the bacterial cytoskeleton modulates motility, type 3 ... · spectrum of disease ranging from...

The Bacterial Cytoskeleton Modulates Motility, Type 3Secretion, and Colonization in SalmonellaDavid M. Bulmer1, Lubna Kharraz1, Andrew J. Grant2, Paul Dean1, Fiona J. E. Morgan2, Michail H.

Karavolos1, Anne C. Doble1, Emma J. McGhie3, Vassilis Koronakis3, Richard A. Daniel1, Pietro Mastroeni2,

C. M. Anjam Khan1*

1 Centre for Bacterial Cell Biology, Institute for Cell and Molecular Biosciences, The Medical School, University of Newcastle, Newcastle, United Kingdom, 2 Department of

Veterinary Medicine, University of Cambridge, Cambridge, United Kingdom, 3 Department of Pathology, University of Cambridge, Cambridge, United Kingdom

Abstract

Although there have been great advances in our understanding of the bacterial cytoskeleton, major gaps remain in ourknowledge of its importance to virulence. In this study we have explored the contribution of the bacterial cytoskeleton tothe ability of Salmonella to express and assemble virulence factors and cause disease. The bacterial actin-like protein MreBpolymerises into helical filaments and interacts with other cytoskeletal elements including MreC to control cell-shape. AsmreB appears to be an essential gene, we have constructed a viable DmreC depletion mutant in Salmonella. Using a broadrange of independent biochemical, fluorescence and phenotypic screens we provide evidence that the Salmonellapathogenicity island-1 type three secretion system (SPI1-T3SS) and flagella systems are down-regulated in the absence ofMreC. In contrast the SPI-2 T3SS appears to remain functional. The phenotypes have been further validated using a chemicalgenetic approach to disrupt the functionality of MreB. Although the fitness of DmreC is reduced in vivo, we observed thatthis defect does not completely abrogate the ability of Salmonella to cause disease systemically. By forcing on expression offlagella and SPI-1 T3SS in trans with the master regulators FlhDC and HilA, it is clear that the cytoskeleton is dispensable forthe assembly of these structures but essential for their expression. As two-component systems are involved in sensing andadapting to environmental and cell surface signals, we have constructed and screened a panel of such mutants andidentified the sensor kinase RcsC as a key phenotypic regulator in DmreC. Further genetic analysis revealed the importanceof the Rcs two-component system in modulating the expression of these virulence factors. Collectively, these resultssuggest that expression of virulence genes might be directly coordinated with cytoskeletal integrity, and this regulation ismediated by the two-component system sensor kinase RcsC.

Citation: Bulmer DM, Kharraz L, Grant AJ, Dean P, Morgan FJE, et al. (2012) The Bacterial Cytoskeleton Modulates Motility, Type 3 Secretion, and Colonization inSalmonella. PLoS Pathog 8(1): e1002500. doi:10.1371/journal.ppat.1002500

Editor: Mark Stevens, Roslin Institute, United Kingdom

Received May 24, 2011; Accepted December 7, 2011; Published January 26, 2012

Copyright: � 2012 Bulmer et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permitsunrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding: This work was supported by Medical Research Council UK (www.mrc.ac.uk) grant (G0801212) to CMAK. LK was supported by a Ford Foundation ofAmerica (www.fordfoundation.org)PhD studentship with CMAK. ACD is supported by a Medical Research Council (UK)(www.mrc.ac.uk) PhD studentship to CMAKand RAD. AJG is supported by a Medical Research Council (UK) (www.mrc.ac.uk)grant (G0801161). The funders had no role in study design, data collection andanalysis, decision to publish, or preparation of the manuscript.

Competing Interests: The authors have declared that no competing interests exist.

* E-mail: [email protected]

Introduction

Salmonellae remain major global pathogens causing a broad

spectrum of disease ranging from gastroenteritis to typhoid fever

[1,2]. The emergence of multidrug resistant salmonellae is

complicating the management of disease [3,4]. Hence, there is

an urgent need to identify novel bacterial targets for the

development of new antimicrobial agents or vaccines to combat

infection.

The view that bacteria do not possess a cytoskeleton has

radically changed in recent years with the discovery of intracellular

filamentous protein assemblies with cell-shape defining function

[5]. Although there is little primary sequence identity between

eukaryotic cytoskeletal proteins and those in prokaryotes, proteins

with actin- and tubulin-like structural motifs have been identified

in bacteria. Bacterial cytokinesis is dependent on FtsZ which

contains a structural fold mirroring tubulin. FtsZ displays similar

dynamic properties to tubulin and is able to polymerise

unidirectionally in a GTP-dependent manner to produce poly-

meric filaments [6,7]. Polymers of FtsZ are able to assemble into a

transient helical structure and subsequently form a ring-like

structure around the circumference of the mid-cell [8]. This Z-ring

is required for recruiting proteins for the assembly of the cell

division complex [8]. The intermediate filament-like protein

crescentin determines the vibroid shape of Caulobacter crescentus

cells [9].

The bacterial proteins MreB, Mbl, and ParM display the

structural and dynamic properties of eukaryotic actin [10].

Amongst these proteins, MreB is the most homologous to actin

in terms of primary sequence, structure, and size [11,12]. The

most conserved region of this actin-superfamily is the ATPase

domain. MreB can polymerise into helical filamentous structures

important for cell morphology. Live cell microscopy in Bacillus

subtilis revealed that MreB forms large cables which follow a helical

path close to the cytoplasmic membrane [5]. An equivalent MreB

protein has been found in Escherichia coli. When MreB is depleted,

rod-shaped B. subtilis and E. coli cells become spherical [5,13–15].

In C. crescentus MreB has been implicated to play a role in the

PLoS Pathogens | www.plospathogens.org 1 January 2012 | Volume 8 | Issue 1 | e1002500

control of cell polarity [16]. In rod-shaped bacteria the MreB

polymeric structures control the localisation of cell wall growth by

providing a scaffold for enzymes involved in cell wall assembly

[17].

The MreB operon in E. coli and B. subtilis encodes for a number

of additional genes, which do not possess any similarity to actin

[18]. These include the cellular membrane proteins MreC and

MreD, which also have a helical disposition. MreC forms a dimer

and interestingly in C. crescentus MreC is localised in spirals in the

periplasm [19]. Recent studies by Rothfield and colleagues

provide convincing evidence to suggest that in E. coli MreB,

MreC and MreD form helical structures independently of each

other [20]. Using affinity purification and bacterial two hybrid

assays, MreC and MreD appear to interact together [13]. In E. coli

there is evidence to suggest that MreB interacts with MreC, but

this may not be the case in Rhodobacter sphaeroides or C. crescentus

[21]. As well as playing a key role in cell morphogenesis, MreB

also has a pivotal function in chromosome segregation [22–24].

Adding the MreB inhibitor A22 [S-(3,4-Dichlorobenzyl) iso-

thiourea] to synchronised cultures of C. crescentus inhibited

segregation of GFP-tagged chromosomal origins [22]. However

MreB may not function in chromosome segregation in Bacillus

[15]. Recently another helically distributed cytoplasmic mem-

brane protein which interacts with MreB named RodZ has been

identified [25–27]. Cellular components including the RNA

degradosome and lipopolysaccharide have also been identified to

be localised in helical structures within the cell [28,29].

In spite of these major advances in our understanding of the

structure and organization of the bacterial cytoskeleton, there are

major gaps in our knowledge of its role in bacterial pathogenicity.

In this study we wished to gain insights into understanding the

function of the bacterial cytoskeleton in the pathogenicity of

Salmonella.

Materials and Methods

Ethics StatementThe in vivo experiments were covered by a Project License

granted by the Home Office under the Animal (Scientific

Procedures) Act 1986. This license was approved locally by the

University of Cambridge Ethical Review Committee.

Culture ConditionsS. Typhimurium SL1344 and mutant derivatives used in this

study are described in Table 1. Strains were routinely grown in

Luria-Bertani (LB) broth with appropriate antibiotics at the

following concentrations: (kanamycin 50 mg ml21), ampicillin

(100 mg ml21 or 30 mg ml21 for pNDM220). A22 (Calbiochem)

was added at 10 mg ml21. Bacteria were grown overnight in 5 ml

LB, before 25 ml of culture was used to inoculate 25 ml of fresh LB

in a 250 ml flask and grown at 37uC shaking (200 rpm) unless

otherwise stated. DmreC was maintained in media containing

100 mM IPTG, however for phenotypic testing this was removed

unless otherwise mentioned.

For the SPI-1 T3S studies cells were grown overnight in LB

before subculturing 1/100 into 25 ml fresh LB and growing at

37uC for approximately 5 hrs with good aeration until

OD600nm,1.2 in 250 ml flasks [30]. For the SPI-2 T3S studies

cells were grown in SPI-2 induction media (100 mM Tris-base,

0.1% w/v casamino acids, 0.1% w/v glycerol, 10 mM MgSO4,

40 mg ml21 histidine, pH 5.8). Cells were grown overnight in LB

before subculturing 1/100 in 25 ml SPI-2 inducing media before

growing for 16 h at 37uC in 250 ml flasks before sampling.

Motility AssaysCells were inoculated from a fresh LB plate onto the semi-solid

motility agar (10 g l21 Bacto-tryptone, 5 g l21 NaCl, 3 g l21 agar)

and incubated upright for a minimum of 5 h. Distinct zones of cell

motility were measured and compared to WT SL1344 and non-

motile SL1344 strains.

Chromosomal Gene Disruptions and Depletion MutantsChromosomal gene deletions were constructed using the

lambda Red method as described previously [31], before

transducing the mutation into a genetically clean parent strain

using bacteriophage P22int. In the case of DmreC and DmreD the

mutations were transduced into a parent strain containing

pTK521 (lac-mreBCD E. coli) to complement the mutation in the

presence of 100 mM isopropyl beta-D-1-thiogalactopyranoside

(IPTG). Gene deletion primers typically encompassed the first

and final 20 bases of the coding sequence of the respective gene

were synthesised. However, as the mreC and mreD gene coding

sequences overlap by a single base, to ensure only a single coding

sequence was disrupted the respective mreC 39 primer and mreD 59

primer were moved internally into their coding sequence such as

to produce no overlapping mutations. Gene deletions for the two-

component systems (DqseF, DphoBR, DyjiGH, DbaeSR, DbasSR,

DhydH, DqseBC DtctDE, DcpxAR, DrcaA, DrcsB, DrcsC, DrcsD,

DrcsDB, and DrcsCBD), were constructed in SL1344 WT using

classical lambda Red methods before transducing into the DmreC

strain using bacteriophage P22int. Primers are listed in Table 2.

Construction of the MreB-GFP Fusion VectorGFP was amplified from pZEP08 and cloned along with a new

multiple cloning site into the EcoRI and HindIII sites of pBR322 to

create pBR322GFP. mreB along with its natural promoter was

amplified from genomic DNA and cloned into the EcoRI and XbaI

sites of pBR322GFP, before the mreB-gfp fusion was subcloned

from the pBR322mreB-gfp into pNDM220 using the EcoRI and

BamHI sites.

Transcriptional Reporter FusionsFlagella and SPI1 transcriptional reporter plasmids were

transformed into SL1344 and DmreC mutant cells. Expression

from the lux transcriptional reporters was measured during the

growth cycle of 1023 diluted overnight cultures cells grown in

microtitre plates (200 ml total volume) for a minimum of 15 h at

37uC with periodic shaking. Optical density (600nm) and relative

luminescence was measured at 15 minute intervals using a Tecan

Infinity200 luminometer. Samples were tested in triplicate, and

repeated at least 3 times.

Author Summary

Salmonella are major global pathogens responsible forcausing food-borne disease. In recent years the existenceof a cytoskeleton in prokaryotes has received muchattention. In this study the Salmonella cytoskeleton hasbeen genetically disrupted, causing changes in morphol-ogy, motility and expression of key virulence factors. Weprovide evidence that the sensory protein RcsC detectschanges at the cell surface caused by the disintegration ofthe bacterial cytoskeleton and modulates expression ofkey virulence factors. This study provides insights into theimportance of the integrity of the bacterial cytoskeleton inthe ability of Salmonella to cause disease, and thus mayprovide a novel target for antimicrobial drugs or vaccines.

Salmonella Cytoskeleton and Pathogenicity


Table 1. Strains and plasmids.

Strain Genotype Reference

SL1344 Parent Strain [69]

DmreC1 SL1344 mreC::kan This work

DmreD1 SL1344 mreD::kan This work

DmreC SL1344 mreC::kan pTK521 This work

DmreD SL1344 mreD::kan pTK521 This work

DSPI-1 RM69 SPI-1::kan [70]

DSPI-2 12023 ssaV::kan [71]

DflhDC LT2 flhDC::kan [72]

DrcsA SL1344 rcsA::kan This work

DrcsB SL1344 rcsB::kan This work

DrcsC SL1344 rcsC::cat This work

DrcsD SL1344 rcsD::kan This work

DrcsF SL1344 rcsF::kan This work

DrcsDB SL1344 rcsDB::kan This work

DrcsCBD SL1344 rcsCBD::kan This work

DmreC DrcsA SL1344 mreC::cat rcsA::kan This work

DmreC DrcsB SL1344 mreC::cat rcsB::kan This work

DmreC DrcsC SL1344 mreC::kan rcsC::cat This work

DmreC DrcsD SL1344 mreC::cat rcsD::kan This work

DmreC DrcsDB SL1344 mreC::kan rcsDB::cat This work

DmreC DrcsCBD SL1344 mreC::cat rcsCBD::kan This work

DmreC DrcsF SL1344 mreC::cat rcsF::kan This work

DmreC DqseF SL1344 mreC::kan qseF::cat This work

DmreC DphoBR SL1344 mreC::kan phoBR::cat This work

DmreC DyjiGH SL1344 mreC::kan yjiGH::cat This work

DmreC DbaeSR SL1344 mreC::kan baeSR::cat This work

DmreC DbasSR SL1344 mreC::kan basSR::cat This work

DmreC DhydH SL1344 mreC::kan hydH::cat This work

DmreC DqseBC SL1344 mreC::kan qseBC::cat This work

DmreC DtctDE SL1344 mreC::kan tctDE::cat This work

DmreC DcpxAR SL1344 mreC::kan cpxAR::cat This work

YVM004 SJW1103 gfp-fliG [32]

YVM004 mreC SJW1103 gfp-fliG mreC::kan [32]

TH3724 PflhDC::T-POP (DEL-25) flhC5213::MudJ [33]

Plasmid Description Reference

pBR322 Cloning vector [73,74]

pBAD24 Cloning vector [75]

pZEP08 GFP+ transcriptional fusion vector [76]

pBR322-gfp pBR322 with gfp This work

pBR322-mreBgfp pBR322gfp with mreB This work

pNDM220 Low copy cloning vector [77]

pNDM220-mreBgfp mreBgfp subcloned from pBR322-mreBgfp This work

pKD13 Lambda Red template [31]

pKD46 Lambda Red recombinase [31]

pLE7 gfpmreB [36]

pTK521 pNDM220 pA1/O4/O3::mreBCD [14]

pCS26 luxCDABE promoter reporter vector [49]

pCS26-hilA hilA [49]

pCS26-hilC hilC [49]

pCS26-hilD hilD [49]



Construction of Complementation PlasmidsThe hilA and rcsC open reading frames were amplified from

SL1344 genomic DNA and cloned into the EcoRI and XbaI or the

EcoRI and HindIII sites of pBAD24 to create pBADhilA and

pBADrcsC respectively.

Protein ManipulationWhole cell total protein samples were obtained by pelleting an

appropriate volume of bacterial culture, followed by resuspension

in SDS-loading buffer and boiling for 10 mins. Culture

supernatants were filter sterilized (0.22 mm) and proteins were

ammonium sulphate precipitated (4 g 10 ml21 supernatant)

overnight at 4uC. Precipitated secreted proteins were resuspended

in H2O and then combined with an equal volume of sample buffer

(Biorad). Whole cell and culture supernatant samples were run on

12% SDS/PAGE and transferred on Protran nitrocellulose

transfer membranes (Schleicher & Schuell) using a wet transfer

apparatus (Biorad). Western blot analysis was performed using

polyclonal SipA, SipB, SipC or PrgH for testing SPI-1 T3S

functionality, coupled with a goat anti-mouse horseradish

peroxidase-labelled secondary antibody (Dako Cytomation).

Detection was carried out using 4-chloro-1-naphthol (Sigma)

according to the manufacturer’s instructions.

In vivo Inoculation and Growth CurvesFemale C57BL/6 mice were purchased from Harlan Olac Ltd.,

(Blackthorn, Bicester, UK). Mice were used when over eight weeks

of age. Bacterial suspensions for injection were grown for 16 h as a

stationary culture at 37oC in LB broth. Bacteria were diluted in

PBS prior to injection into a lateral tail vein. Mice were killed by

cervical dislocation and the livers and spleens aseptically removed.

Each organ was homogenised (separately) in a Seward Stomacher

80 Biomaster (Seward) in 10 ml of distilled water and viable

bacterial counts in the homogenate were assayed on pour plates of

LB agar. Representative bacterial colonies were kept and re-tested

for phenotypic changes.

Construction of Flagella Live Cell Imaging StrainsWild type Salmonella SJW1103 cells with chromosomal N-

terminal GFP fusion to fliG (YVM004) [32] were P22 transduced

with the mreC::kan mutation to create YVM004 DmreC. This strain,

along with the WT control, was subsequently transduced with a

chromosomally-based inducible flhDC locus derived from TH2919

[33].

Visualisation of Type 3 Secretion Systems and FlagellaCells were grown to the appropriate growth phase (mid-log for

SPI-1 and flagella, or stationary phase for SPI-2) in relevant media

(LB or SPI-2 inducing media). Flagella visualisation strains (fliG-

gfp), were mounted on 1% agarose beds for imaging. Samples for

visualising the type 3 secretion apparatus were fixed in 4%

paraformaldehyde diluted in PBS for 1 h before washing for

15 minutes in three changes of PBS. Samples were incubated with

either aSipA, aSipB, aSipC, aSipD (SPI-1) or aSseB (SPI-2)

antibodies diluted 1:1000 in PBS for 3 h with gentle agitation.

Samples were subsequently washed in PBS before incubating in

1:1000 Alexa Fluor 488 conjugated goat anti-rabbit antibody

(Invitrogen-Molecular Probes, Paisley, U.K.), washed for 30 mins

in fresh PBS before mounting onto agarose beds.

Tissue Immunostaining for Fluorescence MicroscopyHalf of each organ was fixed overnight in 4% paraformaldehyde

diluted in PBS, washed for 90 min in three changes of PBS and

then immersed in 20% sucrose (in PBS) for 16 h at 4oC before

being embedded in Optimal Cutting Temperature (OCT)

(Raymond A Lamb Ltd, Eastbourne, U.K.) in cryomoulds (Park

Scientific, Northampton, U.K.). Samples were frozen and stored at

-80oC. 30 mm sections were cut, blocked and permeabilised for

10 min in a permeabilising solution containing 10% normal goat

serum and 0.02% Saponin in PBS (Sigma, Poole, UK). Sections

were stained with 1:1000 dilution of rat anti-mouse CD18+

monoclonal antibody (clone M18/2, BD Pharmingen), together

with a 1:500 dilution of rabbit anti-LPS O4 agglutinating serum

(Remel Europe Ltd), for 16 h at 4oC. Subsequently, sections were

washed in PBS then incubated with 1:200 Alexa Fluor 568-

conjugated goat anti-rat antibody (Invitrogen-Molecular Probes,

Paisley, U.K.) and a 1:1000 dilution of Alexa Fluor 488-

conjugated goat anti-rabbit antibody (Invitrogen-Molecular

Probes, Paisley, U.K.). All sections were mounted onto Vecta-

bond-treated glass slides (Vector Laboratories Ltd.) using Vecta-

shield containing DAPI (Vector Laboratories Ltd.).

MicroscopyAll phase contrast and fluorescence images were captured using

an Andor iXonEM+ 885 EMCCD camera coupled to a Nikon Ti-

E microscope using a 100x/NA 1.4 oil immersion objective.

Images were acquired with NIS-ELEMENTS software (Nikon)

and processed using ImageJ. Fluorescence images were decon-

Plasmid Description Reference

pSB401 luxCDABE promoter reporter vector [41]

pBA409 sopB promoter reporter [41]

pRG34 pSB401-fliA [41]

pRG38 pSB401-flhD [41]

pRG46 pSB401-fliC [41]

pRG51 pSB401-flgA [41]

pMK1-lux luxCDABE promoter reporter vector [52]

pMK1-lux-ssaG pMK1-lux-ssaG This work

pBAD24-hilA hilA inducible expression plasmid This work

pBAD24-rcsC rcsC complementation plasmid This work

doi:10.1371/journal.ppat.1002500.t001

Table 1. Cont.



Table 2. PCR primers.

Primer Sequence (59-39)

mreC-P1 GGATTGTCCTGCCTCTCCGACGCGAGAATACGCATAGCCTGTGTAGGCTGGAGCTGCTTC

mreC-P4 CATCAGGCGCTCATTGGCGACGCGGTGAACCTCTTCCGGATTCCGGGGATCCGTCGACC

mreC5 ATACGGGCAGGATTATCCCT

mreC3 GCGCAATAAGAAACGAGAGC

mreD-P1 GGCGCGACCACGCCGCCTGCGCGTGCGCCGGGAGGGTAGTGTAGGCTGGAGCTGCTTC

mreD-P4 GGGGAACCGGAAGCAAGATACAGAGTTGTCATATCGACCTATTCCGGGGATCCGTCGACC

mreD5 ATCAACGCAACCATCGCCTT

mreD3 TCAATAATTCCTGGCGACGC

qseBC P1 GTTAACTGACGGCAACGCGAGTTACCGCAAGGAAGAACAGGTGTAGGCTGGAGCTGCTTC

qseBC P4 AAATGTGCAAAGTCTTTTGCGTTTTTGGCAAAAGTCTCTGATTCCGGGGATCCGTCGACC

qseBC 59 ACATCGCCTGCGGCGACAAG

qseBC 39 GCGGTGCGGTGAAATTAGCA

rcsA P1 GTAAGGGGAATTATCGTTACGCATTGAGTGAGGGTATGCCGTGTAGGCTGGAGCTGCTTC

rcsA P4 AATTGAGCCGGACTGGAGGTACATTGCCAGTCCGGATGTCATTCCGGGGATCCGTCGACC

rcsA 59 GATTATGGTGAGTTATTCAG

rcsA 39 CGAGAAGGCGGAGCAGGACT

rcsB P1 GCCTACGTCAAAAGCTTGCTGTAGCAAGGTAGCCCAATACGTGTAGGCTGGAGCTGCTTC

rcsB P4 ATAAGCGTAGCGCCATCAGGCTGGGTAACATAAAAGCGATATTCCGGGGATCCGTCGACC

rcsB 59 CGTGAGAAAGATGCTCCAGG

rcsB 39 TGAGTCGACTGGTAGGCCTG

rcsC P1 GTCACACTCTATTTACATCCTGAGGCGGAGCTTCGCCCCTGTGTAGGCTGGAGCTGCTTC

rcsC P4 TTTTACAGGCCGGACAGGCGACGCCGCCATCCGGCATTTTATTCCGGGGATCCGTCGACC

rcsC 59 CGTCATTTACCGCTACCTTA

rcsC 39 GGCCTACCAGTCGACTCATC

rcsD P1 CCTTCACCTTCAGCGTTGCTTTTACAGGTCGTAAACATAAGTGTAGGCTGGAGCTGCTTC

rcsD P4 ACCTTGCTACAGCAAGCTTTTGACGTAGGCGTCAATGTCGATTCCGGGGATCCGTCGACC

rcsD 59 TTCATTACCCTTTATACTGC

rcsD 39 CATATTGTTCATGTATTGGG

rcsF P1 TTCAATATCTGGCAATTAGAACATTCATTGAGGAAATATTGTGTAGGCTGGAGCTGCTTC

rcsF P4 GGGGAGCGAATAACGCCGATTTGATCAAACTGAAAGCTGCATTCCGGGGATCCGTCGACC

rcsF 59 TCATTTATGCAAGCTCCTGA

rcsF 39 CGGCGAATTTTTCTTTATAG

rcsCBD P1 GTCACACTCTATTTACATCCTGAGGCGGAGCTTCGCCCCTGTGTAGGCTGGAGCTGCTTC

rcsCBD P4 CCTTCACCTTCAGCGTTGCTTTACAGGTCGTAAACATAAATTCCGGGGATCCGTCGACC

rcsCBD 59 CGTCATTTACCGCTACCTTA

rcsCBD 39 TTCATTACCCTTTATACTGA

rcsDB P1 CCTTCACCTTCAGCGTTGCTTTTACAGGTCGTAAACATAAGTGTAGGCTGGAGCTGCTTC

rcsDB P4 ATAAGCGTAGCGCCATCAGGCTGGGTAACATAAAAGCGATATTCCGGGGATCCGTCGACC

rcsDB 59 TTCATTACCCTTTATACTGC

rcsDB 39 TGAGTCGACTGGTAGGCCTG

phoBR P1 ATGGCGCGGCATTGATAACTAACGACTAACAGGGCAAATTGTGTAGGCTGGAGCTGCTTC

phoBR P4 CATCCGCTGGCTTATGGAAAGTTATACTTACGAAAGGCAAATTCCGGGGATCCGTCGACC

phoBR 59 TGTCATAAATCTGACGCATA

phoBR 39 CTGCAAAGAAAATAAGCCAG

qseF P1 GGCGCCGTCGCCGTCACAAGATGAGGTAACGCCATGATAAGTGTAGGCTGGAGCTGCTTC

qseF P4 TTAAACGTAACATATTTCGCGCTACTTTACGGCATGAAAAATTCCGGGGATCCGTCGACC

qseF 59 CAAACCCGCGACGTCTGAAG

qseF 39 GTCGCCTGTGTTTTGATCGG

cpxAR P1 CGCCTGATGACGTAATTTCTGCCTCGGAGGTACGTAAACAGTGTAGGCTGGAGCTGCTTC

cpxAR P4 CGAGATAAAAAATCGGCCTGCATTCGCAGGCCGATGGTTTATTCCGGGGATCCGTCGACC



volved using Huygens Deconvolution software (Scientific Volume

Imaging). Cell measurements were taken on a Nikon Ti-E

microscope with NIS-ELEMENTS software. Immunofluorescence

images from tissue sections were analysed multi-colour fluores-

cence microscopy (MCFM) using a Leica DM6000B Fluorescence

microscope running FW4000 acquisition software.

Transepithelial Resistance and Bacterial EffectorTranslocation Assays

The effect of Salmonella infection on transepithelial resistance

(TER) was determined for differentiated Caco-2 cells as previously

described [34]. Briefly, the Caco-2 cells were grown on transwell

inserts (Corning, UK) until differentiated (12–14 days), before the

transepithelial resistance was measured for each well. Salmonella

strains were then added to the cells at a multiplicity of infection

(MOI) of 20, and the cells incubated for 4 h. TER measurements

were taken every hour and the results given as a ratio of TER (t)/

(t0) to show the percentage change in TER over the course of the

experiment. Data were collated and analysed for statistical

differences (Student’s t-test) in Minitab.

Samples for the assay of translocated effector proteins were

isolated from differentiated Caco-2 cells grown in 6 well plates

after infection with an MOI of 20 for 4 h. Excess bacteria were

washed off before the cells were solubilised in 0.01% Triton X-100

and centrifuged to remove bacteria and host cell membranes. The

host cell cytoplasmic fractions were analysed by western blotting

with aSipB antibody.

Results

In silico Identification of the Salmonella Actin HomologuemreB

We wished to identify and characterise putative Salmonella

cytoskeletal gene homologues. A BLAST search of the S.

Primer Sequence (59-39)

cpxAR 59 GTAAAGTCATGGATTAGCGA

cpxAR 39 CTCCCGGTAAATCTCGACGG

tctDE P1 AATTCCCTTTCAATGCGGCAGAAACTTTACAGGATGTGATGTGTAGGCTGGAGCTGCTTC

tctDE P4 TTTTTGTAAACGTGCTTTACCGCTGACACATTTGTCCGCAATTCCGGGGATCCGTCGACC

tctDE 59 TGTTAAAACAATAACCTTTC

tctDE 39 GTCACACCTCAAGATGCGAC

yjiGH P1 TTCCTGCTCCCAGCTCCGGCCTGCGTCAACACCTGTTTCTGTGTAGGCTGGAGCTGCTTC

yjiGH P4 TAAACTCCGCGGCGGATAAATCAGGCATGATAACTCCTTAATTCCGGGGATCCGTCGACC

yjiGH 59 TCAAATTTATTTCTCCTTTT

yjiGH 39 GTGCGCACCCTGTAATAAGG

HydH P1 TCTGGTTGCCAGTGATAGCGAGACAACAGGATTAACAAGGGTGTAGGCTGGAGCTGCTTC

HydH P4 GTAACGACATTGGCTGGCGCGCCATTGAGCGTGAGCAAAAATTCCGGGGATCCGTCGACC

HydH 59 TAAAGGCGCGGTCTTTACTA

HydH 39 CTGGGACGGCAGCTTCAGCC

BasS P1 CTACATGCTGGTTGCCACTGAGGAAAGCTAAGTGAGCCTGGTGTAGGCTGGAGCTGCTTC

BasS P4 AGTTTTATCTATGTGTGGGTCACGACGTATTAAACGCCTGATTCCGGGGATCCGTCGACC

BasS 59 CGCACGGTTCGCGGGTTTGG

BasS 39 GTAGTGTGCTGATTGTCAGC

BaeSR P1 TGGTCATTTCACGGCGTAAAAGGAGCCTGTAATGAAAGTCGTGTAGGCTGGAGCTGCTTC

BaeSR P4 ATATCGTCTTACGACCTTGTTATTGTTATGCCAATAATCAATTCCGGGGATCCGTCGACC

BaeSR 59 CCGCGTGCCGAACGATACAC

BaeSR 39 CAGAATAGCGTTGGCGGAAA

pEGFP5 GCGGAATTCAGGTACCCCCGGGCCATGGTCTAGAATGGTGAGCAAGGGCGAGG

pEGFP3 GCGAAGCTTTTACTTGTACAGCTCGTCC

mreB5 Eco GCGGAATTCGCAGATGTTTGTCAACACATC

mreB3 Xba GCGTCTAGACTCTTCGCTGAACAGGTCGCC

ssaG5 Eco GCGGAATTCCGACAGTATAGGCAATGCCG

ssaG3 Bam GCGGGATCCCCACTAATTGTGCAATATCC

BADhilA5 GCGGAATTCATGCCACATTTTAATC

BADhilA3 GCGTCTAGATTACCGTAATTTAATC

BADrcsC5 GCGGAATTCTTGAAATACCTTGCTTC

BADrcsC3 GCGAAGCTTTTATGCCCGCGTTTTACGTACCC

Bold indicates restriction enzyme recognition sites.doi:10.1371/journal.ppat.1002500.t002

Table 2. Cont.



Typhimurium genome sequence database (www.ncbi.nlm.nih.gov)

[35] for the known E. coli actin-homologue MreB identified a

putative mre operon of high sequence identity. Comparison of the

Salmonella genes to those of E. coli showed 100% (mreB), 88% (mreC)

and 94% (mreD) homology at amino acid level, comparisons of

these same genes to those in B. subtilis revealed sequence

homologies of 57%, 24% and 27% respectively.

MreB Proteins Are Helically LocalisedIn order to determine the localisation of MreB in Salmonella,

vectors expressing N and C terminal fusions of MreB to GFP were

used. The N-terminal fusion plasmid has already been described

[36], and we constructed a C-terminal fusion vector. Both

constructs revealed a helical distribution of MreB along the long

axis of the cell. The helices were discerned by assembling a series

of z-stack images taken in successive planes by using Metamorph

imaging and Huygens deconvolution software (Figure 1A).

Construction of mre MutantsThe mreB gene appears to be essential in bacteria including

Salmonella (data not shown), and DmreB viable cells often contain

compensatory mutations [37]. Each of the components of the

cytoskeletal complex, for example MreB, MreC, or MreD, are

essential for its function. As an alternative strategy to study the

function of the cytoskeleton we therefore generated a mreC

depletion strain under conditions designed to minimise selective

pressures for undefined secondary compensatory mutations [37].

Using the lambda Red one-step gene disruption method, we

successfully constructed a mreC::kan mutant in the S. Typhimurium

wild-type strain SL1344 [31]. This mutation leaves intact the first

gene in the operon mreB. Using bacteriophage P22int the mreC::kan

mutation was then transduced into a genetically ‘‘clean’’ SL1344

strain harbouring plac-mre operon (pTK521) [14] and the resulting

strain designated DmreC. The plac-mre operon is a low copy

number plasmid expressing the mre operon from the IPTG-

inducible lac promoter. The identity of the mutation was

confirmed by PCR and DNA sequencing. Expression of MreC

was assessed by western blotting in the mutant strains, revealing no

detectable levels MreC unless complementation was induced

(Figure S1). In addition to the DmreC mutant, the lambda Red

method was used to generate DmreD.

Morphology and Growth RatesWhen the morphology of the DmreC mutant was examined

microscopically, the cells were no longer rod-shaped but spherical

(Figure 1B). Upon the addition of IPTG the morphology of the

DmreC strain was restored to the wild-type rod shape. Under

microscopic examination the DmreD mutant displays a similar

morphological phenotype to the DmreC. WT cells were measured

to be on 1.61(+/20.49) mm in length and 0.75(+/2 0.17) mm in

width, whereas the DmreC cells were 2.03(+/20.60) mm in length

and 1.21(+/20.41) mm in width. Complementation of the DmreC

mutant with 100 mM IPTG resulted in wild type shaped cells

1.82(+/20.44) mm in length and 0.78(+/20.24) mm in width.

Measurements were taken from a minimum of 350 cells per strain.

Growth rates of the strains were determined in LB media at 37uCrevealing a ,50% increase in the lag phase of the DmreC mutants

(Figure S2), which subsequently grow at a comparable rate to that

of the wild type or complemented mutant strains during log phase.

Motility and Expression of Flagellin SubunitsThe motility phenotype of DmreC was examined on semi-solid

agar plates. In contrast to the isogenic parent, the DmreC cells were

no longer motile. Surprisingly, this motility defect has not been

reported in either E. coli or B. subtilis. Cellular and secreted

proteins of the parent SL1344 and DmreC were examined by SDS-

PAGE and western blotting using antibodies directed against the

phase-1 and phase-2 flagellin subunits FliC and FljB. Neither of

these subunits were present in either the secreted or cellular

proteins, explaining the inability of the cells to swim (data not

shown). The non-motile phenotype was fully complementable in

trans upon the addition of IPTG to the mutant strain harbouring

pTK521 (Figure S3).

Expression of Flagella GenesWe observed that the Salmonella DmreC depletion strain was non-

motile and failed to express flagella subunits FliC or FljB. The

regulation and assembly of flagella in Salmonella is complex.

Flagella genes are arranged into 14 operons and their transcription

is organised into a regulatory hierarchy of early (class I), middle

(class II), and late genes (class III) [38]. The class I flhDC operon is

the master regulator, with FlhD and FlhC forming a hetero-

tetramer that is required for transcriptional activation of the class

II genes, which encode the hook-basal body complexes and the

alternative sigma factor FliA (sigma28). FliA alone or with FlhDC,

activates expression of the class III operon genes, which encode

the filament protein, hook-associated proteins, motor proteins, and

chemotaxis proteins [39,40]. The class III genes are further

subdivided into fliA-independent expression class IIIa or class IIIb

[41]. In order to systematically investigate the mechanistic basis

for the DmreC motility phenotype we have taken selected class I, II,

and III regulated flagella gene promoter fusions to a luciferase

reporter gene, and monitored their expression by luminescence in

Figure 1. Localization and morphological role of the S.Typhimurium Mre proteins. (A) Fluorescence microscopy montageshowing z-sections taken of MreB-GFP fusions in WT SL1344 revealing ahelical distribution. Slices taken at 0.1 mm intervals on live cells in midlog phase going from left to right followed by maximum intensityprojection (boxed). (B) Morphology of WT S. Typhimurium (I) and DmreC(II) reveal the mutant has changed from rod to round-shaped, withsome heterogeneity in size noted. In all images the bar represents1 mm.doi:10.1371/journal.ppat.1002500.g001



wild type and DmreC strains. Constructs with flhD (class I), fliA, flgA,

(class II), and fliC (class III) promoters fused to the luciferase

reporter gene were used. The reporter plasmid pSB401 has a

promoterless luxCDABE operon and was used as a control.

The class I flhD promoter displayed a reduction in the level of

expression in DmreC compared to the wild-type strain suggesting

the class I promoter has reduced activity. Notably greater changes

in the expression profiles occur in other class II and class III genes.

The class II promoters for the operons encoding the transcrip-

tional regulators fliAZY and flgAM display significant reductions in

expression levels in DmreC (Figure 2). As predicted from the

western blotting data expression of the fliC class III promoter was

significantly reduced. Collectively, the promoter-reporter activity

data can account for the motility defect.

Expression of SPI-1 and SPI-2 Type 3 Secretion SystemProteins

Type 3 secretion systems are essential for the virulence of a

range of pathogens including Salmonella [42,43]. The secretion

apparatus assembles into a supramolecular needle-complex.

Secreted effector proteins in the bacterial cytoplasm traverse

through the needle-complex and the bacterial multi-membrane

envelope, directly into host cells [44–46]. The apparatus anchors

to the cell envelope via a multi-ring base. Salmonella possess two

T3SS’s encoded by pathogenicity islands (SPI’s). The SPI-1 T3SS

is important for invasion of intestinal epithelial cells and the SPI-2

T3SS plays a central role in survival within the hostile

environment of a macrophage. The SPI-1 T3S system translocates

virulence effector proteins into the cytosol of epithelial cells

resulting in rearrangements of the actin cytoskeleton which enable

Salmonella to invade [47]. To investigate whether the mreC

mutation has an impact on SPI-1 T3S, we used western blotting

to determine the presence and functionality of the system using

antibodies to an apparatus protein PrgH as well as the effector

proteins SipA and SipC, in both SL1344 and DmreC. In contrast to

the wild-type SL1344, the T3S structural and effector proteins

were not expressed in the cellular or secreted fractions from the

DmreC depletion mutant (Figure 3A). This suggests that SPI-1 T3S

in the DmreC mutant is not fully functional. The expression and

secretion phenotypes were fully complementable in trans upon the

addition of IPTG (data not shown).

The functional assembly of SPI-1 T3SS was also confirmed

using transepithelial resistance (TER) assays in differentiated

Caco-2 cells, showing a reduced ability to disrupt epithelial tight

junctions in the DmreC mutant compared to the wild type strain

(Figure 4).

To further assess the disruption of the functionality of the SPI-1

T3S, a translocation assay was performed in Caco-2 cells infected

with the strains. Host cell cytoplasmic proteins were probed for the

bacterial effector protein SipB using western blotting (Figure S4).

This revealed the inability of the DmreC mutants to infect host

epithelia and disrupt their tight junctions. In addition, DmreC was

fully complementable in this assay following IPTG induction.

The SPI-2 T3SS is pivotal for the establishment of the Salmonella

containing vacuole (SCV) inside macrophages and subsequent

survival [43]. We next investigated the effect of the DmreC

mutation on the functionality of the SPI-2 T3SS. The strains were

grown under SPI-2 inducing conditions and the T3S of the

translocon protein SseB monitored. SseB together with SseC and

SseD function as a translocon for other effector proteins and SseB

is normally found associated with the outer surface of Salmonella.

Thus membrane fractions were purified to monitor expression and

T3S by western blotting. This revealed that in contrast to the SPI-

2 negative control (ssaV), SseB was secreted and associated with the

Figure 2. Impact of DmreC on the transcription of flagellar genes. Transcriptional expression profiles of flhD, flgA, fliA and fliC promoterreporters in WT SL1344 (blue diamonds) and DmreC (red squares) expressing the Photorhabdus luminescens LuxCDABE luciferase. Experiments wererepeated at least three times and error bars indicate standard deviation.doi:10.1371/journal.ppat.1002500.g002



Figure 3. Expression of Salmonella SPI-1 and SPI-2 effector proteins in DmreC. (A) Expression of SPI-1 proteins in WT SL1344, DmreC, DSPI-1,and DSPI-2 mutants during SPI-1 inducing conditions as revealed by western blotting with polyclonal aSipA and aSipC antibodies. Expression of SPI-2in WT SL1344, DmreC, DSPI-1, and DSPI-2 mutants during SPI-2 inducing conditions as revealed by western blotting of membrane fraction sampleswith polyclonal aSseB antibody. Samples representing total proteins and secreted proteins are shown. Arrows indicate the respective protein bands.(B)Transcriptional expression profiles of hilA, hilC, hilD, sopB (SPI-1) and ssaG (SPI-2) promoter reporters in WT SL1344 (blue diamonds) and DmreC (redsquares). Experiments were repeated at least three times and error bars indicate standard deviation.doi:10.1371/journal.ppat.1002500.g003



bacterial membrane surface in both the wild-type and DmreC

strains (Figure 3A). This provides qualitative evidence to suggest

that in contrast to the SPI-1 T3SS, the SPI-2 T3SS appears to

remain functional.

Expression of SPI-1 and SPI-2 Type 3 Secretion SystemRegulatory Genes

Several environmental signals and transcriptional factors

modulate expression of the SPI-1 T3SS. We wished to understand

the mechanistic basis by which expression of the SPI1-T3SS is

down-regulated. Within SPI-1 there are key transcriptional

activators which regulate expression of SPI-1 genes: HilC, HilD,

HilA, and InvF. Both HilC and HilD activate expression of SPI-1

genes by binding upstream of the master regulatory gene hilA to

induce its expression[48]. HilA binds and activates promoters of

SPI-1 operon genes encoding the type 3 secretory apparatus,

several secreted effectors, and the transcriptional regulator InvF.

InvF activates expression of effector genes inside SPI1 and also

effector genes outside SPI-1 such as sopB and sopE [47].

Expression of selected SPI-1 T3SS genes was monitored using

transcriptional promoter reporters in DmreC, using constructs

harbouring the hilA, hilC, hilD, invF and sopB promoters fused to the

promoterless luxCDABE operon that produces light in response to

gene expression [49–51]. Each construct was introduced into both

wild-type SL1344 and DmreC depletion mutant, and the level of

expression of the promoters in these strains monitored by

luminescence assays. WT SL1344 and DmreC cells harbouring

pCS26 or pSB401 vectors alone were used as controls, and did not

produce any luminescence as expected. The reporter assays

revealed that the SPI-1 transcription factor gene promoters for

hilA, hilC, hilD, and invF were completely inactive in DmreC in

contrast to the wild-type strain. However the promoter of sopB

located in SPI-5 remained active but its activity was marginally

lower than in the wild-type strain (Figure 3B). The regulation of

many T3SS genes often require multiple signals for maximal

expression and clearly other signals remain in the DmreC depletion

mutant which drive expression of the SopB in SPI-5.

Expression of SPI-2 T3SS genes were monitored using a

transcriptional reporter for the SPI-2 gene ssaG, whose promoter

was cloned upstream of the luxCDABE luciferase operon in the

plasmid pMK1-lux [52]. The construct was transformed into wild-

type SL1344 and DmreC, and the luminescence and OD600

measured during growth in SPI-2 inducing conditions (Figure 3B).

The ssaG promoter remains active in the DmreC mutant although

expression appears to be delayed, and is marginally less than in

WT. This evidence supports the western blot data with aSseB and

suggests that in contrast to the SPI-1 T3SS, the SPI-2 T3SS

remains functional in the absence of the cytoskeleton.

Function of the RcsC Two-Component System inRegulation of SPI-1 T3S and Motility in DmreC

Two-component regulatory systems are vital in sensing environ-

mental and cell surface signals, enabling bacteria to rapidly adapt to

ever changing conditions [53,54]. These signals are detected by

histidine protein sensor kinases, which subsequently transfer phosphate

groups to an aspartate residue in the response regulator proteins, thus

modulating their regulatory activities. The environmental signals are

thus transmitted by a phosphorelay system to regulate gene expression.

In order to identify putative regulators of the DmreC observed

phenotypes, we have constructed knockout mutations in a range of

two-component systems. As an initial screen, a panel of nine

separate two-component system mutant strains were constructed as

double mutants with DmreC. One two-component system sensor

kinase mutation DrcsC resulted in recovery of SPI-1 effector

expression in the DmreC background as judged by western blotting

using aSipC sera (Figure 5 panels A and B). Interestingly the

amount of SipC protein expressed and secreted from the cell was

less than the wild-type suggesting there are additional repressors

continuing to operate (Figure 5 panels A and B and Figure S5).

Furthermore, disruption of rcsC also significantly de-repressed

motility (Figure 6 and Figure S6) in a DmreC mutant similar to

SPI-1 expression, again suggesting there are additional repressors

involved. Expression of the RcsC protein in trans was able to restore

the phenotype of DmreC DrcsC back to the equivalent of a DmreC

Figure 4. Percentage change in transepithelial resistance of differentiated Caco-2 cells after 4hr infection. TER of polarised Caco-2monolayers exposed to Salmonella strains at an MOI of 20. TER change is expressed as a percentage alteration at 4hr compared to the initial value attime zero. Error bars indicate the standard deviations derived from at least three independent experiments. * Indicates statistical difference from WT(p,0.05).doi:10.1371/journal.ppat.1002500.g004



strain, with respect to repressing SPI-1 type 3 secretion and motility.

These complementation studies provide further evidence support-

ing the regulatory role of RcsC in the DmreC phenotypes (Figure S7).

Rcs is a highly complex multi-component phosphorelay system

and was originally identified in regulating genes involved in capsule

synthesis in Escherichia coli [55,56]. The RcsC sensor kinase

phosphorylates RcsD, which subsequently phopshorylates the

DNA binding response regulator RcsB. The unstable RcsA protein

and additional auxillary proteins can also interact and regulate

RcsB. The Rcs system is involved in down-regulating the expression

of flagella, SPI1-T3S and increasing biofilm formation [57].

We therefore also constructed DmreC DrcsB, DmreC DrcsD, DmreC

DrcsDB and DmreC DrcsCBD mutants, which however did not restore

either SPI-T3S or motility (Figures 5, 6, and S6). We propose that in

the absence of RcsC signalling, phosphorylated levels of RcsB are

depleted enabling de-repression of FlhDC and motility. The

presence of RcsDB appears essential for restoring motility in the

absence of RcsC [55]. The functionality of SPI-1 T3SS in the DmreC

DrcsC and DmreC DrcsDB mutants were assessed in a TER assay,

which revealed partial restoration of tight junction disruption in the

DmreC DrcsC mutant, but not in the DmreC DrcsDB (Figure S8).

It has been suggested that the outer membrane protein RcsF

may perceive some of the environmental signals necessary to

activate the Rcs phosphorelay system. To investigate this we

constructed a DmreC DrcsF mutant which failed to restore motility

or SPI-1 T3S and appeared phenotypically identical to DmreC

(Figure 5, S6). This would suggest that RcsF is not involved in the

observed DmreC phenotypes. Furthermore as the auxillary protein

RcsA can interact and regulate RcsB, we therefore disrupted the

rcsA gene in DmreC and which also resulted in no impact on the

observed phenotypes (Figure 5, S6).

In summary, we propose that RscC is sensing cell surface

perturbations [58] in DmreC, resulting from a disrupted cytoskel-

eton, and subsequently down-regulating the expression of SPI-1

T3S and motility. This signalling appears to be independent of

both RcsF and RcsA.

Chemical Genetic Inactivation of the Essential MreBProtein

A cell permeable compound named A22 [S-(3,4-Dichlorobenzyl)

isothiourea] has been demonstrated to perturb MreB function [59].

As an alternative approach to genetically disrupting the essential

gene mreB, we exposed wild-type Salmonella cultures to A22 and

observed a morphological change from rod to spherical-shaped

cells. In addition we phenotypically screened and tested A22-treated

cells for motility and T3S. The A22-treated cells were phenotyp-

Figure 5. Western blotting screen of DmreC two-component system double mutants for recovery of SPI-1 T3S. Panels A and B showwestern blots of total protein samples obtained from SL1344 WT, DSPI-1, DmreC, DmreC DqseF, DmreC DphoBR, DmreC DyjiGH, DmreC DbaeSR, DmreCDbasSR, DmreC DhydH, DmreC DqseBC, DmreC DtctDE, DmreC DcpxAR, DmreC DrcsDB, and DmreC DrcsC strains with aSipC antibody. Panels C and Dshow western blot of total protein samples obtained from SL1344 WT, DrcsA, DrcsB, DrcsC, DrcsD, DrcsF, DrcsDB, DrcsCBD and DmreC strains alongwith the DmreC DrcsA, DmreC DrcsB, DmreC DrcsC, DmreC DrcsD, DmreC DrcsF, DmreC DrcsDB, and DmreC DrcsCBD double mutants with aSipCantibody. SipC is indicated at approximately 43kDa.doi:10.1371/journal.ppat.1002500.g005



ically identical to DmreC with respect to cell shape, motility, SPI-1

T3S, and also SPI-2 T3S (data not shown). The effects of A22 were

completely reversible following its removal (data not shown). Thus

the chemical genetic inactivation of MreB, independently corrob-

orates the phenotypic observations made with DmreC.

The Salmonella mre Operon Plays an Important Role inColonization during in vivo Infection

The DmreC defect clearly has an impact on the expression of

important virulence determinants of Salmonella in vitro. We therefore

wished to investigate the contribution of the bacterial cytoskeleton

on the virulence of Salmonella in vivo using the mouse model. We

observed that the SPI-1 T3SS in DmreC is completely down-

regulated, and as this virulence system is important for infection

through the oral route of inoculation the strain would be attenuated.

We therefore explored the colonization of DmreC using the

intravenous route allowing us to examine the impact of the host

on the further down-stream stages of infection. Groups of 5 female

C57/BL6 mice were inoculated intravenously with circa 103 colony

forming units of either control SL1344 or DmreC. The times taken

for clinical symptoms to appear were determined. Viable bacterial

numbers in the spleen and liver for SL1344 were determined at days

1 and 4, and DmreC at days 1, 4, 7, and 10. The in vivo bacterial net

growth curves vividly demonstrate two clear phenotypic effects

upon the growth of DmreC compared to the wild-type. Firstly, there

is a greater initial kill of DmreC, and this is secondly followed by a

slower net growth rate. However, in spite of the reduced growth rate

of DmreC, the bacterial numbers steadily increase over 6 days. This

eventually causes the onset of clinical symptoms necessitating

termination of the experiment at day 10 (Figure 7). During these

stages Salmonella infect and multiply within macrophages and the

Figure 6. Motility of Salmonella mutant cells. Representative images showing the motility of SL1344 WT, DflhDC DmreC1, DmreC, DmreC plusIPTG, DrcsC, DmreC DrcsC, DmreC DrcsDB, and SL1344 WT plus A22 cells grown on motility agar at 37uC. White circles highlight the limits of motilityon the agar plates.doi:10.1371/journal.ppat.1002500.g006



SPI-2 T3SS is essential for survival. Thus providing further

evidence to support the presence of a functional SPI-2 T3SS in

DmreC. Collectively, these observations imply the mreC defect

reduces the virulence of the strain, but does not completely

abrogate its ability to multiply and cause disease systemically in vivo.

Morphology in vivoStrains recovered from in vivo passage were tested for changes in

morphology, motility and T3S, and were found to be identical to

the input strain. Furthermore the in vivo morphology of the strain

within livers and spleens was determined by immunofluorescence

microscopy. Sections of livers and spleens were taken and stained

as described in the materials and methods. Figure 8 demonstrates

the Salmonella DmreC mutant strain retains the round morphology

in vivo compared to the rod shaped wild-type control. Collectively

these data suggests that the mutation has remained stable during

the in vivo passage for the virulence phenotypes tested.

Role of the Cytoskeleton in the Assembly, Regulation andFunction of SPI-1 T3SS and Flagella

The regulation and assembly of SPI-1 T3SS and flagella are

complex. When the bacterial cytoskeleton is disrupted both the

Figure 8. Morphology of DmreC in host tissues. Representative fluorescence micrograph of Salmonella SL1344 WT and DmreC within aphagocyte in infected livers of C57BL/6 mice at 72 h p.i. CD18+ expressing cells (red), Salmonella DmreC (green), nucleic acid is indicated by DAPI(blue). Scale bar, 5 mm.doi:10.1371/journal.ppat.1002500.g008

Figure 7. Contribution of DmreC to in vivo colonization. In vivo growth kinetics of WT SL1344 and DmreC in livers and spleens of C57BL/6 miceinoculated intravenously with 103 colony forming units. Viable bacterial counts in the spleen and liver were performed at days 1, 4, 7 and 10, andexpressed as mean log10 viable count +/2 standard deviation.doi:10.1371/journal.ppat.1002500.g007



SPI-1 T3SS and flagella expression are down-regulated. A

hypothesis is that the integrity of the cytoskeleton is essential for

the correct assembly of these complex macromolecular structures

and in its absence the SPI-1 and flagella gene expression are down-

regulated to conserve resources. Alternatively, in the absence of a

functional cytoskeleton the bacterial cell is stressed and shuts down

the expression of energetically expensive ‘‘non-essential’’ machin-

ery. To test these ideas we wished to force on the expression of

SPI-1 T3S and flagella genes, and examine whether these systems

are correctly assembled and functional. We therefore expressed in

trans from heterologous inducible promoters either the flagella

master regulator FlhDC or the SPI-1 T3S regulator HilA in a

panel of strains including DmreC. Strikingly, expression of FlhDC

restored both the expression and assembly of flagella on the cell

surface as determined by fluorescence microscopy (Figure 9A) and

motility assays (data not shown) in DmreC. Furthermore, expression

of HilA in trans up-regulated expression of the SPI-T3SS and its

assembly on the cell surface as determined immunofluorescence

microscopy (Figure 9B) western blotting with aSipB antibody

(Figure S9) or functionally by TER measurements (Figure 4). In

contrast to SPI-1 T3SS and flagella, the expression of the SPI-2

T3SS was not turned off in the DmreC mutant as shown in

(Figure 9C). Interestingly, in WT cells the SPI-1 T3S apparatus

and flagella appear to be present in around six to eight copies

mainly along the long axis of the cell. In marked contrast the SPI-2

apparatus is typically present in one or two copies located at the

poles of the bacterial cell [42], whereas their localisation appears

less clear in the DmreC mutant, possibly due to perturbations in the

cell envelope and the indistinct cell polarity in these cells caused by

disruption of the cytoskeleton. The complementation of the

functional assembly of SPI-1 T3SS was also confirmed using

TER assays, where the levels of decrease in resistance after

infection with DmreC strain reverted to that of the parent strain

upon induction of the transcriptional regulator hilA (Figure 9B and

S9), or complementation of the DmreC mutation (Figure 4). Taken

together the data support the notion that the cytoskeleton is not

required for the correct assembly of these virulence factors but

essential for their expression.

Discussion

Bacterial cells possess dynamic cytoskeletons composed of

diverse classes of self-assembling polymeric proteins. Some of

these proteins resemble eukaryotic actin, tubulin, and intermediate

filaments both structurally and functionally [5,7,11,12]. The

bacterial tubulin FtsZ plays a key role in cell division. Bacterial

actins provide vital functions in maintaining cell morphology,

segregating DNA, and positioning bacterial organelles. It has

recently been demonstrated in Helicobacter pylori, that MreB is

essential not for cell shape but for maintenance of the full

enzymatic activity of urease, an essential virulence factor [60].

Furthermore the MreB cytoskeleton is also essential for the polar

localisation of pili in Pseudomonas aeruginosa [61].

Using a variety of approaches we have demonstrated the

importance of the bacterial cytoskeleton in the pathogenicity of

Salmonella. MreC and MreD form a complex in the cytoplasmic

membrane, which subsequently interacts with MreB. The mreB

gene appears to be essential in many organisms including as we

discovered in Salmonella. Viable mreB mutants often contain

compensatory changes in other genes e.g. ftsZ which compensate

for the lethality of the mreB lesion [37]. As an alternative strategy to

investigate the function of the bacterial cytoskeleton and avoid

these deleterious effects, we carefully constructed depletion

mutants of mreC in strains harbouring a single-copy plasmid

expressing the MreB operon from the lac promoter. In addition we

confirmed the phenotypic effects of the mreC genetic lesion by

disrupting the functions of MreB using a chemical genetics

approach and inactivating MreB with A22.

Removal of the gratuitous inducer IPTG from the growth

medium of the DmreC depletion mutant resulted in cells changing

from rod to a spherical shaped morphology. Using fluorescence

microscopy MreB was observed to be no longer distributed in a

helical fashion throughout the cell but rather diffusely throughout

the cytoplasm (data not shown). Presumably MreB polymers are

no longer able to contact the cytoplasmic membrane via MreD

attachment sites resulting in mis-assembly of the entire cytoskel-

eton. In growing cells, this disruption of the cytoskeleton leads to

loss of the rod-shape.

We next examined the motility of DmreC depletion strain to

assess the functionality of flagella. The strains were non-motile and

western blotting revealed absence of the flagellin filament subunit

proteins FliC and FljB in both secreted and also cytoplasmic

protein fractions, suggesting expression of these alternative

subunits had been switched off. Flagella gene expression is

complex and involves a regulatory hierarchy of Class I, Class II,

and Class III genes [38]. The class I flhDC operon is the master

regulator, and FlhDC complex is required for transcriptional

activation of the class II genes including the specialized flagellar

sigma factor FliA. FliA alone or with FlhDC complex, activates

expression of the class III operon genes encoding motor proteins,

hook-associated proteins, the filament protein, and chemotaxis

proteins [39,40]. Expression of the FlhDC complex was reduced

but still appeared comparable between the wild-type and the

DmreC suggesting changes in the promoter activity of flhDC alone

are not responsible for the observed phenotype. Class II gene

expression was significantly reduced. Expression of the Class III

gene fliC was completely down-regulated confirming the western

blot observations. Hence these independent observations are in

accordance with the DmreC motility data. Thus in the absence of

the cytoskeleton expression of class II and class III flagella genes

appears to be down-regulated.

Expression of the SPI-1 T3S system is essential for invasion of

intestinal epithelial cells and the SPI-2 T3SS plays a central role in

survival within the hostile environment of a macrophage [43].

Western blotting revealed the SPI-1 T3S structural protein PrgH

and the effectors SipA and SipC were no longer expressed or

secreted in the DmreC depletion mutant. The phenoptype was fully

complementable by the addition of IPTG. Several environmental

signals and transcriptional factors modulate expression of the SPI-

1 and SPI-2 T3SS [43,45,62]. We wished to understand the

mechanistic basis by which expression of the SPI1-T3SS is down-

regulated. Within SPI-1 there are key transcriptional activators

which regulate expression of SPI-1 genes: HilC, HilD, HilA, and

InvF. Using promoter-luciferase transcriptional reporter assays it

Figure 9. Localization of flagella and Type 3 secretion systems. Panel A shows representative images of Salmonella SL1344 WT, DflhDC,DmreC, and flagella-complemented DmreC pTETflhDC cells. Panel B shows representative images of Salmonella SL1344 WT, DSPI1, DmreC, and SPI-1complemented DmreC pBADhilA cells. Panel C shows representative images of Salmonella SL1344 WT, DSPI2, and DmreC. Fluorescence images of (A)GFP-FliG, (B) Alexa488-aSipD or (C) Alexa488-aSseB (top panels) and phase merged images (bottom panels) are shown in each panel. Scale barrepresenting 1 mm is indicated in the bottom right panel.doi:10.1371/journal.ppat.1002500.g009



was revealed that the SPI-1 transcription factor gene promoters for

hilA, hilC, hilD, and invF were completely inactive in DmreC, in

marked contrast to the control wild-type strain. Surprisingly, the

promoter of sopB located outside of SPI-1 in SPI-5 remained active

but its activity was marginally lower than in the wild-type strain.

The regulation of many T3SS genes often require the input of

multiple signals for maximal expression and clearly other signals

remain in the DmreC depletion mutant which drive expression of

the SopB in SPI-5. It therefore appears that the SPI-1 T3SS is

completely down-regulated in the absence of an cytoskeleton by an

unidentified regulatory factor. In contrast, the SPI-2 T3SS

remains functional as evidenced by western blotting with SseB

antibody and promoter-reporter assays. This is further corrobo-

rated with the in vivo evidence that following systemic inoculation,

DmreC is able to survive and multiply within the host. This takes

place within the hostile environment of the macrophage where

SPI-2 T3S is essential for biogenesis of the Salmonella containing

vacuole and survival [43,63,64].

We wished to gain further insights into the mechanistic basis of

the down-regulation of both SPI- T3SS and motility in DmreC.

Two-component systems play an essential role in sensing and

responding to environmental and cell surface signals [54]. To

investigate if two-component systems contribute to the regulation

of the DmreC phenotypes, we constructed a panel of separate two-

component system mutant strains in an DmreC background. The

double mutants were screened for recovery of motility and

expression of the SPI-1 T3SS. A mutation in the rcsC sensor kinase

gene resulted in significant but not complete recovery of both

motility and expression of the SPI-1 T3SS.

The Rcs phosphorelay system regulates a broad range of genes

from capsule synthesis in E. coli to increasing biofilm formation

[58]. RcsC also plays an important role in repressing expression of

flagella and SPI-1 T3SS in Salmonella Typhi [57]. The RcsC sensor

kinase normally phosphorylates RcsD, which subsequently

phosphorylates the DNA binding response regulator RcsB.

However, in DmreC DrcsDB and DmreC DrcsCBD there was no

restoration of either motility or expression of the SPI-1 T3SS

suggesting that RcsC signals repression and requires the presence

of rcsDB to mediate this effect. We propose that in DmreC, the

sensor kinase RscC detects cell surface perturbations and down-

regulates expression of flagella and the SPI-1 T3S apparatus [58].

This signalling is independent of both the outer membrane

lipoprotein RcsF sensor and the auxilliary regulatory protein

RcsA.

There are a number of explanations to provide a bacterial

rational for this shutdown in expression. In the absence of a

functional cytoskeleton the flagella and SPI-1 T3SS are either not

being correctly assembled, triggering a feedback loop to repress

expression, or alternatively are down-regulated to prevent the cell

from wasting valuable resources under these conditions. To test

the assembly idea, we forced on the expression of flagella and SPI-

1 T3SS genes by expressing the regulators flhDC or hilA in trans in

DmreC. Using independent methods we observed the correct

assembly and function of these macromolecular machines

suggesting the cytoskeleton is not essential for functionality. The

cytoskeleton could also have a role in sensing cellular stress, as has

recently been suggested by Chiu and colleagues [65]. They

propose that the integrity of the cytoskeleton may be exploited by

the cell to monitor oxidative stress and physiological status. If the

cytoskeleton disintegrates in the absence of MreC, this may be

sensed by the cell leading to a shut-down of the SPI-1 T3S

apparatus and down-regulation of flagella protein expression. We

have provided mechanistic insights into the regulation of motility

and SPI-1 T3S in DmreC. We have identified the two-component

system sensor RcsC as an important regulator controlling

expression of these systems, presumably as a consequence of

sensing membrane perturbations brought about by the disruption

of the cytoskeleton [58].

With a non-functional SPI-1 T3SS, we would expect the DmreC

would be attenuated in mice when administered by the oral route

as it is unable to invade intestinal epithelial cells by the SPI-1

T3SS. We therefore explored the colonization of DmreC in vivo

using the intravenous route of inoculation [66]. This provides an

opportunity to examine the impact of DmreC on the down-stream

stages of infection. Salmonella infect and multiply within macro-

phages during the systemic stages of infection. Survival within the

hostile environment of the macrophage would require a functional

SPI-2 T3SS in the Salmonella-containing vacuole to remodel the

host cell environment and survive attack from reactive oxygen free

radicals [64,67,68]. By examining the in vivo net bacterial growth

curves within livers and spleens two clear phenotypic effects were

revealed with DmreC compared to the wild-type. Greater initial

killing of DmreC is followed by a slower net growth rate with the

bacterial numbers steadily increasing over six days. Clinical

symptoms begin to appear and by day ten these symptoms

necessitate termination of the experiment. The phenotypic data

clearly imply the DmreC defect reduces the colonization of

Salmonella, but does not completely abrogate its ability to multiply

and cause disease systemically in vivo. This would suggest that the

second T3S in Salmonella encoded on SPI-2 remains sufficiently

functional to permit growth in the absence of the cytoskeleton.

In the absence of an intact cytoskeleton in DmreC the expression

of the SPI-1 T3SS and flagella are clearly down-regulated.

Strikingly however, the SPI-2 T3SS appears to remain functional

contributing to the virulence of the DmreC strain observed in vivo. A

possible explanation could be that the regulation of the SPI-2

T3SS is co-ordinated independently of the integrity of the

cytoskeleton in contrast to flagella and SPI-1 T3SS. Collectively

these data highlight the importance of the bacterial cytoskeleton in

the ability of Salmonella to cause disease, and may provide

opportunities for the development of new antimicrobials to target

the cytoskeleton.

Supporting Information

Figure S1 Expression of MreC in complemented DmreCcells. Western blot of total protein samples from SL1344 WT,

DmreC1, DmreC, and DmreC plus 100 mM IPTG cells using aMreC

antibody. MreC is indicated at approximately 38kDa and is

distinguishable from background bands.

(TIF)

Figure S2 Growth curve of Salmonella mutant cells. Log

phase growth of SL1344 WT, DmreC1, DmreC, DmreC plus 100 mM

IPTG, and A22 treated SL1344 WT cells. Strains were grown in

LB media at 37uC.

(TIF)

Figure S3 Motility of Salmonella Dmre mutant cells.Motility of SL1344 WT, DflhDC, DmreC1, DmreC, DmreC plus

100 mM IPTG, and A22 treated SL1344 WT shown as a

percentage of the wild type. Strains were grown on motility agar

at 37uC. Experiments were repeated at least three times and error

bars indicate SD. * Indicates statistical difference from WT

(p,0.05).

(TIF)

Figure S4 Translocation of SipB SPI-1 effector proteininto Caco-2 cells. Western blot of host cytosol fractions with

aSipB antibody following infection of cells with Salmonella



SL1344 WT, DSPI-1, DmreC1, DmreC (+/2 IPTG) mutants. SipB

is indicated at approximately 65kDa.

(TIF)

Figure S5 Secretion of SPI-1 effector protein SipC inDrcsC mutant cells. Western blot of secreted protein samples

from SL1344 WT, DmreC, DSPI-1, DSPI-2, DrcsC, and DmreC

DrcsC cells using aSipC antibody. SipC is indicated at approxi-

mately 43kDa.

(TIF)

Figure S6 Motility of Salmonella Drcs mutant cells.Motility of SL1344 WT, DmreC, DflhDC, DrcsA, DrcsB, DrcsC,

DrcsD, DrcsF, DrcsDB, DrcsCBD, DmreC DrcsA, DmreC DrcsB, DmreC

DrcsC, DmreC DrcsD, DmreC DrcsF, DmreC DrcsDB, and DmreC

DrcsCBD cells shown as a percentage of the wild type. Experiments

were repeated at least three times and error bars indicate SD.

Strains were grown on motility agar at 37uC.

(TIF)

Figure S7 Effect of rcsC expression on SipC productionand motility. Panels A and B show western blots from SL1344

WT, mreC, and SPI-1 control strains, and SL1344 WT

pBADrcsC, mreC pBADrcsC, rcsC pBADrcsC, and mreC rcsC

pBADrcsC strains (+/2 arabinose) with aSipC antibody. SipC is

indicated at approximately 43kDa. Panel C shows motility of

SL1344 WT, mreC, SL1344 WT pBADrcsC, mreC pBADrcsC,

rcsC pBADrcsC, and mreC rcsC pBADrcsC strains (+/2 arabinose)

shown as a percentage of the wild type. Experiments were

repeated at least three times and error bars indicate standard

deviation.

(TIF)

Figure S8 Percentage change in transepithelial resis-tance of differentiated Caco-2 cells after 4hr infectionwith Drcs mutant strains. TER of polarised Caco-2

monolayers exposed to Salmonella strains at an MOI of 20. TER

change is expressed as a percentage alteration at 4hr compared to

the initial value at time zero. Error bars indicate the standard

deviations derived from at least three independent experiments.* Indicates statistical difference from WT (p,0.05).

(TIF)

Figure S9 Complementation of Salmonella Pathogenic-ity Island SPI-1 in DmreC mutant. Expression of SPI-1

proteins in WT SL1344, DSPI-1, and DmreC mutants, and

complemented DmreC pBADhilA strain during SPI-1 inducing

conditions as revealed by western blotting with polyclonal aSipB

antibody. SipB is indicated at approximately 63kDa, and a

breakdown product is evident.

(TIF)

Acknowledgments

We are grateful to the anonymous reviewers of the manuscript for their

comments and suggestions. We would like to thank Brian Ahmer and Ivan

Rychlik for their generous gifts of the flagella and SPI-1 T3SS promoter-

reporter plasmid sets. In addition we would like to thank Roberto La

Ragione for the flagella antibodies; Purva Vats and Lawrence Rothfield for

the pLE7 plasmid; Keiichi Namba and Tohru Minamino for the fliG-gfp

strain, Alex Faulds-Pain and Phil Aldridge for the DflhDC strain, Waldemar

Vollmer for the MreC antibodies, and also Xiu-Jun Yu and David Holden

for the SseB antibodies and the DssaV strain. We also wish to thank Jeff

Errington, Kenn Gerdes, David Holden, David Clarke, and Simon

Andrews for valuable discussions.

Author Contributions

Conceived and designed the experiments: DMB AJG PD PM CMAK.

Performed the experiments: DMB LK AJG PD FJEM. Analyzed the data:

DMB MHK ACD AJG PD PM CMAK. Contributed reagents/materials/

analysis tools: EJM VK RAD. Wrote the paper: DMB CMAK.

References

1. Pang T, Levine MM, Ivanoff B, Wain J, Finlay BB (1998) Typhoid fever-

important issues still remain. Trends Microbiol 6: 131–133.

2. Lilic M, Galkin VE, Orlova A, VanLoock MS, Egelman EH, et al. (2003)Salmonella SipA polymerizes actin by stapling filaments with nonglobular

protein arms. Science 301: 1918–1921.

3. Piddock LJ (2006) Multidrug-resistance efflux pumps - not just for resistance. Nat

Rev Microbiol 4: 629–636.

4. Mirza SH, Beeching NJ, Hart CA (1996) Multi-drug resistant typhoid: a globalproblem. J Med Microbiol 44: 317–319.

5. Jones LJ, Carballido-Lopez R, Errington J (2001) Control of cell shape in

bacteria: helical, actin-like filaments in Bacillus subtilis. Cell 104: 913–922.

6. Bi E, Lutkenhaus J (1991) FtsZ ring structure associated with division inEscherichia coli. Nature 354: 161–164.

7. Lowe J, Amos LA (1998) Crystal structure of the bacterial cell-division proteinFtsZ. Nature 391: 203–206.

8. Lutkenhaus J, Addinall SG (1997) Bacterial cell division and the Z ring. Annu

Rev Biochem 66: 93–116.

9. Ausmees N, Kuhn JR, Jacobs-Wagner C (2003) The bacterial cytoskeleton: Anintermediate filament-like function. Cell 115: 705–713.

10. Carballido-Lopez R, Errington J (2003) A dynamic bacterial cytoskeleton.

Trends Cell Biol 13: 577–583.

11. van den Ent F, Amos L, Lowe J (2001) Bacterial ancestry of actin and tubulin.

Curr Opin Microbiol 4: 634–638.

12. van den Ent F, Amos LA, Lowe J (2001) Prokaryotic origin of the actincytoskeleton. Nature 413: 39–44.

13. Kruse T, Bork-Jensen J, Gerdes K (2005) The morphogenetic MreBCD proteins

of Escherichia coli form an essential membrane-bound complex. Mol Microbiol55: 78–89.

14. Kruse T, Moller-Jensen J, Lobner-Olesen A, Gerdes K (2003) DysfunctionalMreB inhibits chromosome segregation in Escherichia coli. EMBO J 22:

5283–5292.

15. Formstone A, Errington J (2005) A magnesium-dependent mreB null mutant:implications for the role of mreB in Bacillus subtilis. Mol Microbiol 55:

1646–1657.

16. Gitai Z, Dye N, Shapiro L (2004) An actin-like gene can determine cell polarity

in bacteria. Proc Natl Acad Sci U S A 101: 8643–8648.

17. Figge RM, Divakaruni AV, Gober JW (2004) MreB, the cell shape-determining

bacterial actin homologue, co-ordinates cell wall morphogenesis in Caulobacter

crescentus. Mol Microbiol 51: 1321–1332.

18. Wachi M, Doi M, Okada Y, Matsuhashi M (1989) New Mre Genes Mrec and

Mred, Responsible for Formation of the Rod Shape of Escherichia-Coli-Cells.

J Bacteriol 171: 6511–6516.

19. Divakaruni AV, Loo RRO, Xie Y, Loo JA, Gober JW (2005) The cell-shape

protein MreC interacts with extracytoplasmic proteins including cell wall

assembly complexes in Caulobacter crescentus. Proc Natl Acad Sci U S A 102:

18602–18607.

20. Vats P, Shih YL, Rothfield L (2009) Assembly of the MreB-associated

cytoskeletal ring of Escherichia coli. Mol Microbiol 72: 170–82.

21. Slovak PM, Porter SL, Armitage JP (2006) Differential localization of Mre

proteins with PBP2 in Rhodobacter sphaeroides. J Bacteriol 188: 1691–1700.

22. Gitai Z, Dye NA, Reisenauer A, Wachi M, Shapiro L (2005) MreB actin-

mediated segregation of a specific region of a bacterial chromosome. Cell 120:

328–341.

23. Madabhushi R, Marians KJ (2009) Actin homolog MreB affects chromosome

segregation by regulating topoisomerase IV in Escherichia coli. Mol Cell 33:

171–180.

24. Kruse T, Blagoev B, Lobner-Olesen A, Wachi M, Sasaki K, et al. (2006) Actin

homolog MreB and RNA polymerase interact and are both required for

chromosome segregation in Escherichia coli. Genes Dev 20: 113–124.

25. Shiomi D, Sakai M, Niki H (2008) Determination of bacterial rod shape by a

novel cytoskeletal membrane protein. EMBO J 27: 3081–3091.

26. Bendezu FO, Hale CA, Bernhardt TG, de Boer PA (2009) RodZ (YfgA) is

required for proper assembly of the MreB actin cytoskeleton and cell shape in E.

coli. EMBO J 28: 193–204.

27. Alyahya SA, Alexander R, Costa T, Henriques AO, Emonet T, et al. (2009)

RodZ, a component of the bacterial core morphogenic apparatus. Proc Natl

Acad Sci U S A 106: 1239–1244.

28. Ghosh AS, Young KD (2005) Helical Disposition of Proteins and Lipopolysac-

charide in the Outer Membrane of Escherichia coli. J Bacteriol 187: 1913–1922.

29. Taghbalout A, Rothfield L (2008) RNaseE and RNA helicase B play central

roles in the cytoskeletal organization of the RNA degradosome. J Biol Chem

283: 13850–13855. M709118200 [pii];10.1074/jbc.M709118200 [doi].



30. Ehrbar K, Mirold S, Friebel A, Stender S, Hardt WD (2002) Characterization of

effector proteins translocated via the SPI1 type III secretion system ofSalmonella typhimurium. Int J Med Microbiol 291: 479–485.

31. Datsenko KA, Wanner BL (2000) One-step inactivation of chromosomal genes

in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 97:6640–6645. 10.1073/pnas.120163297 [doi];120163297 [pii].

32. Morimoto YV, Nakamura S, Kami-ike N, Namba K, Minamino T (2010)Charged residues in the cytoplasmic loop of MotA are required for stator

assembly into the bacterial flagellar motor. Mol Microbiol 78: 1117–1129.

33. Karlinsey JE, Tanaka S, Bettenworth V, Yamaguchi S, Boos W, et al. (2000)Completion of the hook-basal body complex of the Salmonella typhimurium

flagellum is coupled to FlgM secretion and fliC transcription. Mol Microbiol 37:1220–1231.

34. Dean P, Kenny B (2004) Intestinal barrier dysfunction by enteropathogenicEscherichia coli is mediated by two effector molecules and a bacterial surface

protein. Mol Microbiol 54: 665–675.

35. McClelland M, Sanderson KE, Spieth J, Clifton SW, Latreille P, et al. (2001)Complete genome sequence of Salmonella enterica serovar Typhimurium LT2.

Nature 413: 852–856.36. Shih YL, Le T, Rothfield L (2003) Division site selection in Escherichia coli

involves dynamic redistribution of Min proteins within coiled structures that

extend between the two cell poles. Proc Natl Acad Sci USA 100: 7865–7870.10.1073/pnas.1232225100 [doi];1232225100 [pii].

37. Bendezu FO, de Boer PAJ (2008) Conditional Lethality, Division Defects,Membrane Involution, and Endocytosis in mre and mrd Shape Mutants of

Escherichia coli. J Bacteriol 190: 1792–1811.38. Macnab RM (2003) How bacteria assemble flagella. Ann Rev Microbiol 57:

77–100. DOI 10.1146/annurev.micro.57.030502.090832.

39. Komeda Y (1982) Fusions of flagellar operons to lactose genes on a mu lacbacteriophage. J Bacteriol 150: 16–26.

40. Kutsukake K, Ohya Y, Iino T (1990) Transcriptional analysis of the flagellarregulon of Salmonella typhimurium. J Bacteriol 172: 741–747.

41. Goodier RI, Ahmer BM (2001) SirA orthologs affect both motility and virulence.

J Bacteriol 183: 2249–2258.42. Chakravortty D, Rohde M, Jager L, Deiwick J, Hensel M (2005) Formation of a

novel surface structure encoded by Salmonella Pathogenicity Island 2. EMBO J24: 2043–2052.

43. Waterman SR, Holden DW (2003) Functions and effectors of the Salmonellapathogenicity island 2 type III secretion system. Cell Microbiol 5: 501–511.

44. Espina M, Olive AJ, Kenjale R, Moore DS, Ausar SF, et al. (2006) IpaD

Localizes to the Tip of the Type III Secretion System Needle of Shigella flexneri.Infect Immun 74: 4391–4400.

45. Galan JE, Wolf-Watz H (2006) Protein delivery into eukaryotic cells by type IIIsecretion machines. Nature 444: 567–573.

46. Karavolos MH, Roe AJ, Wilson M, Henderson J, Lee JJ, et al. (2005) Type III

secretion of the Salmonella effector protein SopE is mediated via an N-terminalamino acid signal and not an mRNA sequence. J Bacteriol 187: 1559–1567.

47. Lucas RL, Lee CA (2001) Roles of hilC and hilD in regulation of hilA expressionin Salmonella enterica serovar Typhimurium. J Bacteriol 183: 2733–2745.

48. Ellermeier CD, Ellermeier JR, Slauch JM (2005) HilD, HilC and RtsA constitutea feed forward loop that controls expression of the SPI1 type three secretion

system regulator hilA in Salmonella enterica serovar Typhimurium. Mol

Microbiol 57: 691–705.49. Papezova K, Gregorova D, Jonuschies J, Rychlik I (2007) Ordered expression of

virulence genes in Salmonella enterica serovar typhimurium. Folia Microbiol 52:107–114.

50. Winson MK, Swift S, Fish L, Throup JP, Jorgensen F, et al. (1998) Construction

and analysis of luxCDABE-based plasmid sensors for investigating N-acylhomoserine lactone-mediated quorum sensing. FEMS Microbiol Lett 163:

185–192.51. Winson MK, Swift S, Hill PJ, Sims CM, Griesmayr G, et al. (1998) Engineering

the luxCDABE genes from Photorhabdus luminescens to provide a biolumines-

cent reporter for constitutive and promoter probe plasmids and mini-Tn5constructs. FEMS Microbiol Lett 163: 193–202.

52. Karavolos MH, Spencer H, Bulmer DM, Thompson A, Winzer K, et al. (2008)Adrenaline modulates the global transcriptional profile of Salmonella revealing a

role in the antimicrobial peptide and oxidative stress resistance responses. BMCGenomics 9: 458. 1471-2164-9-458 [pii];10.1186/1471-2164-9-458 [doi].

53. Krell T, Lacal J, Busch A, Silva-Jimenez H, Guazzaroni ME, et al. (2010)

Bacterial sensor kinases: diversity in the recognition of environmental signals.Annu Rev Microbiol 64: 539–559.

54. Stock AM, Robinson VL, Goudreau PN (2000) Two-component signal

transduction. Annu Rev Biochem 69: 183–215.

55. Clarke DJ (2010) The Rcs phosphorelay: more than just a two-component

pathway. Future Microbiol 5: 1173–1184.

56. Pescaretti ML, Lopez FE, Morero RD, Delgado MA (2010) Transcriptional

autoregulation of the RcsCDB phosphorelay system in Salmonella enterica

serovar Typhimurium. Microbiology 156: 3513–3521.

57. Arricau N, Hermant D, Waxin H, Ecobichon C, Duffey PS, et al. (1998) The

RcsB-RcsC regulatory system of Salmonella typhi differentially modulates the

expression of invasion proteins, flagellin and Vi antigen in response to

osmolarity. Mol Microbiol 29: 835–850.

58. Majdalani N, Gottesman S (2005) The Rcs phosphorelay: a complex signal

transduction system. Annu Rev Microbiol 59: 379–405.

59. Iwai N, Nagai K, Wachi M (2002) Novel S-benzylisothiourea compound that

induces spherical cells in Escherichia coli probably by acting on a rod-shape-

determining protein(s) other than penicillin-binding protein 2. Biosci Biotechnol

Biochem 66: 2658–2662.

60. Waidner B, Specht M, Dempwolff F, Haeberer K, Schaetzle S, et al. (2009) A

novel system of cytoskeletal elements in the human pathogen Helicobacter

pylori. PLoS Pathog 5: e1000669.

61. Cowles KN, Gitai Z (2010) Surface association and the MreB cytoskeleton

regulate pilus production, localization and function in Pseudomonas aeruginosa.

Mol Microbiol 76: 1411–1426.

62. Lober S, Jackel D, Kaiser N, Hensel M (2006) Regulation of Salmonella

pathogenicity island 2 genes by independent environmental signals. Int J Med

Microbiol 296: 435–447.

63. Hensel M (2000) Salmonella pathogenicity island 2. Mol Microbiol 36:

1015–1023.

64. Hensel M, Shea JE, Waterman SR, Mundy R, Nikolaus T, et al. (1998) Genes

encoding putative effector proteins of the type III secretion system of Salmonella

pathogenicity island 2 are required for bacterial virulence and proliferation in

macrophages. Mol Microbiol 30: 163–174.

65. Chiu S-W, Chen S-Y, Wong H (2008) Localization and Expression of MreB in

Vibrio parahaemolyticus under Different Stresses. Appl Environ Microbiol 74:

7016–7022.

66. Hormaeche CE (1979) Genetics of Natural-Resistance to Salmonellae in Mice.

Immunology 37: 319–327.

67. Shea JE, Beuzon CR, Gleeson C, Mundy R, Holden DW (1999) Influence of the

Salmonella typhimurium pathogenicity island 2 type III secretion system on

bacterial growth in the mouse. Infect Immun 67: 213–219.

68. Vazquez-Torres A, Xu Y, Jones-Carson J, Holden DW, Lucia SM, et al. (2000)

Salmonella pathogenicity island 2-dependent evasion of the phagocyte NADPH

oxidase. Science 287: 1655–8.

69. Hoiseth SK, Stocker BA (1981) Aromatic-dependent Salmonella typhimurium

are non-virulent and effective as live vaccines. Nature 291: 238–239.

70. Murray RA, Lee CA (2000) Invasion genes are not required for Salmonella

enterica serovar typhimurium to breach the intestinal epithelium: evidence that

salmonella pathogenicity island 1 has alternative functions during infection.

Infect Immun 68: 5050–5055.

71. Beuzon CR, Salcedo SP, Holden DW (2002) Growth and killing of a Salmonella

enterica serovar Typhimurium sifA mutant strain in the cytosol of different host

cell lines. Microbiology 148: 2705–2715.

72. Faulds-Pain, AK (2008) The Regulation of Flagellar Filament Assembly in

Caulobacter Crecentus [dissertation]. Newcastle University.

73. Bolivar F (1978) Construction and characterization of new cloning vehicles. III.

Derivatives of plasmid pBR322 carrying unique Eco RI sites for selection of Eco

RI generated recombinant DNA molecules. Gene 4: 121–136. 0378-

1119(78)90025-2 [pii].

74. Sutcliffe JG (1979) Complete nucleotide sequence of the Escherichia coli plasmid

pBR322. Cold Spring Harbor Symp Quant Biol 43 Pt 1: 77–90.

75. Guzman LM, Belin D, Carson MJ, Beckwith J (1995) Tight regulation,

modulation, and high-level expression by vectors containing the arabinose

PBAD promoter. J Bacteriol 177: 4121–4130.

76. Hautefort I, Proenca MJ, Hinton JC (2003) Single-copy green fluorescent

protein gene fusions allow accurate measurement of Salmonella gene expression

in vitro and during infection of mammalian cells. Appl Environ Microbiol 69:

7480–7491.

77. Gotfredsen M, Gerdes K (1998) The Escherichia coli relBE genes belong to a

new toxin antitoxin gene family. Mol Microbiol 29: 1065–1076.



the bacterial cytoskeleton modulates motility, type 3 ... · spectrum of disease ranging from...

Documents