 6.7, 8.8 (56)
De La Salle 2.3, 3.5, 3.7, 4.8 (32)
GOALS, Collegians: B. Riddle 2, M. Dyer 2, J. Parsons 1, M. Singleton 1, S. Sabbatucci 1, T.
Varigos 1 De La Salle: R. McDonough 2, S. Hogan 1, S. Harrington 1
BEST, Collegians: H. Pool, S. Hall, C. Jesaveluk, H. Apted, T. McNamara, B. Riddle
De La Salle: H. Haley, J. Oakley, L. Bull, D. Millwood, T. McMahon, L. Jarvis
Old Brighton 4.2, 8.6, 14.8, 16.11 (107)
Old Trinity 1.0, 2.2, 4.4, 5.9 (39)
GOALS, Old Brighton: M. Pascoe 4, T. Cooney 3, M. Tregear 2, L. Otto 2, T. Clarke 2, J. Davis 1, R. Cummin
1, J. Pascoe 1 Old Trinity: C. McCasker 1, T. Mitchell 1, F. Stewart 1, O. Fairweather 1, A. Medland 1
BEST, Old Brighton: J. Dickerson, J. Davis, J. Edge, T. Cooney, M. Pascoe, J. Pascoe
Old Trinity: C. McCasker, E. Beasley, A. Medland, C. Riggs, R. Mason, J. Steinhart
Old Xaverians 1.2, 2.3, 8.7, 8.11 (59)
University Blacks 2.1, 2.1, 3.1, 3.4 (22)
GOALS, Old Xaverians: R. Ralph 2, C. Smith 2, L. Keith 1, F. Lane 1, C. Santalucia 1, J. Douglas 1
University Blacks: J. Wilson 1, I. Anderson 1, D. Cooper 1
BEST, Old Xaverians: J. Pintal, J. Douglas, J. Close, L. Keith, E. Lachal, F. Lane
University Blacks: J. Quaile, S. Dadswell, A. Robbins, I. Anderson, J. Champion De Crespign,
T. Storer
Old Scotch 2.1, 5.2, 9.3, 13.8 (86)
St Bedes/Mentone Tigers 4.4, 5.8, 7.13, 11.14 (80)
GOALS, Old Scotch: E. Furey 7, L. McDonough 1, A. Harlock 1, A. Murray 1, M. Wills 1, J.
Nikolovski 1, S. Leith 1
St Bedes/Mentone Tigers: C. Hansen 3, B. Denton 2, B. Hodges 2, L. Stutterd 2, J. Cayhan 2
BEST, Old Scotch: T. Holding, E. Furey, J. Sansom, N. Lindsay, M. Wills, A. King
St Bedes/Mentone Tigers: B. Denton, C. Hansen, L. Stutterd, A. Cross, T. Gogerly, T. Pastura
4 THE AMATEUR FOOTBALLER 2014
There weren’t too many surprises last Saturday, as even I managed to tip all fi ve results correctly for the fi rst time this year! It was a perfect day for football as the overnight rain subsided leaving spectators to bask in sunshine and certain players of fair complexion to reach for the sun cream.
Uni Blues accounted for Old Carey to prove themselves as the class team of the competition; Old Melburnians enjoyed a victory over Old Haileybury; while Mazenod and AJAX had wins against Caulfi eld Grammarians and Old Ivanhoe respectively. The Nodders rise continued, as they remain close behind the OMs’ heels with only percentage keeping them out of fourth spot. Meanwhile, St Kevins won comfortably over Fitzroy to sustain their buff er over the top four chase group and they hold on to third place.
Any questions regarding Uni Blues’ supremacy at the top of the table were put to bed last Saturday, with a strong win over second placed Old Carey at home. A typically slow start saw the Blues trail at quarter time, and an inability to convert goals saw them move in to the main break trailing the Panthers by three goals. However, a fi ve goal third quarter and three goal last eclipsed the away side’s two majors for the half, and saw that the Blues sailed away with a 22-point victory. Jack Watts, Hugh Vickers-Willis, and Sean Carr all stood out through the middle for the Blues, while Marshall Rippon’s three majors were pivotal in the win. The panthers are not to be condemned after this loss, with their half game ascendancy over the Blue’s indicating positive aspects within their brand of football. Although an inability to capitalise on good start will be disappointing for Carey. As for many this was considered a grand fi nal preview, Uni Blues still have to be considered fi rm favourites, but Carey have proved they are no easy-beats.
Old Melburnians comfortably defeated Old Haileybury at Princes Park. OM’s moved to the front of the three way race for fourth spot and all but sealed Old Haileybury’s relegation fate. A six goal to three opening term tipped the scales in the Dark Blue’s favour early, and they would
stay that way for the reminder of the game. Melburnians won every quarter of football, acquiring more contested footy and moving far more freely around the ground than their hosts. Cam Beck kicked a career best fi ve majors, and quality contributions from Sam Playfair, Nick Voyage and Jeremy Beaumont culminated in a 45 point win for Melburnians, one they were hardly challenged for. Unfortunately, sitting three games behind Caulfi eld with only three left to play, Old Haileybury look destined for demotion. Even if they win all of their remaining fi xtures, they must rely on Caulfi eld losing all their matches to avoid the bottom two.
Mazenod continued their winning streak with a hard fought win against a brave Caulfi eld Grammarians. The contest was even, with Caulfi eld leading by four points at the fi rst break and 1 at half time, before they were tied at 47 all at the completion of the premiership quarter. Mazenod barraged the ‘Fields defence thereafter; nearly doubling their goal count with six majors, while holding Caulfi eld goalless to prevail easily. Dean Kelly led the goal kicking, dobbing four for the victors. Performances from Liam Welsford, and Josh Cowan, who also managed three and two goals each, alongside Robert Mann who was ubiquitous around the ground, underscored the important away victory.
AJAX notched up an important win against an consistent and challenging Old Ivanhoe outfi t. An even three quarters saw Old Ivanhoe lead at the fi nal interval as they were perched for a potentially devastating upset win. However the Jackas had the legs in the fi nal stanza, adding six goals to one to come out 30-point victors. Josh Ludski and Warren Steinberg were outstanding in their eff orts to lift the side throughout the match, wining plenty of ball. Jarryd Ludski was a terrier deep in
FEW SURPRISES
PREMIER B — TIPS IN BOLD (YEARS TOTAL 45/60%)
Old Carey v AJAX
Old Ivanhoe v Fitzroy
Old Melburnians v Caulfi eld Grammarians
Old Haileybury v Mazenod
St Kevins v University Blues
PREM
IER
BBlair Morton @blairwmorton
5THE AMATEUR FOOTBALLER 2014
defence, while veteran Ari Lewski was a pivotal
play-making link in many forward eff orts.
St Kevins outperformed Fitzroy at Brunswick
Street to stay in third place. At the same time
SKOBs dashed any hopes Fitzroy had of playing
fi nals footy. SKOBs dictated proceedings all day,
wining every quarter and were looking the better
side in every aspect. Steve Salopek starred with
lots of the football and a classy goal, as did Zach
Ginnies. Anthony Lynch contributed three majors
alongside Nick Wood and Matt Murphy who
provided valuable input for SKOB. Fitzroy now sit
two games behind the three sides locked in the
race for fourth, and need to re-learn calculus in
order to secure a supremely unlikely fi nals berth.
This week sees Old Carey take on AJAX in a game of
huge importanancet for both sides. The Panthers
need to win to remain clear of SKOB and get back
to winning touch, while a Jackas loss could see
them lose touch with the top four competitors.
Old Ivanhoe take on Fitzroy in a contest the Roys
need to win to keep any chance, however slim,
of fi nals footy alive. Old Melburnians can hone
in on fourth spot with a win over Caulfi eld, who
will ensure they avoid relegation with a win on
Saturday. Mazenod too can improve their top four
chances with a win over Old Haileybury, who will
see their chances of retaining a Premier B start in
2015 evaporate with a loss. Lastly, St Kevins take
on Uni Blues at home, a barometer of both sides
form going into fi nals, that has the potential to
go either way, especially if SKOB bring their best
game.
PREMIER B LAST ROUND PREMIER B RESERVE
University Blues 1.2, 2.6, 7.7, 10.12 (72)Old Carey 3.4, 5.7, 6.8, 7.8 (50)GOALS, University Blues: M. Rippon 3, T. Blakey 1, M. James 1, R. Eade 1, P. Hayes 1, P. Gardiner 1, S. Carr 1, C. Williams 1Old Carey: C. Jones 3, J. Reid 2, C. Howat 1, B. Smithwick 1BEST, University Blues: H. Vickers-Willis, J. Watts, S. Carr, P. Summers, M. Rippon, J. Van De PolOld Carey: J. Murrie, A. Reed, M. Evans, A. Sloan, C. Howat, J. Rice
Mazenod 2.1, 5.2, 7.5, 13.9 (87)Caulfi eld Grammarians 2.5, 4.9, 6.11, 6.15 (51)GOALS, Mazenod: D. Kelly 4, L. Welsford 3, J. Cowan 2, N. Gentile 1, J. Trounce 1, B. Bonner 1, F. Reed 1Caulfi eld Grammarians: T. Small 2, Z. Parsons 2, T. Silvestro 1, D. Daly 1BEST, Mazenod: L. Welsford, J. Cowan, R. Mann, C. Smith, D. Kelly, S. InglisCaulfi eld Grammarians: T. Silvestro, M. Slonim, A. McGuinness, T. Small, B. Price, S. Stewart
St Kevins 4.2, 6.4, 10.7, 14.9 (93)Fitzroy 1.0, 3.1, 4.5, 6.8 (44)GOALS, St Kevins: A. Lynch 3, C. Ring 2, P. Karageorgiou 2, H. Townsend 2, L. Nankervis 2, J. Salopek 1, S. Salopek 1, Z. Ginies 1Fitzroy: M. Cussen 2, D. Pound-Palmieri 1, J. Turner 1, D. Patcas 1, W. Fenton 1BEST, St Kevins: S. Salopek, A. Lynch, Z. Ginies, N. Wood, M. Murphy, B. DowdFitzroy: R. Angiolella, W. Fenton, D. Patcas, M. Kyroussis, S. Green, J. Meakin
Old Melburnians 6.1, 11.4, 16.8, 18.14 (122)Old Haileybury 3.4, 5.7, 8.8, 11.11 (77)GOALS, Old Melburnians: C. Beck 5, T. Hywood 4, T. Marshall 3, T. Paule 2, A. Armstrong 2, J. Hooper 1, E. Fanning 1Old Haileybury: M. Meehan 3, J. Backway 2, J. Nicolopoulos 2, T. Witherow 1, H. McLauchlan 1, A. Schofi eld 1, J. Dawson 1BEST, Old Melburnians: S. Playfair, C. Beck, N. Voyage, J. Beaumont, H. Macciolli, T. MarshallOld Haileybury: P. Gleadhill, R. Johnson, M. Taylor, C. Vincent, M. Meehan, J. Toy
AJAX 0.5, 6.8, 7.12, 13.14 (92)Old Ivanhoe 2.2, 5.6, 7.13, 8.17 (65)GOALS, AJAX: D. Fayman 5, A. Burstin 2, J. Lew 2, B. Caplan 2, S. Fayman 1, W. Steinberg 1Old Ivanhoe: A. Delmonte 3, Z. Keane 2, B. Lee 1, C. Johnson 1, N. Gieschen 1BEST, AJAX: J. Ludski, A. Lewski, J. Ludski, R. Winograd, B. Caplan, M. SelzerOld Ivanhoe: D. Heta, C. Groth, H. Heta, A. Delmonte, B. Harrison, C. Johnson
University Blues 1.1, 5.4, 12.5, 14.11 (95)Old Carey 1.2, 2.2, 2.2, 4.4 (28)GOALS, University Blues: J. Mugavin 3, T. Girdwood 3, A. Wettenhall 1, D. McFarlane 1, W. Hartnell 1, J. Wood 1, R. McMahon 1, M. Steinbach 1, H. Weddell 1, J. Brown 1Old Carey: S. Cambridge 1, J. Ymer 1, P. Cremean 1, L. Marriott 1BEST, University Blues: E. Ratcliff e, E. Long, T. Girdwood, G. Chisholm, H. Evans, J. WoodOld Carey: B. Simpson, L. Hall, L. Marriott, P. Cremean, M. Pallozzi, J. Ymer
Caulfi eld Grammarians 2.2, 4.4, 8.9, 11.16 (82)Mazenod 2.2, 5.4, 6.5, 6.5 (41)GOALS, Caulfi eld Grammarians: W. Osborn 4, D. Simic 3, K. Stewart 2, J. Small 1, M. Wood 1Mazenod: D. Maskill 2, S. Mann 2, B. Woods 1, D. McLean 1BEST, Caulfi eld Grammarians: A. Spittal, D. Simic, W. Osborn, A. Bednarek, D. Dickson, D. TobiasMazenod: D. MacLeod, B. Woods, P. Johnson, D. Izon, M. Rich, J. Hende
St Kevins 3.4, 8.8, 15.10, 23.12 (150)Fitzroy 1.0, 1.0, 1.0, 4.2 (26)GOALS, St Kevins: T. McPherson 6, A. White 4, B. Kanakis 2, R. Caldow 2, J. Gambaro 2, J. Staffi eri 2, P. Aughton 1, T. Hickey 1, P. McLennan 1, T. Johnston 1, H. McPherson 1Fitzroy: B. Farley 2, J. Beech 1, C. Evans 1BEST, St Kevins: T. McPherson, T. Hickey, J. Staffi eri, L. McDonell, D. Wissell, P. McLennanFitzroy: D. Olarenshaw, A. Franklin, J. Anderson, R. Willingham, J. Murray, B. Farley
Old Melburnians 6.3, 12.6, 15.12, 19.19 (133)Old Haileybury 5.0, 5.1, 9.2, 10.4 (64)GOALS, Old Melburnians: C. Tunbridge 4, A. Coleridge 3, D. Velakoulis 3, J. Rundell 2, M. McCoy 2, Z. O’Neil 1, W. Boyd 1, Z. Johnston 1, P. Nestel 1, J. McMullin 1Old Haileybury: R. James 5, C. Ferguson 2, C. Hill 1, R. Carroll 1, T. Tyrell 1BEST, Old Melburnians: N. McLardy, Z. Johnston, A. Coleridge, Z. O’Neil, W. Beasley, A. MurrayOld Haileybury: C. Smith, C. Hill, D. Mackenzie, R. Carroll, C. Barter, A. Thomson
Old Ivanhoe 1.4, 7.7, 11.9, 15.11 (101)AJAX 1.2, 1.4, 3.6, 5.8 (38)GOALS, Old Ivanhoe: R. Dennis 7, M. Brown 2, A. Solomidis 2, R. Glavas 2, S. Leon 2AJAX: R. White 3, A. Shenker 1, S. Roth 1BEST, Old Ivanhoe: L. Phillips, J. Dunnett, R. Dennis, C. Crowley, A. Solomidis, R. DavidsonAJAX: D. Steinberg, J. Mendies, J. Brick, J. Bade-Boon, A. Wollan, D. Janover-Rocha
Please email your match reports, thoughts and feelings by Sunday afternoon to [email protected]
6 THE AMATEUR FOOTBALLER 2014
The Banyule faithful have every reason to feel hard done by after their side led for the best part of two hours in its clash against third-placed Hampton Rovers, before going down in the fi nal minute by one point. The loss has all but sealed Banyule’s fate in 2014, whilst the win has given the Rovers hope of securing a double chance. A Banyule snap from the stoppage handed them a fi ve point lead with two minutes left on the clock. However the ensuing bounce saw the Rovers surge the ball forward, and through relentless forward pressure the Bears defence wilted, a Josh Verlin soccer off the ground was enough to see the Rovers home.
Confronting 9th place in round fi fteen always ensures you are in for a tough day at the offi ce. One team is hanging on for grim death, the other is in pursuit of playing fi nals football. Upsets do happen when teams are trying to fi ght their way out of relegation. For the fi rst 10 minutes of the clash between Ormond and Peninsula, an upset was on the cards. The Monders booted three unanswered goals leaving the Pirates scratching their heads. But this only ignited the Pirates. Their midfi eld brigade lifted their work rate and the back-six, led by Brett Brisbane began to provide drive from defence. The Pirates had created an eight goal lead by the fi nal change. As tempers fl ared in the fi nal term the Pirates took control of the game. Late goals to Grigg, Fletcher and Scarpella (4) extended the margin to 77 points. For Ormond, Simon and Upstill could hold their heads high.
The Vultures are another step closer to playing fi nals football, after seizing fourth spot with an imposing 55 point win over Old Camberwell. Going from the smaller confi nes of Gerry Green to a larger ground such as Gordon Barnard Oval can often be a diffi cult assignment. However the Vultures took to their task with relative ease. Precision passing and relentless tacking pressure paved way for a commanding 23 point half time lead. Fearing an onslaught, the Wellers lifted their intensity in the third term with Clarke and Bennett getting on top in the clearances, alongside Rogers (3) who was lively up forward. However their hopes
of a comeback were quelled as the Vultures put the game beyond doubt with fi ve fi nal quarter goals. In the fi nal term it was Dillon and Platt in the midfi eld who broke the Wellers resistance, each snaring three goals for the afternoon. The win was highlighted by three goals to debutant Dylan Glascott, and the Vultures’ eight multiple goal kickers.
PEGS’ inability to play four quarters of football has cost it dearly in their 29 point loss to Monash Blues. PEGS were able to match it with their rivals in the fi rst and third terms, but failed to fi re a shot in the last quarter when the game was in the balance. With scores level at 53 all PEGS would’ve been hoping for a fairytale fi nal quarter, which they have been known to produce this year. However Monash’s rock solid defence were unwavering, refusing to concede a single point. Forrest was the dominant key forward on the ground for the Bombers with three goals. But it was Monash’s even spread of goal kickers that again proved the diff erence as it has often done this year, sharing the load between ten diff erent players. Livori played his fi nest game of the year for PEGS. Meanwhile for the Blues Meade and Griffi ths were standouts. Having fallen to sixth place, the Bombers will need to produce an impressive fi nal three weeks if they are to secure a top four fi nish.
To say Banyule didn’t deserve to win is an understatement. You have to feel for the Bears after they led up until the dying minutes of Saturday’s clash with the Hampton Rovers. And you can bet that Marcellin and Monash would’ve been praying for a Bears victory. The Bears held their opponents at bay for three quarters, and almost pulled off one of the upsets of the season. Unfortunately for the Bears, as time ticked past the 25 minute mark, deep into the fi nal term, they conceded a goal. A Josh Verlin soccer handed the Rovers a one point win. Barclay and Hay were outstanding for Banyule coupled with the starring role of McDonald up
Ned Hunt @ nedhunt1
UN-BEAR-ABLE TO WATCH
PREMIER C — TIPS IN BOLD (YEARS TOTAL 51/68%)
Hampton Rovers v Monash Blues
Parkdale Vultures v Ormond
Marcellin v PEGS
Peninsula v Old Camberwell
Oakleigh v Banyule
WATCH EVERY PREMIER C GAME at www.vafatv.com
PREM
IER
C
7THE AMATEUR FOOTBALLER 2014
forward who booted four. Each time the Rovers
looked dead and buried it was Lovig and McNeil
who they turned to. The Rovers three quarter time
defi cit of 12 points was reduced on the back of
increased output from Care and Turner who each
fi nished with three pivotal goals. A gallant eff ort
from Banyule but one that won’t be enough to see
them remain in Premier C next season.
Oakleigh’s recent goal kicking woes came back to
haunt them on Saturday as they fell 11 points short
of ladder leaders Marcellin. It was the Eagles who
made a fast start, capitalising on an Oakleigh lapse
in concentration, racing to a 29 point half time
lead. Inaccuracy was costing the Krushers, while
their opposition appeared to pierce the big sticks
with relative ease. Bolger added another three to
his tally of 41 majors for the year, while Carlson
and Bortolotto (2) amassed plenty of the ball in the
midfi eld. The Krushers were able to bridge the gap
to 22 points by the fi nal change, after Hogan and
Murray produced stellar third terms. Onlookers
were given a front row seat to the Austin Deneys
show in the last term, as he tried to singlehandedly
kick start an Oakleigh revival, with four fi nal quarter
goals. Unfortunately his fellow teammates failed to
have the same impact.
Back at the familiar surrounds of Boss James, The
Rovers assume 2nd spot if they account for the
Blues. The Vultures are taking fl ight at the right
time of year, win number three in three weeks will
see them tighten their grip on 4th spot. A poor
travelling side this year, PEGS will need to produce
one of their fi nest performances of the season if
they are any chance to defeat the Eagles. Similarly
Peninsula and Oakleigh both need to win to keep
their fi nals prospects alive, but can Old Camberwell
and Banyule bring their 2014 campaigns unstuck?
There is a lot at stake this weekend, four teams
have their eyes set on fourth position. Which teams
will buckle? And which teams will make a big play?
PREMIER C LAST ROUND PREMIER C RESERVEHampton Rovers 1.2, 6.8, 8.10, 13.12 (90)Banyule 4.6, 7.9, 10.10, 13.11 (89)GOALS, Hampton Rovers: M. Care 3, E. Turner 3, J. Donald 2, C. Sharp 2, S. Burggraaff 1, J. Verlin 1, S. Clements 1 Banyule: D. McDonald 4, R. Hay 2, D. Gayfer 2, Z. Wenke 2, L. French 1, A. Barclay 1, R. Williams 1 BEST, Hampton Rovers: J. Lovig, A. McNeil, M. Care, S. Clements, J. Verlin Banyule: R. Hay, A. Barclay, M. Christian, O. Philp-Taylor, J. Clark, L. French
Marcellin 4.5, 9.7, 11.10, 14.12 (96)Oakleigh 2.2, 4.8, 7.12, 11.19 (85)GOALS, Marcellin: D. Bolger 3, X. Burns 2, M. Gasparini 2, J. Bortolotto 2, N. Crosbie 2, A. Beaini 1, J. Antypas 1, D. Redmond 1 Oakleigh: A. Deneys 4, J. Paola 3, S. Tolongs 2, L. Hard 1, T. Scott 1BEST, Marcellin: J. Carlson, J. Bortolotto, P. Hamblin, J. Blanch, P. Millsom, M. GaspariniOakleigh: A. Deneys, C. Hogan, A. Murray, J. Paola, A. Valentini, D. Cleary
Parkdale Vultures 5.1, 10.2, 15.6, 20.8 (128)Old Camberwell 4.2, 6.3, 10.6, 11.7 (73)GOALS, Parkdale Vultures: C. Dillon 3, L. Platt 3, D. Glascott 3, N. Papatsanis 2, S. Hendricks 2, T. Boland 2, J. Le Breton 2, N. Ng 2, C. Tobin 1Old Camberwell: A. Rogers 3, H. Crothers 2, T. Miriklis 1, N. Tsindos 1, D. Toma 1, S. Bennett 1, R. Campbell 1, R. Kapoor 1BEST, Parkdale Vultures: C. Dillon, S. Hendricks, M. Ryan, P. Sullivan, R. Swayn, S. ChittyOld Camberwell: A. Clarke, S. Bennett, R. Kapoor, P. Bennett, R. Campbell, A. Halabi
Peninsula 5.5, 11.7, 13.11, 19.15 (129)Ormond 3.2, 3.6, 5.9, 7.11 (53)GOALS, Peninsula: T. Scarpella 4, T. Stainforth 2, S. Grigg 2, S. Buchanan 2, S. Glenn 2, A. Wood 1, S. Payze 1, A. Marshall 1, G. Fletcher 1, H. Brodie 1, J. Pomeroy 1, J. Gleeson 1Ormond: S. Stait 2, I. Tahana 2, D. Frazier 1, D. Bailey 1, M. Saunders 1BEST, Peninsula: T. Scarpella, B. Brisbane, R. Powney, A. Wood, G. Fletcher, B. SouthamOrmond: B. Upstill, J. Simon, H. Jacobs, M. Saunders, L. Anrep, D. Bailey
Monash Blues 4.0, 8.1, 8.5, 14.7 (91)P E G S 4.3, 4.4, 8.5, 9.8 (62)GOALS, Monash Blues: A. Carr 2, D. Hatch 2, J. Cosgriff 2, J. Taylor 2, L. Buck 1, E. Flanagan 1, Z. Ledin 1, J. McKenzie 1, J. Griffi ths 1, A. Young 1P E G S: D. Forrest 3, D. Cantwell 1, N. Bartram 1, J. Young 1, D. Roscoe 1, C. Livori 1, S. McCann 1BEST, Monash Blues: J. Meade, J. Griffi ths, A. Hickey, J. Taylor, J. Ledin, B. AmbergP E G S: C. Livori, D. Flaherty, S. Ghasimzadeh, J. Pound, B. Jones, J. Young
Hampton Rovers 5.4, 5.9, 9.10, 18.11 (119)Banyule 2.0, 4.4, 5.7, 8.10 (58)GOALS, Hampton Rovers: C. Long 3, C. Malthouse 3, A. Long 2, N. Bloomfi eld 2, G. Ivanka 1, M. Powell 1, M. Broadley 1, L. Dynon 1, M. Rowse 1, J. Coverdale 1, M. Woltering 1, S. Dalton 1Banyule: S. Hills 2, M. Borg 2, J. Plant 1, S. McKenzie 1, J. Pentland 1, M. Stephenson 1BEST, Hampton Rovers: N. Bloomfi eld, L. DeLisle, T. Youl, A. Power, C. Long, C. MalthouseBanyule: S. Hills, H. Tippett, M. Borg, S. McKenzie, A. Valvo, J. Pentland
Marcellin 4.5, 9.6, 14.6, 15.8 (98)Oakleigh 2.2, 6.4, 9.6, 10.12 (72)GOALS, Marcellin: Oakleigh: D. Costigan 3, L. Moeller 2, R. Gonzalez 1, S. Way 1, E. Catalla 1, J. Paola 1, N. Miller 1BEST, Marcellin: Oakleigh: C. Mercuri, B. Hogan, D. Costigan, S. Taylor, R. Gonzalez, A. Matthieson
Parkdale Vultures 3.2, 6.4, 7.8, 11.10 (76)Old Camberwell 1.0, 2.2, 5.6, 7.6 (48)GOALS, Parkdale Vultures: R. Irvine 2, A. Thompson 2, T. McLENNAN 1, S. L’Huillier 1, P. Lee 1, Z. McCarthy 1, M. Ferguson 1, D. McCarthy 1, S. Rzek 1Old Camberwell: B. Hillier 1, B. Cottrell 1, S. Needham 1, M. Woodbridge 1, T. Schipper 1, C. Webster 1, M. Jeff ers 1BEST, Parkdale Vultures: S. Chapman, D. Graham, J. Lay, Z. McCarthy, R. Meade, D. AtkinsOld Camberwell: S. Needham, T. Stayner, C. Gorman, N. Russell, N. Searles, T. Schipper
Peninsula 7.4, 13.8, 19.9, 24.16 (160)Ormond 2.0, 4.2, 5.4, 6.4 (40)GOALS, Peninsula: J. Archdeacon 6, C. Macaulay 5, J. Coghlan 4, S. Cain 3, B. Mitchell 3, T. Shayler 1, L. Baker 1, R. White 1Ormond: S. Walker 2, B. Lydster 1, J. Cukierman 1, C. Carothers 1, J. Gates 1BEST, Peninsula: B. Mitchell, C. Macaulay, E. Coghlan, T. Coghlan, M. Tuckett, S. CainOrmond: W. Cove, B. Lydster, C. Harvey, B. Rockman, J. McDonald, M. Bannan
P E G S 5.1, 6.3, 7.7, 8.7 (55)Monash Blues 1.0, 3.2, 4.2, 7.4 (46)GOALS, P E G S: A. Khallouf 3, M. Miller 1, L. Fitzgerald 1, B. Anderson 1, C. Tzambazis 1, J. Marr 1Monash Blues: not suppliedBEST, P E G S: B. Briggs, D. Phelan, J. Rogers, C. Tzambazis, A. Khallouf, M. MillerMonash Blues: not supplied
Please email your match reports, thoughts and feelings by Sunday afternoon to [email protected]
8 THE AMATEUR FOOTBALLER 2014
VAFA Media Coverage
LATE SCORES, FINES AND TRIBUNAL
STREAMING LIVE AT
southernfm.com.auSUNDAYS at 9:00am
Tom Brain, Steve McCarthy & Stephen
(Chooka) Grey apply their post-mortems
Sundays at 6:00pmGlenn “Scatters” Scarborough
dissect the weekend’s round
Streaming at northwestfm.org
LIVE SCORES: Access the URL on your Smartphone& save to your home screen.
livescores.vafa.com.auLISTEN TO BUSH ‘N’ THE BURBS
WITH MARK FINE 9PM THURS
vafatv.com
facebook.com/vafa.
@VAFA_HQ
9:00 am VAFA Footy ShowHosted by Andrew Leonard and John Kanis. Plus a rotating panel
of VAFA experts discussing all the big issues of the week.
VAFA Match of the RoundSaturday: Old Brighton v Old Scotch from 1.45pm
Results of Tribunal – 5 August 2014
Joshua Watts, Peninsula (Under-19). Striking, 2 matches.
Andrew Khallouf, PEGS (Reserves). Striking, 5 matches.
*James Tyquin, St. Bedes Mentone Tigers. Striking, 2 matches.
*Michael Defontenay, Beaumaris. Striking, 2 matches.
*Lachlan McQueen-Miscamble, Old Carey. Striking, 2 matches.
*Dylan Patcas, Fitzroy. Unreasonably rough conduct, 3 matches.
*Adam Pearson, Whitefriars. Striking, 2 matches.
*Will Wright, Old Carey (Under-19). Striking, 2 matches.
*Accepted Prescribed penalty.
Results of Investigations
Fitzroy and St. Kevins, two major melees, senior match on 2 August.
Both clubs accepted prescribed penalty. Fitzroy $1250, St Kevins $800.
Late Scores - 26 JulyMonash Gryphons — Division 2 (2nd Off ence)
South Mornington — Division 3 (3rd Off ence)
South Mornington — Division 3 Reserve
Old Ivanhoe — Under 19 3
Incorrect Scores - 26 JulyOld Brighton — Premier
Old Mentonians — Division 1
South Mornington — Division 3 Reserve (2nd Off ence)
9THE AMATEUR FOOTBALLER 2014
FOR
THE
LOVE
OF
THE
GAM
E
» Largest range of strapping tapes and medical supplies » Used by Clubs and Leagues for over 15 years » Rewards packages available
Club Warehouse is the leading Sports Medical Supplier, offering an extensive range of quality sports medical supplies. Discuss with us your budget options and we can provide product solutions suited to your needs.
Call us today to experience the Club Warehouse difference!
» Taping Supplies » Sports Nutrition & Hydration » Rehabilitation » Supports and Bracing » Sports Performance
» First Aid Supplies
‘Protect your players with the best’
P: +3 8413 3100 M: +61 413 576 677E: [email protected]
» EDFL, EFL, SFL, WRFL, VAFA, AFL VIC, 14 AFL CLUBS.Proudly chosen medical supplier for:
‘Official Suppliers’
10 THE AMATEUR FOOTBALLER 2014
FOR
THE
LOVE
OF
THE
GAM
E
BULLEEN TEMPLESTOWE CELEBRATE
Three weeks ago, Bulleen Templestowe AFC hosted
their 40th anniversary ball held at The Centre
Ivanhoe. More than 200 attended a gala evening
to celebrate the club’s amazing history. The Club’s
record in the VAFA in the 1970s & 80s in particular
is quite remarkable. The club was formed out of
the Bulleen Templestowe Youth Club who entered
teams in local under age football competitions
and was administered by that club until the senior
committee was formed in 1976. After entering a
senior team in 1975 the club made progress each
year to climb all the way to A Section for the 1984
season. Along the way the club claimed three
premierships before they lost the 1984 A Section
preliminary fi nal. They climbed six sections in 10
seasons! The Bullants spent four years in A Section
before a gradual descent over the years to Division
1 where they now sit. To celebrate the night the
club named a team of the decade for most recent
10 year period and the club also produced a quite
attractive booklet covering the fi rst forty years.
From everyone at the VAFA, congratulations on 40
great years, let’s hope there are another great 40
to come!
THOUGHTS GO OUT…
Our thoughts are with the Prahran Assumption Football Club and the Dean Family whose son Ash was involved in a car accident last Saturday. Ash is currently in the Royal Melbourne Hospital. We wish Ash all the best with his recovery.
BUILDING A ROOF FOR VAFA GROUNDS?
After last week’s debate at AFL level about leaving the roof open for the Melbourne v Brisbane Lions match at Etihad Stadium and how the poor players suff ered looking into the sun, we wondered when VAFA clubs will be looking to build a roof over their grounds. There are many VAFA grounds that run on the same North-South axis as Etihad Stadium does so we thought we would raise the possibility of any of them ever getting a roof installed overhead. Just some that we can think could do with a roof are:
Bennettswood Sports Ground(Emmaus St Leos)
Elsternwick Park Oval 1 and 2(Home of VAFA HQ/Elsternwick AFC)
Glenhuntly Oval (Caulfi eld Grammarians)
Harry Trott (Collegians)
Junction Oval (Old Melburnians)
Princes Park (Old Haileybury)
Toorak Park (Old Xaverians/Prahran Assumption)
Of course there are many more but of these, you would imagine Collegians are closest to installing a roof after their much hyped installation of lights at Harry Trott. Given it took Collegians six years to get their lights up, any takers on how long it will be before they get a roof over Harry Trott?
11THE AMATEUR FOOTBALLER 2014
VAFA TIPPING UPDATE
Only a few more weeks remain in the seven
VAFA Tipping competitions. There are some
great fi nals to be won and there are still a
large number of tipsters that can claim top
honours in any of the seven sections. For
those that might have missed a week or two
the away teams have done you some favours
in recent weeks. There is better news for all
tipsters too, all VAFA staff are ineligible for
the top prizes in each section. But don’t think
that will stop them from trying to at least
win bragging rights.
Head to vafa.com.
au/tipping to see
the leader board in
each section.
BIG V CLUB LUNCH A SUCCESS
Last Friday saw more than 220 guests attend the eighth Annual Big V Club Lunch at the lavish RACV Club. This year saw three new Big V Champion inductees Duncan Anderson (University Blues), Michael Blood (Old Xaverians) and Andrew Ramsden (Old Trinity) who were supported by
their family and friends on the day. Duncan’s sister and daughter accepted the award on his behalf whilst both Andrew and Michael spoke of how honoured they were to be recognised by the Big V Club in this way.
(L-R: Ingrid Anderson (daughter of Duncan Anderson), Rosemary Warssam (sister of Duncan), Andrew Ramsden and Michael Blood.)
ghts.
om.
e
n
12 THE AMATEUR FOOTBALLER 2014
FOR
THE
LOVE
OF
THE
GAM
EFO
R TH
E LO
VE O
F TH
E GA
ME
2014 INTERNATIONAL CUP
The 2014 International Cup will be played in Melbourne from August 9 to 23. There will be 18 men’s and seven women’s teams competing.
Men’s teams: Canada, China, Fiji, Finland, France, Indonesia, Ireland, Great Britain, India, Japan, Nauru, New Zealand, Pakistan, Papua New Guinea, South Africa, Sweden, Tonga, USA. New teams for IC14: Finland, Indonesia and Pakistan.
Women’s teams: Canada – Northern Lights, Canada – Midnight Suns, Ireland, Fiji, Tonga, USA – Freedom, USA – Liberty.
The majority of matches will be played at Royal Park in Parkville and for the fi rst time a community round will be played on Saturday August 16 as curtain-raisers to suburban, amateur and country matches.
The women’s grand fi nal will be played at Punt Road Oval and the men’s grand fi nal will be the curtain-raiser to the Round 22 AFL match between Hawthorn and Geelong at the MCG on Saturday August 23.
Expatriate Australians are ineligible to play in the International Cup. Teams are comprised solely of
amateurs who must be nationals of the country they represent. All players must have lived the majority of the years aged between 10 and 16 as a citizen of their nation.
The International Cup is played every three years. Previous International Cup winners are; Ireland (2002 & 2011), New Zealand (2005) and Papua New Guinea (2008).
Other VAFA clubs are also hosting matches of the International Cup in the competition’s Community Round to take place on Saturday 16th August.
Box Hill North are hosting the match between Japa n and Tonga as a curtain raiser to their senior match against Hawthorn in Division 4.
Manningham Cobras are hosting Fiji and Great Britain as the curtain raiser for their Round 17 match against Dragons also in Division 4.
These two clubs were luckily selected from a large pool of applicants of community clubs wanting to host matches.
FURTHER DETAILS CAN BE FOUND
AT WWW.AFLIC14.COM.AU
13THE AMATEUR FOOTBALLER 2014
MIL
ESTO
NES
All milestones to [email protected] by Monday noon.
Please supply a picture or Milestones reserves the right to fi nd one on the web.
GAMES VAFA CONGRATULATES YOU IN REACHING THE MILESTONE
250
Congratulations to Emmaus St Leos’ PAUL MCGLOIN – Paul arrived at the
club with his twin brother Rob in 2000 to form the ‘Twin Bobcats’, confusing
opposition coaches who thought they were seeing double as they roved all
over the ground, with their courageous team play. Paul is a great on fi eld leader
and a hard at the ball centre man, who likes kicking a few goals and is a popular
clubman at the Animal Cage
250
Congratulations to Kew’s NICK TINETTI – Nick joined Kew from the Old Xaverians in 1999
and quickly made an impact with his leadership and silky smooth skills. In addition to his
contribution to the Kew FC committee, Nick has gone on to be Kew’s longest serving Senior
captain, is a Reserves Best and Fairest winner and more recently, Life Member. Respected by all
and a class act on and off the fi eld, congratulations to Nick on this major milestone.
200
Congratulations to St Bernard’s BRENTON GARTH. A St Bernards Junior, ‘George’
played in two MEGT U19 Premiership sides (‘02/’03). In 2004, George won the
U19 B&F and made his Senior debut, before playing in the clubs last Premier
fi nals campaign. In 10 years of taking on the VAFA’s best, George’s fearless
approach has resulted in a few injuries, so it’s great to see him chalk up the 200.
All at ‘the snakepit’ salute a great clubman.
200
Congratulations to Ivanhoe’s JOE MAZOCCA – Joe has been an outstanding
contributor (on and off the fi eld) over the years and has gained a cult following
during that time. Well known for his on-fi eld banter, red boots and end of season
stories, Joe is admired and well respected by all at the IAFC. Joe has been a
resolute defender for much of his playing career and is aff ectionately known as
the ‘iron fi st’ in acknowledgement of his no nonsense approach to clearing the
ball from many an opponent over the years.
150
Congratulations to Old Geelong’s COLBY O’BRIEN – Arriving in 2004, Colby played in a Seniors
premiership within his fi rst two years and has since become one of the best players the club has
seen. Blessed with an uncanny knack to fi nd his way through traffi c, Colby has become a great
ball-winner and has won two club best-and-fairest awards.
150
Congratulations to Old Mentonians’ KYM REGAN – Since joining the Club in
2002, Kym has been a fantastic contributor to the Panther cause. Kym is one
of the few players to have represented the OMFC in the Seniors, Reserves,
Thirds and Under 19s, and has coached the Thirds. A long term member of the
committee, Kym was the Panthers’ Best Club Member in 2013. Well done Kym,
now that the knee has been repaired we look forward to your 200th.
150Congratulations to Old Ivanhoe’s BRANT HARRISON and BRETT NAGEL – Brant
and Brett have played nearly all games at Senior level, including a number of
fi nals and premierships. Both were part of the 2013 Premier C Premiership team.
14 THE AMATEUR FOOTBALLER 2014
MIL
ESTO
NES
GAMES VAFA CONGRATULATES YOU IN REACHING THE MILESTONE
100
Congratulations to Old Xaverian MATT BALL – Matt arrived at the club in 2009,
where he made an immediate impact as a leader, on and off the fi eld. Club
captain from 2010 to 2013, Bally is your old school ‘in and under’ on-baller and
alpha male of the Old Xavs. One of the clubs greatest and most inspiration
captains, Matt leads from the front and by example. Awarded the Best & Fairest
in 2012, Matt is a true great of the Old Xavs!
100
Congratulations to Oakleigh’s CHRIS HOGAN – Chris was recruited from
Oakleigh JFC and played his fi rst Senior game against Rupertswood in round 11,
2004. With three Premierships, Chris won the 2004 VB Zann Medal and several
other awards at the club.
100
Congratulations to St Kevins’ TOM MCPHERSON – Tom is brother to Reserves
stalwart Hamish, and son of the charismatic Duncan. While still at school, Tom
started at SKOB in 2007 in the U19’s, amassing 28 U19 games, including sharing
the U19 goal kicking Award in 2008. His career has continued with 11 Reserves
games and 60 games in the Seniors, being awarded the Best 1st Year player in
2010.
100
Congratulations to St Kevins’ NICK MARCHESANI – Nick is a journeyman,
reaching the 100 game milestone after 14 years at the club, having debuted with
the Under 19’s in 2000. A member of the Reserves Premiership side in 2004, Nick
didn’t play football between 2005 and 2009. He returned in 2010 where he has
mostly played Thirds football. A highlight of his career was playing with his three
brothers: Ben, Tom and James, earlier this year.
100
Congratulations to Old Haileybury’s RHYS JOHNSON – Rhys has recently
returned to the club after several years at Frankston YCW. Rhys is a fi t, strong,
hard at it mid-fi eld type, with long hair and tattoos that make him stand out
from the crowd. His wife Brooke and son Rye can always be found cheering him
on from the sidelines. Congratulations Rhys on reaching your 100th game.
100
Congratulations to Swinburne Uni’s NICK MAURAN – Nick has the unenviable
task of playing on the opposition’s best forward every week, a challenge he looks
forward to and handles with aplomb. His steely determination and physical
attributes allow Nick to play on the quick smalls or the big key forwards. He
thrives in the contest and always wants to be pitted and challenged by the best.
100
Congratulations to St Bernard’s DAMIAN HURLEY – It’s been a long time coming
for ‘Hurls’ who played in St Bernards’ back to back MEGT U19 Premiership sides
in 2003/04. After a season of Reserves footy, Hurls spent a few years travelling.
Returning to footy, Hurls has been a star with the Warriors and Thirds sides in
recent seasons. Well done Hurls.
100
Congratulations to Ormond’s ORRY LACK – Judgy played his junior footy for
Frankston YCW before joining Ormond’s U19s in 2006. He has played in two U19
Grand Finals in 2006 and 2007, two Reserve Grand Finals in 2010 and 2011 and a
Senior Grand Final in 2013. He won the U19 goal kicking for Ormond in 2007.
15THE AMATEUR FOOTBALLER 2014
GAMES VAFA CONGRATULATES YOU IN REACHING THE MILESTONE
100
Congratulations to Old Ivanhoe’s HAYDEN HETA – Hayden has been Captain of
the club for the last 3 years. In 2007, in his fi rst year with Old Ivanhoe, Hayden
was awarded the Woodrow Medal. He is a Premiership captain, twice Club Best &
Fairest, and has been a Big V representative on a number of occasions. Hayden is
tireless ruckman, great leader and a truly nice bloke.
100
Congratulations to Old Geelong’s JOHN FORSTER – John arrived in 2008 after fi nishing school
at Geelong Grammar, and has since become one of the most consistent players at the club. With
a penchant for mud and a hard contest, John has made a name for himself by winning the hard
balls in the air and on the ground.
50
Congratulations to Old Haileybury’s JOHN NICOLOPULOS – Poppa is a young,
exciting, match winning forward who loves to celebrate a goal with a leap in the
air and a fi st pump, which always brings the crowd to their feet. He is a leader on
and off the fi eld, with a big future in front of him. Congratulations Poppa on 50
memorable games.
50Congratulations to Oakleigh’s MATHEW ARANHA – Mathew was recruited from
Waverley Blues JFC, and played his fi rst game against Rupertswood U19’s in
round 2, 2012.
50
Congratulations to Old Geelong’s WILL SHARP – Will started his career in 2011 with the Reserves
and Club XVIII, a team with which he won a premiership in 2012. In the years since, he has shown
what can be achieved through hard work and dedication, turning himself into one of the club’s
fi ttest and hardest midfi elders.
16 THE AMATEUR FOOTBALLER 2014SPORTS INJURY CASUALTY - OPEN 1-7 SATURDAY
Bulleen Templestowe’s rise from the almost clutches of relegation is no longer a false hope as they closed the gap between themselves and eighth placed Whitefriars to just two points. Following a memorable win over rival Prahran Assumption, Bulleen Temp will need to reproduce that tenacity as their run home consists of three fi nals aspirants in need of victory as dearly as themselves. Elsewhere, Old Mentonians defeated Old Geelong to square up the race for fourth place. The OG’s remain favourites to take the remaining fi nals spot with a slightly easier draw, however the Panthers form is currently far superior.
After a slow start in the fi rst quarter, Bulleen Templestowe returned with a vengeance in the second. Down by 15 at the fi rst change of ends, they piled on fi ve goals to earn a 12-point advantage at the major break. The Bullants kept the pressure on the visitors in the third and managed to hold on to a steely four point win in the last. Despite Tim Rogers’ bag of fi ve, Prahran Assumption were unable to turn the tide and whisk away the four points. Anthony Lucisano was best on ground in Bulleen Templestowe’s second victory on the trot. The Bullants have doubled their win tally for the year in the past fortnight.
In an eight-point game, Old Mentonians thrived in the must-win scenario, as they defeated fellow fourth spot hopeful Old Geelong. Throughout the day both sides gave away opportunities, and the Panthers capitalised on this more so than the OG’s. OMFC controlled the majority of the matchup but seemingly let it slip late in quarters. Their hardy tackling and intensity was there, despite this Old Geelong would kick their way back into the game and almost stole the four points because of it. The Panthers’ seven point lead at three quarter time soon blew out beyond four goals as they dominated the fi rst 20 minutes. But as it ticked into time-on, the OG’s mounted another comeback kicking three quick goals and were roaring home. Unfortunately for the home crowd the siren silenced the fi ght back
as Old Mentonians won by four points. Elliot Macquire was best on across half back for the visitors.
NOBS/St Pat’s survived a monumental scare as Whitefriars threw the book at the fi nals-destined NOBs, leaving it until the last 10 minutes to fl ick the switch and race home to victory. NOBSPC started poorly while the Friars played out of their skin, kicking fi ve majors to two in the fi rst term. Whitefriars embarrassed NOBs in the fi rst half, keeping them to just three goals mostly due to sublime pressure and better spread going forward. The NOBs’ experienced heads slowly awoke in the third, as the visitors closed the margin to 16-points, however NOBs were still lacking the game-winning fi repower. Whitefriars continued to fl ounder opportunities thus leaving the door ajar; NOBSPC returned to their best with a goal-spree that came from nowhere. At the blink of the eye NOB/St Pat’s drove fi ve goals past the Friars and secured a 25-point victory. Damon Byrne was one of the few four quarter contributors for the NOBs, and played a signifi cant part in the match-defi ning fourth term burst to earn best on ground honours.
In the game between Williamstown CYMs (2nd) and MHSOB (10th), both teams had secured their fate long ago and seemingly had little to play for. Nonetheless the CY’s still handled the lowly Unicorns convincingly. The end result was as comfortable as could be expected, Williamstown had lavishly notched up 10 goals by half time. It didn’t stop there as the CY’s doubled that and some by game’s end. MHSOB struggled as most have this season against Williamstown, the CY’s showed no mercy against a side that has tallied just one win for the year. Nicholas Ebinger and Jack Gray had a fi eld day with four goals apiece
BULLANTS’ RELEGATION ESCAPE?
Listen to VAFA FOOTBALL SHOW 9-11am Sat. on 96.5 FM
DIVISION 1 — TIPS IN BOLD (YEARS TOTAL 60/80%)
Yarra Valley v Williamstown CYMS
Whitefriars v Old Geelong
MHSOB v NOBS/St Pats
Prahran Assumption v Therry Penola
Old Mentonians v Bulleen Templestowe
DIVI
SION
1James Reid @JamesRied9
17THE AMATEUR FOOTBALLER 2014
NOBS/St Pats 2.0, 3.4, 6.8, 14.11 (95)Whitefriars 5.3, 7.4, 9.6, 10.10 (70)GOALS, NOBS/St Pats: C. Horsley 4, J. Molony 2, M. Keown 2, D. Tonkin 2, M. Chapman 1, D. Byrne 1, M. O’Donoghue 1, J. Nettlefold 1Whitefriars: M. Mirabella 3, D. Di Staso 2, D. Leardi 2, M. Geilings 1, J. Hogan 1, A. Pearson 1BEST, NOBS/St Pats: D. Byrne, D. Clarkson, D. Tonkin, P. Kelly, T. Weaver, M. O’DonoghueWhitefriars: D. Kaldor, D. Leardi, A. O’Meara, A. Marcello, M. Geilings, S. Currie
Williamstown CYMS 4.2, 10.5, 16.10, 21.14 (140)MHSOB 1.2, 2.5, 3.6, 4.10 (34)GOALS, Williamstown CYMS: N. Ebinger 4, J. Gray 4, N. Holdsworth 3, M. John 3, R. Joy 3, B. Gray 1, J. Hatfi eld 1, S. Puhar 1, F. Adamson 1MHSOB: S. Villani 1, L. Hood 1, L. Meyer 1, B. Jellis 1BEST, Williamstown CYMS: J. Gray, N. Holdsworth, C. Richards, R. Chan, N. Ebinger, F. AdamsonMHSOB: S. Villani, D. Hamilton-Ho, J. Tran, J. Sherwin, L. Meyer, L. Hood
Old Mentonians 3.4, 6.7, 9.9, 13.10 (88)Old Geelong 3.2, 6.5, 8.8, 12.12 (84)GOALS, Old Mentonians: B. Parker 2, T. Banks 2, M. Gledhill 2, L. Hull 2, T. Wilton 1, J. Costello 1, J. Jansson 1, D. Brown 1, M. Myers-Snyders 1Old Geelong: T. Wigan 3, P. Tucker 2, J. Hoevenaars 2, C. O’Brien 2, C. Wood 2, W. Sharp 1BEST, Old Mentonians: E. Macquire, M. Myers-Snyders, K. Conlon, D. Brown, B. Norton, B. ParkerOld Geelong: A. Herd, N. Hardie-Grant, R. Kemp, C. Wood, J. Hoevenaars, T. Wigan
Therry Penola 2.2, 4.9, 6.13, 11.18 (84)Yarra Valley 1.0, 2.1, 2.2, 3.3 (21)GOALS, Therry Penola: J. Bannister 3, A. Marangon 1, M. Costello 1, H. Rowe 1, M. Sullivan 1, M. Valenti 1, C. Bannister 1, J. Crotty 1, J. Costello 1Yarra Valley: T. Hancock 1, J. Canham 1, R. Amos 1BEST, Therry Penola: J. Costello, M. Lyons, J. Egglestone, J. White, M. Sullivan, N. MilevskiYarra Valley: B. Trend, L. Evans, S. Savage, S. Yeo, T. Hancock, J. Amos
Bulleen Templestowe 1.1, 6.6, 8.8, 12.11 (83)Prahran Assumption 3.4, 4.6, 5.10, 11.13 (79)GOALS, Bulleen Templestowe: J. Cowell 2, R. Edsall 2, M. Rogers 2, G. Chivers 1, D. Tulloch 1, S. Lambropoulos 1, P. Florance 1, M. Cowell 1, M. Considine 1Prahran Assumption: T. Rogers 5, P. Harris 4, T. Keaney 1, A. Sleight 1BEST, Bulleen Templestowe: A. Lucisano, L. Bettiol, J. Cowell, H. Vogler, R. Edsall, D. TonelliPrahran Assumption: B. Kenny, D. Anglin, B. Dempsey, B. Field, B. Adams, T. Rogers
NOBS/St Pats 2.0, 3.4, 6.8, 14.11 (95)Whitefriars 2.2, 4.5, 5.7, 7.10 (52)GOALS, Whitefriars: T. Chivers 3, J. Urbano 1, M. Larosa 1, T. Urbano 1, C. Zarafa 1NOBS/St Pats: D. O’Donaghue 2, N. Hrovatin 1, S. Davidson 1, D. King 1, H. Bismire 1BEST, Whitefriars: B. Staff ord, C. McFadyen, C. McDonald, C. Zarafa, M. Scannell, G. ZerbiNOBS/St Pats: C. Fox, D. King, H. Bismire, T. Emmett, M. Rapa, J. Hunter
Williamstown CYMS 2.2, 8.5, 13.10, 14.14 (98)MHSOB 4.1, 6.1, 7.2, 9.3 (57)GOALS, Williamstown CYMS: S. Barlow 6, M. Sultana 2, J. Gill 2, B. Dobney 1, N. Knapman 1, T. Bowers 1, B. Hynes 1MHSOB: M. McKinnon 3, N. James 2, M. Ham 2, N. Taranto 1, K. McDonald 1BEST, Williamstown CYMS: S. Barlow, N. Bratby, M. Cavarra, B. Hynes, A. Thompson, T. BowersMHSOB: N. James, D. Burke, C. Hewish, K. McDonald, B. Pretty, S. Hayes
Old Geelong 9.5, 14.8, 22.12, 30.14 (194)Old Mentonians 0.0, 0.0, 0.0, 0.0 (0)GOALS, Old Geelong: T. Slattery 5, T. Claeys 4, A. Smibert 4, C. Gibbs 3, J. Johnston 3, N. Hobson 2, S. Griffi ths 2, T. Hunt 2, P. Lynch 1, H. Beaumont 1, C. Barham 1, C. Hammond 1, A. Bird 1Old Mentonians: BEST, Old Geelong: A. Bird, T. Slattery, T. Claeys, H. Beaumont, J. Johnston, S. MathesonOld Mentonians: B. Clurey, J. Paul, P. Merkus, T. Goodrich, J. Lee, C. Downie
Yarra Valley 4.2, 6.4, 8.7, 11.8 (74)Therry Penola 3.2, 6.6, 8.10, 8.13 (61)GOALS, Yarra Valley: S. Donald 5, R. Little 2, R. Yeo 2, D. Blewonski 1, A. Whetham 1Therry Penola: D. Leroy 2, R. Steer 2, J. Quinn 2, T. Robertson 1, E. Benson 1BEST, Yarra Valley: M. Neilly, K. Moody, P. Ferrier, R. Yeo, S. Donald, D. RickettsTherry Penola: J. Hanlon, B. Budiono, M. Pell, M. Reynolds, D. Angus, T. Robertson
Prahran Assumption 3.6, 11.9, 15.14, 18.20 (128)Bulleen Templestowe 0.0, 0.0, 1.1, 2.1 (13)GOALS, Prahran Assumption: R. Ellis 7, A. Hall 2, D. Cupples 2, M. Sampson 2, J. Rice 2, N. Giofre 2, T. Candy 1Bulleen Templestowe: A. Lauria 1, D. Gibney 1BEST, Prahran Assumption: R. Ellis, M. Laverty, J. Ancrum, A. Hall, E. Delahenty, D. CupplesBulleen Templestowe: A. Stavretis, M. Stella, A. Radatti, L. Shiel, C. Minkou, D. Russo
DIVISION 1 LAST ROUND DIVISION 1 RESERVE
Please email your match reports, thoughts and feelings by Sunday afternoon to [email protected]
goal fl attered Yarra Valley with the fi nal 63-point margin.
This week, Williamstown CYMS travel to Yarra Valley, predicting the CY’s to return home with the four points. Whitefriars host Old Geelong, if the OG’s are to make fi nals they must win this weekend. MHSOB plays NOBS/St Pats, expect the Nobs to win easily. Prahran Assumption faces Therry Penola who will make it 16 wins in a row. Old Mentonians verse Bulleen Templestowe, the Panthers to keep momentum and be victorious.
while Gray was named B.O.G for his all-round
performance.
Therry Penola had no trouble edging past their
Grand Final competitor of last year in Yarra Valley
to win their 15th game in a row in Division 1.
Yarra Valley’s defensive mindset to play a man or
two behind the ball was fruitless. Aside slowing
down the play, the Bushrangers were unable
to stem control the Lions exerted on the day.
It took Therry a quarter to adjust, but by the
second term they were able to slice through the
extra defenders and fi nd their targets. Jarrod
Bannister was the only multiple goal scorer for
the Lions with three, while Joel Costello was best
afi eld in a game where Therry’s inaccuracy at
18 THE AMATEUR FOOTBALLER 2014Follow the VAFA on Twitter @VAFA_HQ
DIVI
SION
2
It took 15 rounds but we fi nally had our fi rst draw.
Traditional rivals Kew and Ivanhoe were locked
in a dogfi ght all-day, until a fl ying shot at goal in
the dying seconds by the Bears missed and thus
evened the scores. It spelt heartbreak for Ivanhoe,
as they were the better side for most of the day
and victory would have kept their faint fi nals
hopes alive. For Kew, it was a “get out of jail free
card”, as their patchy late season form was nearly
their undoing once again. The overnight deluge
reduced most of Ivanhoe Park into a bog heap
and made goals hard to come by, with a total
of 16 kicked for the day. With goals a premium,
Lovell for Ivanhoe bagged four and earned best
afi eld honours, but unfortunately it was to no
avail. The Hoes had the running early, they were
lower and harder at the ball than the Bears and
held a valuable nine point lead at half-time. The
third however belonged to the Bears, as they
welcomed back CHF Tim Allman and he delivered,
bagging two majors for the quarter. The game
opened up in the last as the ball zipped from end
to end, but both sides lacked polish in front of
goal. Ivanhoe came seconds away from recording
a meritorious victory but had to settle on sharing
the points. Finals now seem a bridge too far, but
the year has by no means been a waste. They will
head to South Melbourne this week as favourites
and should record their eight win of the year.
For Kew, they host Glen Eira, in what should be
viewed as a chance to regain some much needed
consistency of performance.
After a heartbreaking loss to Old Eltham a week
prior, the Raiders went to Elsternwick Park keen
to rebound, and they did so in fi ne style. With
percentage all important this time of year, their 75
point win over the Wicks has all but sealed a fi nals
berth. They sit in fourth place, two games clear of
St Johns, and a victory over the JOCs this week will
set it in stone. The win is even more impressive
given the overnight conditions, and this week
Dave Boundy took a back seat up forward as
Kandilakis bagged fi ve. For Elsternwick, the loss
sees them a mere 5% clear of relegation and will
need a win in the last three weeks to avoid the
bottom two. Old Paradians face a stern test this
week as they host a St Johns side still clinging to
a slim fi nals hope. For Elsternwick, their fate is in
their own hands as they take on Monash in a do-
or-die encounter.
Old Eltham threw the theories about heavy
grounds reducing teams’ ability to score out the
window as they handed South Melbourne a 134
point hiding. It was a precession from the get-go,
as the Turtles did as they pleased in an eight goal
to two opening quarter. By half-time the match
was over, the Districts were 11 goals in arrears.
The Turtles had an astonishing 14 goal-kickers,
Zanter the hero with eight. After a slump in form
mid-year, Old Eltham has well and truly bounced
back, and is now a genuine premiership threat.
South Melbourne will be extremely disappointed
with their eff ort, but were just simply a class
below their top-four opponent. The Turtles face
their sternest test of the year, as they head to
Ferndale Park to face the form side of Division 2.
A win sees them take St Mary’s Salesian’s second
spot. South Melbourne is clear of relegation but
will want to bounce back this week against an in-
form Ivanhoe.
Monash Gryphons kept their hopes of narrowly
avoiding relegation for the second straight year
alive with a gutsy win over a luckless Glen Eira.
The Gryphons scraped home by 13 points and
now are a mere 5% off this week’s opponent
Elsternwick in what is a must win for both sides.
For Glen Eira, their eff ort in the past few weeks
DIVISION 2 — TIPS IN BOLD (YEARS TOTAL 59/79%)
Monash Gryphons v Elsternwick
St Mary’s Salesian v Old Eltham
Old Paradians v St Johns
South Melbourne v Ivanhoe
Kew v Glen Eira
Brenton Mann @BrentyMann
BEARS IN HIBERNATION
19THE AMATEUR FOOTBALLER 2014
unfortunately for the JOCs, turnovers proved
very costly. Countless times throughout the
day, St Johns gave the ball back to St Mary’s via
basic skill errors...and in the end that proved the
diff erence. They were valiantly led by key-forward
Adam Jones in a fi ve goal last quarter, that saw
them hit the front briefl y, but they couldn’t hold
on. St Marys’ class and superior structures saw
them arrest back the lead and march on to a hard
fought 24 point win. The JOCs still hold hopes of
a fi nals berth and face an uphill battle against
Old Paradians. St Mary’s take on a rampaging
Old Eltham, who will be keen to enhance its
premiership credentials.
DIVISION 2 LAST ROUND DIVISION 2 RESERVE
cannot be questioned but they simply lacked the
class when needed, and are still anchored to the
bottom of the ladder. Inaccuracy in front of goal in
the last quarter is to blame for their loss this week,
as they just couldn’t land that killer blow. Monash
had the better of the fi rst half and did enough in
the second to secure victory.
St Johns went into their clash with St Mary’s
Salesian knowing that nothing short of a win
would suffi ce if they were to keep their fi nals
dream alive. Their eff ort and intensity from the
opening bounce refl ected just that. St Mary’s
were made to earn every bit of their 24 point
win, in what was a perfect lead-up with fi nals on
the horizon. The intensity and pressure around
the ball from both sides was fi rst class, but
Old Paradians 0.0, 0.0, 0.0, 18.6 (114)Elsternwick 0.0, 0.0, 0.0, 5.9 (39)GOALS, Old Paradians: J. Kandilakis 5, S. Rehlicki 3, M. Simpson 2, M. Bellizia 2, D. Mahony 1, D. Boundy 1, J. Lidyard 1, R. Licciardi 1, A. Asdagi 1, B. Holden 1Elsternwick: A. Symon 1, S. Grace 1, D. Renton 1, A. Thornton 1, J. Biviano 1BEST, Old Paradians: J. Kandilakis, R. Bugeja, J. Lidyard, M. Bellizia, D. Huntley, M. BoundyElsternwick: S. Grace, D. Convery, I. Clark, N. Tadros, J. Biviano, L. Yeatman
Old Eltham Collegians 8.4, 14.6, 21.11, 26.14 (170)South Melbourne Districts 2.1, 4.3, 4.5, 5.6 (36)GOALS, Old Eltham Collegians: Z. Tranter 8, M. Crooks 3, A. Hargrave 2, B. Switkowski 2, B. O’Malley 2, C. Crooks 1, R. Foo 1, J. Laver 1, M. Hargrave 1, A. Lendaro 1, C. Mizzi 1, T. Wenborn 1, B. Strongman 1, N. Harper 1South Melbourne Districts: S. Mahoney 2, B. Natoli 1, A. Ray 1, K. Tutty 1BEST, Old Eltham Collegians: Z. Tranter, R. Foo, J. Hall, J. Laver, A. Lendaro, M. CrooksSouth Melbourne Districts: D. Blake, J. Cliff ord, K. Tutty, A. Bermingham, T. McNamara, A. Balestra
Monash Gryphons 5.3, 9.5, 10.7, 13.7 (85)Glen Eira 3.3, 5.7, 7.11, 10.12 (72)GOALS, Monash Gryphons: R. Fletcher 3, A. Carey 3, A. Erwin-Ross 2, T. Casha 2, M. Kearsley 1, L. Pound 1, A. Robilliard 1Glen Eira: K. Cevik 4, K. Harwood 1, C. Maddox 1, C. Higgins 1, S. Hollow 1, A. Bradley 1, B. Pascal 1BEST, Monash Gryphons: M. Ryan, R. Pollock-Williams, J. Nuguid, R. Fletcher, A. Carey, D. BaxterGlen Eira: M. Fletcher, C. Maddox, N. Dennis, L. Barda, K. Harwood, A. Spink
Ivanhoe 1.4, 4.6, 5.8, 8.10 (58)Kew 1.2, 3.3, 6.6, 8.10 (58)GOALS, Ivanhoe: M. Lovell 4, Z. Mowat 2, E. Robinson 2Kew: T. Allman 2, A. Brazzale 2, J. Fidanza 2, J. Fultheim 1, C. Quinlivan 1BEST, Ivanhoe: J. Harty, T. Williamson, A. Diorietes, Z. Mowat, J. Chazan, M. SkellyKew: T. Allman, D. Spencer, K. Margaritis, S. Bishop, P. Donaldson, B. Goodwin
St Mary’s Salesian 4.1, 5.5, 10.8, 14.10 (94)St Johns 1.1, 4.3, 6.3, 11.4 (70)GOALS, St Mary’s Salesian: L. Holmes 3, J. Strangward 3, J. Rogers 2, B. Andrews 2, T. Whittle 1, A. Dwyer 1, B. Mc Lean 1, T. Dudgeon 1St Johns: A. Jones 3, K. Arnold 2, A. Abela 2, B. Ayache 1, A. Brannan 1, A. Stevanovic 1, G. Costas 1BEST, St Mary’s Salesian: N. Baum, A. Dwyer, S. Jones, L. Kelly, J. Op’t Hoog, J. KenyonSt Johns: N. Chalk, A. Jones, D. Cattolico, B. Ayache, C. Christiansen, M. Sofoulis
Old Paradians 4.4, 8.6, 15.9, 19.11 (125)Elsternwick 1.3, 1.3, 3.3, 5.6 (36)GOALS, Old Paradians: J. Monro 5, J. Cusumano 3, K. Barry 2, B. Dines 2, A. Gafa 1, M. Christie 1, M. Elliott 1, A. Tak 1, K. Mascitti 1, A. Iacona 1, A. Serafi n 1Elsternwick: M. Cunningham 2, M. Spence 1, J. Martin 1, H. Talarico 1BEST, Old Paradians: A. Jolley, J. Cusumano, M. Christie, A. Iacona, K. Barry, A. GafaElsternwick: K. Kenny-Jones, A. Neill, M. Rosewarne, S. Buckley, H. Talarico, D. Cattigan
Old Eltham Collegians 8.3, 12.7, 17.10, 24.14 (158)South Melbourne Districts 2.2, 2.3, 5.3, 5.4 (34)GOALS, Old Eltham Collegians: A. Coath 8, P. Vidinopoulos 4, J. Bird 3, Z. Cole 3, T. Edgell 2, P. Zumbo 1, J. Howell 1, M. Makin 1, J. Bevilacqua 1South Melbourne Districts: D. Phillips 2, K. Phongthai 1, J. Duim 1, D. Mcbrearty 1BEST, Old Eltham Collegians: A. Coath, P. Zumbo, J. Bird, P. Vidinopoulos, Z. Cole, J. LoveSouth Melbourne Districts: D. Mcbrearty, L. Beanland, M. East, D. O’Dea, K. Phongthai
Monash Gryphons 2.7, 6.7, 7.10, 8.12 (60)Glen Eira 1.2, 1.5, 1.7, 3.10 (28)GOALS, Monash Gryphons: J. Zhivov 1, B. Prigg 1, J. Hickey 1, L. Kerr 1, L. Taylor 1, J. Ogden 1, L. Lewis 1, D. O’Connor 1Glen Eira: I. Delac 1, N. Rudich 1, C. Massis 1BEST, Monash Gryphons: A. Petsinis, J. Rose, T. Mosley, K. Johnsen, W. Dowd, C. BrumleyGlen Eira: J. Drummond, R. McGirr, J. Haddan, A. Heyward, R. Amro, C. Massis
Kew 3.1, 8.1, 8.2, 13.5 (83)Ivanhoe 1.2, 3.5, 5.7, 8.9 (57)GOALS, Kew: J. O’Keefe 4, B. Van Leeuwen 4, C. Watts 2, A. Hawking 2, M. Vlahos 1Ivanhoe: BEST, Kew: D. Boehm, A. Hawking, A. Michael, J. O’Keefe, B. Van Leeuwen, Z. BrabinIvanhoe:
St Mary’s Salesian 6.9, 12.15, 21.18, 33.24 (222)St Johns 0.2, 0.2, 0.2, 0.3 (3)GOALS, St Mary’s Salesian: S. Gatehouse 6, D. Gook 6, S. Gusts 5, N. Alexopoulos 5, K. Buchanan 2, J. Dickinson 2, H. Angley 2, C. McMahon 2, D. Rajkumar 1, M. Kruze 1, C. Rose 1St Johns: BEST, St Mary’s Salesian: K. Buchanan, J. Dickinson, S. Gatehouse, H. Angley, C. Rose, K. DuerdenSt Johns: G. Chuol, M. De Poilly, A. Hall, B. Moldrich, C. West, J. Ayama
Please email your match reports, thoughts and feelings by Sunday afternoon to [email protected]
20 THE AMATEUR FOOTBALLER 2014
There is only three rounds left and every team in Division 3 still has something left to play for. The battle for fi rst place on the ladder and an undisputed double chance fi red up last weekend when the Northern Blues defeated Emmaus St Leos, placing both sides on equal points with eleven wins. Aquinas and Swinburne are fi ghting for home ground advantage in their own mini-tiff on ten wins each. The well-documented middle of the ladder is as tight as ever, with four teams still vying for the fi nal two places in the fi nals. At the other end of the spectrum teams battle for a combination of hope, avoiding relegation and respect as the regular season draws to its inevitable close.
REVIEWIn a match-up that could be re-lived in the fi rst week of fi nals, Aquinas kept Swinburne University scoreless in the fi rst half to take a 33-point victory and third position on the ladder at Aquinas College. Poor conditions at the Blood’s home ground created a low scoring clash – only nine goals for the contest - as the turf struggles to cope with rigors of continuous football and rain. Michael Niezen was at his brilliant best yet again for Aquinas while Joldy Bradley was dominant in the air for Swinburne who now slide down into fourth position.
The Northern Blues offi cially proved their mettle by recovering from a 20-point half time defi cit to defeat the fi rst-placed Emmaus St Leos by 25-points at Bennettswood Sports Ground. The loss ends an eleven game winning streak spanning back to May 3rd for Emmaus. The Animals and the Blues are now on equal points in fi rst and second on the ladder respectively. Division 3 leading goal-kicker Chris Beluszar kicked seven in the clash while James King, Damon Marcon and Jay Phelan combined for 13 for Northern.
A nine goal to two second half from UHS-VU propelled them to a 51-point win over the Eley Park Sharks and kept them in touch with the top
six. The fi rst half was a scrappy aff air, with both sides managing just three goals apiece. Eley Park’s Grant Deacon looked most likely to break the stalemate with dominant play up forward, however it was the Vulture’s Rhys Kirk (fi ve goals) who put the score on the board at the other end. The Sharks now face a tough fi ght to jump ahead of La Trobe in the fi nal three rounds and remain in Division 3 in 2015.
In the fi ght between the yellow and black sashes, Richmond Central made use of a relentless fi rst half to easily account for South Mornington to the tune of 159-points at Citation Oval. Despite their comfortable defeat, the Tiger’s did show courage by kicking three goals to match the three from the Snakes in the fi nal term. Sam Demeo and Woody Bucci joined forces to kick 10 majors for the Snakes while Nathan Coy found himself in the best players for the eighth time this season for South Mornington. Richmond is now ahead of Albert Park in fi fth position following the win.
In the upset of the round, seven goals from La Trobe’s Jack McMeel were enough to give them a shock 26-point win over Albert Park at La Trobe University. The result ends a seven-game winning streak for the Falcons who struggled up forward without focal point Stuart Maunder in the clash. The win gives La Trobe a one game buff er over Eley Park in the relegation zone while the Falcons are now on equal points with three other sides all battling for the fi nal two places in the fi nals.
The fi nal match of Round 15 was crucial for both sides, as Power House moved a game clear of St Francis Xavier in a spirited 59-point win at Ross Gregory Oval. Power House burst from the blocks, fi red up in the contest, kicking ten goals to one in the fi rst half to put the result beyond doubt by the major break. Ant Voyage’s men spread their goal-kickers evenly with nine contributors for the day to help their cause. St Francis will now need to win all of their last three
STILL NO CAKEWALK
DIVISION 3 — TIPS IN BOLD (YEARS TOTAL 61/68%)
Northern Blues v South Mornington
St Francis Xavier v Swinburne University
Power House v Eley Park Sharks
Albert Park v Aquinas
Richmond Central v UHS-VU
La Trobe University v Emmaus St Leos
www.vafatv.com
DIVI
SION
3Kris Neil @KrisANeil
21THE AMATEUR FOOTBALLER 2014
matches if they hope to play fi nals in 2014.
The Sharks conceded six goals in the second term that allowed Albert Park to take a 35-point lead at half time. Stuart Maunder continued his brilliant form in front of goal with fi ve majors, while James Brick was superb for the Falcons. For the home side, Noel Bahnsen enjoyed a return to form with four majors alongside David Viola and Kenneth Darby who toiled hard all afternoon. The Sharks are tied on La Trobe for points; however they remain inside the relegation zone with a lower percentage.
PREVIEWRichmond Central v UHS-VU: If the Snakes can register their third win in a row it will complete a month of good football and cast fear into the other Division 3 fi nalists. La Trobe University v Emmaus St Leos: The Animal’s fi rst loss in almost three
months should be enough to prompt a return to
their best football and La Trobe have proved they
are no easy-beats. Albert Park v Aquinas: Flip a
coin in this one. Albert Park need the win more to
retain their sixth position on the ladder.
Power House v Eley Park Sharks: Eley Park have
been competitive all year but struggle to put
a winning score on the board, Power House
by three goals. St Francis Xavier v Swinburne
University: A loss for the X-men will all but secure
an early football trip. They’ll need to be at their
best to defeat the Razorbacks. Northern Blues v
South Mornington: A percentage-boosting win
for the Blues can edge them closer to Emmaus
in percentage and a guaranteed double chance.
Aquinas 3.2, 4.6, 4.8, 7.9 (51)Swinburne University 0.0, 0.0, 1.4, 2.6 (18)GOALS, Aquinas: T. Niezen 2, M. Jess 1, M. Cull 1, M. Kershaw 1, J. Perrett 1, M. Prouse 1Swinburne University: R. Lugg 1, C. Wight 1BEST, Aquinas: L. Barnes, M. Niezen, P. Jurkovsky, R. Foster, L. McDonald, M. JessSwinburne University: J. Bradley, M. Lingham, M. Manning, D. Webb, Z. Scrase, N. Mauran
Northern Blues 7.3, 8.8, 13.11, 18.14 (122)Emmaus St Leos 4.5, 11.10, 12.11, 14.13 (97)GOALS, Northern Blues: J. King 5, D. Marcon 4, J. Phelan 4, M. Cigagna 2, N. De Andrade 1, J. Warwick 1, M. Holmes 1Emmaus St Leos: C. Beluszar 7, P. Baranello 2, M. Gartland 2, B. Ellis 1, E. Mitchell 1, A. Smith 1BEST, Northern Blues: J. Phelan, M. Holmes, J. King, N. Parkes, R. Jepson, D. MarconEmmaus St Leos: D. Hill, C. Beluszar, P. Baranello, M. Lalor, M. Davis, T. Thorn
La Trobe University 4.3, 5.5, 6.5, 11.6 (72)Albert Park 0.0, 3.1, 5.3, 7.4 (46)GOALS, La Trobe University: J. McMeel 7, D. Weiss 1, B. Dowler 1, S. Field 1, J. Hickey 1Albert Park: N. Sjostrom 2, B. Gellie 1, J. Harrison 1, A. Snowden 1, A. Mackay 1, M. Lanigan 1BEST, La Trobe University: G. Dowler, J. McMeel, A. Rae, S. Field, A. Long, G. LinghamAlbert Park: K. Murray, M. Lanigan, J. Brick, T. Smoker, J. Harrison, N. Cattle
Power House 6.2, 10.2, 15.6, 17.7 (109)St Francis Xavier 0.2, 1.4, 3.6, 7.8 (50)GOALS, Power House: G. Tubridy 3, S. Confait 3, N. Moresi 3, T. Collett 2, L. Johnston 2, D. Burnside 1, B. Kyne 1, A. Collett 1, R. Gregory 1St Francis Xavier: J. Day 2, B. O’Hara 2, D. Scott 1, A. Burns 1, J. Roberts 1BEST, Power House: S. O’Leary, N. Moresi, A. Collett, S. Confait, A. Reynolds, D. BakerSt Francis Xavier: B. O’Hara, J. Lenders, C. Hughes, J. Lafranchi, J. Day, L. Andrews
Richmond Central 12.5, 18.11, 25.15, 28.22 (190)South Mornington 0.0, 1.0, 2.0, 5.1 (31)GOALS, Richmond Central: S. Demeo 6, W. Bucci 4, J. Sharp 3, L. Carland 3, K. Schoenmaekers 3, B. McGoldrick 2, R. Costanzo 2, B. Herbert 1, D. Holland 1, T. Baker 1, S. Bugeja 1South Mornington: B. Hallas 1, J. Bishop 1, D. Droscher 1, S. Pope 1, N. Coy 1BEST, Richmond Central: S. Ward, S. Demeo, J. Sharp, J. Nicholson, N. Anstey, D. HollandSouth Mornington: I. Davies, N. Coy, W. Spencer, L. Kelly, B. Rolls, D. Droscher
UHS-VU 1.2, 4.4, 9.13, 13.13 (91)Eley Park Sharks 2.2, 3.4, 4.5, 5.10 (40)GOALS, UHS-VU: R. Kirk 5, R. Smith 2, D. Benstead 1, R. Matthews 1, K. Barnes 1, E. Ramsay 1, T. O’Halloran 1, E. Clarke 1Eley Park Sharks: A. Olson 2, D. Crawford 1, T. Hudson 1, N. Bahnsen 1BEST, UHS-VU: R. Smith, K. Benstead, A. Kirk, S. McSweeney, J. Healey, J. AhmedEley Park Sharks: G. Deacon, C. Olson, D. Viola, T. Hudson, K. Darby, A. Olson
Aquinas 1.2, 4.7, 5.11, 7.12 (54)Swinburne University 2.2, 2.3, 3.3, 4.3 (27)GOALS, Aquinas: N. Spencer 2, B. O’Loughlin 1, J. Hamilton 1, L. Fringuelli 1, D. Lord 1, K. Rosewarne 1Swinburne University: J. Perillo 3, O. Taylor 1BEST, Aquinas: B. O’Loughlin, J. Bott, C. West, P. Fringuelli, K. Rooney, S. PorterSwinburne University: J. Carson, D. Hadzic, J. Perillo, K. Finn, R. Moloney, A. Hyman
Emmaus St Leos 3.3, 8.5, 11.8, 15.11 (101)Northern Blues 1.1, 1.6, 2.8, 3.10 (28)GOALS, Emmaus St Leos: N. Hodder 6, P. McGloin 2, J. Webb 2, A. LaRiccia 2, T. Canny 2, P. Jones 1Northern Blues: B. Passey 1, P. David 1, J. Mastin 1BEST, Emmaus St Leos: J. Page, T. Canny, N. Hodder, P. McGloin, C. Hadjiantonakis, J. WebbNorthern Blues: C. Paterson, M. Thompson, J. Thompson, B. Passey, L. Spiller, B. Bliss
La Trobe University 2.5, 5.6, 9.8, 12.10 (82)Albert Park 2.0, 2.4, 2.6, 3.8 (26)GOALS, La Trobe University: S. Marchitto 4, M. Harney 2, D. Rodger 1, T. Quirk 1, D. Francis 1, F. Canobie 1, C. Ruwoldt 1, S. Woollard 1Albert Park: L. Main 2, R. Sloan 1BEST, La Trobe University: M. Steiner, C. Taylor, S. Marchitto, E. Buff on, M. Harney, B. TonkinAlbert Park: B. Murnane, J. Smith, A. Waycott, G. Mihelakos, L. Main, T. Wright
Power House 2.8, 6.10, 9.12, 16.19 (115)St Francis Xavier 2.0, 4.0, 5.0, 6.0 (36)GOALS, Power House: P. Arnold 4, P. Mackney 2, C. Reid 2, C. Devaney 2, H. Miller 1, B. Griffi n 1, S. Circosta 1, E. Edwards 1, C. Young 1, G. Murphy 1St Francis Xavier: J. Williams 2, S. Greely 2, D. Johnstone 1, D. Butcher 1BEST, Power House: J. O’Doherty, C. Devaney, D. Buckley, P. Mackney, M. Devine, P. O’GradySt Francis Xavier: D. Johnstone, B. Sheehan, D. Butcher, L. Hall, J. Williams, S. Darlison
Richmond Central 4.3, 5.4, 9.6, 12.9 (81)South Mornington 1.0, 6.2, 8.4, 10.5 (65)GOALS, Richmond Central: South Mornington: BEST, Richmond Central: South Mornington: J. Clarke, J. Millar, C. Joshua, D. Clarke, T. Wilson, N. Douglas
UHS-VU 4.1, 8.3, 11.9, 15.12 (102)Eley Park Sharks 1.2, 2.5, 3.7, 5.9 (39)GOALS, UHS-VU: M. Sweeney 7, R. Dickson 4, A. Bossie 1, W. Smith 1, J. Bullen 1, A. Thomasse 1Eley Park Sharks: T. Houlden 4, L. Booth 1BEST, UHS-VU: A. Bossie, A. Thomasse, S. Cracknell, C. Marchio, O. Malyon, M. SweeneyEley Park Sharks: T. Houlden, T. Scholtes, S. Pertz, A. Chandramouli, A. Stevenson, L. Paolini
DIVISION 3 LAST ROUND DIVISION 3 RESERVE
Please email your match reports, thoughts and feelings by Sunday afternoon to [email protected],au
22 THE AMATEUR FOOTBALLER 2014
Whilst the rest of the Commonwealth mulls
over the inspirational gold medal performance
of the Hockeyroos and Genevieve LaCaze’s
‘stage-bomb’ in Glasgow, the water-cooler talk
for Division 4 fans this week will no doubt have
centred around Manningham’s triumph over
their namesakes. Sustained eff ort and hard
work from North Brunswick in recent weeks
fi nally paid off as they enjoyed a rare 2014
win. Meanwhile at Rathmines, the Hawks left
Westbourne Grammarian’s season hanging by
a thread as they comfortably accounted for the
rebirthed club. These results opened up a gorge
between the top four sides and the followers,
whilst providing an exciting taste of things to
come when the fi nals roll around.
After several cases of ‘close but no cigar’, the Bulls
blitzed Box Hill North to register a well-deserved
third win for the season. Despite having to call
upon several reserves players, the home side put
in a dominant four-quarter display. The Bulls were
spearheaded by Robbie ‘Stalker’ Santacroce who
was involved in everything and fi nished with fi ve
majors. Across the ground Campbell Hynam-
Smith and Scott Rymer were productive as North
Brunswick increased their lead at every change.
Michael Tilley and Sean Donovan were gallant in
defeat, whilst Toby Manning collected four goals
for Box Hill North. The result has spirits high in
the North of Brunswick and all but ends Box Hill
North’s slim hopes of playing fi nals football.
The battle of the Cobras was a venomous
encounter that has virtually sewn up the top four
and the order in which they’ll fi nish. An explosive
fi rst half from Canterbury was countered by
one of the best quarters of the season from
any Division 4 side. Manningham produced an
incredible eight goals to one performance in the
third to steal the lead. Despite the win, inaccurate
kicking nearly cost Manningham in the last
quarter – something they will be looking to
address in the lead up to September. Thomas Bell
continued his stellar season for Manningham.
Solid form from him and Stuart Fisher was the
platform from which Michael Muller was able to
collect fi ve goals. Brett Johnson, Tom Eckersley
and Rohan Walmsley were the most eff ective for
Canterbury, all of them multiple goal kickers. The
result of this match lengthens the abyss between
the top four and the rest. Barring an absolute
meltdown, it would be fair to assume that the
current standings in the top four will sustain until
the fi nals begin.
The Dragons put the sword to the Synners at
Keeley Park. Despite off ering stiff competition for
the fi rst half, Chadstone were unable to match
the relentless intensity of their opponents.
The Dragons will be pleased with a dominant
performance that saw them share the workload.
Four targets up front collected three or more
goals – Pasquale Torcasio the best of them
with four. The Dragons will hope to ride the
momentum from this result as they hunt for
another 2014 win. Chadstone however, will have
their work cut out for them when they meet the
in-form North Brunswick later this afternoon.
The Hawks kept their immaculate season in
tact with an unremitting seventy-eight point
drubbing of Westbourne Grammarians. The
usual suspects Sam Gold, Jason Ince and Sean
Stormonth were uncontainable inside the
forward fi fty. They were well assisted with regular
quality service from Paul Nunan and Davids
Pritchard and Kennedy through the middle. Chris
Sneddon and Adam Imber were admirable in
defeat, however the diff erence in class between
MANNINGHAM SHUT TOP FOUR DOOR
DIVISION 4 — TIPS IN BOLD (YEARS TOTAL 64/85%)
Canterbury v Hawthorn
Box Hill North v West Brunswick
Chadstone v North Brunswick
Manningham Cobras v Point Cook
Westbourne Gr. v Dragons
www.vafa.com.au
DIVI
SION
4Ryan ‘Hammy’ Goodman @HandsomeHammyG
23THE AMATEUR FOOTBALLER 2014
the two sides was apparent throughout the
afternoon. Grammarians will now need to win
all of their remaining games well, and hope that
Manningham hit the self-destruct button to
stand a chance of squeezing in to the four.
The Bulldogs produced a gallant eff ort at the
pristine Saltwater Reserve as they went down
to West Brunswick. The Pies set the game up for
themselves with a dominant second term. The
second half was a matter of going through the
motions, and given the state of aff airs towards
the top of the ladder, West Brunswick seemed
happy to oblige. Evan Lloyd was outstanding in
his ninety-ninth game for the Magpies, whilst
Anthony Gibson and Adam Ross enjoyed the
extra space on the wings. Dylan Walker was a
tower of strength with a fi ve-goal haul. Robbie
Milne and, as always, Mason Kip were the pick of
the litter for the Dogs who now fi nd themselves
out of fi nals contention.
Canterbury will be looking to bounce back
quickly after their narrow loss, but they face
the ultimate test when they host Hawthorn
this afternoon. West Brunswick will be looking
to stamp some authority on the competition
against a side who are now only playing for pride.
North Brunswick have a golden opportunity to
earn back to back wins. Manningham will be hard
to stop off the back of last week’s brilliant result
and Westbourne Grammarians will be desperate
to stay in the race. Whilst things appear settled
up the top towards the pointy end, as we all
know, things can change very quickly in footy…
DIVISION 4 LAST ROUND DIVISION 4 RESERVE
Dragons 5.5, 9.10, 10.15, 15.20 (110)Chadstone 4.1, 6.4, 7.5, 7.6 (48)GOALS, Dragons: P. Torcasio 4, H. Vuong 3, T. Lowden 3, S. Suon 3, P. Rueda 1, M. Babar 1BEST, Dragons: H. Vuong, P. Torcasio, J. Tait, P. Rueda, V. Nguyen, C. Kuang
Manningham Cobras 3.3, 8.7, 16.11, 17.15 (117)Canterbury 7.1, 12.4, 13.5, 17.7 (109)GOALS, Manningham Cobras: M. Muller 5, S. Newton 3, B. Hawker 2, B. Helme 1, T. Bell 1, M. Davies 1, A. Pianto 1, C. Jolly 1, S. Fisher 1, D. Wolfgramm 1Canterbury: B. Johnson 4, R. Walmsley 3, T. Eckersley 3, A. Baker 2, J. Price 1, C. Woods 1, B. Peel 1, C. Skate 1, L. Giles 1BEST, Manningham Cobras: T. Bell, M. Muller, S. Fisher, S. Leonard, P. Wood, S. NewtonCanterbury: B. Johnson, M. Higgins, T. Eckersley, B. Peel, R. Walmsley, R. Gates
Hawthorn 5.2, 11.5, 13.10, 21.15 (141)Westbourne Grammarians 3.4, 4.5, 6.8, 7.11 (53)GOALS, Hawthorn: S. Gold 5, J. Ince 4, G. Edmond 3, S. Stormonth 3, N. Raiti 2, M. McNeill 2, D. Pritchard 1, J. Ridley 1 Westbourne Grammarians: N. Schiano 2, A. Imber 1, C. Sneddon 1, S. Wallace 1, M. Culliver 1, N. Arias 1BEST, Hawthorn: P. Nunan, D. Pritchard, D. Kennedy, D. Monohan, K. Davies, N. RaitiWestbourne Grammarians: C. Sneddon, A. Imber, J. Humphreys, T. Rogers, E. Karageorge, J. Johns
West Brunswick 5.2, 10.5, 12.7, 13.10 (88)Point Cook 4.3, 5.6, 6.12, 9.13 (67)GOALS, West Brunswick: D. Muscat 5, N. Mitchell 2, A. Gibson 1, A. Commins 1, M. Holmes 1, P. Carroll 1, Z. Tisdale 1, J. Turner 1Point Cook: H. Wilkinson 2, P. Hegarty 2, R. Milne 1, C. Cox 1, M. Herbertson 1, J. Mandahl 1, A. Robinson 1BEST, West Brunswick: E. Lloyd, C. Bull, A. Gibson, Z. Tisdale, M. Thompson, A. RossPoint Cook: R. Milne, M. Kip, B. Langley, P. Hegarty, S. Percival, J. Mandahl
North Brunswick 5.4, 7.7, 10.12, 16.16 (112)Box Hill North 4.2, 4.8, 5.10, 8.14 (62)GOALS, North Brunswick: R. Santacroce 5, C. Hynam-Smith 2, K. Zuidema 2, T. Blount 2, D. Manoukian 2, G. McMonigle 1, S. Rymer 1, R. Dowsett 1 Box Hill North: T. Manning 4, R. Ball 2, B. Pearce 1, J. Howarth 1BEST, North Brunswick: R. Santacroce, C. Hynam-Smith, S. Rymer, S. Mair, C. Temperley, T. Blount Box Hill North: S. Donovan, M. Tilley, K. Robinson, C. Lee, E. Charles, B. Watt
Chadstone 2.3, 6.4, 7.7, 8.8 (56)Dragons 3.0, 4.4, 5.9, 5.12 (42)
Manningham Cobras 3.5, 6.8, 10.11, 11.17 (83)Canterbury 2.1, 7.2, 9.2, 11.3 (69)GOALS, Manningham Cobras: D. Wills 3, A. Egan 2, B. Mc Hugh 2, P. Vaughan 1, A. McDill 1, A. Bullen 1, J. Jewson 1Canterbury: Z. Zainal 5, D. Porta 2, C. Mason 1, J. Doak 1, D. Perera 1, M. Small 1BEST, Manningham Cobras: R. Mundy, B. Mc Hugh, J. Sotto, K. Ng, A. Bullen, T. TwynhamCanterbury: Z. Zainal, J. Doak, A. Stals, D. Perera, D. Porta, M. Small
Hawthorn 5.4, 12.7, 19.9, 24.13 (157)Westbourne Grammarians 0.2, 0.4, 2.5, 2.5 (17)GOALS, Hawthorn: J. Jackomos 9, R. White 5, T. Bowler 2, J. Ward 2, D. Lauletta 2, C. Bilton-Gough 1, M. Jones 1, X. Hallam 1, M. Laing 1Westbourne Grammarians: S. King 1, M. Chodowski 1BEST, Hawthorn: L. Chapman, J. Jackomos, T. Bowler, C. Bilton-Gough, R. White, X. HallamWestbourne Grammarians: K. Miller, J. Richardson, R. Binney, H. Wyatt, J. Crumpton, R. Fuentes
West Brunswick 4.5, 7.10, 14.16, 24.18 (162)Point Cook 0.1, 1.6, 1.6, 2.6 (18)
Box Hill North 6.5, 9.6, 12.12, 19.14 (128)North Brunswick 1.2, 4.2, 5.3, 6.7 (43)GOALS, Box Hill North: D. Piccioli 5, G. Cavallo 3, G. Williams 2, A. Obialor 2, J. Cope 2, A. Nyhuis 1, S. Stephens 1, J. Phillips 1, J. Irish 1, U. Khan 1North Brunswick: S. Wernham 2, B. Cornish 1, S. Barrett 1, D. Ilardi 1, T. Geary 1BEST, Box Hill North: D. Piccioli, A. Nyhuis, U. Khan, A. Obialor, K. Axten, S. StephensNorth Brunswick: B. Dancer, B. Cornish, J. Hayes, T. Geary, L. Selkrig, L. Spano
Please email your match reports, thoughts and feelings by Sunday afternoon to [email protected]
24 THE AMATEUR FOOTBALLER 2014
NEXT WEEKS GAMESPREMIER
Collegians Beaumaris 14:00
De La Salle Old Brighton 14:00
Old Scotch St Bernards 14:00
Old Trinity University Blacks 14:00
Old Xaverians St Bedes/Mentone Tigers 14:00
PREMIER B
Old Carey Old Haileybury 14:00
Old Ivanhoe Caulfi eld Grammarians 14:00
University Blues AJAX 14:00
Mazenod St Kevins 14:00
Fitzroy Old Melburnians 14:00
PREMIER C
Hampton Rovers Oakleigh 14:00
Marcellin Banyule 14:00
Monash Blues Ormond 14:00
Parkdale Vultures Peninsula 14:00
P E G S Old Camberwell 14:00
DIVISION 1
NOBS/St Pats Old Mentonians 14:00
Yarra Valley MHSOB 14:00
Therry Penola Whitefriars 14:00
Old Geelong Bulleen Templestowe 14:00
Williamstown CYMS Prahran Assumption 14:00
DIVISION 2
Elsternwick Ivanhoe 14:00
Old Eltham Collegians Glen Eira 14:00
Kew St Johns 14:00
Monash Gryphons Old Paradians 14:00
Sth Melbourne Districts St Mary's Salesian 14:00
DIVISION 3
Albert Park Richmond Central 14:00
Eley Park Sharks La Trobe University 14:00
Emmaus St Leos Power House 14:00
Northern Blues Aquinas 14:00
Swinburne University South Mornington 14:00
UHS-VU St Francis Xavier 14:00
DIVISION 4
West Brunswick Chadstone 14:00
Manningham Cobras Dragons 14:00
North Brunswick Point Cook 14:00
Box Hill North Hawthorn 14:00
Westbourne Gr. Canterbury 14:00
MEGT UNDER 19 PREMIER
Beaumaris De La Salle 14:00
Old Melburnians Old Scotch 14:00
St Bedes / Mentone Tigers St Bernards 14:00
St Kevins Old Xaverians 14:00
UNDER 19 SECTION 2
Mazenod Parkdale Vultures 14:00
Old Brighton Caulfi eld Grammarians 14:00
Old Trinity University Blacks 14:00
University Blues Collegians 14:00
Whitefriars Fitzroy 11:40
UNDER 19 SECTION 3
Marcellin Williamstown CYMS 14:00
Old Carey AJAX 14:00
Old Ivanhoe Old Xaverians 9:20
St Mary's Salesian Old Camberwell 14:00
UNDER 19 NORTH
St Bernards Yarra Valley 14:00
Ivanhoe P E G S 14:00
Wyndham Suns La Trobe University 14:00
Whitefriars Therry Penola 14:00
Northern Blues Banyule 9:20
UNDER 19 SOUTH
Oakleigh Peninsula 11:40
Ormond De La Salle 14:00
Old Haileybury Hampton Rovers 14:00
Collegians Monash Blues 11:40
Beaumaris MHSOB 11:40
VAFA COLTS
Westbourne Gr. Williamstown CYMS 11:40
Mazenod UHS-VU / Flemington 9:20
St Bernards Point Cook AFC 11:40
University Blues Old Paradians 11:40
PREMIER THIRDS
University Blues Old Scotch 9:20
Collegians St Bernards 9:20
Old Xaverians University Blacks 11:40
Old Melburnians Bye
PREMIER B THIRDS
Beaumaris Old Carey 11:40
Old Trinity Mazenod 11:40
AJAX Old Xaverians 11:40
Caulfi eld Grammarians Fitzroy 11:40
Old Brighton St Kevins 11:40
PREMIER C THIRDS
Marcellin Ormond 11:40
St Kevins Hampton Rovers 11:40
St Mary's Salesian P E G S 11:40
Old Ivanhoe Parkdale Vultures 12:00
Monash Blues Bye
CLUB XVIII (1)
Sunday 17th Aug , Preliminary Final 2:00pm Sportscover Arena
CLUB XVIII (2)
Sunday 17th Aug, Preliminary Final 11:40am Sportscover Arena
CLUB XVIII (3)
Sunday 17th Aug, Preliminary Final 9:20am Sportscover Arena
25THE AMATEUR FOOTBALLER 2014
26 THE AMATEUR FOOTBALLER 2014
PREMIERRADIO BROADCAST GAME LISTEN LIVE ON 96.5FM
1 Ben Jakobi2 Matthew Gadsden3 Tom Jakobi4 Josh Homann5 Andrew Edge (CC)6 Jimmy Davis7 Michael Dewar8 Jordan Pascoe9 Andrew Dewar10 Jon Edge11 Dylan Verney12 Ollie Cavallaro12 Michael Tragear13 Nick Coroneous14 Thomas Clarke15 Ben Gadsden16 Kieran Rawlinson17 Ben Jarick18 Brendan Blatt19 Tom Mentiplay21 Tim Fogarty 22 Niall Collins23 Michael Karayannis24 Jon Perrett (CC)25 Riley Cummin26 Ben Austen27 Lachie Nicholls28 Matthew Smith29 Josh Dickerson30 Tom Skewes30 Levi Otto31 Jack Davis32 Charlie King33 Nick Marston34 Tom Mariani35 Luke Forato36 Marshall Pascoe37 Harry Cannon38 Callum Nicholls39 Tom Gunning40 Zac Alcott41 Marcel Bruin
42 Leigh Hendra43 David Fallon44 Daniel Anthony45 Lachie Anthony46 Tim Cooney47 Brett Felsenthal48 Sebastian Zaia49 Matt Browning50 Andrew Ogilvie51 Dale Anderson52 Stuart Hooy54 Will Bardoel55 Michael Fort-Williams56 Jack White57 Alex Dick58 Nick Materia59 Luke Healy60 Pat Kelly61 David Naughton62 Zack Price63 Zack Wilson
Coach: Simon WilliamsAssistant: David PatersonReserves: Ross Stewart
OLD BRIGHTON
1 Sam Thompson (VC)2 Ashley Lim3 Matthew Peric4 Nick Jamieson5 James Sansom6 Jack Bull7 Jordan Clarke8 Lachie Hill9 Scott Sherwen (CC)10 Mark Passador (CC)11 Charlie Long12 James Bowden13 Richard Wilkinson14 Adam Houlihan15 Andrew Jelbart16 Shane Neaves17 Gene van den Broek18 Caillin O’Shannessy19 Tom Harkness20 Sam Neil21 Ned Walmsley22 Hugo Perry23 Max van den Broek24 Jack Davis25 Max Davis26 Will Strange27 Robbie Ferraro28 Justin Nikolovski29 Chris Watts30 Mitch Bradley31 James Long (VC)32 Richard Eva33 Henry Dick34 Sam Barnett35 Callum Goldby36 Nick Clay37 Sean Leith (RC)38 Lachie Cooper39 Charles Dixon40 Angus Harlock41 Hayden Calway42 Tom McKinley43 Stephen Hodges44 Jack Furey45 Jack Hurley46 Max Wills47 Matthew Seed48 Fraser Macfarlane49 Ed Lower50 Alex O’Shannessy
51 John Daggian (3rds C)52 Josh Raines53 Conor O’Beirne54 Ed Furey55 Nich Cox56 Tim Mead57 Rupert Wills58 Andrew Hummerston59 James Parsell60 Scott Wilcox61 Tom Holding62 Kieran McShane63 Chris Docker64 Tristan Bowman65 Fergus McKenzie66 James Carrington67 Matthew Jane68 Will Hewson69 Alex van Ryn70 Blood Jumper71 Nich Reddish72 Nick Lindsay73 Tom Hamilton74 Robert Hays75 Lachie McDonough76 Pat Oughtred77 Jacob Clark78 Nic Poliakow79 Will Carroll80 Evgeni Routman81 Tim Melville82 Will Ponsford83 Alex King84 Will Mackintosh85 Angus Tummel86 Scott Sansom87 James Halbert88 Call McDonough89 Matthew Parisi90 Sam Muttdon91 Ben Summerfi eld92 Pete Hodges93 Blood Jumper94 Maurice Clayton95 Blood Jumper96 Blood Jumper97 Cohan McDermott98 Angus Greenaway99 Ed Barlow
Coach: Dean Anderson & Stuart PowellAssistants: Steve Crisp, Christian Neeson, Matthew Bott, Kemble Edelsten & Ian LeithReserves: Christian NeesonAssistant: George Dick, Tim Green, Nick Allen & Will LewisThirds: Tristan Foenander
OLD SCOTCH
27THE AMATEUR FOOTBALLER 2014
PREMIER
1 Matt Duggan2 Robert Cathcart3 Matt Petering4 Sean Coote5 Tom Abbott6 Lachlan Howes7 Tom Dean (C)8 Josh Ward9 Doug Pritchard10 Nick Loucaides11 Scott Braithwaite12 Scott Gower13 Will Murton14 Luke Casey-Leigh15 Raphael Clarke16 Sam McBain17 Anthony Carroll18 Will Edmonds19 Joel Di Natale20 Cal Buckley21 Mitchell Howes22 Steven Scott23 Jonno Nash24 Mitchell LaFontaine25 Travis Woolnough26 Michael DeFontenay27 Brayden Haynes 28 Mick Millar29 Jordan Thompson30 Will Mattingley31 Tom Gandy33 Matt Stevens34 Michael Globan35 Sean McNicholas36 Ben McLean36 Scott Kendall37 Elliott Harris38 Michael Wilson39 Luke McNicholas40 James Bull41 James Lapa41 Dylan Gabron-Uhe
42 Tim Pritchard43 Luke Edmondson44 Pete Richter45 Greg Roberts46 Luke Sketchley47 Tom Perkin48 Frasier Cloney49 Luke Slater50 Bane Suboticki51 Tyson Rayner52 David Brearley53 Sean Brennan54 Scott Moore55 Will Gillespie56 Oliver Webber57 Jack Richter58 Ryan Bennett59 Germaine Ivanka60 Mitch Bourne61 Lucas Bourne64 Alex Edmondson66 Robert Wilson67 Brad Kilgore68 Byron Hughes72 Mark Ensor
Coach: Stephen LawrenceAssistants: Mick Lovejoy, Sam HeckerReserves: Alex Bennett
BEAUMARIS
http://altitudevolvocars.com.au
1 Jake Walsh 1 Dayne Coulsen-Hoffacker 2 Kristian Butler 3 Harry Tinney 4 Ned Hunt 5 Dan Chamberlain 6 Heath Banfi eld 7 Brendan Iezzi (C)8 Ben Howell 9 Matthew Kilpin 10 Jack Osborn 11 Kris Spassopoulos (RVC)12 Luke Pacconi (VC)13 David Wildsmith 14 Gabe Hamilton 15 Cam McCasker 16 Emerson Satur 17 Jack Hunt 18 Ed Weatherson 19 Nick Howell (VC)20 Chris Riggs 21 Tim Howell 22 Brett Barratt 24 Brett Robertson 25 Will Oldfi eld 26 Andrew Kyriacopoulos 27 Sebastian Nicolosi 28 Christos Manoussakis 29 Nick Chamberlain 30 Alex Hasiotis 31 Callum Pohl 32 Anthony Scott 33 Mark Yeoman 34 Jack Gale 35 Tom Bennett 36 Sean Hanrahan 37 Michael Cooper 38 Jake Steinhart 39 Simon Murphy (RVC)40 Peter Mescher 41 Fergus Stewart 42 Scott Meighan (RC)43 Alex Heuston
44 Matt Coutts 45 Angus Milham 46 Henry Winter 47 Ed Beasley 48 James Spassopoulos 49 Dan Ahearne 50 Nathan Merzvinskas 51 Luther Juric 52 Ted Mitchell 53 Hugh Tyson 54 Andrew Coughlin 55 Joe Campbell 56 Alex Prittie 57 Steve Lawrence 58 Thomas Moore 59 Reggie Smith 60 Nathan Valkanis 61 Alex Syme 63 Stuart Cade 64 Andrew Kinross 65 Nick Pearce 66 Andrew Medland 67 Alex Polidoros 68 Will Bowman 70 Callum Rae 74 Richard Mason
Coach: Adam AndrewsAssistant: Gerard Sholly, Lucien Dean-JohnsReserves: Peter Lawrence
OLD TRINITY
28 THE AMATEUR FOOTBALLER 2014
PREMIER
1 Jake Williams2 Chris Santalucia3 Sam Lees4 Matt Jenkinson5 Caydn Beetham6 Benjamin Kennedy7 Michael Darvell (C)8 Andy Biddlecombe9 Chris Smith10 Damien Ryan11 Luke Barry12 Brendan Goss13 Cauley Beetham14 Josh Douglas 15 Matt Skidmore16 Louis Tiernan17 Chris Larkins 18 John Shaw19 Tim Dynon20 Marcus Allan21 Chris Waller22 Louis Denton23 Lachlan Smith24 Cam Purss25 Tom Williams26 Nick Wynne27 Robbie Ralph28 Tom Crapp29 Matt Handley30 Murphy Ambrose31 Matt Ball 32 Denis Symeopoulos33 Matt Margin34 Pat Allan35 Ed Lachal 36 David Sapuppo37 Daniel Harangozo38 Matt Douglas39 Michael Hannan
40 Jarryd Skene41 Esmond Prowse42 Jonno Close43 Pat Tiernan44 Matt Walsh45 Lachlan Keith46 Josh Anderson47 Daniel Prowse48 Declan Pittonet49 Jonathan Pintal 50 Ben Plant51 Charlie Woodley52 Tristan Parker53 Chris Margin54 Dan Barry55 Julian Darrer56 Michael Henderson57 Nathan Drummond58 Anthony Ongarello59 Andrew Mathis60 Matt Sitch61 Nick Ielasi62 James Mcelhinney63 Harry Healey64 James Forrest
Co-Coaches: Simon Lethlean & Pat HawkinsSenior Assistant: Ted Woodruff Assistants: Matt O’Hanlon, Tim Clarke, Tim Ockleshaw, Andrew Brushfi eld & Luke Gladman
OLD XAVERIANS
1 Tom Curry 2 Jacob Williams3 Matthew Moore4 Charlie Haley5 Michael Stizza6 Tyson Hunt7 Tom Humphrey8 Tom McMahon9 Harry Haley10 David Lowe11 Edward Clinch12 Matthew Fieldsend (C)13 Jacob Gotch (C)14 Joshua Slade15 Tim Allan16 Oscar Persson17 Sam Williams18 Ben Humphrey19 Ryan McDonough20 David Hutchinson21 Daniel Close22 Aaron Kneebone23 Sebastian Gotch24 Antony Forato25 Lachlan Bull26 Stephen Wall27 Adrian Indovino29 Nick Fyfi eld30 Joel Phillips31 Joshua Fisher32 Joshua Oakley33 Mitch Carney34 Aaron Wheatley35 Justin Baxter36 Ben Oakley37 Ed Murphy38 Liam Wood39 Daniel Millwood40 Joel Mattiske41 Hamish Ramsey42 Nick Hyland43 Luke Williams44 Tim Kovess45 Steven Hogan46 Luke Jarvis
47 Sefton McGraw48 Ed Espinosa49 Luke Gogis50 Jason Terrell51 Charlie Athanassiou52 Tom Moloney53 Matt Hamilton54 Simon Lowe (RC)55 Jackson McKay56 Garrett McDonough57 Michael De Luca58 Mitch Carter59 Jack Jarvis60 Jordan Bull61 Chris Cavanagh62 Declan Freeman63 Chris Hyde64 Shane Griffi n65 Sam O’Donnell66 Tyson Parker67 Beau Hill68 Kieran Grant69 Nick Hogan70 James Meade 71 Simon Byers72 Matthew Allan73 Joe Mannix74 Luis Godhino75 Matthew Hogan
Coach: Paul SatterleyAssistants: Michael Brown, Tom Madigan, Ash LeverReserves: John McDonoughThirds: Phil Proy
DE LA SALLE
SPONSORS
29THE AMATEUR FOOTBALLER 2014
PREMIER
1 Alexander Croft 2 Billy Burstin 3 Charlie Holst 4 Nick Ries 5 Andrew Scott 6 Gareth Jones 7 Shura Taft 8 Julian Eimutis 9 Michael Dyer 10 James Jorgensen 11 Dylan Chaplin Burch 11r Luke Casey 12 Simon Hall 13 Josh Cashman 14 Sebastian Evans 15 Matthew Yates 16 Matthew Barton 17 Courtney Hylton (VC)18 Trent Zimbachs (C)19 Stuart Inglis 20 Tim Phillips 21 Hunter Pool 22 Nathan Giles 23 Wil Tardif (VC)24 Toby Goodman 25 James Kondarovskis 26 Jesse Band Conrick (RC)27 Matthew Singleton 28 Tom Penberthy 29 James Dunn 30 Josh Kamener 31 Lindsay Apted 32 Sam Hibbins 33 Lachlan Ferguson 34 Harry Croft 35 Anthony Carydias 36 Nick Corp 37 Andrew Howison 38 Justin Clark
39 Chris Jesaueluk 41 Dominic Russo 42 Jack Parsons 43 Ed Malone 44 Alistair Fahie 45 Andrew Stone 46 Julian Hampton 47 Alex Barr 48 Sam Doupe-Watt 50 Sam Adams 52 James Patterson 53 Billy Riddle (RC)54 Cameron Bonnar 55 Nicholas Brown 56 Calvin Lyon 57 Charlie Simmons 58 Nick Bobeff 59 Sam Cutts 61 Ed Cordner 64 Bernie Morris 65 Ned Withers 66 Huw Forbes
Coach: Mark HibbinsCoach: Darren BaxterReserves: Matt James, Nick RoachThirds: Nathan Moon
COLLEGIANS
1 Daniel Riley 1R Damien Ryan 2 Ryan Schroder 3 Alex Mcleod 4 Tom Sullivan 5 Adam Bentick (VC)5R Owen McIntyre 6 Jacob Bevanda 7 Michael Angel 8 Nathan Kazuro 8R Justin Evans 9 Ben Considine 10 George Garth 11 Sam Fleming, 11R Liam Mcintyre 12 Chris Peart 13 Thomas Duyndam 14 Nick Cooke 14R Michael Hughes 15 Luke Madden 16 Mitch Hannan 17 Glen Chivers 17R Jake Van Meel 18 Alex Singleton 18R Jarrod Gill 19 Andrew Merrington 19R Sam Firth 20 Shaun Clarke 21 Tom Overman 22 Simon Caven 22R Lachlan Jowett 23 Jake Forder 24 Alex Boyse25 Tom Russell 26 Tom Gleeson 27 Chad Jones 28 Jack Gay 29 Jack Fraser 30 James Weir 31 Lachlan Mcleod32 Tom Caven (C)32R Jake Wright 33 David Wall 34 Nick Burgin 35 Ben Peart 36 Brad Cooper 37 Pat Macdonough 38 Isaac Madden 39 Jack Saundry 40 Josh Madden 41 Jake Calvert 42 Adrian Corsetti 43 Matt Borzillo 44 Zeeshan Awan 45 Steve Cannatelli
46 Michael Moloney 47 Caleb Forder 48 James Bennie 49 Luke Sullivan 50 Pat Gamwell 51 Matt Pear 52 Jesse Manunzio 53 Jonathan Rose 54 Jack Wheeler 55 Malseed Jayden56 Damien Hurley 57 Michael Sulzberger 58 Luke Scerri 59 Peter Le Noury 60 Adam Bevanda61 Mark Salvadori 62 Andrew Gurrisi63 Matt Boscolo 64 Josh Cunningham 65 Taylor Devers 66 Michael Dillon 67 Matthew Feehan 68 Matthew Gurrusi 69 Will Kingston 70 Ned McAllister 71 Matt McCann 72 Daniel Molony 73 Liam Neal 74 Jake Notaro 75 Kieran O’Connor 76 Tim O”Sullivan 77 Paul Rahill 78 Stefan Romeo 79 Danial Segrave 80 Will Sullivan 81 Liam Whelan 82 Seamus Whelan 83 Brendan Ryan 84 Luke Baird 85 Alex Buckley 86 Sasha Bugryn 87 Gerard Christie 88 Jarred Couch 89 Chris Godfrey 90 Aaron Helenius 91 Nick Hughes 92 Thomas Isaacs 93 Sam Jones 94 Clark Mitchell 95 Justin Monaghan 96 Tate Pearson 97 Matt Sargent 98 Nick Shultz 99 Nicholas Toy
Coach: Anthony RockAssistants: Tim Harvey, Matt O’ConnorReserves Coach: Chris DavisAssistant: Gary McIntyre3rds Coach: Kevin Jones, Brian Moon, Chris Cunningham
ST BERNARDS
30 THE AMATEUR FOOTBALLER 2014
PREMIER
1 Paul Wintle2 Luke Wintle3 Michael Curcio4 Pat Kean5 Dan Garside6 Tom Garside7 Steve Doherty8 Tim Doherty9 Chris Richards10 Michael Wintle11 Simon Richards (C)12 Tom Tyquin13 Pat Tyquin14 Hayden Jeans15 Hiwad Shaikaib16 Shaun Glennen17 Mitchell Kent18 Alex Kane19 James Murnane20 Pat Liston21 Sam D’Andrea22 Jamie Maddocks23 Charlie Kinsey24 James Tyquin25 Jack Beckwith26 Michael Barnes27 Cameron Hansen28 Daniel Foot-Connolly30 Chris Mangoni31 Dale Foley32 Trent Bond33 Lachlan Mirams34 Jack O’Kearney35 Brayden O’Toole35R Paul Groves36 Chris McCready37 Jaryd Robertson38 Michael Seeber39 Brett Denton41 Mark Geschke42 Mitchell Coen43 James Symons44 Alex Cross
46 Josh Heron47 Nathan Cerisara48 James Dalzotto49 Fin Neaves50 Alex Whalebone51 Nick Seeber52 Taylor Gogerly53 Jack Hellier55 Tom Foster56 Juy Capp57 Ben Hodges58 Tom McMahon59 John Patounas60 Tim Jeans61 Ben Nicill62 Jamie Popaz66 Damien Waters70 Luke Terrell73 Lewis Stutterd74 Matthew Pitt76 Mitchell Kent
Coach: Mick DwyerAssistants: Jamie Shanahan, Greg SiwesReserves: Steve D’Andrea
ST BEDES/MENTONE TIGERS
SPONSORS
Clear Cut Hairdressing Mentone
Bendigo Bank Parkdale Branch
Buxton Real Estate Mentone
1 Joshua Steadman2 Harrie Lahy3 Scott Myers4 Andrew Willingham (VC)5 Huw Lacey6 Simon Hogan7 Jandre Slabbert8 Tyson Kruse9 Scott Weekley (VC)10 Bede Mahon (C)11 Bart Mill12 Daniel Hunt13 Angus Drysdale14 Simon Thomas15 Lachlan Huntington16 Jesse Laurie17 Peter O’Rouke18 Jason Johnson19 Ben Saliba20 Justin Crameri21 Jason Blake22 Tom Howgate23 Robert Humann24 Isaac Anderson25 Brent Sheahan26 Adam Pattison27 Nick Batten28 Trent Storer29 Scott Dadswell30 Angus Locke31 Clive O’Sullivan32 Steven Flight33 Jordan Foster34 Tyson Roberts35 James Bismire36 Jake Gardiner37 Ben Kealy38 Tom Napier39 Adam Pitt (VC)40 Hugh Curnow41 Joel Ernest42 Charlie Richardson43 Alastair Robbins
44 Hamish Guthrie45 Mitchell Aitken46 Ben Vile47 Tom Brennan48 Alex Williamson49 Andrew Pilbrow50 Jack Heeley51 Michael Coffey52 Henry Robinson53 Tom Sharp54 Cameron Turner55 Sean Butler56 Stephen Judson57 Peter Markworth58 Wayne Curnow
59James Champion de Crespigny
60 Andrew Kraeft61 Damian Kelly62 Jonathon Bunge63 William Van De Fliet64 Sam Bell65 Callum Lawford66 Matthew Witokowski67 Andrew Moore68 Sam Pattison69 Sam Forrest70 Mark Rees71 Sam Aldous
Coach: Cameron RobertsAssistants: Paul Yeomans, Darren CollopyReserves Coach: Xavier Moloney
UNIVERSITY BLACKS
31THE AMATEUR FOOTBALLER 2014
PREMIER B
1 Steven Freemantle2 Tim Smith3 Ben Smithwick4 Jacob Murphy5 Joel Rice (VC)6 James Rimington7 Ryan Bongetti8 Tom Roach9 James Gaff10 Mathew Laidlaw11 Brenton McKenry12 Glen Parker13 James Courtot14 Alistair Stewart-Holmes15 Jarrod Reid (VC)16 Sam Casey17 Col Crowther18 Nicholas Colbert19 Andrew Sloan20 James Murrie
21Lachlan McQueen-Miscamble
22 Sam Rimington23 Cameron Howat (C)24 Marcus Cushen25 James Evans26 Tom Newton27 Shane Zabiegala28 Simon Cust29 Jack Joslin30 Cameron Jones (VC)31 Brett De Leijer32 Bas Simpson33 Luke Marriott34 Freddie Cator34 Nicholas Thompson35 Lachlan Macleod36 Matthew Pallozzi37 Brodie Easton38 Travis Chiuchiarelli38 Luke Mckinnon39 Chris Allen40 Morgan Evans40 Sam Hassett41 Harry Moore
42 Scott Gordon43 Alistar Reed44 Nick Richardson45 Tim Rule46 Simon Bramwell47 Liam Cooney48 Chris Bell49 David Pocock50 Blake Fordham51 Christian Virgona 52 Sam Pentney53 Lochlan Hall54 Henry McQueen-
Miscamble55 Spencer Cambridge56 Lewis Fotheringham57 Harry Maxwell58 Pat Arundel59 Jack Ymer60 Jarret Barber61 William Guiney62 James Coull63 Alexander Moshovelis64 Alex Richardson65 Adrian Morris66 Matthew Roach67 Patrick Cremean68 Tim Wilkins70 Sam Landgren71 Zac Lisle72 Campbell Wallace73 Callum O’Brien74 Tom Macready-Bryan75 Tim Laidlaw76 Simon Lenders77 Andrew Bird78 Rhett Mitchelhill
Coach: Glenn CoxAssistants: Dave Wright, Justin Seabury, James Wagner, Nicholas Thompson
OLD CAREY
1 Nadav Harel2 Adam Caplan3 Asher Burstin4 Jarryd Ludski5 Jason Ritterman6 David Fayman7 Marcus Jankie8 Geoff Measey 9 Gary Blieden10 Daniel Cohen11 Warren Steinberg12 Ezra Poyas13 Michael Shafar14 Jarrod White15 Rubin Winograd16 Nick Marks17 Josh Ludski18 Richie Simon19 Ashley Kalb20 Josh Kalmus21 Noah Rischin22 Luke Peters23 Ari Lewski24 Josh Sacks25 Jake Lew 26 Ben Kalmus27 Josh Givoni28 Dean Steinberg29 Brad Caplan30 Josh Gottlieb31 Josh Dorevitch32 Josh Singer33 Jordan Bade-Boon34 Jason Samuel35 Corey Jankie
36 Danny Markov37 Roi Abraham38 Luke Jankie39 Stuart Fayman40 Joel Gocs41 Jamie Grigorianis42 Ryan White43 Jeremy Forbes44 Michael Selzer45 Zac Leiser-Moore46 Alex Wollan47 Daniel Roth48 Simon Roth49 Josh Mendies50 Alon Abraham51 Ari Wytwornik52 Ben Michowski53 Adam Lerner54 Tim Freed55 Daniel Goodman56 Brandon Joel57 Brett Joffe58 Matt Markoff59 Jordan Tonkin60 Anton Ritterman61 Jarrod Swire62 Dean Rotenberg63 David Glass65 Myles Miller67 Daniel Janover-Rocha68 Noah Keddie69 Daniel Smorgon70 Sam Friede73 Nitsan Miliekowski
Coach: Leigh McQuillenAssistants: Dale Carey, Brent McGrath, David Veale, Darren Seidl & Nick GoldReserves: Adam Slade-JacobsonThirds: Barry Simon
AJAX
32 THE AMATEUR FOOTBALLER 2014
PREMIER B
1 Keegan Stewart2 Ben Price (C)3 Max Slonim3 Matthew Gould4 Aiden Clarke5 Tom Silvestro6 Chris Hammond6 Michael Bowden7 Tim Nixon (VC)8 TJ Rothel9 Will Edwards9 Harrison Mills10 Tim Yelland11 Sean Meredith12 Andrew McGuinness13 Sam Wood14 Alex Ford15 Scott Dickson16 Jackson Leigh17 Declan Reilly18 Tom Small19 Luke Price20 Darcy Daly21 James Shanahan (VC)22 Zac Parsons23 Nick Tonkin23R Chris Fagan24 Chris Game24 John Nankervis25 James Gray26 Matthew Mcternan27 Louis O’Keefe28 Daniel Meddings29 Dominic O’Keefe30 Josh Rogers31 Will Osborn32 Clay Williams33 Damien Simic34 Sean Stewart35 Andrew Spittal36 Lloyd Everett37 Francis McArdle
38 Hugo Gates39 Adrian Bednarek40 Lachlan Kellock41 Jackson Small42 Tom Green43 Woody Eke
44Conor Mengler-Francis
45 Norbert Williams46 Tyler Haugh47 Nick Karoly48 Tom Stewart49 Luke Matias50 Dylan Tobias51 Jake Tobias52 Robert Handel53 Drew Dickson54 Sam O’Sullivan55 Matthew O’Connor56 James Cleeve57 Tom Quinn58 Fred Cooper59 Matthew Wood60 Liam Bourke61 Will Conly62 Peter Mayes63 Andrew Clark64 Simon Tamblyn65 James Easton66 William Berry67 Hugh Goodfellow68 George Berry70 Damien Hay71 Glenn Thomson72 Mitch Bain74 David Roberts75 Tyler Smith
Coach: Tim O’ShaughnessyAssistants: Wayne Oswald, David LandriganReserves: Andrew Strain
CAULFIELD GRAMM
1 Harry Macciolli2 James Beaumont3 Tom Paule (C)4 Tom Healey5 Josh Freezer6 Chris Righetti7 Ted De Fegely8 Al Armstrong9 Pete Kennon10 Lachie Borthwick11 Tom Bachet12 Chris Wischer13 John Cooper14 Sam Gibbons15 Timmy Oman16 Nick Voyage17 Tim McLardy18 Harry Jupp19 Will Thompson20 Guy Brayshaw21 Charlie Cumbrae-
Stewart22 Ed Fanning23 Nick De Steiger24 Tom Hywood25 Cameron Tunbridge26 Billy Hatfi eld27 Marty McCoy28 Jeremy Beaumont29 Lachie Bennett30 Sam Quennell31 Cameron Beck32 Sammy Peacock33 Nick Daish34 Zach O’Neil35 Nick McLardy36 Matt Demicoli37 Chris Barry38 Adrian Karatzas39 Nick Madders40 Oscar Hosking41 Al Ferguson42 Alex Crosby43 Zach Johnston44 Johnny Ross45 Patty Garschagen46 Lewis Haralambous47 Nick Churkovich48 Will Fuller
49 Stephen Land50 Angus Murray51 James Bate52 Jono Phillips53 Alex Thorley54 Mac Webster55 Paul Mishura56 Will Fuller57 James Land58 James Siebert59 Josh Rundell60 Damon Velakoulis61 Alex Coleridge62 Julian Draudins63 Tom De Fegely64 Oscar Dixon65 Toby Dickson66 Tim Spargo67 Sam Playfair68 Tom Watson69 Jim De Fegely70 Rupert Doyle71 Richie Armit72 Will Boyd73 Andy Cameron74 Will Marshall75 Tom Lackman76 Nick Burke77 Cal Williamson78 Chris Lam79 Justin De Steiger80 Ben Rogers81 Max Gibson82 Jack Brandwood83 Rupert Middleton84 Will Beasley85 Morgan Cottee86 Sam Dellios87 Nick Molony88 Stefan Stacey89 Josh McMullin90 Edward Robinson91 Jack Sanford92 Sam Daddo93 Guy Shearman94 Ed Fuller95 Jordan Hooper96 Nick Sloan97 Charles May
Coach: Nathan BrownAssistants: Daniel Hughes, Peter NunnReserves: Chris Hood
OLD MELBURNIANS
33THE AMATEUR FOOTBALLER 2014
PREMIER B
1 Matthew Murphy2 Nick Wood3 Ben Dowd 4 Callum Matheson5 Patrick Dowd6 Steven Salopek7 Charles Ring8 Joshua Gabelich9 Julian Staffi eri10 Karl Wissell11 Elliot Waldron12 Nick McArdle13 Patrick Keely14 James Grinter15 Joshua Taylor16 Jason Salopek17 Patrick Aughton18 Billy Kanakis19 Anthony Kirwan20 Sean Kennedy21 Francis Keely22 Phil Edgar23 Tom Simpson24 Zachary Ginies24 Tom (R) Marchesani25 Lachlan Nankervis26 Matthew Lodge27 Gerard Gleeson28 Edward Ring29 Chris Gleeson30 Tom Cunningham31 Anthony Lynch (C) 32 William Coates33 Jack Weber34 Julian Gambarro35 Patrick McLennan
36 Michael Dolan37 Luke McDonell38 Pana Karageorgiou39 Hamish Townsend40 Anthony Giarrusso41 Tom McPherson42 Matthew Nolan43 Rick Caldow 44 Henry Parkes45 Tom Hickey46 Domenic Losciavo47 John Griffi ths49 Dylan Wissell50 Tim Sharpe59 Hamish McPherson60 Liam Dunne61 Nelson Pryor64 Ray Short66 James Marchesani72 Pat Rhodes74 Ben Marchesani75 Adam Fenech77 Tom Gleeson78 Tom Johnstone84 Jarrod Nash
Senior coach: Daniel HarfordSenior assistants: Jon Edgar, Michael Christian
ST KEVINS
1 Cam Williams2 Jack Townley3 Matt Hart3R Alex Schipp4 Marshall Rippon4R Andy Wettenhall5R Jared Edwards6 Marc James7 Jeremy Mugavin8 Henry Weddell9 Tim Blakey10 Pete Summers11 Hugh Vickers-Willis12 Jack Watts (C)13 Tom Girdwood14 Tom Fairbairn15 Sam Henry16 Paddy Hayes17 Rich Langham18 Dan Zambon19 Matt Torney20 Dom Nixon21 Al Evans22 Jordan Brown23 Sean Carr24 Will Cunningham25 Angus Nice26 Jack Maxwell27R Charlie Craig27 Hugo Steinfort28 George Curnow29 Patrick Gardiner30 Angus Ford31 James Van de Pol32 Riley McMahon33 Tom MacKenzie34 Will Hartnell
35 James Coumans36 David Withers37 Tom Foott38 Ryan Eade39 Dirk Heinz40 Henry Hanlon41 Jack Rutherford42 Jack Wood43 Bennett Merriman44 John Wood45 Damian Barton46 Mick Steinbach48 Hugh Evans50 George Chisholm51 Daniel McFarlane52 Josh Caldow53 Cam McDonald55 Llewyn Butler56 Jason Cowland57 Jack Heinz58 Ed Long59 Jamie Mugavin60 Darcy Del Rio61 Ed Sinnott62 Danial Van de Pol66 Dan Gumley67 Jack Kershaw69 Nick Macrae73 Jesse Pardo74 Ben Jongebloed76 Sam Caldow78 Ed Ratcliffe79 Bernie Chomley80 Tom Kerr
Coach: Quinton GleesonAssistants: James Walker, Andrew Lowcock, Huw FlanaganReserves: Bob Girdwood
UNIVERSITY BLUES
34 THE AMATEUR FOOTBALLER 2014
PREMIER B
1 James Backway2 James Paul3 Hamish Mclauchlan4 Alex Woltering5 Luke Pinot (VC)6 John Nicolopoulos7 Lachlan Nash8 Nic Gooda9 Peter Gleadhill (VC)10 Matt Taylor11 Mark Collins 12 Corey Rich 13 Tim Lockwood14 Jarrod Rafferty15 David Mackenzie (RC)16 Spencer Roberts 17 Mitch Rafferty
18Jackson Heagney-Steart
19 Daniel Newby20 Michael Meehan 21 Oliver Armstrong22 Tim Witherow 23 Chris Ferguson24 Corey Barter25 Scott Ellis (RVC)26 Nick Leonidas27 Tom Chisholm28 Chris Povey29 Rhys Johnson30 Hamish McWilliam31 Adam Weekes (C)32 Ed Limon33 Rory James 34 Sean Verway35 Josh Alkemade36 Chris Smith37 Adam Schofi eld38 Josh Dawson39 Tim Hunter40 Jason Leonidas41 Michael Stowe41 Rilyn Mosbey42 Luke Skelton
43 Adam Vitolins44 Tom Dalton45 Sean Corrigan46 Jake Lynch47 Jordan Toy48 Tristan Coles (RVC)49 Luke Pitcher50 Toby Gill51 Jack Steen52 Mark Seccull53 Tom Tyrell54 Sam Hall55 Damian Fletcher56 Joe Fisscher57 Tim Miller58 Johnathan Spanos59 Shane Walden60 Adam Floyd61 Cameron Hill62 Sam Sturrock63 Cameron Vincent64 Jason Kurta65 William McTaggert66 Jackson Coleman67 Daniel Farmer68 Lee Griffi ths69 Hector Simpson70 Luke Floyd
Coach: Stewart LoeweAssistants: Matt O’Sullivan, Sean Murphy, Kain Taylor, Brett O’Farrell, Matt Brewer, Sam Langford-JonesReserves: Craig BrockleyAssistants: Johnathan Spanos, Drew GilbyThirds: Adam Floyd
OLD HAILEYBURIANS
1 N. Lewton 2 M. Chamberlain 3 D. Kelly (DVC)4 T. Bourbon 5 L. Welsford 6 R. Mann 7 F. Reed 9 J. Cowan 10 D. Chamberlain 11 C. Smith 12 P. Iacovangelo (RC)13 H. Black 14 B. Phibbs 15 M. Johnson (VC)16 M. Pecora 16 N. Thomas 17 T. Chambers 18 B. Bonner 19 J.P. Van Rensberg 20 N. Gentile 21 S. Inglis 22 S. Veltman 23 S. Oldman 24 L. Riley 25 J. Kelly (C)26 A. Patti 27 T. Bailey 28 S. Welsford 29 C. Collins 29 A. Holmes 31 B. Woods 32 J. Cetraro 32 R. McCarthy 32 B. Kovac 33 S. Balloch 34 D. Regan 35 D. McLean 36 N. McLean 37 M. Rice 38 A. DiPetta 39 J. Trounce 40 A. Bortoli
41 T. Wilson 42 D. Izon 44 J. Campbell 45 D. Micallef 51 P. Flanagan 52 P. Johnson 53 J. Mather 54 M. Rich 56 S. Mann 57 D. MacLeod 58 D. Maskill 60 R. Woolley 61 A. Ciavarella 62 J. Verbyla 63 J. Hende 67 J. Bates 68 J. Egan 81 G. Lofthouse 82 S. Paolucci
Coach: Adrian ConnollyAssistants: Wayne Poulter, Kevin ChamberlainReserves: Ben Chamberlain
MAZENOD
35THE AMATEUR FOOTBALLER 2014
PREMIER B
1 Matthew Murray2 Josh Doherty3 Nick Gieschen4 Sam Geilings5 Adrian DelMonte6 Victor Sicilano7 Jake McKeon8 Joel Macdonald9 Chris Sutherland10 Brett Nagel11 Nick Butler12 Alex Vella13 Ricky Jessop14 Chris Johnson15 Kobe Trajanovski16 Brad Flintoff17 Zac Keane18 Michael Mitris19 Carl Groth20 Jake Trajanovski21 Bernard McDowell22 James Moio23 Iza Dawkins24 Richard Butler25 Rob Davidson26 Brandt Harrison27 Hayden Heta (C)28 Dean Heta29 Andrew Paine30 Brandon Lee31 James Binney32 Joey Cua33 Stephen Ward34 Richard Skok35 Robert Hondromatidis36 Sam Wilcox37 Nick Kenyon-Smith38 Tom Earle39 Arthur Solomidis40 Michael Basckos41 Max Kirwan42 Jordan O’Neill
43 Robert Glavas44 Lochlan Phillips45 Callum Matheson46 Tyson Hill47 Simon MacKenzie48 Gareth Fowler49 Sam Armstrong50 Jordan Stanton51 Josh Dunnett52 Ryan Buckley53 Nathan Valkanis54 Josh Spoor55 Tom Falconer56 Richard Dennis57 Jacson Cecil58 Chris Sarthou59 Ashley Steer60 Alec Steinicke61 Simon Leon62 Heath Evans63 Michael Pierce64 Tom Eggleston65 Adam Veli66 Daniel Mancuso67 Vincent Mancuso68 Luke Pace69 Paul Spurling70 Jason Burns71 Brendon Michael72 John Apostolopoulos73 Danny Stone74 Andrew Sheehan75 Brendon Knox76 Sjouke Price77 Michael DelMonte78 Justin Beilin79 Adam Karim81 Michael Baxter83 Danny Stone85 Nathan Pratt
Coach: Travis RonaldsonAssistant: Daniel WellerReserves: Darren TollAssistant: John Hill
OLD IVANHOE
East Ivanhoe
1 Rory Angiolella (C)2 Matt Kyroussis3 Ross Borland4 Toby Hudson Bevege5 Michael Cussen6 Chris Polidoras7 Jack Beech8 James Meakin9 Maxim Allen10 Tom Cheshire11 Daniel Bisetto12 Alister Green13 Jesse Dimond14 Ben Roberts15 Richard Willingham16 Tom Biscaro17 Alex Ricco18 Ryan Floyd19 Antony Harbor20 Dimitri Kynigopoulos21 Michael Lee22 Mitch McWhinney23 Sam Baker24 Jack Parkinson25 Michael Racovalis26 Jack Dalton28 James McGee30 Jamie Mackay32 Dom Pound-Palmieri33 Tom Parkinson34 Will Johnson35 Cailean Moore36 Dylan Patcas37 Will Fenton ( C )38 Jan Leman
39 Drew Olarenshaw40 Josh Munro41 Matt Brown42 Greg Hesse43 Raphael Lloyd44 Stefan Green45 Nick Marshall46 Cameron Ball47 Julian Turner49 Adam Franklin51 Max Ellis52 Phillip Carydis54 Luke Baker55 Dylan Leech56 Joshua Murray58 Gary McCarthy
59Diaramuid O’Donoghue-Cooney
60 Jonathan Anderson62 Brad Farley63 Brendan Johnstone64 Luke McNally66 Sam Buckely85 Will Pickering88 Conor Smith
Coach: Michael PickeringAssistants: John LeGrand, Vince Silluzio, Steve HurlReserves: Ryan Aisbett
FITZROY
SPONSORSRoyal Derby HotelReds Foundation
Clifton Hill/North Fitzroy Community Bank - Bendigo Bank
Fitzroy Victoria Bowls Club
36 THE AMATEUR FOOTBALLER 2014
PREMIER C
1 Leigh Fletcher2 Mark Devereaux3 Rory Lynch4 Kyle Pinto5 Stuart Burggraaff6 Bryce Pewtress7 Jesse Lovig8 Stephen Anderson9 Matthew Care10 Guy Martyn11 Tom Youl12 Ben Traeger-Haig13 Nick Jewell14 Nick Pinto15 Josh Schmitz16 David Morton17 Daniel Corp18 Tim Jones19 Christopher Long20 Adam Power21 Jay Ting22 Charlie Miles23 Richard Atkins24 Adam McNeil25 Shem Curry26 Samuel Clements27 Josh Verlin28 Ben Kezilas29 Jesse Donald30 Cain Malthouse31 Ed Turner32 Joshua McPherson34 Jason McCoy35 Jay Dillon36 Stefan Constantinou37 James Short38 Ash Fisher40 Matt Powell41 Liam Woodland43 Jack Baxter44 Paul Adams45 Marlon Woltering46 Nigel Bloomfi eld47 Michael Dynon48 Lachlan Wheeler49 Liam Dynon50 Andrew Long51 Josh Pavlou52 Kyal McNeil
53 Brendan Culvenor54 Jack Wilson55 Zac Pirrie56 Mark Short57 Daniel Andersen58 James Benjamin59 Matthew Broadley60 Vincent Camera61 Ben Clarke62 Zachary Cochrane63 Adam Cockie64 Sam Cougan65 Thomas Cougan66 Jay Coverdale67 Travis Cowan68 Sam Dalton69 Lachlan DeLisle70 Lachlan Edgar71 Christopher Ellison72 Nathan Foster73 Steven Helliger74 Brenton Holt75 Patrick Hosking76 Reece Houston77 Kristian Johannsen78 Szczepan Kasinski79 Ben Lane80 Jason Laver81 Will Lingard82 Jack Lloyd83 David McCarthy84 Leon McCarthy85 Tobias Morrison86 William O’Haire87 Jesse Rees88 Thomas Rowse89 Matthew Ryan90 Simon Schultz91 Chris Smith92 Nick Taylor93 Stephen Tiernan94 Ned Tikner95 Kieron Turner96 Ryan Warren97 Jadyn Wilkinson98 Sebastian Wright
Coach: Guy MartynAssistants: Owen Lalor & Steve KennedyReserves: Steven Kidd Thirds: Sebastian Wright
HAMPTON ROVERS
1 Ewan Flanagan2 Nick Petering3 Ryan Smith4 Harry Stephenson5 Dylan Harris6 Michael Davidson7 Andrew Young8 Andrew Hickey9 Sam Baring (C)10 Pat Bryce11 James Taylor12 George Smyth14 Jye Ledin15 Ben Tilley16 Darcy Meehan17 Jake Meade18 Joe Cosgriff19 James McKenzie20 Zac Ledin21 Tim McKenzie22 Alex Carr23 Lachlan Inglis24 Gareth Taylor25 Damien Hatch26 Sam Whatley27 Ben Amberg28 Tom Lancaster29 Andrew Costley30 Joe Griffi ths31 Callum Dick32 Daniel Brogden33 Rami Shenouda34 Rowan Shields35 Chris Godsil36 Jonathon Rau37 Grant Chessari38 Matt Hunt39 Matt McCart40 Gerard Gillian41 Shane Chapman42 Michael Chapman43 Tom Duffy44 Luke Leviston45 Martin Phillips46 Justin Mazur47 Brett McCaughan48 Matt Mason
49 Luke Meeking50 Greg Pavlos51 Henry Drysdale52 Simon Chandler53 Jake Richardson54 Luke Richardson55 Jake Cockburn56 Jacob Meehan57 Pat Long58 Brenton Bourke59 David Meulendijks60 Paul Tweedly61 Nick Rhoden62 Chris Vizard63 Darcy Bourke64 Ryan McIvor65 Zac Wilson66 Will Lucas67 Tom Lakeland68 Tom O’Dwyer70 Tom Freeman71 Jared Samuels72 Matt White73 Jacob Meehan74 Ryan Phillips75 Nick Malcolm76 Hayden Devanny77 Ben Dempsey78 Matt Stewart79 Daniel Heap80 Michael Fenwick-Nevin81 Nick Armstrong82 Josh Anaf83 Rhys Waller84 Bill Geary85 Seb Poole86 Daniel Garabiles87 Nick Burri88 Chris Wilson89 Freek Faber90 Jenson Leung91 James Hertan92 Aaron Darnell93 Matt Davies94 Haydn Brouwer96 Avi Ehrenreich97 Alex Hutchesson
Coach: Hayden Stanton, Jye LedinAssistant: Nicholas SalvatoreReserves: Shane Paynter
MONASH BLUES
37THE AMATEUR FOOTBALLER 2014
PREMIER C
2 Jarrod Carlson2 Liam Mc Cormack3 John Mc Intyre4 Patrick Chard 5 Simon Considine5 Paul Symes6 Nicholas Crosbie7 Matthew Gasparini8 Stuart Kemp9 Patrick Millson 10 Timothy Lincoln 10 Paul Symes11 Jonathan Blanch12 Jeremiah Antypas 13 Robert Galea 14 Michael Abrahams 15 Jonathan Bortolotto16 Simon Abrahams17 James Baxter 18 Derrin Gartner19 Steven Crapper20 Mathew Beayni20 Harrison Lee 21 David Tantsis Hall21 Domenic Bolger 22 Timothy Montagna23 Michael Mc Coll24 Trent Carlson25 Daniel Mc Mahon26 Laine Rice27 Robert Costanzo27 Brendon Pearce 28 Jacob Gasparini29 Matthew Molloy30 Daniel Redmond31 Anthony Beaini31 Anthony Mc Glin32 Adrian Coburn33 Jake Symes34 Dallas Jarred34 Liam Brockhus35 Ashley Viney36 Timothy Blanch37 Bradley Taylor 38 Anthony Manakis39 William Delahunty
40 Jordan Bettello41 Cameron Kemp42 Heath Jenkins43 Thomas Cullen 44 Tom Black45 Rowan Mc Kenzie 46 Stewart Callan47 Nicholas Watty 48 Ari Loucas49 Jacques Augustin 50 Dustin Cracknell51 Joseph Kardami52 Hayden Manassa53 Liam Ryan 54 Scott Mc Pherson 55 Tom Natoli56 Paul Laccarruba57 Michael Ryan 58 Julien Toohey 59 Daniel Coloe60 Robert Kemp61 Hamish Murray62 Vincent O’Flynn63 Stephen Gill 64 Anthony Pezzimenti 65 Nicholas Thompson 66 Luke Money67 Joshua Normoyle68 David Mc Donald70 Adam Ceccomancini71 Christopher Walsh72 Paul Symes73 Sam Ayob74 Alexander Montalto75 James Moloney76 Jonathon Wilkinson 77 David Montalti78 Richard Stansbury79 Nicholas James 80 Daniel Kofoed81 Dale Juchnevicius82 Michael Whittle83 James Vear85 Joel Donnellan87 Gerard Mc Mahon88 Gianluca Romanin
Coach: Greg FremantleAssistants: Cameron Crowley, Graham AndersonReserves: Stuart KempThirds: Liam McCormack
MARCELLIN
1 Andrew Frazer2 Chris Goullet3 David Forrest4 Daniel Ryan5 Chris Tzambazis6 James Lenhart7 Jordan Leask7 Cameron Livori8 Cal Glassford9 Josh Pound (C)10 Tom Black11 Daniel Roscoe12 Mark Wilson13 Ryan Jones14 Brett Hannah15 Jarad Rogers16 Sandon McCann17 Sean Towner (C)18 Daniel Flaherty19 Aaron Bell20 Rob Baddeley21 Jack Fenner21 Stuart Dale22 Jed Watson23 Trent Skurrie24 Chris Caminiti25 Bradley Jones26 Jarryd French27 Rowan Nolan28 Sahand Ghasimzadeh29 Michael Fahey30 Ben Briggs31 Daniel Cantwell32 Damien Cerantonio33 Jake Barrett34 Dean Podger35 Jesse Saunders36 Nick Karikakas37 Blake Anderson38 Stuart Tibbitts39 Jackson Marr40 James Taylor
41 Dylan Anderson42 Andrew Baddeley43 Dave Bianchi44 Hugh Braden45 Jack Clarke46 Josh Dazkiw47 Hayden Federico48 Liam Fitzgerald49 Matthew Flaherty50 Rob Frain51 Daniel Galea52 Adrian Gurry53 Andrew Khallouf54 Michael Lepa55 Mitch Miller56 Mark Mitchell57 Matthew Nola58 Dale Phelan59 Ryan Richardson60 Daniel Rowland61 Matt Semini62 Liam Sutawon63 Jordan Williams64 Jack Williams65 Anthony Atkinson66 Shane Azzapardi67 Manuell Gauding68 John Hughes69 Andrew Palmer70 Andrew Petersen 71 Basil Remboulis72 Luke Schultz
Coach: Mark Murray Assistants: M. Regan, C. Jayaweera
PEGS FC
38 THE AMATEUR FOOTBALLER 2014
PREMIER C
1 Jake Rice1 Zan Wenke2 Leighton O’Donnell3 Stefan Courtot4 Fraser Oliver5 Ash Brown6 Jeremy Brazzale (RVC)9 Michael Christian (C)10 Luke Giles11 Tore Valvo12 Ryan Byrne13 Ryan Hay15 Oscar Philp-Taylor16 Liam Austin19 Dale Equid21 Benjamin Smith22 Darcy Cumberland23 Angelo Russo24 Michael Italia (VC)25 David Higgins26 Craig Skicko27 Michael Stephenson31 Nicholas Biscontin (VC)32 Mark Smith33 Adam Barclay35 Anthony Valvo36 Devin McDonald36 James Pentland37 Nick Smith38 Michael Sacchetta39 Andrew Hopgood41 Luke French44 Marcus Borg (C)49 Paul Trovato51 Scott Hills52 Jake Grose53 Adam Layt54 Luke Delaney57 Mark Morgan (DVC)58 Harrison Tippett59 Christian Lendaro60 Brendan Danaher61 Matthew Crema
63 Lincoln Burns65 Jonathan Knape67 Jarrad Appleby68 Brandon Kelly
Coach: Craig HayesAssistant: Jason PlantReserves: Peter Judge
BANYULE
1 M Bennett 2 T Scott 3 D Cleary (C)4 C Hogan 5 K Hogan 6 A Cloke 7 C Lavery 8 W Manning 9 G Bennett 10 S Wines 11 A Deneys 12 B Hogan 13 J Revere 14 P Di Siervi 15 P Ioannidis 16 D Costigan 17 A Valentini 18 J Chapple 19 J Hunt 20 S Tolongs 21 J Pappon 22 L Andreatta 23 K Holden 24 T Golik 25 J Hind 26 J Paola 27 L Barrand 28 B Wass 29 R Holden 30 P Holden 31 T Bromley 32 A Murray 33 N Seel 34 Z Thiessens 35 L Gillard 36 A Mase 37 C Grant 38 M Wass 39 A Binns 40 A Shaw 41 S Way 42 J Olson
43 D Mercuri 44 G Valenzuela (RC)45 A Matthieson 46 J Lever 47 L Hard 48 A Paisley 49 L Kioussis 50 J Benoiton 51 K Paisley 52 B Grizzell 53 C Mercuri 54 M Klonaridis 55 J van der Ven 56 R Gonzalez 57 M Kohli 58 B Sleet 59 J Paola 60 N Shannahan 61 D Ashworth 62 N Miller 63 B Clayton 64 L Moeller 65 J Faranda 70 M Catalla
Coach: Jamie MolloAssistant: Nathan MillerReserves: Jamie Connellan
OAKLEIGH
39THE AMATEUR FOOTBALLER 2014
PREMIER C
1 Tom Buckley2 Lucas Hemming3 Matt Saunders 4 Henry Jacobs4 Yannick Chani5 Matt Martinov (C)6 Daniel Brosnan8 Sean Meeking9 Joss Holdsworth10 Ryan Martin11 Craig Harvey12 Henry Simon13 Jeremy Simon14 Boyd Upstill15 Tim Blackburn16 Sam Stait17 Jordan Tabakman18 Wayne Cove19 Dwain Bailey20 Matt Oaten21 Orry Lack22 Luke Duthie23 Tim Naylor24 Alistair McCooke25 Lloyd Anrep26 Sam Mason27 Will Sayce28 Andrew Clinch29 Luke Saunders30 Chris Coghlan31 Sam Barnes31 Roger Breust32 Daniel Riazah-Kesheh33 Stewart McCooke34 Mark Pappas35 Nicholas Curwood36 Blair Atkins37 Damien Casey37 Chris Everett38 Scott Walker39 Nick Ryde40 Stuart Gay
41 Dan Frazier42 Greg Hammond43 Mitch Veal44 Sam Ashton45 Ben Lydster46 Jarred Harry47 Sam Blandford48 Tom McCrabb49 Leon Calvert50 Daniel Farthing51 Dan Haysom51 Jason Kille52 Tom Haysom53 David Machin54 Haydon Whitehead56 Jesse Plostins57 Nick Topakas58 Ben Rockman
59Andrew Hastings-Dodge
60 James Hastings-Dodge61 Damien Cleary62 Michael Bannan63 Lachlan Upstill65 Jerome Keast66 Tom Cameron66 Daniel Milosavljevic67 Matt Pardy68 Brad Cromack68 Josh Cukierman70 James Young71 Chris Hecker77 Tim Ashford78 Michael Jukes80 Paul Konstanty81 Jason McDonald82 Chris Cleary85 James Gates86 Cody Johnston88 Nick Manning89 James Johnson
Coach: Brett RoweAssistant: Rod StrahanReserves: Stephen KeleherAssistant: Andrew KahoferThird 18 Coach: Paul Konstanty
ORMOND
1 Tom McLennon2 Sam Chitty2 Patrick Lee3 Liam Platt4 Adam Knight4 Matthew Hayes5 Michael Graham6 Daniel Price7 Brett Hampton8 Charlie Dillon8 Kris Little9 Michael Meyer10 Tim Kight11 Robert Swayn11 Mac O’Donnell12 Claye Tobin13 Matthew Ryan 14 Jack Edwards14 Dan Atkins15 Shaun Hendricks16 Paul Sullivan17 Mark Kidner18 Stephen Sullivan19 Luke Morgan20 Shaun Chapman21 Sam Larkins21 Lucas Thomas22 Daniel McCarthy23 Tim Boland (C)24 Zeke McCarthy25 Jesse Waters26 Jackson Boland 26 Darren Rochford27 Mitch Todd28 Jesse Balic29 Max Nixon29 Guy Crilley30 Tom Redmond
31 Jack Edwards32 Lewy Emmerson33 Sam L’huillier33 Jack Dunston34 Chad Ryan35 Jarryd Capiron36 Reid Irvine36 Ryan O’Leary37 Nathan Papatsanis37 Michael O’Connor38 Robert Meade39 Chris Welch40 Jacob Crowley41 Andrew Thompson42 Mark Ferguson43 James Lay
44 Retired In Memory Of John Kenny
45 Dean Kelly46 Dylan Glasscott47 Darcy Ballard48 William McGowan49 Nathan Ng50 Jonathan Fitt52 Daniel Graham53 Tom Fenwick54 Rob Heaney55 Shane Jones56 Jesse Waters57 Dean Lonsdale58 Jackson Harris60 James Le Breton61 Tim Matthews62 Jarrod Pierce64 Jacob Crowley72 Ben Wapling73 Antony McNeil
Coach: Sam RadfordAssistants: Corey Stephens, Mark Haynes, Ben Hampton Reserves: Tony WhiteAssistant: Ken WoodThirds: Jason Austin
PARKDALE VULTURES
40 THE AMATEUR FOOTBALLER 2014
PREMIER C
1 S Bennett2 R Campbell3 S Romanin3 M Cottrell4 O Scheiber4 B Hillier4 C Young5 N Adamson5 A Rogers6 O Lloyd7 N Tsindos7 M Hook7 M Woodbridge8 J Heffernan8 P Kanz9 R Deev10 M Powell12 A Lloyd12 B Cottrell13 G Tolson13 J Wilson14 L Campbell15 R Kapoor16 S Killworth16 D Toma17 P Bennett18 J Eade19 T Kanz19 C Woodbridge21 A Clarke22 J Howells23 W Kanz24 D DeSanctis25 H Crothers26 T Schipper27 C Hillier28 C Webster29 S Needham30 T Allwright31 A Romanin32 N Searles35 J Le Cerf
36 W McDonald38 D McGuigan41 T Mirikilis42 J Duke 42 M Jenkin43 B Hart (C)47 S Warr48 N Ross49 J Hart50 N Russell51 TSheehan53 C McLaughlin57 R Shute58 J Louey67 B Dean76 T Stayner
Coach: Ben Robertson
OLD CAMBERWELL
1 Sam Glenn2 Harry Whitty3 Stuart Grigg (C)4 Stefan Barbour5 Michael Lambert5 Garth O’Connor-Price6 Vaughan Clarke7 Sam Murray 8 Robert Stainforth (VC)9 Tom Coghlan10 Ben Southam (DVC)11 Ben Mitchell12 George Fletcher13 Sam Buchanan14 Brett Brisbane15 Alex Wood (VC)16 Alex Marshall17 Eddie Coghlan18 Tom Stainforth19 Rob Bambery20 Jeremy Gleeson21 Paul Coldrey22 Nicholas Fisher23 Reed Powney24 Thomas Grigg25 Adam Granger25 Jeremy Gleeson26 Ash Law27 Shaun Payze28 Lachlan Heron29 Jordan Pomeroy30 Tom Feldgen30 Adam Crean31 Zac Kurts32 Ryan Trickey
33 Andrew Starkins34 Jordan Owens35 Tim Scarpella36 Jake Archdeacon37 Luke Keon38 Cam Mccauley39 Leith Baker40 Aaron Brockley42 Scott Cain43 Mathew Tuckett44 Mathew Beggs46 Laurens Van der Sluijs47 Tom Shayler48 John Wilkins
49Mitchell Sheldon Collins
50 Aaron Anson51 Sam Messinis52 Liam Nickels53 Daniel Bruce54 Chris Davis55 Demi Pinxt57 Callum Savio59 Hayden Brodie60 Jamie Rhodes61 Lachlan O’Grady62 Dan Laversha63 Anthony Kyriacou64 Ryan White65 David Kotsiakos68 Aaron Bouten70 Dave Dungan77 Tom Lardner
Coach: Nick ClaringboldAssistant Coaches: Damian Brice, Peter Williamson, Michael Lambert & Neil KentReserves Coach: Adam Crean
PENINSULA
41THE AMATEUR FOOTBALLER 2014
CLUB WAREHOUSE RISING STAR 2014
Congratulations to Timothy Marshall who has been nominated as
this week’s Club Warehouse Rising Star.
Timothy joined his brother at Old Melburnians this year for his
fi rst year of football since leaving Melbourne Grammar. Timothy’s
promotion to the senior team is highlighted by the fact he arrived
half way through pre-season after returning from a gap year
travelling. After missing a complete season, Timothy set him self
the goal of returning to peak fi tness and utilising his pace to
impress the coaching staff . During the practice matches earlier
in the year, it was not only his blistering pace that stood out, but,
his ability to read the play and exceptional skills which caught the
eye of senior coaches. Since his fi rst senior game, he has been a
coaches dream; reliable, competitive, does not fear anyone, as
defensive as he is attacking, and eager to learn. Timothy also has
the attributes to excite the supporters, tucking the ball under his
arm and when he’s off like the Road Runner, no-one can catch him.
Timothy is rarely seen around the club without his cheeky smile
and cheeky attitude.
* to be eligible for the club Warehouse Rising
Star, a player must be born no earlier than
1991 and playing his fi rst full season of
senior football.
TIM MARSHALL – OLD MELBURNIANS
42 THE AMATEUR FOOTBALLER 2014
Geoff Reilley @GeoffreyReilley
5 YEARS AGO – 2009
In A Section, Uni Blues went down to SBMT in a crucial game for the Blues. They remained in fourth spot but
were now vying with Collegians and Old Scotch; the other three, Xavs, De La and The Tigers were pretty safe. The Blues led at half time 6.7 to 3.4 but the Tigers were fantastic in the third quarter kicking 8.3 to 1.1. The Tigers went on with it in the last to win easily 17.12 to 12.11. Best: Anstey, Collins, Curcio, Hellier, Phibbs, Bliesner (SBMT) and Nicholson, McConnell, Paterson, Lewis, Austin, Weddell (Blues).
Vinnie Vescovi offi ciated in his 400th game as an umpire. Now in the goals after starting as a boundary runner, Vinnie was a fi eld ump for 8 years before settling for the fl ags on Saturdays.
10 YEARS AGO – 2004
The two top teams in D1 Section met at Banyule and the home side was looking to take the 4 points and maintain their second place. The ladder leaders, Uni Blacks, were not about to upset their unbeaten record for the season and commenced in fi ne fashion to take the lead at quarter time by 3 goals. Banyule threw everything at the Blacks, however whilst the Blacks didn’t have it all their own way in the second half, they proved to be too strong, winning comfortably in the conditions, 10.6 to 6.10. Best: Moff att, M Kempton, Middleton, Savige (4) (UB) and Cantwell, Lorenzini (4), Wilmore, N Taylor (Ban).
20 YEARS AGO – 1994
The talented St Kevins Old Boys’ team in D Grade were outright favourites and although winning out at Williamstown, were made to earn it in their 16.12 to 9.20 win. Sheedy, Mulcahy and Terzini were best for SKOBS and Griffi ths, Featherston and Harry for Williamstown.
In E Grade the match of the day was St Mary’s v Glenhuntly but the ‘Hunters’ made light work of it (20.18 to 9.15) as Thomas, Halpin, Raff erty and Miller (5) stood out for the winners, Stewart, Stone and Ymer gave their all for the Saints.
30 YEARS AGO – 1984
There were a number of ‘double centurians’ in this round – Greg (Les) Horton for Old Camberwell, Peter Ferguson at Fawkner, Kelvin ‘Lizard’ Leiper
achieved the milestone at Thomastown and Fawkner produced a second player to play 200 in Jeff Stewart.
40 YEARS AGO – 1974
In Junior Section 2, Parkside (1st) and Geelong (4th) had a terrifi c battle. After Parkside opened up an early lead, the boys from Corio came right back to lead by 67 points at half time. The second half produced some thrilling football but in the end, the ‘Red Devils’ hung on by 5 points at the fi nal siren. Best: Skalitisis, Simpson (3), Tanner and Bourke (Park); Barrow, Friend, Silver and Leeds (3) (Geel).
50 YEARS AGO – 1964
It was becoming a habit in A Grade as once again, four of the top fi ve teams were defeated and as a result, Collegians replaced MHSOB in the top four. There was only one Junior section and the leading teams were MHSOB 56, Old Scotch 52, University 48, Ivanhoe 44, Alphington 44 and Hampton Scouts 40.
60 YEARS AGO – 1954
Parkside remained undefeated in C Section and showed their superiority with a resounding win over Elsternwick (3rd) 18.16 to 3.15. Balwyn made sure of 3rd spot with a good win over Malvern (5th) 9.14 to 8.9.
A Hawthorn player was reported for abusing and striking an umpire! Guilty of the fi rst charge, he was given 6 weeks for the abuse, fortunately for the player he was found not guilty of striking the ump! Imagine what he would have copped given the 6 weeks for abuse!
80 YEARS AGO – 1934
A former Old Scotch Collegian, Cr. Baron Marks, presented a gold medal, suitably inscribed, to the mercurial Bill Pearson, the Old Scotch champion, for kicking 30 goals in the previous round (yes, 30 majors) against Brunswick in A Section! Pearson was an outstanding all-round sportsman who also kicked 24 against Uni Blacks! His record in amateur football was remarkable. He won the A Section goal-kicking in fi ve of six seasons from 1932 to 1937 and in those fi ve seasons he kicked 126, 220, 138, 121 and 155. Needless to say, Old Scotch won four consecutive A Section fl ags in the early 1930s! Bill was also an outstanding District cricketer with State honours.
RETR
OSPE
CTIV
E
43THE AMATEUR FOOTBALLER 2014
SUPPORTS
MUSCLE GROWTH& RECOVERY
AIDS FOCUS &CONCENTRATION
ELECTROLYTEREPLACEMENT
<1g OF SUGAR PER SERVE
1g OF CARBS PER SERVE
44 THE AMATEUR FOOTBALLER 2014
MEG
T UN
DER
19
MEGT U19 Premier with John Donohoe @jdonohoe12
St Bernards continued their
rich vein of form with a 17 goal
demolition of Old Scotch in
Essendon. Five Bernards goals
to the Cardinals none gave
the Snowdogs a decent buff er
and they were never headed from there. Vague
kicked 4, and O’Halloran 3 and he was named
best. Daggian kicked the only 2 goals for Old
Scotch. Old Xaverians took on Old Melburnians
for the fourth time this season and this large win
for Xavs was much the same as the previous ones.
Jeremey Hannan was the catalyst with 11 goals
in the 210 point rout. Silk got 4 of his own and
classy ball user Luke Barry was outstanding with
3 goals. St Kevin’s hosted Beaumaris and a 5.2 to
2.5 fi rst quarter to the home side was the start
they were after. Doggett (3) and Massey, Lewin
and Quinlan all with 2 were instrumental in the
103-55 win for the home side. Burke, Hudson
and Kelly kicked 2 each but it wasn’t enough
with Kelly and Ryan Beauy’s best. De La won
their second game in a row against the depleted
St Bedes/Mentone, with Howard kicking 3 and
Vawser, McGaw, Martinez and Gava all kicking
2. Dumbelton and Halliday were outstanding for
the home side. Hoy was a shining light for the
Tigers in the loss though booting 3 goals.
U19 Section 2 Report @LewisEmmerson
Parkdale’s 55-point win over Caulfi eld Grammarians means the Vultures are sitting in the four. Parkdale are fl ying home and should be considered a real premiership contender
as Kane Bode was a rock in defence for the Vultures. Whitefriars produced a commanding 72-point victory over Old Brighton, Ciaran Hickey instrumental in his side’s victory. Brighton’s Jack Rutter kicked two thirds of his side’s goal tally, unfortunately, that amounted to only 2 goals. In a low-scoring aff air, both sides were wayward in front of goal as Mazenod came away with a
21-point win over Collegians. Peter Rozanitis
kicked 3 for the Nodders. Collegians’ James Edward
Emmett among his side’s best. Uni Blues can
breathe a sigh of relief after their narrow 3-point
win over Uni Blacks. A loss for the Blues would have
compromised their standing within the four; in a
desperate last quarter they were able to hold off
a fast fi nishing Blacks. It was a shootout at either
end between Daniel Batarilo of Blues (4) and John
Vrodos of Blacks (5). Fitzroy’s slide continues with
their 76-point loss to top-placed Old Trinity. The
loss sees the Roys drop to fi fth position. Trinity’s
Alex Polidoros was prolifi c with 6 goals.
U19 Section 3 with Tom Connolly @tomconnolly15
The sun was shining on
Saturday afternoon and all
teams would have enjoyed
playing in the dry conditions
considering what had
transpired in the preceding 12
hours. Old Xaverians played Old Camberwell and
took the 4 points by two straight kicks in a tight
aff air. Old Xaverians led all day and were just too
strong, as Bosner kicked 4 goals for the day. In
what you could say was the game of the round,
Marcellin played Williamstown CYMS and it was
Marcellin away from home that won by 14 points
as Di Roberto for the Eagles kicked 4 goals and
was best on ground. There was a late charge by
the CY’s, but it was all left too late. In another tight
clash, Old Carey took on St Mary’s Salesian and
just won by 8 points, as Old Carey’s Nixon kicked
4 goals and Schipper kicked 3 and Curwood was
best on ground for the Saints. It wasn’t enough
for St Mary’s Salesian who were left agonisingly
short of just their second win of the season. Old
Ivanhoe ran over the top of the AJAX by 25 points.
AJAX led by 8 points at 3 quarter time but in the
last quarter, Old Ivanhoe were just too strong and
kicked 6 goals to 1 to win.
Read the full MEGT U19 Premier report on the VAFA iPad App – Available at the App store
45THE AMATEUR FOOTBALLER 2014
U19 North Anna O’Donnell @annaod_
La Trobe Uni just got up over Whitefriars, in a low scoring match, it was the Uni’s inaccurate kicking that saw them with enough scoring shots to win by just two
points despite kicking less goals. It was another heartbreaker for Whitefriars, they still search for that elusive victory.
Ivanhoe beat Therry Penola by 19 points, the Hoes’ were in control of the game and on top the entire four terms. Aments, Cochrane and Ioannou worked well for Ivanhoe, allowing them to keep their reign at the top of the table. Banyule
had a 28 point win over PEGS, putting them just
inside the top four. Christou and Kerrison were
Banyule’s best for the day, helping contribute to
a handy win that keeps their fi nals hopes in tact.
Yarra Valley fought back valiantly after trailing St
Bernards by 23 points in the fi rst term, but were
unable to get the points. St Bernards got up by 5
points, placing them well inside the top four, on
equal points with Wyndham Suns. The loss all but
ended the Bushrangers fi nals hopes. Wyndham
Suns grabbed a comfortable victory over
Northern Blues, both Galley and Gallina kicked
four goals for the day, whilst teammates Bean and
Dineen were the best performers for the Suns.
U19 South with Anna O’Donnell @annaod_
Monash Blues grabbed an easy 81 point win over MHSOB, Blues did not allow MHSOB to kick a goal until the fi nal term. Hogan kicked fi ve of the 17 goals for Monash, and was one
of their best along with teammates Brimacombe and Thomas, who worked well. Benoiton slotted eight goals for Oakleigh, contributing to an 80 point win over Beaumaris. The loss sees the Sharks sit a game outside the four. Oakleigh’s win has them equal top with Ormond, though the Krushers lead the way on percentage. De La Salle had a convincing win over Old Haileybury,
winning by 104 points. Old Haileybury struggled as they only managed three goals for the day. It was Lee who kicked six goals for the De La, in a win that has placed them comfortably inside the four. Hampton Rovers managed a 21-point victory over Peninsula, despite a late charge in the fi nal quarter by the Pirates. Roberston and Daley were Hampton’s best for the day, as they made good contributions to help the team get the points. Rovers sit in fourth, with Beaumaris not far behind. Ormond had an enforced bye as Collegians forfeited their match. With three games to go, only Beauy can sneak in but they would require a slip up from Rovers.
MEGT UNDER 19 Premier (YEARS TOTAL 51/85%)
Old Melburnians v St Bernards
St Bedes/Mentone v St Kevins
Old Scotch v De La Salle
Old Xaverians v Beaumaris
UNDER 19 Section 2 (YEARS TOTAL 55/73%)
Parkdale Vultures v University Blues
Whitefriars v Old Trinity
Fitzroy v Mazenod
University Blacks v Caulfi eld Grammarians
Collegians v Old Brighton
UNDER 19 Section 3 (YEARS TOTAL 46/72%)
Old Xaverians v St Mary’s Salesian
Old Carey v Old Camberwell
Williamstown CYMS v Old Ivanhoe
Marcellin v AJAX
UNDER 19 South (YEARS TOTAL 50/67%)
Hampton Rovers v Collegians
Ormond v Old Haileyburians
Oakleigh v MHSOB
Monash Blues v De La Salle
Peninsula v Beaumaris
UNDER 19 North (YEARS TOTAL 48/67)
La Trobe Uni v Yarra Valley
Whitefriars v Wyndham
Ivanhoe v Banyule
Therry Penola v St Bernards
PEGS v Northern Blues
46 THE AMATEUR FOOTBALLER 2014
RESULTS UN
DER
19 MEGT U19 Premier
De La Salle 5.3, 10.5, 12.10, 17.17 (119)St Bedes / Mentone Tigers 0.1, 3.2, 4.2, 6.4 (40) GOALS, De La Salle: J. Howard 3, M. Martinez 2, J. Gava 2, S. Vawser 2, J. McGAW 2, J. Cooke 1, M. Dumbleton 1, J. O’Sullivan 1, A. Wheatley 1, S. McGraw 1, W. Mackie 1 St Bedes / Mentone Tigers: M. Hoy 3, A. Watterson 1, J. Green 1, C. Michaud 1BEST, De La Salle: M. Dumbleton, N. Halliday, H. Ramsay, S. McGraw, J. Gava, J. Howard St Bedes / Mentone Tigers: M. Hoy, J. Beddoe, A. Watterson, M. Millwood, J. Millwood, B. Hubeek
Old Xaverians 5.3, 14.7, 22.9, 33.18 (216)Old Melburnians 0.0, 0.0, 0.0, 1.0 (6)GOALS, Old Xaverians: J. Hannan 11, O. Silk 4, T. Vander Haar 3, L. Barry 3, C. Stratford 3, M. Hess 2, T. Harrison 2, L. Tobin 1, B. Polkinghorn 1, A. Cannon 1, T. Wynne 1, J. Buff on 1 Old Melburnians: T. Scott 1BEST, Old Xaverians: J. Hannan, T. Harrison, L. Barry, T. Anderson, H. Sleeman, C. Stratford Old Melburnians: S. Clarke, R. Alstergren, J. Baring, A. Hurley, S. Madsen, A. Kleiman
St Bernards 5.4, 10.8, 14.15, 19.23 (137)Old Scotch 0.0, 0.1, 1.3, 2.4 (16)GOALS, St Bernards: C. Vague 4, Z. O’Halloran 3, J. Riley 2, T. Delzoppo 2, E. Sibbald 2, J. Carey 1, G. Zoccali 1, C. Hughes 1, H. Wade 1, R. Woods 1, E. Connelly 1 Old Scotch: J. Daggian 2BEST, St Bernards: Z. O’Halloran, C. Hughes, W. Considine, J. Hedley, T. Riley, E. Connelly Old Scotch: H. Harms, W. Michael, C. Melville, J. Hunt, E. Dalton, H. McCallum
St Kevins 5.2, 9.7, 12.8, 15.13 (103)Beaumaris 2.5, 4.5, 8.6, 8.7 (55)GOALS, St Kevins: J. Doggett 3, T. Massey 2, T. Quinlan 2, S. Lewin 2, L. Sabato 1, T. Sullivan 1, T. Corboy 1, D. Lattanzio 1, J. Canterbury 1, J. Tighe 1 Beaumaris: S. Burke 2, B. Hudson 2, D. Kelly 2, R. Keating 1, S. Gibbins 1BEST, St Kevins: T. Sullivan, T. Massey, J. Tighe, R. Stagg, N. Meehan, L. Sabato Beaumaris: D. Kelly, R. Ryan, D. Johns, A. Nohel, B. Hudson, R. Keating
Under 19 Section 2
Parkdale Vultures 3.1, 7.2, 12.3, 16.8 (104)Caulfi eld Grammarians 1.5, 3.6, 5.6, 6.13 (49)GOALS, Parkdale Vultures: L. Ellis 4, J. Francis 3, M. Dickie 2, A. Sivell 1, W. McGowan 1, C. Peele 1, R. O’Leary 1, J. Andrews 1, J. Everest 1, L. Jenkins 1Caulfi eld Grammarians: J. Brand 3, Z. Amos 2, J. Stewart 1BEST, Parkdale Vultures: K. Bode, L. Ellis, C. Peele, J. Francis, K. Love-Linay, A. CaprionCaulfi eld Grammarians: J. Stewart, J. Brand, L. Topp, B. Green, L. Matte, J. Anderson
Mazenod 2.5, 2.10, 4.11, 6.11 (47)Collegians 0.0, 1.1, 2.5, 3.8 (26)GOALS, Mazenod: P. Rozanitis 3, M. Acciarito 1, D. Fowler 1, J. Walton 1 Collegians: L. Walsh 1, C. Richards 1, J. Kyroussis 1BEST, Mazenod: N. Peck, F. Palleschi, J. Walton, D. Smith, P. Rozanitis, T. Odrowaz Collegians: J. Emmett, F. Sullivan, C. Richards, J. Kyroussis, E. Rice, M. Irvine
Whitefriars 4.3, 7.5, 10.7, 14.13 (97)Old Brighton 2.3, 2.4, 2.4, 3.7 (25)GOALS, Whitefriars: R. Malt 3, T. Petts 2, L. Tuke 2, C. Hickey 2, N. Mercuri 2, H. Murray 1, N. Hee 1, J. Spencer 1Old Brighton: J. Rutter 2, G. Kimpton-Moss 1BEST, Whitefriars: C. Hickey, N. Hee, T. Nilsson, T. Petts, N. Mercuri, D. Mendes Old Brighton: A. Andrews, J. Bilu, P. Chantzos, A. Grant, G. Kimpton-Moss, H. Vulcan
Old Trinity 4.5, 8.7, 14.8, 16.14 (110)Fitzroy 0.1, 2.4, 2.6, 4.10 (34)GOALS, Old Trinity: A. Polidoros 6, D. Moore 3, C. Manoussakis 3, H. Aikman 2, J. Nitsopoulos 1, D. White 1Fitzroy: L. Edwards 2, J. Hill 1, B. McDonald 1BEST, Old Trinity: D. Moore, A. Polidoros, H. Aikman, N. Valkanis, S. Emerson, J. Cooper Fitzroy: N. Ligris, N. Gibbons, T. Robinson, B. McDonald, J. Hill, L. Grace
University Blues 6.2, 7.4, 8.6, 9.11 (65)University Blacks 1.2, 3.4, 5.11, 8.14 (62)GOALS, University Blues: D. Batarilo 4, A. Adams 2, T.
Hodge 1, W. Blakey 1, S. Walsh 1University Blacks: J. Vrodos 5, Z. Harris 1, H. Clarkson 1, A. Horton 1BEST, University Blues: D. Cumming, D. Batarilo, S. Walsh, T. Hodge, J. Cross, A. AdamsUniversity Blacks: J. Vrodos, A. Horton, J. Hill, S. Goulding, J. Moff att, J. Grant
Under 19 Section 3
Old Xaverians 1.0, 3.3, 6.3, 9.3 (57)Old Camberwell 1.4, 2.7, 5.7, 6.9 (45)GOALS, Old Xaverians: L. Bosnar 4, D. Nash 3, H. Denton 1, P. Darrer 1Old Camberwell: J. Bruce 1, B. Frattin 1, M. Bromell 1, F. Wells 1, A. Parker 1BEST, Old Xaverians: P. Darrer, H. Denton, J. Norman, D. Nash, N. Sestan, G. SmartOld Camberwell: F. Wells, M. Bromell, J. Mascitelli, R. Vienet, J. Wilson
Old Ivanhoe 3.3, 6.5, 8.11, 14.15 (99)AJAX 2.2, 7.4, 10.7, 11.8 (74)GOALS, Old Ivanhoe: T. Crouch 5, N. Christo 2, D. Pierri 2, A. Meikle 2, F. Portella 1, A. Bacskos 1, N. Ligdopoulos 1AJAX: T. Rogers 2, B. Joel 2, B. Shapiro 1, J. Sackville 1, B. De Winter 1, J. Berkowitz 1, Y. Saltzman 1, J. Goldberg 1, B. Schwartz 1BEST, Old Ivanhoe: J. O’Kane, C. Jowett, J. Stanton, A. Bacskos, S. Tsanoudakis, A. MeikleAJAX: J. Berkowitz, B. De Winter, A. Fetter, S. Lustig, J. Sackville, M. Voinsky
Old Carey 3.1, 5.4, 8.8, 10.13 (73)St Mary’s Salesian 6.0, 6.2, 9.3, 10.5 (65)GOALS, Old Carey: M. Nixon 4, J. Harris 2, J. Gaff 2, C. Wallace 1, C. Cameron 1St Mary’s Salesian: D. Schipper 3, J. Dragonetti 2, N. Bussell 2, M. Kinsella 1, D. Ryan 1, W. Douglas 1BEST, Old Carey: C. Wallace, K. Rodenberg, J. Harris, P. Akec, J. Ryan, N. AndrewsSt Mary’s Salesian: J. Curwood, M. Baum, C. Angley, H. Morris, M. Howard, C. O’Bryan
Marcellin 2.4, 6.7, 8.8, 9.10 (64)Williamstown CYMS 1.2, 2.6, 4.10, 6.14 (50)GOALS, Marcellin: R. Di Roberto 4, J. Robertson 2, M. Mazzone 1, M. Jones 1, J. Bolzonello 1Williamstown CYMS: M. Parkinson 2, M. Barnes 1, M. Christakakis 1, J. Connolly 1, B. Deller 1BEST, Marcellin: R. Di Roberto, L. MacKie, J. Dimattina, J. Hesse, J. Robertson, P. LunnWilliamstown CYMS: T. Gill, J. Goetz, J. Eccles, S. Raunik, M. Morris, J. Dawson
Under 19 North
La Trobe University 0.2, 2.4, 4.9, 4.11 (35)Whitefriars 2.1, 2.1, 3.2, 5.3 (33)GOALS, La Trobe University: P. Carroll 1, J. Webb 1, C. Toomey 1, B. Hoff man 1Whitefriars: H. Murray 2, T. Baker 1, J. Hardiman 1, D. Jacotine 1BEST, La Trobe University: J. Salau, J. Millen, R. Nolan, S. Neville, B. Hoff man, J. KeillerWhitefriars: L. Morris, N. Adam, T. Battista, T. Condon, M. Coen, J. Morais
Ivanhoe 2.2, 5.2, 7.4, 8.6 (54)Therry Penola 1.2, 3.2, 4.2, 5.5 (35)GOALS, Ivanhoe: B. McGregor 3, J. Scardamaglia 1, J. Lagreca 1, W. Emerson 1, M. Rees 1, L. Jacob 1Therry Penola: A. McIntyre 1, S. Tatlock 1, S. Calafi ore 1, M. Jacobson 1, S. Rees 1BEST, Ivanhoe: M. Amenta, M. Cochrane, D. IoannouTherry Penola: S. Rees, S. Calafi ore, H. Donohoe, J. Keenan, A. Mudgway, C. Evans
Banyule 3.4, 7.8, 8.10, 11.14 (80)P E G S 1.1, 2.5, 6.8, 7.10 (52)GOALS, Banyule: M. MacDonald 3, J. Esposito 1, J. Clarke 1, J. Hart 1, J. Lowe 1, M. Barnes 1, L. James 1, D. Wells 1,
R. Brown 1P E G S: A. O’Raff erty 2, J. Condon 1, M. Barton 1, J. Vovos 1, G. Stubbs 1, H. Weerasooriya 1BEST, Banyule: N. Christou, M. Kerrison , J. Lowe, L. James, A. Fleskens, L. BalcombeP E G S: L. Zammit, M. Barton, S. Prasad, A. O’Raff erty, W. Odgers, T. Mules
St Bernards 6.4, 8.6, 11.7, 14.10 (94)Yarra Valley 2.5, 7.5, 11.7, 13.11 (89)GOALS, St Bernards: J. Sullivan 4, B. Ronke 2, J. Firth 2, J. Notaro 2, P. Comerford 2, M. Farrant 1, C. Denahy 1Yarra Valley: B. Lee 5, J. Gleeson 2, C. Kassabis 1, J. Gray 1, M. Hatton 1, D. Hawking 1, C. Mitchell 1, O. Bolt 1BEST, St Bernards: A. Crocitti, M. Farrant, D. Douge, J. Oruba, W. Isaacs, F. McNicolYarra Valley: B. Lee, R. Chipman, M. Hatton, N. MacLennan, W. Elsworth, N. Stedman
Wyndham Suns 5.1, 9.3, 13.8, 17.12 (114)Northern Blues 0.2, 1.2, 2.4, 4.7 (31)GOALS, Wyndham Suns: A. Gallina 4, T. Galley 4, A. Galati 2, B. Wilson 2, H. Iannacone 2, J. Stephens 1, S. Nahyna 1, D. Bean 1Northern Blues: N. Petkopoulos 1, C. Useinov 1, P. Steinicke 1, T. Evans 1BEST, Wyndham Suns: D. Bean, J. Dineen, H. Iannacone, A. Gallina, T. Galley, A. GalatiNorthern Blues: T. Evans, J. Hamilton, T. Smith, E. Mitchell, L. Natoli, A. Mohamed
Under 19 South
Monash Blues 6.2, 11.4, 14.5, 17.6 (108)MHSOB 0.2, 0.3, 0.6, 3.9 (27)GOALS, Monash Blues: W. Hogan 5, J. Lawson 3, P. Mulcahy 2, C. Oppy 2, S. Cresser 1, P. Brimacombe 1, T. Berenyi 1, G. Adlam-Hunt 1, A. Fitzgerald 1MHSOB: B. Cook 1, G. Crampton 1, J. Ah-kan 1BEST, Monash Blues: P. Brimacombe, L. Thomas, W. Hogan, S. Cresser, G. Adlam-Hunt, P. MulcahyMHSOB: S. Babb, G. Crampton, S. Shearer, J. Ah-kan , B. Cook, J. McDonagh
Oakleigh 5.6, 8.6, 13.10, 19.11 (125)Beaumaris 1.1, 5.3, 5.4, 6.9 (45)GOALS, Oakleigh: J. Benoiton 8, N. Di Cioccio 3, J. Lever 2, S. Bhanwal 2, J. Cook 1, L. Pappon 1, A. Malhotra 1, A. Malhotra 1Beaumaris: N. Griffi n 2, N. Lapa 1, T. Woods 1, L. Cox 1, S. Chamberlain 1BEST, Oakleigh: J. Benoiton, S. Bhanwal, N. Di Cioccio, M. Tate, L. Pappon, J. CookBeaumaris: K. Jensen, A. Tanzimat, C. Griffi ths, H. Goodman, N. Griffi n, T. RichardsOrmond won by foreit.
De La Salle 6.2, 10.5, 13.6, 20.9 (129)Old Haileybury 1.1, 1.2, 2.3, 3.7 (25)GOALS, De La Salle: M. Lee 6, D. Marchese 2, M. Howard 2, M. Mullaly 2, D. Kelly 1, J. Cox 1, T. Still 1, O. Milner 1, D. Cowan 1, C. Akritidis 1, W. Agar 1, J. Dennehy 1Old Haileybury: A. Toy 2, C. White 1BEST, De La Salle: D. Marchese, M. Lee, L. Carracher, T. Still, M. Mullaly, M. LaoumtzisOld Haileybury: S. MacPHERSON, J. Mantell, Z. Tsinanis, B. O’Leary, N. Tabe, W. Meehan
Hampton Rovers 2.2, 4.3, 6.7, 9.8 (62)Peninsula 0.1, 2.4, 3.4, 6.5 (41)GOALS, Hampton Rovers: M. Robertson 2, S. Care 2, C. Jones 2, C. Clarke 1, J. Bryant 1, R. Fogarty 1Peninsula: B. Worn 3, J. Anthony 1, S. Harrison 1, J. Johnson 1BEST, Hampton Rovers: M. Robertson, J. Daley, D. Broadstock, J. Benjamin, C. Cullis, J. CampionPeninsula: J. Moignard, S. Barbour, T. Malan, T. Taylor, B. Worn, M. Forsyth
47THE AMATEUR FOOTBALLER 2014
Old XaveriansCoach: Peter Callinan
Assistants: Nick Ferrari
1 Chris Turner2 Tom Harrison3 Matthew Merlo4 Daniel Hachem (VC)5 Tom Anderson6 Charlie Stratford7 Michael Henderson (C)8 Oscar Silk9 Callil Peter9 Charlie Wilson10 Jonny Benson11 Rupert Condon12 Paddy Nunan13 Hugo Denton13 Michael Stanley14 Fletcher Nugent15 Jeremy Hannan16 Nick Prowse17 Todd Vander Haar18 Liam Tobin19 harry Bales20 Richard Wilton22 James Midgley23 David Nash26 Jack Buffon27 Lucas O’Sullivan28 Andy Cannon31 Harry Sleeman52 Lachie Wright
De La SalleCoach: Simon Brown
Assistants: Anthony Hale
1 James Howard2 Charlie Haley3 Harry Zaia6 Ollie Purton-Smith7 William Kanz8 Sefton McGraw9 Liam Feather10 Tim Shallue11 Luke Gogis12 Matthew Hogan13 Adrian Indovino15 Pat Hatch16 Liam Wood17 Matthew Harvey18 Xavier Leonard19 Jack Gava21 Darcy Craig22 Pat Arceri23 Jordan Bull24 Matthew Dumbleton25 Nicholas Halliday26 Joey Cox28 Sam Harrington29 Kobi Wallis32 Hamish Ramsey34 Joel Mattiske38 Jack Hanley42 Joel Stewart45 Dominic Spicer48 Ashley Munday49 Daniel Anastasio51 Hamish Curtis52 Aaron Hay54 Damon Grant
St Bernard’sCoach: Rocky Iannello
Assistants: Serge Ramano
1 Chris Hughes2 Mitch Hughes3 Pat Romano4 Sam Woods5 Jed Carey6 Charlie Vague7 Stefan Piantella8 Tim Rose9 Tom Delzoppo10 Marcus De Leur11 Giacomo Zoccali12 Jack Holland13 Will Considine14 James Riley15 Joshua Hedley16 Darren Colaco17 Anthony Dillon18 Claude Issa19 Michael Caven20 Harrison Wade21 Edyn Sibbald22 Zac O’ Halloran23 Tom Riley (Capt)24 Jeremy Sullivan25 Nicholas Larkin26 Daniel Parkes27 Edward Connelly28 Joshua Turville29 Sean O’Keefe30 Jayden Foster31 Benjamin Ronke35 Tom Saundry
St Bedes/Mentone TigersCoach: Rick Caratello
Assistants: Ray Clark, Brad Berry
1 Pat Hurst2 Jonathon Dawes3 Johnny Cayhun4 Cory Michaud5 Sam Upton6 Alec Shaw7 Maxwell Millwood8 Jack Eldred9 Jayden Clark10 Steven Lay11 Jack Vawdrey12 Kieran Arthur13 Jake Beddoe14 Matthew Caia (Capt)15 Mitchell Johnstone16 Reagan Maddaford17 Jackson Millwood18 William Dutt19 Adam Heatley20 Joshua Green21 Ben Hubeek22 Liam Smithers23 Dale McArthur24 Andrew Watterson25 Robert Iudica26 Samuel Barca27 Thomas Chesters28 Darcy James76 Jordan Pastura
SPONSORS
Clear Cut Hairdressing Mentone
Bendigo Bank Parkdale Branch
Buxton Real Estate Mentone
Old MelburniansCoach: James Ray
Assistants: Guss Murray
1 Max Gibson2 Jack Lidgett3 Ritesh Varma (VC)4 Louis Raymond5 Nick Churkovich (C)6 Charlie Nettlefold7 Chris Barry8 Will Leveni9 Nick McLardy10 Will Heggen11 Hamish Baillieu12 Harry Smith13 Robbie Hayward14 Jack Kelly15 Will Bate16 David Parkinson17 Chris Lam18 James Fink19 Alex Hamer20 Lachlan Prendergast (VC)21 Stuart Watson22 Oscar Hosking23 Ollie Madders24 Guy Shearman26 Nicholas Bennison27 Jordan Cutter28 Charles May29 Matt Panton30 Sam Brand31 Alex Quirk32 Adam Borensztajn33 Nick Benson34 Andy Spargo35 Charlie Paine36 Ruari Wood-Freeman38 Darcy Coombs40 Peter Feaver
MEGT U19 – PREMIER
Old ScotchCoach: Steve Reddish
1 Julian Beard2 Nick Balson3 Alex Brkic4 Dom McDermott (Co-Capt)5 Hamish Dennis6 Ed Gillies7 Brett Borland8 Nick Mursell9 Harry McCallum10 Lewis Parisi11 Jonathon Leggo12 Gus McDonough13 Jock McKinnon14 Will Michael (VC)15 Kris Paltoglou16 John McLellan17 Richard Meadows18 Ed Dalton19 Cameron Melville20 Mitchell Pert21 Henry Harms22 Jono Daggian24 Mitch Nikolovski25 Daley Mackenzie (Co-Capt)26 Tom Peers- Barlow28 Josh Gordon29 James Hunt30 James Voltscos31 Tom Streat33 Tom Beddison (VC)34 Sam Hatty36 Chris Rosengarten37 Blood jumper38 Blood jumper39 Blood jumper40 Patrick Hamilton41 Gordon Ryan42 Jack McIntosh44 Ed von Moger46 Will Hays47 Blood jumper48 Charlie Worrell-Smith
BeaumarisCoach: Carty Mick
1 Matthew Williams1 Gibbons Sam2 Johns Damien3 Zagni Matt5 Lovejoy Matt6 Pierce Rhys7 Smout Alex13 Douglass Todd16 Gabron-Uhe Jack17 Kelly Drew18 Watson Andrew19 Dickson Ben20 Beattie-Powell Cal22 Woodward Tom26 Williams Matt27 Smith Jordan28 Ryan Richard30 Cusack Cal31 Carcassi James33 Crowe Daniel34 Pace Cameron35 Keating Ryan40 Atkins Dylan43 Hudson Ben48 Aridas Athan
St Kevin’sCo-Coaches: Tom Purcell, Timothy Sim
1 Luke Sabato2 Mitchell Smart3 Noah Armato4 Harrison Snell5 Samuel Holland6 Mark Spence6 James Spencer7 Daniel Dicintio8 Matthew Roberts12 William Ostrowsky13 Nicholas Fletcher14 Luke Peric15 Thomas Corboy16 Samuel Doyle18 Nicholas Brown19 Jay Canterbury21 Roland De Biase22 James Tighe24 Roland Stagg26 Joff Mithen27 Jacob Edginton28 Joshua Doggett30 Sam Lewin31 Daniel Lattanzio32 Thomas Vanderslik33 Thomas Sullivan35 Xavier Siebel37 Thomas Quinlan40 Jay Haydon42 Thomas Massey49 Oliver Gabelich52 Joshua Dunne53 Max Mercuri55 Matthew Knight59 Michael Turnbull61 Vince Newton63 Harry Kerr64 Henry Shaw66 Daniel Giannini80 Thomas Corboy90 Nicholas Meehan Scott Kaiser Thomas Peyton Michael Smith Thomas Stephenson Conor Utri
48 THE AMATEUR FOOTBALLER 2014
FitzroyCoach: Bruce Edwards
1 Will Zaghis2 Sam Dalton3 Luke Edwards4 Stephano Calabro4 Tom Robinson5 James Bluer6 Angelo Garcia7 Mica Worthington8 George Bountris9 Zac Hancock10 Nathan Ligris11 Connor Breheny12 Ben Caplikas13 Isaac Wattis14 Max Davie15 Jacob Fraser16 Joe Hill18 Otto Ishak19 Pep Gascoigne20 Jules Meltzer21 Martin Deasey22 Dom Golding 23 Lachy Grace24 Nick Harding25 Sam Lynch26 Andrew Indian Manning27 Sam Gill28 Nick McMahon29 Finn Kinsella30 Aiden Tregillis31 Jacob McCormack32 Aiden Lambert33 Nathan Fillieri34 Harrison Leech35 Ben McDonald36 Dylan Vella Horne37 Daniel O’Brien38 Lewis Pavlich39 Charlie Phillips50 Harry Dorrat Thorpe
WhitefriarsCoach: Jeremy Freeman
Assistants: Dave Kelsey, Dick Baker
1 Mitchell Malt3 Sean Currie5 Tom Lewis6 Jonathan Deller7 Toby Mcgurgan8 Ciaran Hickey9 Ryan Malt10 Tim Nilsson11 Luke Galtieri12 Nicholas Adam13 Nicholas Hee14 Daniel Nilsson16 Declan Power17 Hewitt Murray18 Matthew Gasowski19 Jason Spencer20 Damian Jacotine21 Jack Hardy22 Bryan Dinh23 Lachlan Tuke24 Anthony Giuliano25 Timothy (Capt) Petts26 Daniel De Angelis27 Matthew Perrin28 Ben Kelsey29 Tom Gastin30 Taylor Battista31 Tomas Condon32 Glenn Ibbott33 Benjamin Tatterson34 Nic Mercuri35 Angus Hands36 Jackson Byrne37 Luke Sandy38 Matthew Ciardulli
Caulfield GrammariansCoach: Brett Sinclair
Assistants: Simon Widjaja, Mark Liddell
1 Charlie Logan2 James Small3 Matthew Gould4 Lachlan Topp5 Tom Silvestro6 Michael Bowden7 George Tselios8 Daniel Meddings9 Harrison Mills10 Ben Green11 Tim Mollard12 Chris Bold13 Lachlan Holmes14 Daniel Goldberg15 Kosmo Malignaggi16 Josh Steiger17 Khan Oxenham18 Kirren Ponniah19 Jack Scott20 Lewis Matte21 Lachlan Gallop23 Tom Jordan24 John Nankervis25 Liam De Nardis26 Max Judd27 Matthew Baer28 John Szetho29 Malcolm Mccurdy30 James Anderson32 Travis Mudra33 Jeremy Anderson34 Joshua Brand35 Jerome Stewart36 James Turner38 Thomas Campbell39 Lucas Grigg40 Zach Tomaino42 Jake Mcloughlin43 Lachlan Rayner44 Zach Amos47 Hugh Mcmahon51 Nic Gould54 Thomas Cameron58 Charlie Cohen60 Darcy Levin67 Jack Edwards
Uni BlacksCoach: TBA
Assistants: TBA
ParkdaleCoach: Luke Borella
Assistants: Ned Harding
1 Kurt Lopo2 Darcy Ballard3 Matthew Dickie4 Kane Bode5 James Everest6 Luke Ellis7 Nathan Papatsanis8 Bailey Dillon9 Jack Edwards10 Jake Stent-Powell12 Corey Peele13 Nathan Ng14 Ryan O’Leary15 Joshua Gray16 William McGowan17 Alexander Taylor-Hirst18 Lyndon Byrnes19 Kye Steegstra20 Craig Sterling21 Dylan Glascott22 Tom Congerton23 Mac O’Donnell46 Kobi Delaney47 Harley Balic50 Jesse Andrews51 James Baker52 Adam Capiron53 William Cross54 Sean De Amicis55 Mitchell Donald56 Corey Fall-Jabonka57 Nicholas Farnbach58 Jack Francis59 Leigh Jenkins60 Patrick Larkin61 Kai Love-Linay62 Matthew McCoy63 Matthew McDonald64 Thomas Rayner65 Kyle Ross66 Jordan Russell67 Ash Sivell68 James Salouris69 Harrison Spencer70 Luke Symons71 Joshua Whelan
University BluesCoach: Jeff Scotland
Assistants: Nathan Green
1 Josh Cross2 Sam Walsh3 Matt Nevett4 Zach Thompson5 Angus Adams6 Tom Hodge7 Will May (DVC)8 Tom Morrison9 Dan Bartarilo10 Matt Hart (Capt)11 Jacob Jess12 Will Blakey13 Fred Harrison14 David Cumming15 Will Langley16 George McFarlane17 Andrew Bartarilo18 Lachie Cameron19 Will Ford21 Jack Reynoldson23 Michael Peart (V-Capt)26 Harrison Sullivan27 Charlie Craig32 Lachie Chomley33 Jack Curnow35 Sam Briggs36 Jack Morgan37 Denis Mooney38 Sean Scotland42 Matt Roche44 Tom Coburn64 Tom Lanyon
Old BrightonCoach: Ryan Joseph
Assistants: Andrew Knight,
Andrew Rutter
1 Ollie Parsons3 Jesse McLean4 Tom Fisher5 Dane Robinson6 Ben Williams7 Ben Middendorp 9 Ciacho Ong10 Jack Knight11 Adam Andrews14 Jack Cowling15 Alex Hargrave16 Tom Boxtel17 James Baimbridge19 Cal Macleod21 Jackson Bilu22 Brandon Harris23 Fred Boxtel25 Marcus Grant26 Sam Campbell28 Michael Lees69 Peter Chantzos
CollegiansCoach: Rob Ferguson, Mark Louis
Assistants: Alan Solomon
1 Tom Danks2 Milo Abeyratne3 Josh Dickinson4 Michael Irvine (VC) 5 Jack Burmeister6s Mitch Newton6 Charlie Richards 7 Matt Singleton7s Rob Jesaveluk8 Linus Walsh9s Sid Marshall9 Nick Holmes10 Fergus Huntington11 Sam Porz12 Zac Burns13s Alex Waddington13 Levi Fernandez14s Dane Wilson14 Harrison Sinclair15 Harry Butterss16 Alex Porz17 Seamus Hobbs (C)18 Matt Mandile19 Alex Cullen20s Rob Jesaveluk20 Michael Gregory21s Chris Kipouridis21 Harry Cattell22 Jake Kyroussis23 Dave Ellinghaus24 Ross Katsambanis25 Jaison Simadri26 Tom Danks27 Jaison Simadri27s Harry Hawkins28s Darcy Regan28 Eden Di Sipio29 James Dunn30 Eddie Rice31 Callum Sinclair32 Calum Wilson33 Jacob Diplaris34 Lachie Cooke35 Todd Campigli36 Jamie Clarke37 Chris Mark38 Mitch Palmer39 Ash Walls41 Seb Mundy42 Alex Barr43 James Emmett44 Jack Harris45 Curtis Collins46 Lachie Borthwick47 Lewis Hentschke49 James Kenyon Smith 50 Max Goodwin 51 Josh Third52 Jaden Douglass53 Harry Wilson55 Griffi n Siassios56 Jai Fernandes- Kemp57 James Widdop58 James Barry60 Freddie Sullivan61 Lochie Peck71 Oscar Pearson91 Rhys Hildebrand-Wise
Old TrinityCoach: Speros Beasley
Assistants: Adam Joyce, Nick Polidoros
1 Danny Land4 Darcy White (VC)5 Jad Khallouf6 Simon Emerson8 Lachlan Aikman11 Hugh Tyson13 Corey Mangos14 Dane Fencaros15 Mac Brown (Co.C)16 Will Cooper17 Nick Roberts18 Andrew Bennett24 Duncan Moore (Co.C)25 Alex Contos26 Sam Joyce 27 Seb Nicolosi28 Christos Manoussakis (VC)29 Tom Kerkvliet30 Alex Gebert32 Anthony Scott33 Mark Yeoman34 James Rogers35 Tom Bennett38 Mitchell Bourke 41 Simon Tselios43 Matt Lasorko44 Nathan Valkanis47 Zac Aarons48 James Spassopoulos58 James Nitsopoulos62 Harry Aikman 66 Alex Polidoros67 Luke Brendish70 Joe Camppbell73 Hugh Boyle74 Nicholas Emery
MazenodCoach: Paul McDonald
Assistants: Guy Ritchie
2 T. Cincotta3 F. Palleschi4 D. Hayes5 J. DiNezza6 M. Acciarito7 P. Cincotta8 J. White9 S. Forster10 A. Carney11 J. Walton12 X. Patti13 D. Smith14 T. Corrie15 T. Odrowaz16 J. Paola17 N. Peck18 C. Grady19 N. Melenhorst20 L. Strudwick23 T. McDonald24 M. Harris25 P. Rozanitis27 D. Fowler29 M. Guiliano
U19 – SECTION 2
Deta
ils
Unava
ilable
at
tim
e o
f pri
nt
49THE AMATEUR FOOTBALLER 2014
Old IvanhoeCoach: Brad Shadbolt
Assistants: Chris Branigan
1 Josh Begeman2 Ross Eckersley3 Alex Bacskos4 AdamMeikle5 Anthony Stenta6 Dominic Inglese7 Tim Fidler8 Niko Ligdopoulos9 Liam Oliver11 Patrick Walsh13 Tyson Deane15 Richard Skok18 Ian Lobo20 Gianni Mancuso21 Jake Erman22 Damian Pierri23 Sam Wilcox24 James Mitchell25 Francesco Portella26 Henry Gibbs27 Nick Christo28 Josh Doherty29 William Gough30 Matthew Broughan31 Nick Marshall32 Nick Horsford3334 James Kandiliotis3536 Tom Kellock37 Chris Jowett38 James O’Kane39 Stephen Tsandoudakis40 Trent Crouch
East Ivanhoe
Old CareyCoach: Michael Tarrant
Assistants: Michael Mitchell
1 Mitchell Nixon2 Tom Bedford3 Jeremy Cator4 Charlie Pentney5 Karsten Rodenberg6 Harry Hill7 Cameron Wallace8 William Wright9 James Gaff10 James Davy11 Callan Ahmling12 Christopher Hill13 Robert Cumming14 Lee Andrianakis15 Nicholas Andrews16 Pier Akec17 Dan O’Connell18 Jack Ryan19 Edward Kerr20 Matt Reddish21 Alister Dickson22 Callum Cameron23 Jack Harris24 Matthew Prentice25 Toby Wooldridge26 Stephan Panagos27 Louis Triandos28 29 Athol Candlsih
Old CamberwellCoach: Michael Ericson
2 M Troy 4 X Troy (C )5 S Boyce 7 A Taverner 12 B Warburton 14 A Halabi 16 A Parker 17 S Powell 19 Z Douglas 22 H Donnellan 23 L Birch 24 B Frattin 26 M Hook 27 B Mann 28 A Bongiorno 29 T Owen 30 H Urwin 32 D Bancroft 33 B Hansford 34 C Lindsey 37 S Clark 38 L Bannister 42 J Drago 51 A Giovannucci (VC)52 P Dennis 59 J Bruce
Williamstown CYMSCoach: Con TerzoglouAssistants: Zac Read
2 John Dawson3 Yuma Hemphill 4 Jackson Pennington 5 Indi Ridout6 Sam McHugh7 Raunik Sam8 Brodie Meadows9 Ethan Tuck10 Jack Connolly11 Mitchell Knight 12 Jacob Martin13 Edward Bordas14 Nicholas Harkins15 Austin Slaney16 Jordan Tripodi17 James Goetz18 Mati Christakakis 19 Tim Ball20 Vincent DiLorenzo21 Brendan Dawson22 Caleb Taylor23 Michael McLaughlin24 Alex Georgiadis25 Matt Barnes26 Jake Slee27 Daniel Fontaine28 Hayden Barnett28 Dali Sulejmani-Blackwell29 Nicholas Ebinger30 Steve Miller30 Ben Deller31 Evan Galerakis32 Jake Muddle33 Jordan Davies34 Luke Micallef35 Tim Farrugia36 Nicholas Green37 Bryson Ford38 Darcy Schwarze40 Tom Gill41 Jack Temby42 Julian Franze43 Charles Bold45 Tim Purves46 Keegan Gilbert47 Matt Morris48 Jonathan Omrcen49 Aiden Miller50 Ali Hamad51 Oliver Becroft52 Luke Goetz54 Darcy Wall58 Liam Cavarra60 Jesse Johnstone
AJAXCoach: Adam Sacks
Assistants: Danny Van Aken
1 Misha Voinsky2 Dylan Dexter3 Aaron Fetter4 Joshua Silver5 Dylan Rothschild (C)6 Jesse Velleman7 Jordan Lipton8 Jarred Grek9 Yoni Saltzman10 Jacob Kingston11 Jarrod Nankin12 Nathan Zielinski13 Ben Michelson14 Jeremy Forbes15 Josh Baron16 Jess Broons17 Justin Berkowitz18 Stephen Lustig19 Orren Chabbat20 Josh Kalmus21 Tom Rogers22 Adam Shapiro23 Ben De Winter24 Joshua Singer25 Joshua Heine26 Jamie Sackville27 Anton Fitt28 Ben Schwarz30 Brent ShapiroSponsors:TeskaCarson
Old MarcellinCoach: TBA
Assistants: TBA
1 Oliver Grant 2 Joshua Edwards3 Mathew Gough4 Jonathan Sammut5 Patrick Hamblin6 James Marazita7 Harry Malos8 Jacob Bolzonello9 Nicholas Giovas10 Marcus Hopkins11 John Nicolaci12 Jeremiah Antypas14 Adam O’Sullivan15 Lachlan MacKie16 Mitchell Jones17 Robert Di Roberto18 Daniel Grosso19 Adrian Bonato 20 Brent De Highden21 Joel Cunningham22 Xavier Burns23 Michael Mazzone24 Michael Mascitti25 Liam Hehir26 Joe Licciardi27 Adrian Beaini29 Chris Lane30 John Dimattina31 Joshua Hesse32 Antony Di Censo33 Joshua James36 Kieran Mahoney38 Tim James41 Patrick Lunn52 James Robertson
U19 – SECTION 3
St Mary’s SalesianCoach: Manny De Bono
Assistants: Jason ReddickNeil Taylor
1 Denereaz Luke2 Dragonetti Jesse4 Monaco Brad5 Gibbs Cambell 7 Williams Rueben8 Ryan Daniel9 Zacharopoulos Danny10 Curwood James11 Grant Darcy12 Newton Jeremy13 Baum Max14 Bussell Nick15 Ife Angus17 Douglas Will 18 Drew Anthony19 Clery Connor21 Brooks Hugh 22 Byrnes Jack24 Howard Michael25 Schipper Dane26 Hutchinson Cory27 Heggie Andrew28 Hanson Tom29 Angley Charlie32 Morrell Ben33 Fly Tom36 Evans Nathan43 nmeiselbach Harry44 Duncan Harley
Old XaveriansCoach: Patrick Kennedy
1 James Agius2 Harry Bales3 Luke Bosnar4 Jack Bueno5 Peter Callil6 Ben Case7 Nicholas Chancellor8 James Cosgrave9 Patrick Darrer10 Hugo Denton11 Harvey Donoghue12 Angus Dunn13 Lachlan Fitzpatrick14 Alex Gazdowicz15 Liam Gostencnik16 William Heath17 Adam Hermans18 James Hicks19 Henry Higgins20 Harry Higgins21 Jack Kelliher22 Fotios Keramitsis23 James McCANN24 Will McClusky25 Thomas McNamara26 Hugh Moodie27 Ben Murphy28 James Norman29 Fletcher Nugent30 Matthew Ongarato31 Theodore Paikopoulos32 Thomas Pepperell33 Jack Pica34 Nicholas Pillon35 Ben Polkinghorn36 Christian Prowse37 Matthew Quinn38 Edward Resic39 Tom Rickard40 Matthew Sharkey41 George Smart42 Josh Smith43 Nathan Sorrenti44 Michael Stanley45 Michael Timlin46 Bart Vaughan47 Lachlan Wright48 Thomas Wynne
50 THE AMATEUR FOOTBALLER 2014
IvanhoeCoach: Bill Emerson
Assistants: Leighton Pearce
5 James Lagreca6 William Emerson8 Zac Mowat16 Sam Batterton19 Max Post25 Dylan Treloar28 Daniel Jones31 Nathan Zervides38 Keke Blackmore-Moore39 David Ioannou40 William Cuthbert43 Alex Griffi th47 Cameron Bath54 Mitchell Rees63 Ed Robinson83 Ben McGregor88 James Schaffert Fenian Orsag Liam Kennedy Jake Scardamaglia Michael Vassilou Will Martin Dylan Power
BanyuleCoach: Sam Italia
2 Jayden Esposito3 James Clark4 James Bonello (C)5 Patrick McKinlay7 Dale Rodda (VC)9 Mathew Corcoran10 Matthew Barnes11 Lachlan James12 Mitchell MacDonald13 Mitchell Kerrison14 Jack Hook15 Blake McEntee16 Dale Wells17 Riley Williams18 Marc Centofanti19 Dylan Lester20 Rian Brown23 Ryan Cleaver24 Ryan Lester26 Stephen Mathieson27 Benjamin Stevenson37 Lachlan Pirret40 Rudi Mukumba41 Anthony Domini43 Tom Cowey46 Connor Lennox59 Jonah Clarke60 Nick Christou61 James Lowe64 Thomas Clarke65 Daniel Langford66 Andrew Fleskens67 Sean Tanudtanud
La Trobe UniversityCoach: TBA
PEGSCoach: Frank Troost
1 Anthony Barresi2 Matt Barton3 Ben Caminiti4 Tim Cannan5 Jacob Capovilla6 Reece Centin7 Jack Condon8 Tom Ferris9 Matthew Bergin10 Sam Graf11 Alex Hannah12 Brian Hughes13 Callum Hutchesson14 Stephen Iiistro15 John Karikakas16 Jackson Lanting17 Andrew Lepa18 Lachlan Marr19 Tom Memery20 Jack Mighell21 Theo Miokovic22 Corey Moore23 Tom Mules24 David Mundy25 Toby O’Brien26 Will Odgers27 Aidan O’Rafferty28 Luke Pearce29 Michael Stergioponios30 Grant Stubbs31 Michael Troost32 Jimmy Vovos33 Hashan Weerasooriya34 Luke Zammit
Northern BluesCoach: TBA
Assistants: TBA
U19 – NORTH
Deta
ils
Unava
ilable
at
tim
e o
f pri
nt
Deta
ils
Unava
ilable
at
tim
e o
f pri
nt
St BernardsCoach: TBA
9 P. Moloney25 F. Mc Nicol30 A. Mulkearns34 D. Parkes35 M. Farrant36 M. Dillon38 L. Perryman42 T. Devers44 L. Sullivan45 P. Comerford46 J. Firth48 A. Crocitti49 D. Drouge51 J. Oruba52 J. Notaro53 P. O’Sullivan56 M. Satterley57 W. Paszynk58 T. Hanmer59 W. Isaacs55 W. Baird60 J. Gauci61 S. Whelan62 C. Denahy63 J. Jones64 S. Tamraz65 D. Gilbert
WhitefriarsCoach: Ben Bucello
Assistants: Scott McDonough
1 Jon Pisani5 Lachlan Imeneo6 James Battista7 Patrick Moseley9 Sean Maher10 Ashley Hickman11 Jordan Thompson12 Nicholas Adam13 Daniel Chen17 Jordan Morais18 Tom Battista19 Tom Walker20 Thomas Compassi21 Daniel Serrao22 Tom Lewis23 Lachlan Tuke26 Daniel De Angelis27 Adrian Cardamone28 Dean Mendes30 Taylor Battista (Capt)31 Thomas Condon32 Lachlan Morris33 Michael Coen34 Daniel Michael35 James Hardiman36 Callum Maynard
Wyndham SunsCoach: Brad Gilham
1 Habib Ali2 Cody Harkin3 Ash Gallina4 Adam Scarpino5 Blake George6 Hayden Iannaconne (CC)7 Jaiden Dineen (VC)8 Abdullah Mohammed9 Josh Stephens10 Trent Galley11 Brenden Wilson12 Daniel Bean13 Nathan Clarke14 Scott Ryan15 Simon Nahyna16 Andrew Moshoudis17 Aaron Zahra18 Michael Bresnan19 Alex Galati20 Tate Stiles21 Mitch Bourchier23 Angus Holmes24 Harley Tunnicliffe (CC)26 Ash Collins28 Matt Accetta29 Jackson Gathercole30 Jake Millsom
Yarra ValleyCoach: Bart Drew
Assistants: Nick Chipman
1 Nicky MacLennan2 Daniel Hawking3 Nathaniel Johnston4 Jedd Purbrick5 Josh Dobson6 Harry Parkes7 Nick Stedman8 Luke Bacolas9 Will Elsworth10 Cam Mitchell11 Liam Robb12 Mark McMillan14 Daniel Pascoe15 Matthew Killey16 Jake Maher17 Corey Kassabis18 Tyler Smith21 Jeremy Fensome23 Jesse Woolley24 Owen Bolt25 Tom Hancock26 Joel Gleeson29 Jordan Goldsmith30 Damian Rigo31 Rory Chipman32 Chris Fraser36 Mitchell Hatton41 Michael Gazeas37 Brendan Lee68 Josh Gray
Therry PenolaCoach: Mark Hudson
1 Raffaele Liano2 Hamish Donohue3 Anthony Tana4 Jack Twomey5 Lucas Di Vito 6 Sean Rees7 Sean O’Sullivan8 Tom White9 Joel Costello10 Ethan Daley11 Luke Rocca12 Mitchell Keogh13 Luke Marinelli14 Jonathon Tonna15 Brendan Ward16 Aiden McIntyre17 Louis Taylor18 John Humphrey19 Andrew Mudgway22 Phouc Nguyen25 Jared Keenan27 Connor Kilbane28 Brock Egglestone32 George Di Ciero35 Chris Skapetis36 Chris Fiorile70 Michael Jacobson
BIG
V CL
UB L
UNCH
Mark McLure entertains the crowd
Tony Wilson interviews Luke Beveridge Andrew Ramsden
51THE AMATEUR FOOTBALLER 2014
OakleighCoach: Danny Hall
Assistants: Geoff Brereton, Chris
White
3 J Benoiton
4 M Tate
5 B Grizzell
8 A Seremalis
9 J Cook
11 J Lever VC
14 C Pearson
15 T Michael
17 A Weymouth
18 S Ciavarella DVC
20 S Murray C
21 Z Barrett
22 M Aranha
23 L Pappon
24 K Schmauder
25 C Pinney
26 B Weymouth DVC
27 T Nolan
28 J Davidson
30 K Bradley
33 T Perrett
34 R Henderson
36 D Paola
41 AN Malhotra
42 M Ansell
43 S Bhanwal
45 AK Malhotra
52 L Gillard
53 A Deneys
61 A Mezenstaff
70 L Lloyd
Old HaileyburyCoach: TBA
OrmondCoach: David Robbins
Assistants: Robert Putamorsi
1 Daniel Gregg-Mantle2 Cameron Muir3 Matthew Hirschman4 Sam Elliott5 Will Robertshaw6 Richard Main7 Jack McCambley8 Jack Cappichiano9 Tom Putamorsi10 Brodie Todd11 Benjamin Hardwick12 Matthew Jordan13 Adam Schwarz14 Edward Scanlan15 Zac Papacostas16 Jack Meeking17 Liam Adlington18 Myles Neville19 James Rumanovsky20 Nick Halsall22 Marcus LaGreca25 Nick Edwards31 Anthony Strahan33 Cal Carothers35 Nick Curwood37 Lucas Lampos38 Troy Kettle44 Nick Oaten53 Mitchell Price57 Nick Houghton64 Roland Johnson73 Rob Davis74 Josh Smithe75 Isaiah Tahana79 Marlon Kerstens87 Chris Harms
Peninsula Old BoysCoach: Barry Besanko
Assistants: Theo Messinis,
Mark Featherby, Anthony Thripp &
Brian Parton
Runner: Paul Gleeson
1 Jaycob Johnson2 Mitch Glenn3 James Moignard (C)4 Jack Miers5 Tom LaBrooy6 Cal Parton7 Harry Featherby8 Tory Taylor9 Dylan Wilson10 Tom Malan (VC)11 Leon Newton12 Mitch Skaife14 Bryce McLean15 Seb Barbour (VC)17 Josh Watts18 Nelson Felsinger19 Jimmy Sinclair20 Jordan Boak 21 Brandon Warn22 Jason Anthony23 Nick Messinis (C)25 Jeremy Gleeson26 Andrew Hockhegger27 Tom Feldgen (C )28 Alex Stock (VC)29 Ben Ivansevic30 Tom Paterson31 Alex Treherne33 Sam Harrison68 Rory Farrell
BeaumarisCoach: Darren Wadley
2 Mitchell Barber3 Frasier Johns4 Aaron Keating6 Daniel Ladds7 Alex Smout9 Kaine Beasley10 Neil McKenzie11 Adam Tanzimat12 Joshua Davis16 Nick Lapa23 Tom Gregory24 Kyle McDonagh26 Max Aldrich32 Keenan Jensen33 Pat Brooks36 Tyler Rix41 Sam Burke49 Matt Banham53 Brendan Ellul54 Anthony Zanca57 Tom Richards59 Tim Woods61 Jason Murray66 Ned Griffi n
CollegiansCoach: TBA
De La SalleCoach: TBA
Hampton RoversCoach: TBA
MHSOBCoach: Jamie Anderson
1 Sapphire Watkinson
2 Paul Niklas
3 Ben Kuang
4 Jerome Ah-Kan
5 Alex Gleeson
6 Ben Steiner
7 Guy Velik
8 Athan Sgardelis
9 Tony Tran
11 Tom Feeney-Connor
12 Osman Elsouki
13 Tom Scelsi
14 Lllewellyn Ryan
15 Aarish Alinizar
16 Conor Khan
17 Stephen Babb
18 James Ward
21 Sam Shearer
22 Brendan Cook
24 Max Stella
25 Nick Clampett
26 Gibson Crampton
28 Julian Avila
29 Bernie Chen
30 Phil Huynh
32 Jason Pollock
33 Will Penhalluriack
35 James McDonagh
36 James Ness
40 Jayme Lawson
41 Charlie Franklyn
42 Oliver Croad
43 Michael Manteit
44 James Ellison
45 Danny Douros
Monash BluesCoach: James Donnelly
Assistants: Joe Salvatore,
Nicho Salvatore
1 Tim Berenyi2 Lachlan Blackwood3 Mitchell Blair4 Pat Brimacombe5 Lachlan Buck6 Lucas Buncle7 James Chiefalo8 Charles Cosgriff9 Hugh Duffy10 Justin Field11 Andrew Fitzgerald12 Andrew Hawes13 Will Hogan14 Alex Hutcheson15 Thomas Jackson16 Tom Lancaster17 James Lawson18 Toby Leemon19 Harrison Long20 Jason Ly21 Conor Mackle22 Levi McDonald23 Patrick Mulcahy24 Calvin Oppy25 Daniel Quattro26 Jonathan Rutherford27 Nicholas Schade28 Conor Squires29 Fraser Tankel30 Llewellyn Thomas31 Jake Wilson
U19 – SOUTH
Deta
ils
Unava
ilable
at
tim
e o
f pri
nt
Deta
ils
Unava
ilable
at
tim
e o
f pri
nt
Deta
ils
Unava
ilable
at
tim
e o
f pri
nt
Deta
ils
Unava
ilable
at
tim
e o
f pri
nt
Ian Cordner with Barry Richardson, David Yoff a and Quinton Gleeson
Ingrid Anderson and Rosemary Warssom accepting Duncan Anderson’s induction
Andrew Ramsden
52 THE AMATEUR FOOTBALLER 2014
50 SHADES OF MELBOURNE
Melbourne’s weather transitioned rapidly from Friday to game day. Some of the city’s coldest temperatures in a decade were almost forgotten, as icy, wet and windy conditions morphed into footy perfection. The sun was out and undershirts returned to optional status for umpires. Veteran goal umpire Clayton Evans was even overheard asking fellow fl ag-waver, Premier A debutant Guy Hexter, if he’d brought a short-sleeved uniform. The new kid on the block replied that he hadn’t and Clayton had to put his deckchair and thongs back in the boot. It was fi nals weather in Round 13/14 and nobody was complaining. You know you’re doing alright if the beach seems like a borderline realistic option in early August. Melbourne, don’t ever change.
BACK IN TOWN
Last Saturday we saw the comeback game of one of our absolute legends. After nearly two years on the sidelines with a debilitating foot injury, Leah Gallagher donned the greens (for the fi rst time) when she stepped out in an under 19 game at Old Trinity. The good news is that she pulled up well, (according to her match day coach, Daggles, however we’re not sure who’d be coaching who) so with a few more games under her belt followed by a big pre-season she’ll be ready to strut her stuff again in senior football in round 1 next year.
A BIG HONOUR FOR “DROPPY”
Congratulations to Grant Wardrop who last week became the 107th Life Member of the VAFAUA. This achievement will be offi cially recognised at the Pre Finals Dinner on 25 August 2014 in the Members Dining Room at the MCG.
AFL VISITOR
Last week our group was fortunate to have a visit from former VAFA and now AFL-listed umpire Rob O’Gorman. Rob (#33 for those playing at home) spoke to the group outlining his pathway and journey from Moorabbin Saints Juniors to the VAFA, the VFL and now AFL. He showed that these
pathways which are in place can and do succeed if you persist and listen to your coaches. After his debut at AFL level earlier this year he joins an ever growing list of umpires at the elite level who have passed through or gained their start in our ranks. Last weekend Rob umpired the Melbourne v Brisbane game and we had great representation on the day with three other ex-VAFA umpires being on the fi eld with Rob. 2011 AFL Grand Final umpire Chris Donlon was one of the other fi eld umpires whilst Damian Cusack and Matthew Jenkinson were two of the boundary umpires. It
can happen to you!!!
LAWS OF THE GAME QUIZ
LAST WEEK’S QUESTION:
Before the siren goes to start a match, the umpire notices the full forward from Team A being thrown to ground by Team B’s full back. What happens next?
The correct answer was OPTION C: the umpire blows their whistle, holds the ball up, waits for the siren and then awards a free kick to the Team A full forward, which is taken from where the incident occurred.
THIS WEEK’S QUESTION:
A player from Team A is having a shot at goal. A teammate goes through the mark, closely followed by a Team B player. What does the umpire do?
a) The umpire pays a 25-metre penalty against
Team B.
b) The umpire pays a free kick against the Team A
player for coming in to the protected area.
c) The umpire blows time on and tells both players
to clear the area and resets the mark .
UMPI
RES
Proudly supported by
East Malvern Community Bank®Branch
300 Waverley Road, East Malvern, phone 9563 6044
Steve McCarthy & Kit Harvey @VAFAUA
53THE AMATEUR FOOTBALLER 2014
St BernardsCoach: TBA
Assistants: TBA
1 Jonathan Ayres1 T. Doody2 J. Comito3 T. Howard4 T. Mahony5 A. Cunsolo7 M. Jaggard8 C. Tormey9 D. Heenan10 T. Baker11 M. Diamandis12 C. Gavaghan13 R. Brettell14 L. Arrowsmith15 C. Brasher18 D. Kennedy19 B. Ward20 S. Merkel21 R. Woods22 T. Noonan23 E. Vahland24 J. Sullivan25 N. Kelly26 J. Hannah37 M. Zammit47 L. Grech
MazenodCoach: TBA
Assistants: TBA
Point Cook AFCCoach: TBA
Assistants: TBA
1 Jonathan Ayres2 Jed Carey3 Lachlan Clark4 Edward Connelly 5 Anthony Dillon6 Thomas Donohoe7 Jack Firth8 James Ford9 Frazer Gatens10 Chris Gavaghan11 Thomas Howard12 Jack Howard 13 Will Isaacs14 Bomani Jackson 15 Max Jaggard16 Jake Jones17 Nick Larkin18 Nick Larkin 19 Dan Mighell 20 Adam Mulkearns21 Ben Nathan 22 Zach O’Halloran23 Pat O’Sullivan 24 James Oruba 25 Daniel Parkes 26 James Riley27 Tom Saundry28 Michael Sauro29 Lachlan Sullivan30 Chris Tormey31 Josh Wallis32 Liam Whelan33 Seamus Whelan 34 Rhyen Woods35 Sam Woods
Williamstown CYMSCoach: TBA
Assistants: TBA
1 Kieren Delaney2 Mason Smith3 Nishan Coyne4 Dylan McLellan5 Matthew Burton7 Jack Harris8 Mitchell Thar9 Patrick O’Brien10 Luke Vella11 Daniel Delaney12 Jayme Lawson16 Luke Gibbs17 Aaron Knezevic18 Callum Lawerson19 Alex Shanks20 Daniel Stoios21 Jake Hibbert22 Alex Court23 Jack Elliott24 Liam D’Arcy25 Haydn Acciarito26 Dane Thomas27 Nicholas Christou28 Scott Stewart
UHS-VU / FlemingtonCoach: TBA
Assistants: TBA
1 Matthew Williams4 Miles LEGUDI5 Daniel AITON6 Conor WALSH8 Nick WALLACE11 Thomas CHEYNE12 Jack SUTTON13 Finn DEVLIN15 Vince McINTYRE17 Dylan VELLA HORNE18 Nick PERICA20 Ray HASSAN 21 Anthony AUSAGE24 Camron ARISTOTLE25 Michael HEALEY26 Harry ANDERSON27 James McMAHON28 Nick McMAHON30 James GOSLING31 James HEALEY ©32 Toby KRUISHEER33 Tom McALL35 Esub RAMSAY37 Nathan FILIERI38 Marcus WALSH69 Lloyd GRANT
South Melbourne DistrictsCoach: TBA
Assistants: TBA
16 Paul Cuttajar-Milosev20 Vincent Di Lorenzo28 Hayden Barnett34 Luke Micallef36 Nicholas Green37 John Dawson50 Matthew Morris51 Tim Ball Edward Bordas Tyron Boorman Liam Cavarra Jack Connelly Brendan Dawson Ben Deller Daniel Di Lorenzo Nicholas Ebinger Damon Falzon Tim Farrugia Bryson Ford Kai Harty James Hazeldine Jesse Johnstone Tom Johnstone Wade Mcewan Jake Muddle Luke Mullen Mitchell Parkinson Tim Purvis Sam Raunic Johnny Ross Darcy Schwarze Matthew Singleton Austin Slaney Jake Slee Caleb Taylor
UNDER 18
Deta
ils
Unava
ilable
at
tim
e o
f pri
nt
Deta
ils
Unava
ilable
at
tim
e o
f pri
nt
Deta
ils
Unava
ilable
at
tim
e o
f pri
nt
Deta
ils
Unava
ilable
at
tim
e o
f pri
nt
Deta
ils
Unava
ilable
at
tim
e o
f pri
nt
Mantra Lorne is the perfect location for a mid-season alignment and recovery retreat. Located beachside on 12 acres
with onsite gymnasium, access to salt therapy and hydrotherapy, football oval, indoor heated lap pool, numerous outdoor
group training and recovery activities. A variety of conference spaces exist to suit team meetings, massage therapy,
motivational talks and team building sessions. Our experienced coordinator will work closely with your nutritionist to
personalise menus, alongside coaches to tailor fitness programs and provide a seamless retreat event program.
To book, contact Michael Canny on 0419 808 670 or email [email protected]
Let Mantra Lorne tailor a package to
rejuvenate your team mid season.
Alignment & recovery retreats
are only a trip down the
Great Ocean Road
Located beachfront for cold therapy sessions Access to salt therapy and hydrotherapy Personalised menu options
54 THE AMATEUR FOOTBALLER 2014
After last week’s disappointing loss to UHS-
VU (losing having led all day), University Blues
were keen to avoid another replay of that
performance against another quality side in
Williamstown CYMS. Unfortunately history
repeated for the Blues, after leading by 27 points
at half time, they switched off in the second
half as the CY’s showed dominance across all
parts of the ground. A great come from behind
victory for the CY’s with the fi nals door still ajar.
Old Paradians were simply no match for ladder
leaders Mazenod, the 97 point defeat crushing
to the Old Paradians. Kieran McKeogh was again
impressive with another 3 goals, taking his tally
to 55 for the year, whilst Andrew D’Souza was
named best afi eld for the Paradians. Finals now
out of the equation, Old Paradians must focus
on fi nishing off the season well, whilst Mazenod
must continue their good form to give it a
good shot at the premiership. Westbourne Gr.’s
impressive performance kept their opponents
Point Cook to scoring only two points in the
second half to claim a 46 point victory. The
Warriors’ six goal to one opening quarter set
them up nicely as Jay Amore kicked 3. The
Bulldogs were never really in the match, with
Cody Hobbins the standout in the defeat. Point
Cook must now play consistent football for the
remaining few games to keep hold on to fourth
position from Williamstown CYMS who are just
behind them on percentage. Top two side St
Bernard’s, made life diffi cult for UHS-VU who
managed only two goals to their name by half
time and a 40 point loss by game’s end. This
victory to the Snowdogs sees them hold second
spot on the ladder. Despite the loss, Matthew
Mallia kicked goal, whilst Tim Rocke was best for
UHS-VU. Michael Diamandis was impressive with
three goals for the Snowdogs.
VAFA COLTS — TIPS IN BOLD (YEARS TOTAL 42/72%)
UHS-VU Vs Point Cook
Williamstown CYMS Vs Old Paradians
Westbourne Gr Vs Mazenod
St Bernards Vs University Blues
VAFA COLTS LAST ROUNDSt Bernards 4.0, 6.6, 8.8, 11.11 (77)GOALS, St Bernards: M. Diamandis 3, M. Zammit 2, M. Jaggard 1, C. Tormey 1, E. Vahland 1, D. Kennedy 1, J. Gauci 1, J. Turville 1UHS-VU / Flemington: M. Mallia 2, N. Munari 1, M. Morise 1, A. Okud 1BEST, St Bernards: D. Kennedy, C. Tormey, T. Doody, T. Howard, T. Baker, M. DiamandisUHS-VU / Flemington: T. Rocke, E. Ramsay, M. Healey, M. Legudi, T. Cheyne, F. DevlinWestbourne Grammarians 6.0, 7.5, 8.6, 10.10 (70)
Point Cook AFC 1.2, 3.4, 3.4, 3.6 (24)GOALS, Westbourne Grammarians: J. Amore 3, T. Kitson 2, L. Hogarth 1Point Cook AFC: J. Hynes 1, B. Foley 1, J. Johnson-Boe 1BEST, Westbourne Grammarians: L. Vella, P. O’Brien, A. Briggs, K. Djordjevic, A. MolloyPoint Cook AFC: C. Hobbins, A. Gauci, N. Ezard, C. England, K. Harvey, P. KerrMazenod 2.5, 6.8, 9.10, 14.13 (97)
Old Paradians 0.0, 0.0, 0.0, 0.0 (0)GOALS, Mazenod: K. McKeogh 3, J. Winn 2, J. Swainston 2, D. Wiles 1, F. D’Alfonso 1, S. Deegan 1, M. McLellan 1, P. Mulligan 1, E. Van Rensburg 1, D. Mydaras 1Old Paradians: BEST, Mazenod: M. Sier, T. McKenna, M. McLellan, T. Patterson, P. Mulligan, S. McCullaghOld Paradians: A. D Souza, W. Gilmore, S. Money, M. Ouzas, R. Ursino, T. DimasiWilliamstown CYMS 2.2, 3.5, 8.6, 12.6 (78)
University Blues 2.5, 7.8, 7.10, 8.10 (58)GOALS, Williamstown CYMS: K. Gilbert 4, J. Kilpatrick 2, A. Zadel 2, J. Franze 1, E. Tuck 1, E. Galerakis 1, D. Schwarze 1University Blues: D. Challis 1, F. Mulder 1, T. Lanyon 1, L. Walder 1, G. McFarlane 1, J. Johnson 1, F. Harrison 1, R. Chapman 1BEST, Williamstown CYMS: E. Tuck, I. Ridout, A. Weaven-Cahill, T. Farrugia, E. Galerakis, J. DaviesUniversity Blues: D. Baird, D. Lou, D. Itsines, G. McFarlane, T. Coburn, L. Walder
Olivia Crowe @Liv_Crowe
CONSISTANCY THE KEY
VAFA
COL
TS
PERFORMANCE RECOVERY AGILITY
55THE AMATEUR FOOTBALLER 2014
KewCoach: Ian Aitken
Assistants: Myles Ashton
1 Josh Weightman2 Kyle Margaritas3 Zac Jones4 Zan Simons5 Darcy Sketcher6 Corey Quinlivan7 Jake Chesson8 James Thompson9 Grant Filsell10 Jono Benson11 Sam Nicholson12 Ethan Murray13 Tim Laughlin14 Tyler Hayward15 Josh Fidanza16 Billy Shute17 Mitch Walch18 John O’Keefe19 Cal Spencer20 Mick Kinsella21 Tieren Barbera22 Blake Van Leeuwen23 Jai Lane24 Marshall Sadikin25 Matt Jeffrey26 Jett Guerin27 Jordy Henman29 Max Waters30 Jono Thornley31 Brandon Droessler32 Jayden Barker33 Rob Maibaum35 Liam Kinsella37 Chris Simons91 Blair Hudson93 Joel Dale
CollegiansCoach: Ben Mason
4 Michael Irvine8 Linus Walsh10 Fergus Huntington17 Seamus Hobbs19 Alex Cullen22 Sam Porz24 Ross Katsambanis26 Michael Gregory27 Harry Hawkins29 James Dunn30 Eddie Rice34 Lachie Cooke36 Jamie Clarke37 Chris Mark38 Mitch Palmer39 Ash Walls40 Harry Butterss41 Seb Mundy43 Jake Kyroussis44 Jack Harris46 Tom Danks47 Alex Porz49 James Kenyon Smith50 Toby Benjamin52 Jaden Douglass53 Harry Wilson54 Harrison Sinclair55 Nimai Gordon56 Jimmy Benjamin57 Jordan Rettke58 Zach Grabovic59 Josh Dickinson60 Freddie Sullivan61 Lachie Peck63 Tom Madden71 Oscar Pearson
Point CookCoach: Glenn McAlpine
Assistants: Wayne Gough,
Paul Reardon, David Kip
1 Josh Crofton2 Brandyn Foley3 Matthew Volk4 Cody Day5 Daniel Hird6 Nicholas Ezard7 Mason Kip8 Liam MacGibbon9 Andrew Gough10 Kurt Mayne11 Callum Morrison12 Alex Grigg13 Aaron Sagona14 Luke Rappazzo15 Zac Harrington16 James Aquilina17 Daniel Duskovic18 Matthew Barnes20 Robbie Milne21 Patrick Kerr22 Josh Evans23 Ashley Gauci24 Ashton Cook25 Dillon Van Der Putten30 Riley Matthews31 Mitchell Pruscino34 Liam Gilbee
St BernardsCoach: Craig Connelly
Assistants: Shane Denahy
1 Jonathan Ayres2 Jed Carey3 Lachlan Clark4 Edward Connelly 5 Anthony Dillon6 Thomas Donohoe7 Jack Firth8 James Ford9 Frazer Gatens10 Chris Gavaghan11 Thomas Howard12 Jack Howard 13 Will Isaacs14 Bomani Jackson 15 Max Jaggard16 Jake Jones17 Nick Larkin19 Dan Mighell 20 Adam Mulkearns21 Ben Nathan 22 Zach O’Halloran23 Pat O’Sullivan 24 James Oruba 25 Daniel Parkes 26 James Riley27 Tom Saundry28 Michael Sauro29 Lachlan Sullivan30 Chris Tormey31 Josh Wallis32 Liam Whelan33 Seamus Whelan 34 Rhyen Woods35 Sam Woods
St Mary’s SalesianCoach: Michael Learmonth
1 Lindsay Moreen4 Bradley Monaco7 Reuben Williams8 Daniel Ryan9 Danny Zacharopoulos10 James Curwood11 Darcy Grant12 Jeremy Newton13 Ben Johnston14 Nick Bussell15 Nick Curwood19 Luke Devereuz22 Jack Byrnes24 Matthew Howard26 Cory Hutchinson27 Angus Ife29 Charlie Angley30 Matt Mace31 Nat Edwards32 Ollie Baxter36 Nathan Evans38 Nathan Phillips39 Tom Keys41 Cambell Walsh43 Tim Pepperell44 Kurt Brauns45 Louie Holmes47 Will Douglas48 Jesse Dragonetti50 Harry Meiselbach52 Lorenzo Bukulatjpi53 Hugh Brooks54 Hugh McRae61 Shane Baykai
Werribee DistrictsCoach: Stephen Frenkel
1 Mason Frenkel2 Sarian Scarlett-Long3 Mitch Thar4 Dan Stois5 Tim Malia6 John Kaklikos7 James Borg8 Zac McMillan9 Aaron Gatty10 Kieran Delaney11 Nick Holdsworth12 Zane Goetz13 Hamish Keogh14 Brayden Monk15 Jordan Patty16 Anthony Limina17 Callum Lawson18 Jacob Russell19 Matthew Defi na20 Brandon Doyle21 Max Gundy22 Alex Court23 Brendan Parker24 Ethan Henley25 Connor Yeoull26 Patrick Esposito27 Aaron Pogerzelski28 Anthony Daw82 Jarrod Stewart
UHS-VUCoach: David Speedie
Assistants: Greg Sutton
3 Connor Walsh4 Cal Aristotle5 Tom McMahon8 Nick Wallace9 Jack Sutton10 Myles Legudi11 Daniel Aiton12 Marcus Walsh13 Anthony Ausage16 Tom McAll17 Nick Perica18 James Healey(C)20 Omar Boru21 Nick McMahon22 Toby Kruisheer24 Michael Healey25 Thomas Cheyne28 Lachie Mitchell31 Finn Devlin33 Ezza Ramsey35 Fred Cawte36 Ray Hassan37 James Gosling69 Lloyd Grant81 Matthew Malia
Williamstown CYMSCoach: Bredan Cocks
Assistants: Gregor Burgess
16 Paul Cuttajar-Milosev20 Vincent Di Lorenzo28 Hayden Barnett34 Luke Micallef36 Nicholas Green37 John Dawson50 Matthew Morris51 Tim Ball Edward Bordas Tyron Boorman Liam Cavarra Jack Connelly Brendan Dawson Ben Deller Daniel Di Lorenzo Nicholas Ebinger Damon Falzon Tim Farrugia Bryson Ford Kai Harty James Hazeldine Jesse Johnstone Tom Johnstone Wade Mcewan Jake Muddle Luke Mullen Mitchell Parkinson Tim Purvis Sam Raunic Johnny Ross Darcy Schwarze Matthew Singleton Austin Slaney Jake Slee Caleb Taylor
Richmond CentralCoach: Louie Binios
Assistants: Reg Hickey
1 Zach Munnery2 Rifki Ergul3 Kaylem Lambrecht4 Benson Adams5 Thomas Harvey6 Jack Hendrich7 Rory Benson8 Hayden Binios9 Danny Baglava10 Chris Waiting11 Jayden Tran12 Emannuel Majok13 Gavin Kennedy14 Andrew Kelly15 Caleb Hounihan16 Chris Theodoridis17 Liam Laffey18 Jack Harvey19 Brad Katon20 Simon Hall21 Lorent Chitkrapong22 Ben Johnson23 Brendan Gallagher24 Ryan Armstead25 Tyson Wicks26 Ned Brown27 Michael Walsh28 Paul Johnson29 Jackson Lee30 Joshua Green31 Lewis Grieves32 Chris Christofi 33 Nic Willis34 Dylan Curnow35 Nathan Coote
UNDER 18
56 THE AMATEUR FOOTBALLER 2014
RESU
LTS
PREMIER THIRDS LAST ROUNDUniversity Blacks 3.1, 7.3, 9.8, 10.9 (69)University Blues 2.4, 4.7, 6.7, 6.12 (48)GOALS, University Blacks: M. Witkowski 3, T. Brennan 1, M. Coff ey 1, A. Torney 1, B. Mikus 1, R. Cleary 1, B. Farrow 1, S. McKnight 1University Blues: J. Cowland 1, T. Nagle 1, D. DelRio 1, N. MacRae 1, D. Condon 1, H. Hanlon 1BEST, University Blacks: M. Nicolson, A. Torney, M. Witkowski, A. Spinks, S. McKnight, A. MackayUniversity Blues: D. DelRio, C. Craig, D. Van De Pol, D. Aukema, W. Girdwood, J. Cowland
St Bernards 2.4, 6.7, 9.8, 15.11 (101)Old Melburnians 2.0, 6.1, 10.3, 11.7 (73)GOALS, St Bernards: K. O’Connor 2, M. Sulzberger 2, M. Hughes 2, M. Boscolo 2, J. Madden 2, A. Helenius 1, S. Cannatelli 1, J. Gill 1, L. Whelan 1, J. Cunningham 1Old Melburnians: E. Hughes 7, B. Holland 2, A. Cameron 1, T. Oman 1BEST, St Bernards: M. Sulzberger, S. Whelan, M. Hughes, S. Cannatelli, D. Hurley, J. WheelerOld Melburnians: E. Hughes, W. Leveni, S. Land, T. Oman, R. Armit, N. Molony
Old Xaverians 5.2, 7.9, 15.9, 20.16 (136)Collegians 1.1, 3.2, 3.6, 3.8 (26)GOALS, Old Xaverians: C. Dipierdomenico 4, T. Daniher 3, D. Molan 3, T. Cannon 2, S. Ross 2, M. Adams 1, J. Davies 1, P. Armstrong 1, T. Agius 1, J. Hanger 1, N. Ielasi 1Collegians: N. Crema 1, T. Baxter 1, C. Collins 1BEST, Old Xaverians: M. Dipietro, N. Ielasi, L. Rogan, A. Torre, P. ArmstrongCollegians: N. Crema, N. Brown, A. Carydias, J. Slatyer, A. House, C. Collins
PREMIER B THIRDS LAST ROUNDFitzroy 2.1, 3.4, 5.9, 11.14 (80)Old Brighton 1.8, 4.9, 4.9, 4.9 (33)GOALS, Fitzroy: L. Sugrue 2, M. Willson 2, B. McAdam 2, R. Bartel 1, M. Gloster 1, B. Finn 1, S. Delai 1, J. Ford 1Old Brighton: R. Baines 1, B. Trivett 1, A. Betts 1, J. Withers 1BEST, Fitzroy: B. McAdam, B. Finn, C. Hart, M. Gloster, D. Ryan, S. DelaiOld Brighton: S. Henley, A. Betts, L. Buntz, C. Betts, P. Weakley, Z. Wilson
Mazenod 2.1, 5.5, 11.9, 13.14 (92)Caulfi eld Grammarians 3.4, 4.6, 7.6, 8.8 (56)GOALS, Mazenod: S. Bamblett-Furner 3, T. Ross-Edwards 3, G. Joachim 2, A. Weekes 2, N. Parry 1, J. Carroll 1, A. Bau 1Caulfi eld Grammarians: D. Hay 2, B. Scott 2, L. Bourke 2, J. Cleary 1, A. Alibrando 1BEST, Mazenod: S. Bamblett-Furner, N. Klavins, A. Weekes, G. Joachim, M. Hickleton, A. BauCaulfi eld Grammarians: D. Hay, M. Price, J. Schwarer, S. Ilgoutz, L. Bourke, M. Linklater
Old Trinity 4.5, 7.7, 12.9, 15.10 (100)Old Carey 4.2, 6.9, 7.11, 8.13 (61)GOALS, Old Trinity: C. Sparsi 5, T. Cohen 5, R. Gillies 1, T. Gale 1, T. Mead 1, I. Huynh 1, S. Kilgower 1Old Carey: S. Lenders 2, T. MacReady - Bryan 2, J. Arrowsmith 2, L. Cooney 2BEST, Old Trinity: C. Sparsi, T. Cohen, N. Bourke, T. Hunter, I. Huynh, A. SmithOld Carey: A. Richardson, P. Arundel, C. Macrow, A. Moshovelis, Z. Lisle, J. Arrowsmith
Old Xaverians 5.8, 9.17, 15.23, 23.31 (169)Beaumaris 0.2, 2.3, 5.3, 5.4 (34)GOALS, Old Xaverians: T. Fenton 3, A. Ongarello 2, N. Sitch 1, D. Cotchett 1, S. Grigg 1, B. Lyon 1, T. Dillon 1Beaumaris: J. Miller 1, J. Bull 1, S. Kendall 1, A. Davies 1, A. Edmondson 1BEST, Old Xaverians: T. Fenton , A. Dickinson, C. Denton, S. Grigg, J. Silk, H. TrueloveBeaumaris: B. Hughes, M. Hardeman, F. Cloney, J. Bull, D. Cockburn
St Kevins 0.0, 0.0, 0.0, 13.13 (91)AJAX 0.0, 0.0, 0.0, 7.6 (48)GOALS, St Kevins: C. Randles 4, L. Kenyon 2, J. Leggett 2, M. Coloe 2, M. Cape 1, C. McPherson 1, B. Marchesani 1AJAX: Z. Aron 2, B. Fogelgarn 2, Y. Gottlieb 1, R. White 1, D. Wein 1BEST, St Kevins: D. McFarlane, J. Mustey, C. Randles, J. Liston, B. Marchesani, B. OmizzoloAJAX: B. Jones, D. Wein, Z. Aron, B. Adelist, E. Adelist, J. Brick
Yarra Valley BushrangersIs looking for Senior, Reserve &
U19 Coaches in 2015.Join us on the journey as we take the next step Finalists, Premiers & Grand
Finalists 2011-13Take us to the top. Be an important part
of a club which is fi ercely proud of its culture and keen to continue the success
we have achieved over recent years.Now located at our brand new home in
Doncaster.
For further informationcontact Ron Garlepp
Mob 0408 907 774
PREMIER C THIRDS LAST ROUNDSt Kevins 2.1, 5.4, 11.5, 17.9 (111)Ormond 1.1, 2.2, 3.4, 4.6 (30)GOALS, St Kevins: T. McMaster 3, S. Kaiser 2, M. Austin 2, M. Nolan 2, D. Kerr 2, D. Bourke 2, N. Brown 1, N. Pryor 1, J. Montgomerie 1, J. Mason 1 Ormond: C. Hirschman 1, J. Holland 1, L. Adlington 1, M. Hirschman 1 BEST, St Kevins: M. Austin, D. Bourke, M. Moore, S. Reid, N. Pryor, T. McMasterOrmond: S. O’Sullivan, C. Hirschman, J. Holland, C. Cleary, N. Houghton
Parkdale Vultures 5.2, 6.3, 8.7, 9.8 (62)Monash Blues 1.0, 1.6, 2.9, 4.12 (36)GOALS, Parkdale Vultures: M. Todd 3, J. Dobler 2, P. Vernon 1, A. Wingrave 1, J. Austin 1, M. Donald 1Monash Blues: W. Geary 1, D. Heap 1, G. Pavlos 1, N. Armstrong 1BEST, Parkdale Vultures: M. Todd, M. Donald, L. Symons, S. De Amicis, P. Vernon, R. HeaneyMonash Blues: C. Godsil, C. Vizard, C. Wilson, S. Poole, S. Fazzolari, W. Lucas
Old Ivanhoe 4.2, 8.5, 10.8, 11.9 (75)Marcellin 4.2, 5.5, 5.11, 7.14 (56)GOALS, Old Ivanhoe: K. Ellis 6, B. Mantesso 1, T. Ikeda 1, J. Vinicombe 1, S. Beattie 1, D. Hawkes 1BEST, Old Ivanhoe: K. Ellis, B. Mantesso, A. Velli, J. Vinicombe, M. Gorden, J. Mathew
P E G S 6.7, 12.15, 21.19, 27.26 (188)Hampton Rovers 0.0, 0.0, 0.1, 1.2 (8)GOALS, P E G S: M. Flaherty 5, G. Wilson 4, J. Lanting 2, T. Di Blasi 2, T. Rumble 2, B. Remboulis 2, D. Ryan 2, J. French 1, S. Caruso 1, K. Ng 1, J. Maguire 1, A. DeMarco 1, C. Ridley 1, M. McDougall 1, J. Barr 1 Hampton Rovers: B. Woodland 1BEST, P E G S: J. French, T. Di Blasi, S. Caruso, M. Flaherty, G. Wilson, B. RemboulisHampton Rovers: V. Camera, W. Wright, B. Woodland, S. Cougan, B. Lane, Z. Cochrane
LIVE SCORES: Access the URL on your Smartphone& save to your home screen.
livescores.vafa.com.au
57THE AMATEUR FOOTBALLER 2014
58 THE AMATEUR FOOTBALLER 2014
Norm Nugent
REVIEW ROUND 15SECTION 1
As predicted in this column, Old Xaverians infl icted Hawthorn’s fi rst loss on Sportscover Arena when the Crocodiles fi nished nine points ahead. Hawthorn started well and held a four point lead at half time before a six goal to one third quarter gave the Xaverians a 27 point advantage at the last change. Hawthorn fought back valiantly in the last, but were unable to bridge the gap. Best for the winners were: Andrew Jones, Tim O’Meara and Matt Omen (No 67). For Hawthorn, Stan Neohoritis, Anthony Marguccio and Anthony Demitriou were best. Prahran/Assumption had a day to forget when they journeyed to Mt Lilydale. The Two Blues goaled in the opening quarter, which proved to be their only major score of the match. Mt Lilydale, who had a confi dence building victory by 80 points, were well served by the consistent Neil Trigwell with fi ve goals. Old Geelong ended their disappointing season with a fi ve point win over Masala after a very even contest.
SECTION 2
In an early match, fourth placed Therry Penola had the better of leaders, Emmaus/St Leo’s in the fi rst quarter. However the Animals fought back and held a one point lead at the half way mark. With six goals to two in the third quarter, Emmaus/ St Leo’s took control to lead by 29 points at three quarter time. They maintained their ascendency in the last and led by 36 points at the fi nal siren. Williamstown CYMS were always in control of their early morning match against Eley Park. The Sharks, who were all at sea by the Bay, went down by 113 points as the CY’s clinched second place and the double chance in the fi nals. On Friday night at Victoria Park, Richmond Central kept Bulleen Templestowe scoreless for a half and confi ned the Bullants to a sole goal as the Snake’s cruised to victory by 96 points.
SECTION 3
With a winning margin of 92 points, NOBs/ St Patrick’s easily accounted for a disappointing MHSOB who struggled throughout on the big Gillon Oval. The best for the winners were;
CROCS ROLL SPARTANS DOUBLE CHANCE SEAGULLSDRAGONS SIGN OFF WITH WIN
Christopher Gatto, Hamish Christie and Thomas O’Halloran who kicked fi ve goals. The consistent Tom Doer-Tolhurst was best for the losing Unicorns. Fourth placed, Kew proved no match for leaders, La Trobe University, who were in control throughout the match and ran out winners by 123 points. Twelve players shared the 21 La Trobe goals, to demonstrate their multi pronged attack. Despite marked inaccuracy, Dragons were able to defeat UHS/ VU by eight points. The Dragons came home with newfound accuracy in the fi nal quarter to snatch their third victory of the season. William Cheesman kicked fi ve of the eight University High goals in a fi ne display.
SEMI FINALS PREVIEWSECTION 1
Hawthorn, the minor Premiers have defeated perennial Premiers Old Xaverians twice this season albeit twice on the small Rathmines Road, Reserve. Last week on Sportscover Arena, Old Xaverians infl icted Hawthorn’s only loss for the season. So many factors will be in “play” in this game. The weather often gives teams kicking south an initial advantage. Will potential match winners, Nick Bye, Matthew Green and James McDonnell play this week? Xavs won without them last Saturday! The ground had not proven favourable to Hawthorn over the years until their Premiership victory in 2013 and certainly the Xaverians have enjoyed unparalled success there over a generation. The Xaverians justifi ed my faith in them last week and I tip them to win again today. Mt Lilydale will start favourites to defeat Prahran/Assumption because of their two home victories during the season including the confi dence building one last week. In Round 12, The “Two Blues” won on the Righetti Oval and I suspect the Mt Lilydale players will be able to out run their opponents on Sportscover where the fi tness of so many Two Blues players has been tested over the years. Many of those who have struggled will be playing today. Even though my observation of Mt Lilydale was of a big defeat, I am selecting them to win today.
SECTION 1 TIPS IN BOLD (YEARS TOTAL 41/91%)
Hawthorn v Old Xaverians
Mt Lilydale v Prahran Assumption
SECTION 2
Richmond Central has defeated Therry Penola twice this season as well as playing the only tie of 2014 against them in Round 13. On form this year, Richmond Central must be favoured to win again.
CLUB
XVI
II
59THE AMATEUR FOOTBALLER 2014
Their defence has been the more impressive although over the 15 rounds there has not been a marked diff erence in points scored by each team. Based on the form to date, I select Richmond Central. Surely the success story of 2014 (so far) has been that of Williamstown CYMS, a team considered unlikely to compete this season after early setbacks. They have fi nished second and will approach today’s major semi fi nal knowing they hold a two to one winning advantage over the Animals including that in round 4 when the CY’s powered home to win by two points. Emmaus/St Leo’s won in Round 8 when their stars, Ben Walters, Mark Petryk and Robert Hughes were all on form. In Round 13, Willy won by eight points to set the stage for today. I have memories of Emmaus/St Leo’s fading out of the 2013 fi nals with consecutive defeats. Could it happen again despite their galaxy of much travelled stars? I am taking the risk on the Animal’s fi tness and select them to win.
SECTION 2 TIPS IN BOLD (YEARS TOTAL 30/67%)
Richmond Central v Therry Penola
Emmaus St Leos v Williamstown CYMS
SECTION 3
On Friday night MHSOB and Kew meet under lights on the wide wings of a fi tness testing Sportscover Arena. The Unicorns have twice defeated Kew whose sole win was by seven points in Round 8. From the times I have watched each team, it has been apparent that neither can sustain pressure for the whole game. At their best, I favour Melbourne High to win narrowly although Kew could surprise. Two weeks ago, La Trobe University would have been highly favoured to win this game against NOBs/St Patrick’s. However in Round 14, the “Combined Colleges” scored a 63 point victory under the La Trobe Lights. Unlike many other fi nal four teams, the wide expanses of headquarters will hold no fear for either side as they are both accustomed to playing on a big ground. La Trobe do not rely on individual goal kickers, rather they have shown versatility in attack, with their many goals spread between several players. NOBs/St Pat’s have relied fi rstly on Todd MacLeod and latterly on Tom and Ben O’Halloran for their goals. The result on Sunday morning could well depend on which back line holds up the better against unusual pressure. After a closely fought encounter, I select La Trobe to triumph.
TIPS IN BOLD (YEARS TOTAL 38/84%)
La Trobe Uni v NOB/St Pat’s
Kew v MHSOB
CLUB XVIII (1) LAST ROUNDOld Geelong 1.0, 2.3, 6.6, 8.8 (56)
Masala 2.5, 3.5, 4.5, 7.9 (51)
GOALS, Old Geelong: R. Buckley 3, B. Ferguson 2, A. Smith 1, M. Leslie 1, J. Graham 1
Masala: P. Kailasanathan 2, S. Freeman 2, J. Coghill 2, M. Decarne 1
BEST, Old Geelong: R. Buckley, A. Smith, B. Ferguson, S. Jenner, O. Davies, P. Menciassi
Masala: W. McMahon, S. Giritharan, M. Decarne, T. O’Brien, D. Nugent, D. Inge III
Old Xaverians 1.3, 3.5, 9.7, 10.8 (68)
Hawthorn 4.3, 4.3, 5.4, 9.5 (59)
GOALS, Old Xaverians: H. Lyons 3, T. Lee 3, N. Corcoran 2, M. Owen 1, N. Larkins 1
Hawthorn: A. Marguccio 2, S. Neohoritis 2, C. Katsanevakis 1, A. Brizzi 1, A. Mitropoulos 1, M. Dabab
1, M. Elijah 1 BEST, Old Xaverians: N. Corcoran, N. Larkins, T. Lee, D. Quinn, A. Barrett, H. Lyons
Hawthorn: A. Karim, M. Dabab, B. Wignell, S. Neohoritis, A. Marguccio, A. Demetriou
Mt Lilydale 2.5, 6.8, 10.12, 13.13 (91)
Prahran Assumption 0.1, 0.1, 0.2, 1.5 (11)
GOALS, Mt Lilydale: N. Trigwell 5, A. Thorne 2, J. Oakes 2, D. Cerra 1, N. Hooke 1, M. Fernando
1, M. Hollingsworth 1
Prahran Assumption: J. Corrigan 1
BEST, Mt Lilydale: B. Hughes, N. Trigwell, S. Hickey, H. Moyes, A. Stockley, B. Boomsma
Prahran Assumption: N. Keohler, N. Gouin, J. Corrigan, M. Slaven, L. Godeassi, P. O’Connor
CLUB XVIII (2) LAST ROUNDRichmond Central 2.7, 6.10, 11.14, 15.15 (105)
Bulleen Templestowe 1.1, 1.1, 1.1, 1.3 (9)
GOALS, Richmond Central: S. Hartmann 3, J. Stevenson 3, N. Rice 3, M. Sandilands 2, T. Nolan
1, R. Nolan 1, S. D’Arcy 1, M. Baron 1 Bulleen Templestowe: J. Gigliotti 1
BEST, Richmond Central: J. Stevenson, S. Hartmann, R. Nolan, M. Sandilands, P. Iser, L. McKenzie
Bulleen Templestowe: M. Vergamalis, R. Brancatisano, R. Rametta, M. Silvaggio, C. Smith, C. Broom
Williamstown CYMS 5.4, 11.8, 18.10, 23.15 (153)
Eley Park Sharks 0.4, 2.6, 5.7, 5.10 (40)
GOALS, Williamstown CYMS: C. Fennell 4, J. Buttigieg 3, M. Ferrie 3, D. Elias 3, M. Keating 2,
J. Streets 1, T. Humberstone 1, J. Street 1, C. Wiltshire 1, L. McKenzie 1, F. Henry 1, J. Micallef 1, J.
MacKenzie 1 Eley Park Sharks: J. Brown 2, P. Salvatico 1, A. Rock 1, P. Arouinthan 1
BEST, Williamstown CYMS: F. Henry, B. Gatt, L. McKenzie, J. Trethowan, D. O’Keeff e, M. Busuttil
Eley Park Sharks: I. Gridchin, J. Sheahan, T. Silvers, C. Cresswell, W. Knight, A. Quantrell
Emmaus St Leos 0.4, 2.8, 8.8, 11.9 (75)
Therry Penola 2.1, 3.1, 4.3, 6.3 (39)
GOALS, Emmaus St Leos: R. Hughes 4, M. Pietryk 2, J. Greensides 2, T. Walters 1, J. Vince 1,
A. Athorne 1
Therry Penola: D. McKibbin 1, D. Casey 1, N. Robinson 1, M. Helm 1, A. Rosso 1, A. Maynard 1
BEST, Emmaus St Leos: J. Vince, M. Pietryk, B. Walters, J. Greensides, O. Scott, T. Walters
Therry Penola: S. Matthews, S. Bye, A. Maynard, D. Casey, L. Vassallo, R. McKerrow
CLUB XVIII (3) LAST ROUNDDragons 1.4, 2.7, 3.17, 7.18 (60)
UHS-VU 2.2, 4.3, 6.3, 8.4 (52)
UHS-VU: W. Cheesman 5, S. Seeger-Snowden 1, A. Ausage 1, L. Grant 1
UHS-VU: A. Ausage, M. Reinhard, W. Cheesman, H. Waterman, L. Grant, E. Coombe
NOBS / St Pats 0.0, 0.0, 0.0, 19.5 (119)
MHSOB 0.0, 0.0, 0.0, 3.9 (27)
GOALS, NOBS / St Pats: T. O’Halloran 5, B. O’Halloran 3, T. Macleod 3, H. Christie 3, M. Piazza 3,
C. Roberts 1, T. Pick 1 MHSOB: T. Doer-Tolhurst 1, L. Albiston 1, M. Griffi n 1
BEST, NOBS / St Pats: M. Karunaratne, B. O’Halloran, L. Fogarty, C. Gatto, C. Ives, P. Moore
MHSOB: T. Doer-Tolhurst, A. Ahsan, M. Chowdhury, D. Grantham, D. Ndenzako, D. Nuttall
LA TROBE UNI 6.3, 10.8, 17.11, 21.17 (143)
Kew 2.0, 2.1, 3.2, 3.2 (20)
GOALS, La Trobe Uni: J. Eltringham 4, N. Doyle 3, Z. Curwen-Walker 3, S. Johnstone 2, R.
Clifton 2, J. Mildren 1, M. Beaumont 1, B. Cameron 1, A. Hughes 1, B. Jordan 1, M. Sturges 1, K.
Jeff rey 1 Kew: S. Healey 1, R. Harmeston 1, S. Coles 1
BEST, La Trobe Uni: P. Russell, A. Hughes, Z. Curwen-Walker, J. Eltringham, B. Jordan, R.
Garland Kew: T. Hunter, J. Galbraith, A. Quinn, R. Shute, A. Cross, M. Plain
60 THE AMATEUR FOOTBALLER 2014
SHARPSHOOTERS
SHAR
PSHO
OTER
S
Premier LR TOTAL
Matthew Handley Old Xaverians 0 40
Shura Taft Collegians 6 37
Chad Jones St Bernards 1 33
Andrew Merrington St Bernards 5 32
Premier Reserve LR TOTAL
Billy Riddle Collegians 2 22
Benjamin Considine St Bernards 0 22
Ned Walmsley Old Scotch 0 21
Thomas Duyndham St Bernards 2 19
Premier Thirds LR TOTAL
Damien Ryan St Bernards 0 28
Todd Daniher Old Xaverians 3 20
Andrew Walsh University Blues 0 18
Joshua Hanger Old Xaverians 1 16
Premier B LR TOTAL
David Fayman AJAX Afc 5 55
Michael Meehan Old Haileyburians 3 43
Jake Lew AJAX Afc 2 37
Cameron Beck Old Melburnians 5 34
Premier B Reserve LR TOTAL
Jamie Mugavin University Blues 3 50
Julian Gambaro St Kevins OB 2 41
Will Osborn Caulfi eld Grammarians 4 31
Cameron Tunbridge Old Melburnians 4 30
Premier B Thirds LR TOTAL
Charles Randles St Kevins OB 4 34
Zev Aron AJAX Afc 2 26
Alexander Edmondson Beaumaris FC 1 24
Israel Gutnick AJAX Afc 0 24
Premier C Reserve LR TOTAL
Nicholas Manning Ormond AFC 0 28
Tim Naylor Ormond AFC 0 27
Jake Archdeacon Peninsula OB 6 27
Jack Fenner PEGS Football Club 0 23
Premier C LR TOTAL
Ed Turner Hampton Rovers AFC 3 42
Dominic Bolger Marcellin OC 3 41
David Forrest PEGS Football Club 3 39
Joseph Cosgriff Monash Blues 2 39
Premier C Thirds LR TOTAL
Dylan Gook St Mary’s Salesian 0 50
Troy McMaster St Kevins OB 3 42
Matthew Flaherty PEGS Football Club 5 28
James Barrie St Mary’s Salesian 0 21
Division 1 LR TOTAL
Jarrod Bannister Therry Penola OB 3 83
Corey Bannister Therry Penola OB 1 68
Matthew Keown NOBS/St Pats 2 41
Callum Wood Old Geelong 2 37
Division 1 Reserve LR TOTAL
Matthew Sultana Williamstown CYMS 2 45
Steven Barlow Williamstown CYMS 6 41
Joel Quinn Therry Penola OB 2 35
Jon Rice Prahran Assumption AFC 2 29
Division 2 LR TOTAL
David Boundy Old Paradians 1 60
Sabastian Ciavola Eltham Collegians AFC 0 52
Andrew Brazzale Kew AFC 2 48
Louis Holmes St Mary’s Salesian 3 39
Division 2 Reserve LR TOTAL
Stefan Gusts St Mary’s Salesian 5 66
Andrew Coath Eltham Collegians AFC 8 45
Joshua Monro Old Paradians 5 42
Zach Tranter Eltham Collegians AFC 0 37
Division 3 LR TOTAL
Christopher Beluszar Emmaus St Leos OC AFC 7 57
Rhys Kirk UHS-VU AFC 5 52
Damon Marcon Northern Blues 4 49
Jack McMeel La Trobe University AFC 7 48
61THE AMATEUR FOOTBALLER 2014
Division 3 Reserve LR TOTAL
Mitchell Sweeney UHS-VU AFC 7 59
Travis Houlden Eley Park Sharks 4 34
Leigh Booth Eley Park Sharks 1 30
Jake Munro Richmond Central AFC 0 28
Division 4 LR TOTAL
Jason Ince Hawthorn AFC 4 73
Sam Gold Hawthorn AFC 5 53
Andrew Baker Canterbury Football Club 2 44
Daniel Penny Box Hill North AFC 0 36
Division 4 Reserve LR TOTAL
Jason Jackomos Hawthorn AFC 9 70
Shane Devers West Brunswick AFC 0 33
Glenn Williams Box Hill North AFC 2 27
Daniel Lauletta Hawthorn AFC 2 27
MEGT U19 Premier LR TOTAL
Jeremy Hannan Old Xaverians 11 66
James Canterbury St Kevins OB 1 52
Jonathan Daggian Old Scotch 2 46
Sam Lewin St Kevins OB 2 39
Under 19 Section 2 LR TOTAL
Joseph Campbell Old Trinity Grammarians 0 42
William Blakey University Blues 1 39
Daniel Batarilo University Blues 4 38
Jack Francis Parkdale Vultures 3 33
Under 19 Section 3 LR TOTAL
Mitchell Nixon Old Carey Grammarians 4 70
Nicholas Ebinger Williamstown CYMS 0 63
Xavier Burns Marcellin OC 0 53
Daniel Ryan St Mary’s Salesian 1 42
Under 19 North LR TOTAL
Josh Stephens Wyndam Suns Football Club 1 48
Thomas Hancock Yarra Valley OB 0 36
Jack Firth St Bernards 2 32
Reuben Blackmore-Moore Ivanhoe AFC 0 25
Under 19 South LR TOTAL
Campbell Jones Hampton Rovers AFC 2 50
Jack Meeking Ormond AFC 0 42
Jake Benoiton Oakleigh AFC 8 36
Jaycob Johnson Peninsula OB 1 34
VAFA Colts LR TOTAL
Kieren McKeogh Mazenod OC 3 55
Josh Swainston Mazenod OC 2 33
Brandyn Foley Point Cook AFC 1 27
Nicholas Munari UHS-VU AFC 1 26
Club XVIII (1) LR TOTAL
Ari Mitropoulos Hawthorn AFC 1 67
Antonio Brizzi Hawthorn AFC 1 47
Anthony Marguccio Hawthorn AFC 2 44
Sam Chester Old Xaverians 0 36
Club XVIII (2) LR TOTAL
Robert Hughes Emmaus St Leos OC AFC 4 46
Joshua Brown Eley Park Sharks 2 43
Joe Vernali Therry Penola OB 0 30
Mark Pietryk Emmaus St Leos OC AFC 2 30
Club XVIII (3) LR TOTAL
Todd Macleod NOBS/St Pats 3 37
Louis Meyer MHSOB 0 36
Thomas O’Halloran NOBS/St Pats 5 24
Benjamin O’Halloran NOBS/St Pats 3 23
62 THE AMATEUR FOOTBALLER 2014
1116 SEN VAFA PREMIERSHIP LADDERS 2014
PREMIER C RESERVESP W L D FF F A % Pts
P E G S 15 14 1 0 0 1312 532 246.62 56
Parkdale Vultures 14 12 2 0 1 1251 741 168.83 52
Old Camberwell 15 9 6 0 0 1274 827 154.05 36
Monash Blues 15 9 6 0 0 919 925 99.35 36
Peninsula 15 7 8 0 0 1161 956 121.44 28
Oakleigh 15 7 8 0 0 915 1125 81.33 28
Ormond 15 6 8 1 0 1176 1182 99.49 26
Marcellin 15 5 10 0 0 857 1087 78.84 20
Hampton Rovers 15 4 10 1 0 952 908 104.85 18
Banyule 14 0 14 0 0 466 2050 22.73 0
DIVISION TWO RESERVESP W L D F A % Pts
Old Eltham Collegians 15 14 1 0 1792 639 280.44 56
St Mary's Salesian 15 13 2 0 1962 517 379.5 52
Kew 15 12 3 0 1573 734 214.31 48
Ivanhoe 15 11 4 0 1628 638 255.17 44
Old Paradians 15 7 8 0 949 1072 88.53 28
Monash Gryphons 15 5 9 1 896 1305 68.66 22
St Johns 15 4 10 1 795 1275 62.35 18
Glen Eira 15 4 11 0 605 1282 47.19 16
South Melbourne Districts 15 3 12 0 701 1435 48.85 12
Elsternwick 15 1 14 0 300 2318 12.94 4
DIVISION THREE RESERVESP W L D For Agst % PTS
Richmond Central 15 13 2 0 1626 620 262.26 52
UHS-VU 15 13 2 0 1406 850 165.41 52
La Trobe University 15 10 5 0 1282 696 184.2 40
Aquinas 15 10 5 0 984 853 115.36 40
Power House 15 9 6 0 1228 772 159.07 36
Swinburne University 15 9 6 0 960 1061 90.48 36
Albert Park 15 8 7 0 1276 827 154.29 32
Eley Park Sharks 15 7 8 0 1269 948 133.86 28
St Francis Xavier 15 5 10 0 808 1280 63.12 20
Emmaus St Leos 15 4 11 0 876 1304 67.18 16
Northern Blues 15 2 13 0 823 1418 58.04 8
South Mornington 15 0 15 0 486 2441 19.91 0
PREMIER CP W L D F A % Pts
Marcellin 15 12 3 0 1425 1038 137.28 48
Monash Blues 15 11 4 0 1337 843 158.6 44
Hampton Rovers 15 11 4 0 1408 1125 125.16 44
Parkdale Vultures 15 8 7 0 1204 1217 98.93 32
Peninsula 15 8 7 0 1249 1277 97.81 32
P E G S 15 8 7 0 1225 1318 92.94 32
Oakleigh 15 7 8 0 1210 1113 108.72 28
Old Camberwell 15 5 9 1 1272 1317 96.58 22
Ormond 15 2 12 1 1084 1517 71.46 10
Banyule 15 2 13 0 1149 1798 63.9 8
DIVISION ONEP W L D F A % Pts
Therry Penola 15 15 0 0 1831 842 217.46 60
Williamstown CYMS 15 11 4 0 1315 1047 125.6 44
NOBS/St Pats 15 10 5 0 1407 1176 119.64 40
Old Geelong 15 8 7 0 1287 1257 102.39 32
Old Mentonians 15 8 7 0 1325 1357 97.64 32
Prahran Assumption 15 7 8 0 1465 1223 119.79 28
Yarra Valley 15 5 9 1 1138 1520 74.87 22
Whitefriars 15 5 10 0 1081 1299 83.22 20
Bulleen Templestowe 15 4 10 1 1041 1331 78.21 18
MHSOB 15 1 14 0 910 1748 52.06 4
DIVISION ONE RESERVESP W L D F A % Pts
Williamstown CYMS 15 12 3 0 1494 700 213.43 48
Prahran Assumption 15 12 3 0 1225 706 173.51 48
Therry Penola 15 10 5 0 1192 642 185.67 40
Old Geelong 15 10 5 0 1363 885 154.01 40
Whitefriars 15 9 6 0 1102 874 126.09 36
Yarra Valley 15 9 6 0 1099 944 116.42 36
Bulleen Templestowe 15 6 9 0 858 1043 82.26 24
NOBS/St Pats 15 5 10 0 972 1102 88.2 20
MHSOB 15 2 13 0 695 1488 46.71 8
Old Mentonians 15 0 15 0 391 2046 19.11 0
DIVISION TWOP W L D F A % Pts
Kew 15 12 2 1 1450 928 156.25 50
St Mary's Salesian 15 12 3 0 1677 831 201.81 48
Old Eltham Collegians 15 12 3 0 1483 972 152.57 48
Old Paradians 15 10 5 0 1325 982 134.93 40
St Johns 15 8 7 0 1432 1157 123.77 32
Ivanhoe 15 7 7 1 1265 1112 113.76 30
South Melbourne Districts 15 6 9 0 1157 1468 78.81 24
Elsternwick 15 3 12 0 991 1700 58.29 12
Monash Gryphons 15 3 12 0 856 1600 53.5 12
Glen Eira 15 1 14 0 749 1635 45.81 4
DIVISION THREEP W L D F A % Pts
Emmaus St Leos 15 11 4 0 1775 952 186.45 44
Northern Blues 15 11 4 0 1709 1126 151.78 44
Aquinas 15 10 5 0 1416 974 145.38 40
Swinburne University 15 10 5 0 1274 1047 121.68 40
Richmond Central 15 8 7 0 1544 1151 134.14 32
Albert Park 15 8 7 0 1307 1097 119.14 32
Power House 15 8 7 0 1139 1009 112.88 32
UHS-VU 15 8 7 0 1154 1211 95.29 32
St Francis Xavier 15 7 8 0 1119 1193 93.8 28
La Trobe University 15 5 10 0 1076 1139 94.47 20
Eley Park Sharks 15 4 11 0 1049 1340 78.28 16
South Mornington 15 0 15 0 380 2703 14.06 0
PREMIER C THIRDSP W L D FF F A % Pts
St Kevins 13 13 0 0 2 1830 322 568.32 60
St Mary's Salesian 13 11 2 2 0 1387 496 279.64 52
P E G S 12 7 5 1 2 1117 681 164.02 40
Old Ivanhoe 12 7 5 1 0 728 685 106.28 32
Parkdale Vultures 12 6 6 2 0 612 944 64.83 32
Marcellin 10 4 6 1 2 896 942 95.12 28
Monash Blues 14 5 9 0 1 778 1057 73.6 24
Ormond 12 2 10 2 0 453 1301 34.82 16
Hampton Rovers 14 2 12 1 0 412 1365 30.18 12
VAFA COLTSP W L D FF F A % Pts
Mazenod 14 13 1 0 1 1246 322 386.96 56
St Bernards 15 11 4 0 0 1164 544 213.97 44
Westbourne Gr 13 11 2 0 0 927 453 204.64 44
Point Cook AFC 15 7 8 0 0 818 853 95.9 28
Williamstown CYMS 15 7 8 0 0 732 1043 70.18 28
Old Paradians 13 4 9 0 0 552 901 61.27 16
UHS-VU / Flemington 15 3 12 0 0 587 1003 58.52 12
University Blues 13 1 12 0 0 464 1219 38.06 4
63THE AMATEUR FOOTBALLER 2014
DIVISION FOURP W L D F A % Pts
Hawthorn 15 15 0 0 2055 684 300.44 60
West Brunswick 15 13 2 0 1571 957 164.16 52
Canterbury 15 11 4 0 1567 1247 125.66 44
Manningham Cobras 15 9 6 0 1379 1088 126.75 36
Westbourne Gr 15 7 8 0 1448 1309 110.62 28
Box Hill North 15 6 9 0 1328 1489 89.19 24
Point Cook 15 6 9 0 1130 1306 86.52 24
Dragons 15 5 10 0 973 1436 67.76 20
North Brunswick 15 3 12 0 1079 1386 77.85 12
Chadstone 15 0 15 0 618 2246 27.52 0
1116 SEN VAFA PREMIERSHIP LADDERS 2014
CLUB XVIII (3)P W L D FF F A % Pts
La Trobe Uni 13 12 1 0 2 1712 416 411.54 56
NOBS / St Pats 14 12 2 0 1 1486 653 227.57 52
MHSOB 14 6 8 0 1 918 1096 83.76 28
Kew 15 6 9 0 0 879 1185 74.18 24
Dragons 11 3 8 0 0 483 1650 29.27 12
UHS-VU 15 2 13 0 0 772 1431 53.95 8
MEGT UNDER 19 PREMIERP W L D FF F A % Pts
St Bernards 15 14 1 0 0 1944 676 287.57 56
St Kevins 14 11 3 0 1 1640 796 206.03 48
Old Xaverians 14 10 3 1 1 1697 814 208.48 46
Beaumaris 15 8 6 1 0 1298 1128 115.07 34
Old Scotch 15 6 9 0 0 1056 1272 83.02 24
De La Salle 15 4 11 0 0 1115 1455 76.63 16
St Bedes / Mentone Tigers 14 2 12 0 0 765 1647 46.45 8
Old Melburnians 14 2 12 0 0 443 2253 19.66 8
UNDER 19 SECTION 2P W L D F A % Pts
Old Trinity 15 12 3 0 1278 833 153.42 48
Whitefriars 15 11 4 0 1330 756 175.93 44
University Blues 15 11 4 0 1361 996 136.65 44
Parkdale Vultures 15 10 5 0 1305 907 143.88 40
Fitzroy 15 10 5 0 1240 966 128.36 40
Mazenod 15 7 8 0 973 974 99.9 28
Old Brighton 15 5 10 0 826 1204 68.6 20
Collegians 15 5 10 0 597 1028 58.07 20
University Blacks 15 4 11 0 699 1253 55.79 16
Caulfi eld Grammarians 15 0 15 0 732 1424 51.4 0
UNDER 19 SECTION 3P W L D F A % Pts
Old Ivanhoe 15 12 3 0 1509 906 166.56 48
Williamstown CYMS 15 11 4 0 1464 937 156.24 44
Old Carey 15 11 4 0 1481 985 150.36 44
Marcellin 15 11 4 0 1259 921 136.7 44
AJAX 15 8 7 0 1186 1038 114.26 32
Old Xaverians 15 5 10 0 968 1242 77.94 20
Old Camberwell 15 5 10 0 853 1182 72.17 20
St Mary's Salesian 15 1 14 0 868 1652 52.54 4
UNDER 19 NORTHP W L D F A % Pts
Ivanhoe 15 14 1 0 1339 713 187.8 56
Wyndham Suns 15 10 5 0 1220 913 133.63 40
St Bernards 15 9 4 2 1269 1030 123.2 40
Banyule 15 8 6 1 1134 868 130.65 34
Therry Penola 10 7 3 0 940 561 167.56 32
La Trobe University 15 7 8 0 941 937 100.43 28
P E G S 15 7 8 0 1067 1122 95.1 28
Yarra Valley 15 6 9 0 1163 1191 97.65 24
Northern Blues 10 2 8 0 621 1010 61.49 8
Whitefriars 15 0 14 1 539 1504 35.84 2
UNDER 19 SOUTHP W L D D FF F A % Pts
Oakleigh 13 11 2 0 1 1 1318 593 222.26 52
Ormond 14 12 2 0 0 1 1489 690 215.8 52
De La Salle 14 10 4 0 1 0 1265 833 151.86 44
Hampton Rovers 15 9 6 0 0 0 1204 968 124.38 36
Beaumaris 14 7 7 0 0 1 1386 1032 134.3 32
Peninsula 15 7 8 0 0 0 1211 1124 107.74 28
Monash Blues 15 6 9 0 0 0 970 1220 79.51 24
Old Haileybury 15 5 10 0 0 0 830 1298 63.94 20
Collegians 12 4 8 0 0 0 601 1364 44.06 16
MHSOB 15 1 14 0 0 0 560 1671 33.51 4
DIVISION FOUR RESERVESP W L D B F A % Pts
West Brunswick 15 15 0 0 2371 276 859.06 60 4
Hawthorn 15 13 2 0 2003 454 441.19 52 4
Manningham Cobras 15 8 6 1 833 976 85.35 34 4
Westbourne Gr. 15 8 7 0 1030 909 113.31 32 4
Box Hill North 15 8 7 0 988 1190 83.03 32 4
Canterbury 15 8 7 0 1054 1292 81.58 32 4
North Brunswick 15 4 10 1 832 1468 56.68 18 0
Chadstone 15 4 11 0 715 1644 43.49 16 0
Point Cook 15 3 12 0 762 1514 50.33 12 0
Dragons 15 3 12 0 541 1406 38.48 12 0
Club XVIII (1)P W L D F A % Pts
Hawthorn 15 14 1 0 2075 711 291.84 56
Old Xaverians 14 12 2 1 1804 866 208.31 52
Mt Lilydale 15 8 7 0 1292 1155 111.86 32
Prahran Assumption 15 7 8 0 975 1341 72.71 28
Old Geelong 14 2 12 0 709 1565 45.3 8
Masala 15 1 14 0 663 1924 34.46 4
Club XVIII (2)P W L D FF F A % Pts
Emmaus St Leos 15 12 3 0 0 1431 714 200.42 48
Williamstown CYMS 14 10 4 0 1 1202 1046 114.91 44
Richmond Central 15 10 4 1 0 1069 762 140.29 42
Therry Penola 15 6 8 1 0 1039 1075 96.65 26
Eley Park Sharks 15 5 10 0 0 903 1137 79.42 20
Bulleen Templestowe 14 0 14 0 0 597 1562 38.22 0
64 THE AMATEUR FOOTBALLER 2014
WINNING EDGE CLUB CHAMPIONSHIP
Club Seniors Reserves 19/18Thirds/
C18Total
St Bernards 44 26 42 11 123
University Blues 52 28 33 5.5 118.5
Williamstown CYMS 44 24 33 10.5 111.5
Therry Penola OB 60 20 24 6.5 110.5
St Kevins OB 36 26 34.5 10.5 107
Hawthorn AFC 60 26 0 14 100
Marcellin OC 48 10 33 6 97
Parkdale Vultures 32 25 30 8 95
Ivanhoe AFC 30 22 42 0 94
Old Xaverians 28 18 33 10.5 89.5
PREMIER RESERVESP W L D F A % Pts
St Bernards 14 13 1 0 1220 620 196.77 52
Old Xaverians 14 9 5 0 982 741 132.52 36
Old Scotch 14 8 6 0 998 867 115.11 32
Collegians 14 8 6 0 891 845 105.44 32
Beaumaris 14 7 6 1 995 851 116.92 30
Old Brighton 14 7 7 0 973 847 114.88 28
University Blacks 14 6 7 1 783 820 95.49 26
St Bedes/Mentone Tigers 14 5 9 0 821 1048 78.34 20
Old Trinity 14 4 10 0 786 1292 60.84 16
De La Salle 14 2 12 0 718 1236 58.09 8
PREMIERP W L D F A % Pts
University Blacks 14 11 3 0 1325 791 167.51 44
St Bernards 14 11 3 0 1264 931 135.77 44
Old Scotch 14 8 6 0 1254 1090 115.05 32
Old Trinity 14 8 6 0 1103 1004 109.86 32
Collegians 14 8 6 0 1078 1115 96.68 32
Old Xaverians 14 7 7 0 970 1052 92.21 28
Beaumaris 14 5 9 0 1124 1201 93.59 20
Old Brighton 14 5 9 0 906 1253 72.31 20
De La Salle 14 4 10 0 840 1201 69.94 16
St Bedes/Mentone Tigers 14 3 11 0 985 1292 76.24 12
PREMIER THIRDSP W L D B FF F A % Pts
University Blacks 12 11 1 0 1 1 1044 646 161.61 52
Old Xaverians 11 9 2 0 0 3 1107 619 178.84 48
St Bernards 13 10 3 0 1 0 1080 692 156.07 44
University Blues 13 5 8 0 0 1 892 839 106.32 24
Collegians 13 5 8 0 1 0 707 891 79.35 24
Old Melburnians 11 4 7 0 1 0 621 993 62.54 20
Old Scotch 12 1 11 0 2 0 572 972 58.85 12
PREMIER BP W L D F A % Pts
University Blues 15 13 2 0 1708 699 244.35 52
Old Carey 15 10 5 0 1477 1174 125.81 40
St Kevins 15 9 6 0 1484 1253 118.44 36
Old Melburnians 15 8 7 0 1245 1131 110.08 32
Mazenod 15 8 7 0 1210 1217 99.42 32
AJAX 15 8 7 0 1183 1212 97.61 32
Fitzroy 15 6 8 1 1049 1327 79.05 26
Caulfi eld Grammarians 15 6 9 0 998 1426 69.99 24
Old Haileybury 15 3 11 1 1068 1448 73.76 14
Old Ivanhoe 15 3 12 0 935 1470 63.61 12
PREMIER B RESERVESP W L D F A % Pts
University Blues 15 14 1 0 1686 461 365.73 56
St Kevins 15 13 2 0 1690 607 278.42 52
Caulfi eld Grammarians 15 10 5 0 1121 764 146.73 40
Old Melburnians 15 8 7 0 1224 1056 115.91 32
Old Ivanhoe 15 7 8 0 902 1175 76.77 28
Old Carey 15 6 9 0 967 1098 88.07 24
Fitzroy 15 6 9 0 936 1158 80.83 24
AJAX 15 5 10 0 720 1067 67.48 20
Old Haileybury 15 3 12 0 676 1635 41.35 12
Mazenod 15 3 12 0 603 1504 40.09 12
PREMIER B THIRDSP W L D F FF A % Pts
Old Xaverians 12 10 1 1 3 1591 641 248.21 54
St Kevins 13 9 3 1 2 1385 794 174.43 46
Fitzroy 14 10 4 0 1 1192 728 163.74 44
Old Brighton 14 8 6 0 1 1208 981 123.14 36
AJAX 15 7 8 0 0 1006 1019 98.72 28
Beaumaris 13 7 6 0 0 1137 1193 95.31 28
Caulfi eld Grammarians 12 5 7 0 1 929 1132 82.07 24
Old Carey 15 5 10 0 0 912 1319 69.14 20
Old Trinity 13 4 9 0 0 704 1229 57.28 16
Mazenod 13 1 12 0 0 467 1775 26.31 4
1116 SEN VAFA PREMIERSHIP LADDERS 2014
PROUD SPONSOR OF VICTORIAN AMATEUR FOOTBALL ASSOCIATION
www.bayford.com.au
BAYFORD FORDCOBURG PHONE: 9297 5000EPPING PHONE: 9401 8888
BUNDOORA PHONE: 9467 5533
BAYFORD CITROENSOUTH YARRA PHONE: 8290 2877
BAYFORD PEUGEOTCITY PHONE: 9341 4444
SOUTH YARRA PHONE: 8290 2888
CHRYSLER JEEP DODGEHAWTHORN EAST PHONE: 9811 1800
BAYFORD VOLKSWAGENCAMBERWELL PHONE: 9811 1888
EPPING PHONE: 9409 9000 FAIRFIELD PHONE: 9471 5500
BMWSOUTH YARRA PHONE: 9521 2121
OAKLEIGH PHONE: 9252 5000
• New, Used and Demonstrator vehicles• 12 convenient locations • Multiple brands
Bayford would like to thank you for the opportunity to be involved with the V.A.F.A. We look forward to fostering a supportive relationship with all those involved
with the association well into the future.
To demonstrate our proud sponsorship of the VAFA, we’d like to extend the following offer to your club.
We’ll gladly pledge $500 to your club for any successful introduction at any of our
dealerships, resulting in a new or used vehicle sale, from any member, player or supporter.
Simply spread the word to help raise funds for your club! We thank you again for choosing Bayford as your sponsor.
Bendigo and Adelaide Bank Limited, The Bendigo Centre, Bendigo, VIC 3550. ABN 11 068 049 178. AFSL 237879. (S45195) (6/13)
www.bendigobank.com.au
East Malvern Community Bank® Branch are proud sponsors of Amateur Football
With every product or service we offer, money goes back into the community to support local clubs, organisations and initiatives like Amateur Football.
As a Bendigo Bank customer you benefit from competitive products and great service and get the satisfaction of knowing your banking is contributing to your community.
So make a difference – to your own banking and to your community. Drop into East Malvern Community Bank® Branch at 300 Waverley Road, East Malvern or phone Branch Manager, Peter Wolff on 9563 6044.
East Malvern Community Bank® Branch
TTTTTTTTTTTTTTTTThe
he
he
he
he
he
he
he
he
he
he
he
hee
he
he
hhhhhhhwwwwwwwwwwwwww
ooooooooorrrrrrrrrrd
Sd
Sd
Sd
SSSd
Sd
SSd
SSSd
Sd
SSSd
Sd
Sddd
OPOPOPOPOPOPOOPOPOPPPRRRRRRRRRR
TTTTTTTTTTSSSSSSSSSSSSCCCCCCCC
OV
EEV
EEV
EEEV
EV
EEV
EO
VEE
OV
EV
EO
VEEEEEE
VEEEEEEE
VEE
VE
OV
EV
EO
VE
VVO
VVO
VVO
R aa
R a
R a
Ra
R a
Ra
Ra
RRRRRRRRRRRRRRRRRRRRRRR
dd
d
d
d
dn
ddn
ddn
ddn
dn
dn
dnnnnn
the
the
the
the
the
the
the
the
SSSSSSSSSSSSSpppppppppppppooooooooooooo
rrrrrrrrrrrrrrtststststststststtststccccccccoooooooo
vvvvvvver er
er
er
erreLLLLLLLLLLLLo
go
og
oo
go
og
oo
go
og
oo
go
og
oo
goo
go
og
oo
go
go
og
og
aaaaaaaaaaarrrrrrrrrrre
tte
te
te e
te
te
te
te
te
te
te
rrrrrrrrrrrrdad
ead
ed
ead
ead
ead
ead
edad
ed
ead
edadad
ma
ma
ma
ma
ma
maa
marrrrr
kskskskskskkf
of
of
of
off
of
offf
offf
oooooooooooSSSSSpppppppp
oooooooooorrrrrt
ststststststtccccccooooooooooo
vvvvvvvvvver er
err r reeeeeeeAAAAAAAAAAAAAA
ust
ustt
ust
ust
ust
us
uss
uurrrrra
liali
ali
aliilialiii
alaaaa a aaaaa
PPPPPPPPttttttty
Ly
Ly
Ly
Ly
Ly
Lyy
Lyy
ttttttttttttddddddddddd
Supporting Amateur Football Since 1991
www.sportscover.comVAFA MAJOR SPONSOR
worldwide sports insurance pty ltd
BROKER FOR THE VAFA
Web: www.wwsi.com.au
SPO
RTS
CO
VER
TM