the bradykinin type 2 receptor is a target for p53-mediated

1

The Bradykinin Type 2 Receptor is a Target for p53-Mediated Transcriptional Activation

Zubaida Saifudeen, Hong Du, Susana Dipp, and Samir S. El-Dahr‡

From the Department of Pediatrics, Section of Pediatric Nephrology, Tulane University School of Medicine, New Orleans, Louisiana 70112

‡To whom correspondence and reprint requests should be addressed: Tulane University School of Medicine, 1430 Tulane Avenue, New Orleans, LA 70112. Tel: (504) 588-5377; Fax: (504) 584-1852; E-mail: [email protected]

JBC Papers in Press. Published on March 15, 2000 as Manuscript M909810199 by guest on A

pril 16, 2018http://w

ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

2

Running title: p53-dependent regulation of the B2 kinin receptor gene.

by guest on April 16, 2018

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

3

Summary

The bradykinin type 2 receptor (BK2) is a developmentally regulated G protein-coupled

receptor that mediates diverse actions such as vascular reactivity, salt and water excretion,

inflammatory responses and cell growth. However, little is known regarding regulation of

the BK2 gene. We report here that the rat BK2 receptor is transcriptionally regulated by the

tumor suppressor protein p53. The 5'-flanking region of the rat BK2 gene contains two p53-

like binding sites: a sequence at -70 bp (P1 site) that is conserved in the murine and human

BK2 genes; and a sequence at -707 (P2) that is not. The P1 and P2 motifs bind specifically

to p53, as assessed by gel mobility shift assays. Transient transfection into HeLa cells of a

CAT reporter construct driven by 1.2-kb of the BK2 gene 5'-flanking region demonstrated

that the BK2 promoter is dose-dependently activated by co-expression of wild-type p53. Co-

expression of a dominant negative mutant p53 suppresses the activation of BK2 by wild-

type p53. Promoter truncation localized the p53-responsive element to the region between

-38 and -94 bp encompassing the p53-binding P1 sequence. Furthermore, the

transcriptional co-activators, CBP/p300, augment p53-mediated activation of the BK2

promoter. Interestingly, removal of the P2 site by truncation or site-directed deletion

amplifies p53-mediated activation of the BK2 promoter. These results demonstrate that the

rat BK2 promoter is a target for p53-mediated activation and suggest a new physiological

role for p53 in the regulation of G protein-coupled receptor gene expression.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

4

Introduction

The type 2 bradykinin (BK) receptor, BK2, is a G protein-coupled receptor that

mediates diverse actions, such as vascular relaxation, urinary sodium excretion,

inflammatory responses, and cellular growth (1). The rat BK2 gene is composed of 4

exons, the last of which contains the entire open reading frame (2). Initial characterization

of the rat BK2 gene by Pesquero and co-workers (2) revealed that this gene lacks a typical

TATA module and identified potential binding sites for a number of transcription factors,

including cyclic AMP response element binding protein (CREB), AP-1, NF-KB, SP-1, and

Egr-1. Although traditionally thought to be expressed in a constitutive manner, the BK2

gene is developmentally regulated in the kidney and cardiovascular system (3), and is

induced by mitogenic growth factors (4) and inflammatory cytokines (5,6). Furthermore,

BK2 receptors are overexpressed in ras-transformed fibroblasts (7) and are coupled with

mitogenic signaling pathways (8,9). The nuclear factors regulating BK2 gene expression

are largely unknown.

The tumor suppressor protein, p53, is present at low levels in normal cells but is

activated in response to cellular stress such as hypoxia, oncogene activation, and DNA

damage (10,11). Tight regulation of p53 activity appears to be essential for normal

development as overexpression of p53 in transgenic mice produces abnormal kidneys (12)

and knockout of its negative regulator, mdm2, is fatal (13). The consensus DNA sequence

specific for p53 binding consists of two copies of the inverted repeat sequence

[RRRC(A/T)(T/A)GYYY] separated by 0-13 nucleotides (14,15). p53 binds DNA as a

tetramer with a stoichiometry of one p53 molecule per consensus pentamer (16,17).

Recent studies have also shown the importance of protein-protein interactions between p53

and the co-activators, CREB-binding protein (CBP)/p300, in mediating the transcriptional

effects of p53 (18-21).

p53 transactivates a number of genes important for cell cycle control (e.g., p21/Waf-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

5

1), DNA repair (e.g., GADD45) and apoptosis (e.g., IGF-BP3, Bax) (22-29). p53 regulated

genes also include, among others, the c-fos and c-met proto-oncogenes, tyrosine kinase

receptors (e.g., the epidermal growth factor receptor), proliferating cell nuclear antigen, and

nitric oxide synthase type 2 (30-34). In addition to its transactivation function, p53 can

directly repress transcription by interfering with basal promoter function (35-39) or by

sequence-specific DNA binding and exclusion of a trans-acting factor (40).

We report here that the promoter region of the rat BK2 gene contains a p53-binding

site and that p53 activates BK2 promoter-driven transcription of a reporter gene. We

further found an upstream p53 binding DNA element that down modulates p53-mediated

activation of the BK2 promoter. These data may have important implications regarding the

regulation of BK2 gene expression in early development and in response to cellular stress.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

6

EXPERIMENTAL PROCEDURES

Plasmids and BK2 promoter constructs - A DNA fragment spanning from -1184 to +93 of

BK2 5'-flanking region was amplified by polymerase chain reaction from rat liver genomic

DNA. The primers (5'-GTCCTTCGTTTTGAGTCTGG-3') and (5'-

GGTTCTGTGTTGTAGGGAGT-3') were selected from the gene sequence published by

Pesquero et al (2). The DNA fragment was inserted into the SmaI site in the polylinker

region of a T/A cloning vector, pCR2.1 (Invitrogen). Following digestion with KpnI (in the

polylinker of pCR2.1, upstream to the SmaI site) and NheI (at position +55 of the insert), the

DNA fragment was ligated into the reporter plasmid pCAT3Basic (Promega) upstream from

the chloramphenicol acetyl transferase (CAT) open reading frame. For the generation of

promoter constructs with serial deletions in the 5'-upstream region, the original construct (-

1184+55/CAT) was digested with XhoI (-1087), NcoI (-827), BglII (-635), and EcoRI (-563).

The -384, -200, -94 and -38/CAT promoter constructs were generated by polymerase chain

reaction using the -1184+55/CAT construct as a DNA template. Partial (15/20 bp) or

complete (20/20 bp) deletion of the p53 binding site at -707 to -688 was performed by the

QuickChangeTM Site-Directed Mutagenesis System (Stratagene, La Jolla, CA) following the

manufacturer’s recommendations. All constructs were sequenced to verify the sequence

and orientation by manual DNA sequencing using T7 Sequenase (Amersham) or by

automated DNA sequencing (Applied Biosystems, Model 373A).

Tissue Culture and Transfections - HeLa cells (American Type Culture Collection) were

maintained in Dulbecco’s modified Eagle medium (DMEM) containing 10% fetal bovine

serum (FBS), penicillin (100 U/ml), and Streptomycin (100 µg/ml) (Gibco BRL) at 37 oC in a

humidified incubator with 5% CO2.. Cells were plated in duplicates in six-well plates at 1.8 X

104 cells/well in DMEM containing 10% FBS one day prior to transfection. Cells were

transfected with 1.2 µg of DNA per well of pCAT vectors, driven by various BK2 promoter


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

7

fragments. A control β-galactosidase vector pSVZ (Promega, 0.5 µg of DNA/well) was

cotransfected with BK2-pCAT plasmids to correct for transfection efficiency. CMV-driven

expression vectors for wild-type or mutant p53 (33) were co-transfected using 10-500 ng of

DNA/well. Transfections were performed using LipofectAMINE PLUS Reagent (Gibco BRL)

according to the manufacturer’s recommendations. Four hours after transfection, fresh

medium was replaced and cell extracts were prepared 24 hours later using a reporter lysis

reagent (Promega). After normalization for β-galactosidase activity in the lysate, aliquots of

cell lysates were analyzed for CAT activity by the addition to the aliquot of 20 µl of 4µM

acetyl-CoA, 70 µl of 1M Tris-Cl (pH 7.8), 5 µl of 25 µCi/ml [14C]chloramphenicol (40-60

mCi/mmol), and H2O to a final volume of 150 µl, and incubated at 37 oC for 1 h. The

reaction was extracted with 1 ml of ethyl acetate and the ethyl acetate evaporated in a

Speedvac evaporator. Samples were suspended in 25 µl of ethyl acetate and spotted 2 cm

above the edge of a plastic-backed TLC sheet. Thin layer chromatography was run in 19:1

chloroform/methanol, and the sheet was air-dried and placed on film for autoradiography.

The optical density of the radioactive spots was measured by densitometry and CAT activity

was calculated as percent acetylated product.

Oligonucleotides - The oligonucleotide sequences used were as follows (double-

stranded): Consensus p53, 5'-TAGGCATGTCTAGGCATGTCTAAGCT-3' (14); p21, 5'-

ATCAGGAACATGTCCCAACATGTTGGAACATGTCCCAACATGTTGAGCTC-3' with the

p53 consensus in the p21 gene; BK2-P1 5'-AGGGGGGAGGTGCCCAGGAGAGTGATGA-3'

with the p53 site in the rat B2 receptor gene (positions -70 to -50 bp) and BK2-P2 5'-

ACTCTTGCCTGGTCTTCCCT-3' (positions -707 to -688) (2).

Nuclear extracts and electrophoretic mobility shift assay (EMSA) - Nuclear extracts

containing wild-type p53 were prepared from the embryonic fibroblast cell line, SVT-2 (from

ATCC). In addition, we used purified C-terminus truncated and constitutively active p53 (gift


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

8

from M. Barton, Univ. of Cincinnati). Double stranded oligonucleotides were 5'-end

labeled with [32P]γ-dATP with T4 kinase for use as probes in the gel mobility shift assays.

The labeled probe was incubated for 20 min at room temperature with nuclear extracts and

the binding buffer (5 µM Hepes, pH 7.9, 5% glycerol, 0.2 µM dithiothreitol, 5 µM

spermidine, 1.5 µg poly(dI-dC). Reactions containing a p53-specific activating antibody,

pAb421 (Oncogene Science), were preincubated on ice for 15 min before adding the

radiolabeled probe. Specific competitor oligonucleotides were added in 100 to 300-fold

molar excess 15 min before addition of the radioactive probe.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

9

Results

Putative Binding Sites for Wild-Type p53 in the BK2 Promoter - Based on homology

alignment, two putative binding sites for p53 were identified at positions -70 to -50 (BK2-

P1): 5'-GGAGGTGCCCAGGAGAAGTGA-3' and -707 to -688 (BK2-P2): 5'-

ACTCTTGCCTGGTCTTCCCT-3' of the rat BK2 receptor promoter (Fig. 1A). Sequence

variation from the tandem 10 bp motif, RRRC(A/T)(T/A)GYYY, described as a consensus

p53 recognition sequence (14) is underlined (See also Fig. 1B). Whereas the P1

sequence is conserved in the human (41,42) and mouse (Saifudeen and El-Dahr,

unpublished) BK2 genes, the P2 site is not (Fig. 1C).

Specific Binding of p53 to the P1 element Identified in the BK2 Promoter- We next

examined whether p53 binds to these putative p53 binding sites (P1 and P2) using

electrophoretic mobility shift assays (EMSA). As a source of p53, we used nuclear extract

from SVT-2 embryonic fibroblasts as well as recombinant p53. Western blots using the p53

antibodies, PAb421 (Oncogene Science) and FL-393 (Santa Cruz), showed that SVT-2

cells contain p53 (data not shown). EMSA assays utilizing a 32P-labeled BK2-P1

oligonucleotide and SVT-2 nuclear extracts revealed two major DNA-protein complexes

(Fig. 2A, lane 2). The addition of the p53-activating antibody, PAb421 (1, 2 µl) resulted in

enhanced DNA-binding activity (Fig. 2A, lanes 3, 4), demonstrating the presence of p53 in

the complexes. To test the specificity of the DNA-protein interactions, EMSA competition

experiments were performed (Fig. 2B). Incubation of the consensus p53 oligoduplex probe

with SVT-2 nuclear extracts produced two major DNA-protein complexes (Fig. 2A, lane 1).

The addition of 100-fold molar excess of unlabeled consensus p53 oligoduplex eliminated

both band shifts (Fig. 2B, lane 2). An unlabeled oligonucleotide corresponding to the p53

binding site in the p21 gene prevented the formation of the higher mobility complex when

added at 100-fold molar excess (Fig. 2B, lane 3) and both low and high mobility complexes


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

10

when added at 200- and 300-fold excess (Fig. 2B, lanes 4 and 5). An 100-200 fold molar

excess of unlabeled BK2-P1 oligoduplex also competed efficiently with binding to the

consensus p53 probe (Fig. 2B, lanes 6, 7). In contrast, a P1 probe containing point

mutations in the p53 BK2-P1 sequence did not produce any specific band shifts (Fig. 2B,

lanes 8-10, see figure legend). Finally, the band shift produced by binding of nuclear

proteins to the P1 probe was greatly diminished upon addition of 100-fold molar excess of

unlabeled p53 consensus sequence (Fig. 2B, lanes 11, 12).

To further document the specific binding of p53 to the p53-like motif in the P1 site,

we examined the binding of the P1 duplex to purified p53 (Fig. 2C). Binding of p53 to the

P1 oligoduplex (Fig. 2C, lane 1) is competed, albeit not completely, by 100-fold excess of

unlabeled oligoduplexes corresponding to the p53 binding site in the p21 promoter (lane 2)

or the p53 consensus (lane 3). However, when added at 200-fold excess, the p53

consensus sequence and the p53 motif in the p21 gene compete efficiently with the BK2-P1

for binding to purified p53 (Fig. 2D). Binding of the p53 consensus oligoduplex to purified

p53 (Fig. 2C, lane 4) is abolished or attenuated by 100-fold excess of unlabeled p53

consensus sequence (lane 5), p53 motif in the p21 gene (lane 6), or BK2-P1 (lane 7).

These cross competition experiments demonstrate that p53 binds specifically to the P1

sequence in the BK2 promoter. In addition, the results suggest that the binding affinity of the

p53 site in BK2-P1 to p53 may be higher than that of the consensus p53 sequence or the

p21 gene p53 site. We speculate that the difference in mobility of the DNA-protein

complexes in SVT-2 nuclear extracts (two major bands) as compared to recombinant p53

(one major band) may be related to the presence of p53-interacting proteins in the former

but not the latter.

p53-dependent Transactivation of the BK2 Promoter - In HeLa cells, p53 is bound to the

human papillomavirus E6 protein, which targets p53 for degradation (43) and renders these

cells functionally deficient in p53. Other studies have shown that these cells can be used to


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

11

study p53-mediated transcriptional responses (33). HeLa cells were transiently transfected

with CAT vectors containing segments of the BK2 promoter with and without a CMV

promoter-driven p53 expression plasmid. As shown in Fig. 3A, cells cotransfected with

pCMV-p53(wt) and seven different BK2 promoter-CAT constructs, pBK2 (-1184), (-827), (-

635), (-563), (-384), (-200), and (-94), showed a clear induction of CAT activity only in the

presence of wild-type p53. In contrast, no increase in CAT expression was observed in

cells cotransfected with pCMV-p53(wt) and pBK2(-38) (Fig. 3A). Wild-type p53 stimulated

pBK2(-1184) or pBK2(-94)-driven CAT expression in a dose-dependent manner (Fig. 3B).

These results suggest that the p53 response element in the BK2 promoter is located in the

region between -38 to -94 bp, which is consistent with the location of the P1 p53 binding

site.

To test the specificity of the stimulatory effect of wild-type p53 on BK2 promoter-

driven CAT transcription, HeLa cells were co-transfected with a CMV promoter-driven

expression plasmid, pCMVp53E258K, which encodes a dominant negative mutant of p53,

with a Glu → Lys change at amino acid 258 (33). Co-transfection with this p53 mutant

which lacks the ability to bind DNA, failed to induce BK2 promoter-driven CAT expression

(data not shown and Fig. 5B), and in experiments in which both pCMV-p53(wt) and

pCMVp53258K were cotransfected, the mutant p53 repressed the activation of the BK2

promoter by wild-type p53 in a dose-dependent manner (Fig. 3C, D).

Effect of CBP/p300 on p53-mediated activation of the BK2 promoter - CBP/p300 are

transcriptional co-activators that bind and activate a number of transcription factors

including the p53 protein (18-21, 44,45). Accordingly, we examined the effect of CBP/p300

on p53-mediated transcriptional responses of the BK2 promoter. As shown in Fig. 4A & B,

co-transfection of viral promoter driven expression plasmids for CBP/p300 (0, 10, 50 ng

DNA) into HeLa cells augmented the p53-mediated activation of BK2 promoter in a dose-

dependent manner. The transactivation by CBP/p300 most likely occurs via the p53-like


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

12

motif at the P1 site (located at -70), rather than via the NF-KB site which overlaps with the

upstream BK2-P2 motif, for two reasons. First, CBP/p300 activates CAT transcription from

the pBK(-94) construct, which lacks the NF-KB site (Fig. 4C). Second, deletion of the BK2-

P2 site (see below) destroys the NF-KB site, yet this mutant construct (with an intact P1

site) remains responsive to CBP/p300 (data not shown).

The P2 p53 site modulates p53-mediated activation of BK2 promoter - In addition to

the proximal P1 p53-like binding site, the rat BK2 5'-flanking region contains a second p53-

like motif at positions -707 to -688 (Fig. 1B). Unlike P1, P2 is not conserved in the human

BK2 gene. This DNA sequence binds specifically to p53 present in SVT-2 cells’ nuclear

extracts as indicated by the enhanced DNA binding activity following treatment with the

PAb421 antibody (Fig. 5A). Specificity of the complex was demonstrated by competition

by unlabeled p21 and BK2-P2 (Fig. 5A) but not by irrelevant oligoduplex (Jun/AP-1) (data

not shown). To determine the functional relevance of the P2 site, we compared the effect of

wild-type p53 on the activity of BK2 promoter constructs either containing (pBK-1184) or

lacking (pBK-635) the P2 site. As shown in Fig. 5B, p53-mediated transactivation is

approximately 2-fold higher in pBK2-635 than pBK2-1184. To validate this finding, we

utilized a deletion mutagenesis approach in which we removed either 3/4 (∆P215bp) or 4/4

(∆P220bp) pentamers of the P2 site. As shown in Fig. 5C and D, pCMV-p53(wt) activates

the activity of the BK2(-1184) promoter construct in a dose-dependent manner. When co-

transfection was performed using the mutant pBK2(-1184) constructs, up to 2-fold further

increase in CAT activity was observed. This finding suggests that the P2 site has a

negative modulation effect on p53-mediated activation of the BK2 promoter.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

13

Discussion

The bradykinin type 2 receptor, BK2, is a heptahelical G protein-coupled receptor.

Upon ligand activation, BK2 engages numerous second messenger systems such as

phospholipase C and D, phospho inositol-3-kinase, protein kinase C, and tyrosine kinases.

Among the nuclear factors activated by BK are AP-1 (9) and NF-KB (46) which are believed

to mediate the effects of BK on growth, differentiation, and gene expression of inflammatory

cytokines and growth factors. Activation of BK2 on endothelial cells mediates nitric oxide

release and vasorelaxation, consistent with the hypertensive phenotype of BK2-deficient

mice (47-49).

In the present study, transient transfections into HeLa cells of promoter-reporter

constructs containing serial deletions of the BK2 5'-flanking region localized the p53

activation effect to a 56-bp region extending from -38 to -94 of the promoter. This region

contains a p53-like binding motif (P1 site) at -70 to -50. This finding together with the

sequence-specific binding of p53 to the P1 site, the inhibition of p53-mediated activation by

co-expression of a mutant p53, and the species conservation of this site strongly implicate

this DNA element in p53-mediated activation of the BK2 promoter.

CREB-binding protein and p300 (CBP/p300) are structurally related activators of

numerous transcription factors including p53. CBP/p300 possess intrinsic histone

acetyltransferase activity (18-21). Acetylation of lysine residues in the N-terminal domains

of histones facilitates gene activation, perhaps by reducing histone tail affinity for DNA,

leading to a more favorable transcription factor binding to nucleosomal DNA. CBP/p300

acetylate components of the basal transcription machinery, such as TFIIEβ and TFIIF in

vitro (50-52). Furthermore, p300 acetylates p53 on its C-terminus thereby enhancing its

DNA-binding activity in vitro (21). In our model, co-expression of CBP/p300 with p53

augmented the transactivation function of p53. Based on these results, we propose that

the interaction of p53 with the P1 site acts as a recruiting vehicle for CBP/p300 to the


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

14

vicinity of the proximal promoter thereby activating the basal transcription machinery.

We also identified a second p53-like binding site (P2) at position -707 of the rat

BK2 gene. This site differs from P1 in many aspects. First, unlike P1, P2 is not conserved

in the mouse or human BK2 genes. Second, removal of P2 by truncation or deletion

amplified p53-mediated transactivation. It is not clear how the P2 site down modulates the

positive transcriptional activity of p53 that is exerted at the level of the proximal promoter.

One possibility may involve the displacement of an activator protein from binding to the

same regulatory element, as recently reported in the alpha-fetoprotein gene (40). Indeed,

the P2 sequence overlaps with a putative binding site for the transcription factor, NF-KB.

Another may be that p53, when bound to the P2 site, interacts with an early stage of the

assembling complex of general transcription factors, blocking further assembly. It is also

conceivable that HeLa cells have a limited pool of CBP/p300 (53) and that binding of p53 to

P2 “sequesters” the available pool of p53 and its co-activators. Ongoing studies in our

laboratory are testing these various hypotheses.

The biological significance of p53-mediated regulation of BK2 gene expression

remains unclear. We speculate that endogenous p53 may be important in the regulation of

BK2 expression under at least two conditions. Both p53 and BK2 are highly expressed in

certain tissues during development (3). Our preliminary studies have shown a remarkable

overlap in the cellular expression of p53 and BK2 in the developing kidney (54). Thus, it is

conceivable that p53 may have a role in the developmental regulation of the BK2 gene, as

has recently been proposed for the "-fetoprotein gene (40). In addition, p53 is induced and

activated by cellular injury and chronic inflammation (55) and this may represent a new

mechanism to activate BK2 gene expression in response to inflammation (5,6).

We conclude that the rat bradykinin B2 receptor gene is a target for the tumor

suppressor p53. This is the first report of a G-protein-coupled receptor gene regulated by

p53. Future challenges will be to determine the biological relevance of p53-mediated

regulation of BK2 in vivo and if p53 regulates other G protein-coupled receptor genes.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

15

Acknowledgments

We thank Dr. Michelle Barton for generously providing activated purified p53, and for

helpful discussions and critical reading of the manuscript. We also thank Drs. R. Kwok for

the CBP expression vector, and G. Morris for the wild-type and mutant p53 expression

plasmids. Grants DK-53595 and DK-56264 from the National Institutes of Health supported

this study.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

16

References

1. Bhoola, K. D., Figueroa, C. D., and Worthy, K. (1992) Pharmacol. Rev. 44, 1-80

2. Pesquero J. B., Lindsey C. J., Zeh, K., Paiva A. C. M., Ganten D., and Bader M.

(1994) J. Biol. Chem. 269, 26920-26925

3. El-Dahr, S. S., Figueroa, C. D., Gonzalez, C. B., and Müller-Esterl, W. (1997) Kidney

Int. 51, 739-749

4. Dixon, B. S., Sharma, R. V., and Dennis, M. J. (1996) J. Biol. Chem. 271, 13324-

13332

5. Schmidlin, F., Scherrer, D., Daeffler, L., Bertrand, C., Landry, I., and Gies, J-P (1998)

Mol. Pharmacol. 53, 1009-1015

6. Lung, C-C., Jagels, M. A., Daffern, P. J., Tan, E. M., and Zuraw, B. L. (1998) 39, 243-

253

7. Hembree, T. N., and Leeb-Lundberg, L. M. F. (1996) J. Cell. Physiol. 169, 248-255

8. Owen, N. E., and Villereal M. L. (1983) Cell 32, 979-985

9. El-Dahr, S. S., Dipp, S., Baricos, W. H. (1998) Am. J. Physiol. 275, F343-F352

10. Agarwal, M. L., Taylor, W. R., Chernov, M. V., Chernova, O. B., and Stark, G. R.

(1998) J. Biol. Chem. 273, 1-4

11. Ko, L. J., and Prives, C. Genes & Dev. (1996) 10, 1054-1072

12. Godley, L. A., Kopp, J. B., Eckhaus, M., Paglino, J. J., Owens, J., and Varmus, H. E.

(1996) Genes & Dev. 10, 836-850

13. De Oca Luna, R. M., Wagner, D. S., and Lozano, G. (1995) Nature 378, 203-206

14. El-Deiry, W. S., Kern, S. E., Pietenpol, J. A., Kinzler, K. W., and Vogelstein, B.

(1992) Nat. Genet. 1, 45-49

15. Funk, W. D., Pak, D. T., Karas, R. H., Wright, W. E., and Shay, J. W. (1992) Mol.

Cell. Biol. 12, 2866-2871

16. Nagaich, A. K., Zhurkin, V. B., Durell, S. R., Jernigan, R. L., Appella, E., Harrington,


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

17

R. E. (1999) Proc. Natl. Acad. Sci. USA 96, 1875-1880

17. McLure, K. G., and Lee, P. W. K. (1998) EMBO J. 17, 3342-3350

18. Avantaggiati, M. L., Ogryzko, V., Gardner, K., Giordano, A., Levine, A. S., and Kelly,

K. (1997) Cell 89, 1175-1184

19. Gu, W., Shi, X.-L., and Roeder, R. G. (1997) Nature 387, 296-299

20. Lill, N. L., Grossman, S. R., Ginsberg, D., DeCaprio J., and Livingston, D. M. (1997)

Nature 387, 823-827

21. Liu, L., Scolnick, M., Trievel, R. C., Zhang, H. B., Marmorstein, R., Halazonetis, T. D.,

and Berger, S. L. (1999) Mol. Cell. Biol. 19, 1202-1209

22. Buckbinder, L., Talbott, R., Velasco-Moguel, S., Takenaka, I., Faha, B., Seizinger, B.

R., and Kley, N. (1995) Nature 377, 646-649

23. El-Deiry, W. S., Tokino, T., Velculescu, V. E., Levy, D. B., Parsons, R., Trent, J. M.,

Lin, D., Mercer, W. E., Kinzler, K. W., and Vogelstein, B (1993) Cell 75, 817-825

24. El-Deiry, W. S, Tokino, T., Waldman, T., Oliner, J. D., Velculescu, V. E., Burrell, M.,

Hill, D. E., Healy, E., Rees, J. L., Hamilton, S. R., Kinzler, K, W., and Vogelstein, B (1993)

Cancer Res. 55, 2910-2919

25. Hollander, M. C., Alamo, I., Jackman, J., Wang, M. G., McBride O. W., and Fornace,

A. J. Jr. (1993) J. Biol. Chem. 268, 24385-24393

26. Macleod, K. F., Sherry, N., Hannon, G., Beach, D., Tokino, T., Kinzler, K., Vogelstein,

B., and Jacks, T. (1995) Genes Dev. 9, 935-944

27. Miyashita, T., and Reed, J. C. (1995) Cell 80, 293-299

28. Perry, M. E., Piette, J., Zawadski, J. A., Harvey, D., and Levine, A. J. (1993) Proc.

Natl. Acad. Sci. U. S. A. 90, 11623-11627

29. Zauberman, A., Lupo, A., and Oren, M. (1995) Oncogene 10, 2361-2366

30. Elkeles, A., Juven-Gershon, T., Israeli, D., Wilder, S., Zalcenstein, A., and Oren, M.

(1999) Mol. Cell. Biol. 19, 2594-2600

31. Deb, S. P., MuÁoz, R. M., Brown, D. R., Subler, M. A., and Deb, S. (1994)


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

18

Oncogene 9, 1341-1349

32. Seol, D-W., Chen, Q., Smith, M. L., and Zarnegar, R. (1999) J. Biol. Chem. 274,

3565-3572

33. Morris, G. F., Bischoff, J. R., and Mathews, M. B. (1996) Proc. Natl. Acad. Sci. U.

S. A. 93, 895-899

34. Forrester, K., Ambs, S., Lupold, S. E., Kapust, R. B., Spillare, E. A., Weinberg, W.

C., Felley-Bosco E., Wang, X. W., Geller, D. A., Tzeng, E., Billiar, T. R., and Har:ris, C. C.

(1996) Proc. Natl. Acad. Sci. U. S. A. 93, 2442-2447

35. Agoff, S. N., Hou, J., Linzer, D. I. H., and Wu, B. (1993) Science 259, 84-87

36. Farmer, G., Colgan, J., Nakatani, Y., Manley, J. L., and Prives, C. (1996) Mol. Cell.

Biol. 16, 4295-4304

37. Farmer, G., Friedlander, P., Colgan, J., Manley, J. L., and Prives, C. (1996) Nucleic

Acids Res. 24, 4281-4288

38. Wang, Q., Zambetti, G. P., and Suttle, D. P. (1997) Mol. Cell. Biol. 17, 389-397

39. Wang, X. W., Forrester, K., Yeh, J., Feitelson, M. A., Gu, J.-R., and Harris, C. C.

(1994) Proc. Natl. Acad. Sci. U. S. A. 91, 2230-2234

40. Lee, K. C., Crowe, A. J., and Barton, M. C. (1999) Mol. Cell. Biol. 19, 1279-1288

41. Ma, J-X., Wang, D-Z., Ward, D. C., Chen, L., Dessai, T., Chao, J., and Chao, L.

(1994) Genomics 23, 362-369

42. Kammerer, S., Braun, A., Arnold, N., and Roscher, A. A. (1995) Biochem. Biophys.

Res. Commun. 211, 226-233

43. Scheffner, M., Werness, B. A., Huibregtse, J. M., Levine, A. J., and Howley, P. M.

(1991) Cell 63, 1129-1136

44. Utley, R. T., Ikeda, K., Grant, P. A., Côté, J., Steger, D. J., Eberharter, A., John, S.,

Workman, J. L. (1998) Nature 394, 498-502

45. Berger, S. L. (1999) Cur. Op. Cell Biol. 11, 336-341

46. Pan, Z. K., Zuraw, B. L., Lung, C-C., Prossnitz, E. R., Browning, D. D., and Ye, R. D.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

19

(1996) J. Clin. Invest. 98, 2042-2049

47. Alfie, M. E., Sigmon, D. H., Pomposiello, S. I., and Carretero, O. A. (1997)

Hypertension 29, 483-487

48. Madeddu, P., Varoni, M. V., Palomba, D., Emanueli, C., Demontis, M. P., Glorioso, N,

Dessi-Fulgheri, P., Sarzani, R., and Anania, V. (1997) Circulation 96, 3570-3578

49. Cervenka, L., Harrison-Bernard, L. M., Dipp, S., Primrose, G., Imig, J. D., and El-Dahr,

S. S. (1999) Hypertension 34, 176-180

50. Truant, R., Xiao, H., Ingles, C. J. and Greenblatt, J. (1993) J. Biol. Chem. 268,

2284-2287

51. Thut, C. J., Chen, J. L., Klemm, R., and Tjian, R. (1995) Science 267, 110-104

52. Lu, H., and Levine, A. J. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 5154-5158

53. Wadgaonkar, R., Phelps, K. M., Haque, Z., Williams, A. J., Silverman, E. S., and

Collins, T. (1999) J. Biol. Chem. 274, 1879-1882

54. Saifudeen, Z., and El-Dahr, S. S. (1998) J Am Soc Nephrol 9, 367A (abstract)

55. Arai, N., Mitomi, H., Ohtani, Y., Igarashi, M., Kakita, A., and Okayasu, I. (1999) Mod

Pathol 12, 604-611


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

20

Figure Legends

FIG. 1. The rat bradykinin B2 receptor promoter contains two p53-like binding sites.

A, schematic showing the promoter-reporter BK2 (pBK2-CAT) construct and the relative

positions of the p53-binding sites, P1 and P2. B. Sequence comparisons of the P1 and P2

sites with the consensus p53 binding sequence (ref. 14). Underlined bases denote

sequence variation from the consensus p53 element. C. Species conservation of P1 site.

FIG. 2. p53 binds the p53-like motif (P1 site) in the BK2 promoter. (A) EMSA using a

32P-labeled BK2-P1 oligoduplex (5'-AGGGGGGAGGTGCCCAGGAGAGTGATGACA-3').

Lane 1, free probe; lane 2-4, in the presence of SVT-2 nuclear extracts (-10 µg). Lanes 3

and 4 contain 1 or 2 µl, respectively, of the p53-activating antibody, PAb421. (B) EMSA

using 32P-labeled oligoduplexes containing the p53 consensus sequence (5'-

TAGGCATGTCTAGGCATGTCTAAGCT-3') (lanes 1-7), mutant BK2-P1 oligoduplexes (5'-

AGGGGTGAGGCGCACAGGAGATTGATGACA-3', lane 8; 5'-

AGGGGTGAGGTTACCAGGAGAGTGATGACA-3', lane 9; 5'-

AGGGGGGAGGTAGCAAGGAGAGTGATGACA-3', lane 10), or wild-type BK2-P1

oligoduplex (lanes 11, 12). All lanes contain SVT-2 nuclear extracts. In lane 2, 100-fold

excess of unlabeled consensus p53 sequence was added. Lanes 3-5 represent

competition with increasing amounts (100 to 300-fold molar excess) of unlabeled

oligoduplex corresponding to the p53 DNA binding sequence in the p21/waf-1gene (5'-

ATCAGGAACATGTCCAACATGTTGGAACATGTCCCAACATGTTGAGCTG-3'). Lanes 6 &

7 represent competition with 100- or 200-fold excess of BK2-P1. Lanes 8-10 show lack of

specific binding of mutant BK2-P1 site to nuclear extracts. Lanes 11 and 12 show that

protein binding to the p53-like motif in the P1 site is competed by 100-fold excess unlabeled

p53 consensus sequence. (C) EMSA using recombinant p53 and either radiolabeled BK2-

P1 oligoduplex (lanes 1-3) or the consensus p53 binding oligoduplex (lanes 4-7) as probes.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

21

Unlabeled competitors (100-fold excess) used included the p53 sequence in the p21/waf-1

gene (lane 2 and 6), consensus p53 site (lanes 3 and 5), or BK2-P1 (lane 7). (D) EMSA

using recombinant p53 and BK2-P1 probe. Unlabeled competitors used included 200-fold

excess of BK2-P1 (lane 2), consensus p53 sequence (lane 3) or the p53 site in the p21

gene (lane 4).

FIG. 3. Wild-type p53 activates BK2 promoter-driven transcription in HeLa cells.

A, representative CAT assay result. Using the Lipofectoamine reagent, 1.2 µg of each

reporter construct was cotransfected with 50 ng of the plasmid expressing wild-type p53.

Cells were harvested 24 h after transfection and analyzed for CAT activity. Transfection

and CAT assays were performed in duplicate in at least three independent experiments,

and consistent results were obtained. B, dose-response effect of wild-type p53 (10, 50, 75

ng) on CAT activity of the BK2 promoter constructs, pBK2(-1184) and pBK2(-94). C and D,

Co-transfection of pBK2(-1184) construct with a fixed amount, 50 ng, of pCMV-p53(wt), and

increasing amounts (0, 50, 100, 500 ng) of pCMV-p53(mutant) showing that the dominant

negative mutant p53 suppresses the transcriptional activation of the BK2 promoter by wild-

type p53.

FIG. 4. The transcriptional co-activators, CBP/p300, augment p53-mediated

transactivation of the BK2 promoter. HeLa cells were co-transfected with pBK2(-1184)

(A, B) or pBK2-(-94) (C) constructs (1.2 µg) with or without expression plasmids for wild-

type p53 (50 ng) and increasing amounts of CBP (A) or p300 (B) (0, 10, 50 ng DNA).

FIG. 5. The upstream BK2-P2 sequence modulates p53-mediated transactivation. A,

EMSA gels. 32P-labeled oligoduplexes corresponding to the BK2-P2 sequence (5'-

ACTCTTGCCTGGTCTTCCCT-3') were incubated with SVT-2 nuclear extracts (-10 µg

protein/sample) in the presence or absence of the p53-activating antibody, PAb421 (1 µl).


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

22

The position of the band shifts is indicated by (*). Addition of PAb421 enhanced the DNA-

binding activity, while addition of unlabeled p53 sequence from the p21 gene attenuated the

binding. B, HeLa cells were co-transfected with pBK2 reporter constructs either containing

(-1184) or lacking (-635) the P2 site with expression plasmids for wild-type (wt) or mutant

(mut )p53. CAT activity is 2-fold higher in pBK2(-635) than pBK2(-1184) (n=3 assays in

duplicates). A DNA-binding mutant p53 fails to activate the BK2 promoter. C,

representative CAT assay showing the effect of deletion of the BK2-P2 site on p53-

mediated activation of the BK2 promoter. HeLa cells were transfected with 1.2 µg each of

the promoter-reporter plasmids. BK2 promoter activity is increased in a dose-dependent

manner by wild-type p53. Removal of 3/4 or 4/4 pentamers of the P2 site amplifies the p53-

mediated activation. D, quantitative analysis of the CAT assay in C; white bar: pBK-2(-

1184), gray bar: pBK2-(P2∆15bp), black bar: pBK2-(P2∆20bp). Similar results were obtained in

3 independent experiments.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

A

B

BK2-P1Rat GGAGGTGCCCAGGAGAGTGAMouse GGAGGTGCCCAGGAGAGTGAHuman GGAAGTGCCCAGGAGGCTGA

CAT

NheI+5

5

KpnI

-118

4

BglII

-635

Nco

I-827

XhoI

-108

7

Eco

RI-5

63

ACTCTTGCCTGGTCTTCCCT GGAGGTGCCCAGGAGAGTGA

C

-50-688

Consensus p53 RRRCA/T T/AGYYY

Rat BK2-P1 GGAGGTGCCCAGGAGAGTGARat BK2-P2 ACTCTTGCCTGGTCTTCCCT

P1P2

-70-707

FIG. 1.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

1 2 3 4 5 6 7 8 9 10 11 12

FIG. 2.

Cons. p53 BK2-P1Probe:

SVT-2 cells nuclear extracts

BK2-P1 Cons. p53

1 2 3 4 5 6 7

Probe:

Purified p53

B

C

A

1 2 3 4

Probe: BK2-P1SVT-2 nuclear extracts

MutantP1

1 2 3 4

BK2-P1

D


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

- + - + - + - + - + - + - + - +pCMV-p53

pBK2(-1184)pBK2(-827)

pBK2(-635)pBK2(-563)

pBK2(-384)

pBK2(-200)

pBK2(-94)

pBK2(-38)

0 10 20 30 40 50 60 70 80 90 1000

5

10

15

20

25

pBK2(-1184 )pBK2(-94 )

A

B

Amount of pCMV-p53 (ng)

CA

T/b

-ga

lF

old

activ

atio

n

C

0

20

40

60

80

100

0 50 100 500

D

FIG. 3 Amount of mutant p53 vector (ng)

CA

T/b

-ga

lP

erce

nt in

hibi

tion

pCMV-p53 (wt) ng 50 50 50 50pCMV-p53 (mut) 0 50 100 500


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

pCMV-p53 - + + + + pRSV-CBP - - -pRSV-p300 - - -

A B

FIG. 4.

pCMV-p53 + + + + + + -pRSV-CBP - - - - -pRSV-p300 - - - - -

C


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Competitor - P2 - - P2 - p21 P2 PAb421 - - + + + + + +

Probe: BK2-P2

**

pBK

2(-1884)

pBK

2(-635)

pBK

2(-1884)

pBK

2(-635)

pCMV-p53(wt) pCMV-p53(mut)

pBK2

pBK2

∆P215bp

∆P2 20bp

pBK2∆P2

15bp

∆P220bp

pBK2

∆P2 15bp∆ P2 20bp

A

B

C D

0 10 ng 25 ng 50 ngpCMV-p53

FIG. 5

0

5

10

15

20

10 ng 25 ng 50 ng

CAT/b-gal (fold)


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Zubaida Saifudeen, Hong Du, Susana Dipp and Samir S El-DahrActivation

The Bradykinin Type 2 Receptor is a Target for p53-Mediated Transcriptional

published online March 15, 2000J. Biol. Chem.

10.1074/jbc.M909810199Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M909810199

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;M909810199v1&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2000/03/15/jbc.M909810199.citation

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=early/2000/03/15/jbc&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2000/03/15/jbc.M909810199.citation

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/

the bradykinin type 2 receptor is a target for p53-mediated

Documents