Scottish Centre for Infectionand Environmental Health NHS++

SCOTLAND

r

The Development of a

National Reference Collection

for Oocysts of Cryptosporidium ]

Research Contract DWI 170/2/l 25

The Development of a National Reference Collection for Oocysts of Cryptosporidium Research Contract Number DWI 170/2/1

Professor WJ Reilly, Dr Lynda Browning Scottish Centre for Infection and Environmental Health Clifton House Clifton Place Glasgow, G3 7LN Tel 0141 300 1122, Fax 0141 300 1170 Bill.Reilly@scieh.csa.scot.nhs.uk Lynda.Browning@scieh.csa.scot.nhs.uk

Professor A Tait Welcome Centre for Molecular Parasitology Anderson College University of Glasgow 56 Dumbarton Road Glasgow, G11 6NU Tel 0141 330 3579, Fax 0141 330 5422 gvwe01@udcf.gla.ac.uk Dr HV Smith Scottish Parasite Diagnostic Laboratory Stobhill NHS Trust Glasgow, G22 3UW Tel 0141 201 3028, Fax 0141 558 5508 h.s.smith@spdl.org.uk Dr R Chalmers Dr Rachel Chalmers Head, PHLS Cryptosporidium Reference Unit Swansea PHL Singleton Hospital Swansea SA2 8QA Tel 01792 285341, Fax 01792 202320 Rachel.chalmers@phls.wales.uk Dr J Wastling Division of Infection and Immunity Institute of Biomedical Life Sciences Joseph Black Building University of Glasgow Glasgow, G12 8QQ Tel 0141 330 4437, Fax 0141 330 4600 j.wastling@bio.gla.ac.uk

1

EXECUTIVE SUMMARY

The protozoan parasite Cryptosporidium parvum is transmitted via contact with infected

animals, recreational waters or contaminated drinking water or food and represents a

significant public health problem. Approximately 6000 cases are reported each year in

the UK. The number of cases in the UK is likely to be underreported. In the absence of

available specific treatment of human cases, research has been directed towards

developing molecular methods to characterise parasites so that sources and origins of

infections can be identified and appropriate measures put in place to control routes of

infection. To support the underlying scientific process of the development of

Cryptosporidium parvum genotyping, a national collection of Cryptosporidium parvum

oocysts and DNA, with a supportive database of patient data, has been established.

The aims of the project were several-fold.

• To develop a national collection of oocysts of Cryptosporidium parvum.

• To isolate & identify a series of highly polymorphic markers that are able to

identify different isolates of Cryptosporidium parvum.

• To use the selected markers in the analysis of the variation between the isolates

collected from clinical cases.

• To analyse whether the multilocus system could be used to identify sources of

infection and in particular differentiate point sources.

• To pilot the transfer of any such developed typing system to the PHLS

Cryptosporidium Reference Unit.

• To initiate testing the performance of the developed typing system on samples

from England and Wales

• To extend the application of the typing system to the investigation of field isolates

in England and Wales.

2

A large collection of well-documented Cryptosporidium sp. isolates (1172 from Scotland,

5001 from England and Wales) has been collected and archived providing not only a

comprehensive picture of the prevalence and distribution of human and livestock cases of

the disease but also an essential archive of material for future development of molecular

epidemiological tools. The results have shown that the application of molecular

fingerprinting using the new highly polymorphic markers provides much greater

definition and resolution of the differences between Cryptosporidium parvum isolates

than has been possible previously.

3

INTRODUCTION

Cryptosporidium parvum causes acute diarrhoea and vomiting and is transmitted via

contact with infected animals, recreational waters, the drinking water supply or

contaminated food and represents a significant public health problem. In the UK

approximately 6000 human cases are reported per annum. While the number of cases

may seem small compared to a number of other diseases (approximately 60,000 cases of

Campylobacter and 20,000 cases of Salmonella are reported in the UK each year) the

potential for large-scale outbreaks as a result of contamination of the water supply is

considerable as illustrated by the outbreak in Milwaukee in the 1994 where an estimated

403,000 people became ill and 19 people died. Currently there are no effective methods

of treatment for the disease in people and control is based on the prevention of cases and

outbreaks by the identification and monitoring of sources of infection with the

appropriate implementation of public health measures (Smith and Rose, 1998).

Prior to the initiation of this project, PCR based molecular methods had been developed

and led to the definition of two groups of Cryptosporidium parvum (Type 1 and Type 2);

the first is associated almost exclusively with infection in humans, implying a human-

human cycle while Type 2 is found in both humans and domestic animals and is

considered to be a zoonotis. The two types of C. parvum are most commonly

distinguished by PCR amplification and restriction digestion of a variety of genes

including those encoding the Cryptosporidium outer wall protein (COWP) or a fragment

of the small subunit ribosomal RNA gene (Xiao et al, 1999; Spano et al, 1997). This

restricted genotyping of parasites only allow two main types to be defined thus

significantly reducing the ability of investigations to accurately pinpoint either the source

of any outbreak or indeed sporadic infection further.

The approach taken to develop a molecular finger printing system will allow different

isolates of the parasite to be distinguished such that the source of an outbreak could

potentially be identified. Based on studies in human genetics and tropical parasites, two

4

types of marker (micro- and minisatellite) would potentially be able to identify sources of

human outbreaks with a much greater level of precision than hitherto and would offer the

prospect of defining the geographical origin of outbreaks and the particular sources

responsible.

The molecular fingerprinting system could be used to retrospectively identify the source

of an outbreak and so identify measures that could be taken to prevent further outbreaks.

However, it would be of considerable value if such a system could be used to define

whether oocysts routinely sampled from the water supply were human infective and

provide data that could identify the source of such contamination. Current methods for

routine monitoring of the water supply involve the collection of oocysts by filtration and

their identification by microscopy and genus specific immunofluorescence (Smith, 1998)

and so do not allow the determination of whether the oocysts are human infective. Thus

the possibilities of improving our ability to track disease outbreaks and identify sources

of infection by developing such a fingerprinting system are significant. These

considerations provide the rationale for the project, which should be considered

essentially as a proof of principle study for the use of this new technology.

The development of a national reference collection of Cryptosporidium oocysts and DNA

was a pivotal part of the project and was required to better understand the distribution of

Cryptosporidium genotypes causing disease in the population, to broaden the sample

base, and to facilitate technology transfer between the collaborative partners, the Scottish

Centre for Infection and Environmental Health, Scottish Parasite Diagnostic Laboratory,

Wellcome Centre for Molecular Parasitology, University of Glasgow and the PHLS

CRU.

5

AIMS AND OBJECTIVES

The specific experimental objectives were:

• To develop a national collection of oocysts of Cryptosporidium parvum.

• To isolate & identify a series of highly polymorphic markers that are able to

identify different isolates of Cryptosporidium parvum.

• To use the selected markers in the analysis of the variation between the isolates

collected from clinical cases.

• To analyse whether the multilocus system could be used to identify sources of

infection and in particular differentiate point sources.

• To pilot the transfer of any such developed typing system to the PHLS

Cryptosporidium Reference Unit.

• To initiate testing the performance of the developed typing system on samples

from England and Wales

• To extend the application of the typing system to the investigation of field isolates

in England and Wales.

6

DEVELOPMENT OF A NATIONAL COLLECTION OF Cryptosporidium parvum

OOCYSTS IN SCOTLAND

Establishment and characterisation of the national collection of Cryptosporidium parvum

oocysts involved the collection of large numbers of isolates to represent those infecting

the population, the systematic collection of demographic and epidemiological data, the

archiving of material, and incorporation of genotyping data into the archive database.

Collection and characterisation of parasite isolates in Scotland.

Faecal samples from human clinical cases were examined for the presence of

Cryptosporidium using standard diagnostic procedures. Animal isolates were provided by

the Scottish Agricultural College, Veterinary Services Division. Oocysts were prepared

from each sample using the techniques described by Nichols & Smith (in press) and the

resulting purified preparations adjusted to equivalent concentrations before lysis by

freeze thawing in lysis buffer (Nichols & Smith, 2002) to generate extracts for marker

analysis. Each extract was subjected to PCR amplification using the primers for the

COWP gene and on the basis of the RFLP pattern of the resultant amplicon, defined as

belonging to the Type 1 or 2 genotypic class of C. parvum (Spano et al, 1997). One

isolate from each multilocus genotype was additionally genotyped by PCR-RFLP of the

18S ribosomal gene as described by Xiao et al 1999 to confirm that all isolates were C.

parvum Type 1 or Type 2.

Over the period of funding (Nov 2000 - Jan 2002), 1260 faecal samples were received at

Scottish Parasite Diagnostic Laboratory (SPDL) and these were initially confirmed as

positive for Cryptosporidium by microscopy and then the oocysts purified. After

purification, each preparation was lysed and then genotyped by PCR-RFLP of the COWP

gene. A total of 1172 were successfully purified and 1127 typed (Appendix 1); 45

isolates were either pcr failures or were non-interpretable (too feint). The human samples

were obtained from throughout Scotland and data such as post-code, sex, history of travel

also collected. The bulk of the animal isolates were collected from three regions in

Scotland and included two type 1 isolates (from animals on different livestock units),

7

which are normally associated with human infection. Despite considerable efforts very

few ovine isolates were collected. Fifty seven percent of human isolates were Type 2.

Three of the human isolates were not C. parvum but a different species (C. meleagridis)

originally described in turkeys (Slavin 1955). In addition, a small collection of oocysts

(obtained from colleagues in the UK & USA) representing different species of the

parasite as well as C. parvum from other hosts (dog & cat) was examined (8 C.

meleagridis, 2 C. baileyei, 2 C. felis/andersoni, 2 C. muris, 1 C. parvum (horse), 1 C.

parvum (cat). These were used as standards for determining the species specificity of the

new markers and to confirm the genotype of a sub-set of the collection using 18s r-RNA

PCR-RFLP.

This collection is unique in that it comprises both human and animal isolates collected

from the same geographical areas at the same time as well as being one of the most

comprehensive available. The work involved in collecting, purifying and conventional

genotyping of this material represents a substantial component of the project. The

availability of such a well-characterised collection of isolates was critical in terms of

evaluating the 'new' markers generated during the project in relation to their ability to

define different isolates.

A full database of these isolates has been compiled containing all the information

available. The epidemiological analyses of this dataset will be included in a separate

report to the Chief Scientist Office (Grant Reference CSO K/MRS/50/C2762). A copy of

this report will be sent to DWI.

8

DEVELOPMENT OF A NATIONAL COLLECTION OF Cryptosporidium

OOCYSTS IN ENGLAND AND WALES

Collection and characterisation of parasite isolates in England and Wales To establish a national collection of Cryptosporidium parvum isolates from patients in

England and Wales, Cryptosporidium-positive specimens were requested from primary

diagnostic laboratories. This was achieved initially through a “Dear Director” letter

circulated to all 49 PHLs in England and Wales in February 2000 (Appendix 2). NHS

laboratories also use the services of the CRU, for example for confirmation of equivocal

samples, and were also requested to submit isolates. Laboratories were asked to send

specimens with a minimum set of information systematically collected on a sending form

(Appendix 3). This included the patient name, address, postcode, date of birth or age, sex,

clinical details, specimen date, history of recent foreign travel and whether the case was

considered to be part of a cluster or outbreak. Each faecal sample was given a unique

identifying number and the information on the sending forms was entered into the

Pathology laboratory database “CILMS” (Computer Integrated Laboratory Management

System, I SOFT PLC, Manchester UK) to store the data, and so that individual patient

reports could be generated for issue to the sending laboratory.

To encourage the continued submission of isolates and provide an update to laboratories,

summary update reports were sent out in June 2001 and April 2002 (Appendix 4) to all

laboratories sending isolates. An article was also published in CDR weekly in October

2001, providing an update and requesting samples (Anon, 2001).

To generate exposure hypotheses for further investigation of unusual species of

Cryptosporidium identified during the study, more detailed questionnaires for such cases

were circulated to Consultants in Communicable Disease Control. Data gathered by this

route were analysed separately from those collected as part of the national collection.

9

Three sentinel Veterinary Laboratories Agency (VLA) laboratories (Aberystwyth,

Shrewsbury and Penrith) also voluntarily provided clinical specimens from farmed

animals.

Each faecal isolate was prepared as described below and archived, maintaining the

unique identifier and preparation date. Faeces were stored at +4oC, oocyst suspensions

(see below) stored at +4oC, and DNA extracts (see below) stored at –20 oC.

Sample preparation and genotyping

Oocysts were separated by flotation from faecal debris using saturated NaCl solution and

centrifugation for 8 min at 1600 g (Ryley et al., 1976). The floated material containing

the oocysts was washed with de-ionised oocyst-free water, the oocysts resuspended in 1

ml de-ionised, oocyst-free water and stored at +4 oC prior to use. To extract DNA, 200 μl

oocyst suspension was incubated at 100 ºC for 60 min and DNA extracted using

proteinase K digestion in lysis buffer at 56 ºC and a spin-column filtration technique

(QiAMP DNA mini kit, Qiagen). DNA extracts were stored at -20oC prior to use.

To provide baseline genotyping data, the Cryptosporidium oocyst wall protein (COWP)

gene was investigated using PCR-RFLP (Spano et al., 1997). Briefly, primers cry-15 and

cry-9 were used to amplify a 550 bp region of the COWP gene, which was then subjected

to restriction endonuclease digestion by RsaI. The digestion products were separated by

agarose (3% w/v) gel electrophoresis, visualised using ethidium bromide (0.1 mg / 100

ml) and recorded using a digital camera and KDS1D analysis software (Kodak). Product

sizes were confirmed by comparison with a DNA molecular weight standard marker (Life

Technologies).

Confirmation of equivocal samples and validation of genotyping results

Equivocal and negative samples were confirmed by microscopy using bright field,

differential interference contrast and immunofluorescence staining according to the

10

manufacturer’s instructions (TCS Water Sciences). A calibrated eyepiece graticule was

used to measure modified Ziehl-Neelsen stained oocysts (Casemore, 1991).

The genetic identity of isolates was further investigated in equivocal samples by

PCR/RFLP using primer sets for the thrombospondin-related adhesive protein (TRAP-

C2) and 18s rRNA genes. A nested PCR-RFLP was performed to analyse the TRAP-C2

(Elwin et al., 2001). External primers which amplify a 369 bp region of the C. parvum

TRAP-C2 gene, and internal primers which generate a 266 bp product, were used. PCR

products were then subjected to restriction endonuclease digestion by HaeIII and BstEII.

The digested products were separated and visualised as described above. A nested PCR-

RFLP was performed to analyse the 18s rRNA gene (Xiao et al, 1999). Internal primers

which generate a secondary product of 826 bp to 864 bp were used, followed by RFLP

analysis using two restriction endonucleases (SspI and VspI). The digested products were

separated and visualised as described above.

Analysis of DNA sequence data was used to selectively validate PCR/RFLP results and

for the further investigation of unusual isolates. COWP and 18s rRNA PCR products,

generated as described above, were sequenced (Oswel DNA), but to generate a less

wieldy product for sequencing of the 18s rRNA gene a single PCR approach which

generated a 298 bp product was also used (Morgan et al., 1997). The results were

compared with published sequences (Xiao et al., 2000) and using the Blastn search

programme (Altschul et al., 1997).

Data analysis

Patient data was downloaded from CILMs into a Microsoft Excel spreadsheet. Data were

cleaned to eliminate duplicate reports and input missing data.

To confirm the representative nature of the dataset it was validated by comparing the age

and gender distribution with primary diagnostic laboratory reports to national

surveillance, stored by the PHLS Communicable Disease Surveillance Centre (CDSC).

Gender tabulations were compared by the Mantel-Haenszel version of the Chi squared

11

test. Associations between patient characteristics (exposure) and genotype (outcome)

were examined using the Mantel-Haenszel version of the Chi squared test and age

distributions by the Kruskal-Wallis two sample test. All statistical analyses were

undertaken using EpiInfo (Dean et al., 1990) and STATA (StataCorp, 1999).

Results – description and validation of specimen submission

Between January 2000 and 31st July 2002, a total of 5157 human faecal specimens were

received from 111 primary diagnostic clinical microbiology laboratories in England and

Wales for Cryptosporidium genotyping. The sending laboratories comprised 48 PHLs or

PHLS collaborating centres and 63 NHS trust laboratories throughout England and

Wales. The proportion of specimens received represented 47% (2745 / 5811) of the

laboratory reports to CDSC during 2000, 46% (1635 / 3569) during 2001 and 77% (777 /

1113) to the end of July 2002.

The date the specimen was collected from the patient was available for 4888 / 5157

(95%) specimens. The time delay between specimen date and date of receipt by the CRU

ranged from 1 to 188 days (mean = 6 days, mode = 5 days, median = 5 days). For the 269

submissions that did not have a specimen date, a proxy date was calculated by deducting

5 days from the date of receipt at the CRU.

The age of the patient was known for 5111 / 5157 (99%) specimens received by CRU.

The youngest patient was 2 months old and the oldest 98 years (mean = 16 years, median

= 9 years, mode =1 year). Reports to CDSC over the same time period have age data for

90% and record the youngest patient as less than 6 days and the oldest as >79 years

(mode=1 year). Because of the way the data are collected at CDSC, and further

comparison is not possible.

The gender of the patient was known for 5132 / 5157 (99.5%) specimens. 2477 / 5157

(48%) were from males and 2655 / 5157 (51.5%) were from females. These differed from

those reported to CDSC (Table 1), largely due to the higher proportion of cases in the

CDSC database where the sex was not known.

12

Table 1 Validation of isolate collection, by gender

Gender Reports to CDSC Specimens submitted to CRU

χ2

Male

4847 / 10493 (46%) 2477 / 5157 (48%) 4.70 (p<0.05)

Female

4947 / 10493 (47%) 2655 / 5157 (51.5%) 26.04 (p<0.05)

Not known

699 / 10493 (7%) 25 / 5157 (0.5%) 298.97 (p<0.05)

The monthly distribution of specimens (by specimen date) submitted to the CRU

reflected those reported to CDSC (Figure 1). During 2000 and 2001 most isolates were

received during September, when a consistent annual autumnal peak is observed in the

number of reports nationally. During 2000 there was also a spring peak in the number of

reports to CDSC, reflected by a peak in submissions to the CRU. However, this peak was

not evident during 2001.

13

Figure 1

Monthly distribution of Cryptosporidium isolates submitted to CRU by specimen date compared with reports to CDSC

0

200

400

600

800

1000

Jan

Feb

Mar Ap

r

May Jun

Jul

Aug

Sep

Oct

Nov

Dec

Month by specimen date

Num

ber o

f spe

cim

ens

or

repo

rts CRU 2000

CDSC 2000

0

200

400

600

800

1000

Jan

Feb

Mar Ap

r

May Jun

Jul

Aug

Sep

Oct

Nov

Dec

Month by specimen date

Num

ber o

f spe

cim

ens

or

repo

rts CRU 2001

CDSC 2001

0

200

400

600

800

1000

Jan

Feb

Mar Apr

May Jun

Jul

Aug

Sep

Oct

Nov

Dec

Month by specimen date

Num

ber o

f spe

cim

ens

or

repo

rts CRU 2002

CDSC

14

Results – description of the national collection of Cryptosporidium oocysts

Cryptosporidium was confirmed in 5001 / 5157 (97%) specimens submitted to the CRU.

Of the 156 (3%) specimens where Cryptosporidium was NOT confirmed, 8/156 (5%)

were identified as Cyclospora cayetanensis. In 39 / 156 (25%) there was insufficient

material for confirmatory microscopy and no PCR product was generated with

Cryptosporidium genus–specific primers. The remaining 109 / 156 (70%) unconfirmed

isolates included yeast cells, mushroom spores, pollen grains and unidentified artefacts.

The national collection thus comprised 5001 confirmed Cryptosporidium isolates

collected between January 2000 and July 2002, and was characterised into sample sets

(Table 2). It must be noted that these are not necessarily mutually exclusive.

Table 2

Sample sets within the national collection of Cryptosporidium oocysts Sample set description Number of isolates

Immunocompromised patients

46 / 5001 (1%) isolates came from patients who were immunocompromised

Hospitalised patients 62 / 5001 (1%) isolates came from patients who were hospitalised.

Sequential specimens from the same patient

88 / 5001 (2%) isolates were sequential specimens from 41 patients

Outbreaks 327 / 5001 (6.5%) isolates were from 17 general outbreaks of illness

Non-outbreaks: • Apparently sporadic • Household or family

cluster

4674 / 5001 (93%) isolates were non-outbreak isolates 4278 were from apparently sporadic cases 396 were part of household or family clusters

Recent foreign travel 516 / 4674 (11%) non-outbreak isolates were from cases who reported recent foreign travel

15

Genotyping analysis of the 5001 confirmed isolates collected over the study period by

PCR-RFLP are shown in Appendix 5. Novel RFLP patterns were identified in 20 isolates

and are being further investigated. Amplicons were generated by PCR from 12 isolates

but failed to show restriction fragment digestion products and, with 7 other equivocal

isolates, remain under investigation. In 155 specimens, although confirmed by

microscopy, no PCR product could be generated.

46 isolates were received from patients known to be immunocompromised for various

reasons: HIV (n=15), T cell disorders (n=6), SCID (n=1), organ transplant (n=6),

oncology (10), not known (n=8). Of these, 20 isolates were C. parvum genotype 1, 16

were C. parvum genotype 2, 2 were C. meleagridis and 1 was C. felis.

62 isolates were received from hospitalised patients. 27 were C. parvum genotype 1, 28

were C. parvum genotype 2, 1 was C. meleagridis and 1 was an unidentified

Cryptosporidium species.

Sequential samples from the same patient showed that in 28 patients C. parvum genotype

1 was detected on each occasion and in 7 C. parvum genotype 2 was detected on each

occasion. C. meleagridis was detected consistently in two patients. Two samples from

one patient, while confirmed by microscopy, failed to amplify with COWP or 18s

primers as did one sample from a patient who had been previously diagnosed with a C.

parvum genotype 1 infection.

Of the 4674 non-outbreak isolates, 2401 (51%) were C. parvum genotype 1, 2040 (44%)

were C. parvum genotype 2 and 62 (1%) were other Cryptosporidium species or

genotypes (Appendix 5). Of the 516 isolates from these patients reported recent foreign

travel, and 376 (73%) were C. parvum genotype 1, 98 (19%) were C. parvum genotype 2

and 17 (3%) were other Cryptosporidium species or genotypes (Appendix 6). Isolates

from patients reporting recent foreign travel were significantly more likely to be C.

parvum genotype 1 than isolates from patients who did not report such travel (χ2=

136.34, df=1, p<0.05).

16

Outbreaks were caused by C. parvum genotypes 1 and 2 (Appendix 7). Of the 327

isolates genotyped from 17 general outbreaks of illness, 144 were C. parvum genotype 1

and 210 were C. parvum genotype 2 and a PCR product could not be generated from 3.

One municipal drinking water outbreak was caused by C. parvum genotype 2 and one by

genotypes 1 and 2. Of the nine swimming pool associated outbreaks from which samples

were received for genotyping, five were C. parvum genotype 1, two were C. parvum

genotype 2 and two were mixed C. parvum genotypes 1 and 2. Isolates were genotyped

from two outbreaks at children’s day nurseries, both of which were caused by C. parvum

genotype 1. Other outbreaks involved contact with a farm holiday centre that had a

private water supply (C. parvum genotype 2), attending a residential college on a private

water supply (C. parvum genotype 2), exposure to environmental faecal contamination

(C. parvum genotype 2) and an outbreak where multiple vehicles were identified (C.

parvum genotype 2).

Since general outbreaks could contribute a disproportionate number of isolates to the

database in terms of time/place/genotype, those samples from cases involved in general

outbreaks were omitted from further analyses. Of the non-outbreak isolates, 2260 were

from males and 2392 were from females. The distribution of genotypes 1 and 2 did not

differ by sex (χ2=0.03, p>0.05, df=1) (Appendix 8). The distribution of C. parvum

genotypes varied by age. The mean age of cases with C. parvum genotype 1 infections

was 17 years (range 0 to 97 years, median 9 years), significantly older than the mean age

of those with C. parvum genotype 2 infections which was 15 years (range 0 to 92 years,

median 8 years) (Kruskal-Wallis = 6.853, p<0.05, df=1) (Appendix 9). However, the

modal age did not differ, being 1 year for both genotypes 1 and 2

There was a significant difference in the distribution of C. parvum genotypes 1 and 2

between years 2000 and 2001; in 2000 52% of cases were genotype 1 and 44% genotype

2 while in 2001 57% were genotype 1 and 36% wre genotype 2 (χ2=21.70, p<0.05, df=1)

(Appendix 10). The number of laboratory reports nationally to CDSC in 2001 fell by

35% from the previous 10-year average of 4784 to 3569 (PHLS data). Therefore, further

analysis of the data from the national collection is presented on a year-by-year basis.

17

During 2000, there was a spring peak in the number of C. parvum genotype 2 isolates and

an autumn peak in the number of genotype 1 isolates peak (Appendix 11). However,

during 2001 the spring peak was much less marked, and only partially restored in 2002.

The late summer / autumn peak in the C. parvum genotype 1 isolates comprised both

those from patients who had reported foreign travel and those who did not. The spring

peak in the C. parvum genotype 2 isolates was almost exclusively composed of

indigenous cases (Appendix 12).

The epidemiological distribution of Cryptosporidium genotypes in England and Wales is

shown in Appendix 13.

A geographical distribution in C. parvum genotypes was observed, but this changed over

time (Appendix 14). Wales and the South West maintained a predominance of genotype 2

over genotype 1 but during 2001 many regions were influenced by the increase in the

proportion of genotype 1 (or decrease in genotype 2).

Animal isolates

C. parvum genotype 2 was detected in 208/209 clinical isolates submitted from the

sentinel veterinary laboratories, and in 1 no PCR product could be generated. These

isolates provide material for sub-typing and comparative studies with human isolates.

18

MICRO AND MINISATELLITE MARKERS

DEVELOPMENT OF TECHNOLOGIES IN SCOTLAND

Isolation of micro and minisatellite markers

The tri-nucleotide repeat described by Caccio et al. 2001 was amplified using the

published primers while primers were designed to the sequences flanking the complex

repeat identified in an antigen (GP15/45/60) described by Strong et al. 2000 and also to

sequences flanking the repeat sequence in the hsp70 gene Khramtsov et al, 1995. The

remaining markers were identified by screening the databases of genomic sequences with

the tandem repeat finder program (Benson et al, 1999). The details of the markers

selected are provided in Appendix 15. Each isolate was genotyped by PCR amplification

using a 1/10 or 1/100 dilution of the parasite lysates in a total reaction volume of 20µl

under previously described conditions (MacLeod et al, 2000) and the following cycle

conditions: 950C 50s, 50-620C (temperature dependant on the specific primer set) 50s,

and 700C 60s for 30-35 cycles. Each distinct allele was allocated a number for ease of

data handling and a representative of each sequenced to confirm the length and identity.

A complete list of the alleles identified and the corresponding number for each are listed

in Appendix 16.

Bio-informatic analysis of the available genomic sequence databases (using the repeat

finder programme) initially identified 96 microsatellite sequences and 86 minisatellites of

variable repeat length. Examination of these sequences using the criteria of: (a) sufficient

unique sequence flanking the repeat for PCR amplification (b) the length of the repeat

sequence in terms of copy number (c) nucleotide composition of the repeat sequence,

lead to the selection of 6 di-nucleotide, 19 tri-nucleotide and 16 minisatellite sequences

for further analysis. None of the minisatellite sequences were of high (>10) repeat copy

number. Based on the unique sequence flanking each repeat, PCR primers were designed

and then tested for the ability to amplify a single fragment of the predicted size from

DNA of the reference lowa strain of C. parvum, Type 2. Annealing temperature titrations

were undertaken to optimise amplification and ensure that only a single locus was being

19

amplified. In addition to these markers, microsatellite sequences reported in the literature

by Caccio et al (2001), Strong et al (2000) and Khramatsov et al (1995) were also

developed (primer design and annealing temperature titrations) as they had been

demonstrated to show polymorphism within the two main genotypes (Type 1 & 2).

Analysis of micro and minisatellite markers

The alleles identified at each of the seven loci were combined to provide a multilocus

genotype for each isolate. The data obtained in terms of the genotypes of each isolate

were analysed in a number of different ways. To determine the differences between

isolates Jaccards coefficient of similarity was measured by pair wise comparisons of the

multilocus genotype of each sample to generate a matrix of similarities (Jaccard, 1908).

The results were analysed using the clustering calculator program

(http://www.biology.ualberta.ca/jbrzusto/cluster.php) ) and plotted as a dendrogram using

TREEVIEW http://taxonomy.zoology.gla.ac.uk/rod/treeview.html). This allowed

different groups of isolates to be defined in terms of their similarity. In addition genetic

distances (Nei, 1978) between these groups of related isolates were calculated using

standard genetics software. In order to determine if the populations of parasites were

undergoing genetic exchange and to establish their population structures, measures of

linkage disequilibria and genetic distance were calculated using the genetic data analysis

program (http://chee.unm.edu/gda/) and the LIAN 3.0 program of Haubold and Hudson

(2000), using the allele frequencies at each pair of loci. The standardised index of

association measures the strength of linkage disequilibrium and does not vary with the

number of loci analysed unlike the “classical” IA (Maynard-Smith et al, 1993). In samples

where more than one allele was identified only the most abundant was scored assuming

that the parasite is haploid. The main methods used in the experimental work are covered

in the published references quoted and primarily involve routine molecular biological

techniques and parasite enumeration methods.

20

Evaluation of mini and microsatellite markers

A panel of 20 isolates from those collected by SPDL was set up in order to screen the

identified markers for their ability to distinguish between Type 1 & 2 isolates and to

demonstrate variation within each sub-genotype. The panel comprised 8 human Type 1

isolates, 5 human type 2 isolates and 7 bovine Type 2 isolates from different regions of

Scotland with the exception of one bovine isolate (lowa) from the USA. The analysis of

the size of the amplified products of each marker was undertaken by agarose gel

electrophoresis. The criteria for selecting markers for further evaluation was based on the

ability to detect variation in the size of the amplified product both within and between the

different groups of isolates (human Type 2 versus bovine Type 2, Type 1 versus Type 2,

within bovine Type 2 and within human Type 2).

The amplified products from the dinucleotide microsatellite repeats proved difficult to

resolve on agarose gels and although 2 showed polymorphism, it was decided not to take

this class of markers further. The trinucleotide repeats (19 in total) were evaluated and

10 of these showed inter isolate variation between Type 1 & 2 parasites. Of these, 5

showed variation within Type 2 isolates and three of these showed variation within both

Type 1 & 2. Analysis of the 16 minisatellite markers identified 10 that differentiated

between Type 1 & 2 of which 7 showed differences within Type 2 and 1 differences

within Type 1. Taking all the data together, 7 of the markers were able to distinguish

between nine of the twelve Type 2 isolates and the Type 1 isolates could be sub-divided

into two types. Difficulties were encountered in the unambiguous definition of alleles at

the 7 loci chosen for further analysis due to the relatively low resolution provided by

agarose gel electrophoresis. To overcome this limitation and provide a robust and

reproducible method for defining the alleles at each locus, a fluorescent labelled primers

were used and the resulting products resolved on an ABI sequencer. This allowed the size

of each amplified fragment to be determined accurately to a resolution of 1-2bp. Based

on this analysis a set of 7 markers have been identified that show substantial variation

between isolates.

21

Evaluation of markers on populations of isolates within Scotland

Rather than randomly type all the available isolates, they were divided into specific

geographical sub-groups in order to address specific questions about the utility and

diversity of the panel of markers chosen for further analysis. The populations of isolates

were also chosen on the basis of there being sufficient numbers from a particular region

to enable the conclusions to be quantitatively sound. Fifty eight multilocus genotypes

(MLGs) were identified including C. meleagridis and the “monkey” genotype (Appendix

17).

Geographical and host sub-structuring of isolates in Scotland.

The most frequent MLGs identified in each of the 3 areas studied to date are very similar

and although each has a low frequency of geographically distinct MLGs, for example

MLGs 14-21 in one region, 40-45 in another region and 46-58 in another, there appears

to be little evidence for geographical sub-structuring from these data. To determine if the

conclusions reached by simple inspection of the data in graphical format were correct, the

genetic distance between each of the populations was calculated using the genetic data

analysis program. The values were all low showing little difference between each of the

areas examined.

To determine whether or not host sub-structuring occurs, the human Type 2 samples from

one area were compared with the bovine samples from the same area and the genetic

distance found to be 0.001 a value, which is even less than that found for the human and

bovine Type 2 groups in one of the other areas looked at. The Fst value was also very low

between the 2 host populations suggesting that the same population of parasites infects

both cattle and humans in these areas. The results from the Jaccards similarity analysis

and the resulting dendrogram (Appendix 18) however, do show that there are 2 sub-

groups of isolates (1 and 5) which are quite distinct from the majority of Type 2 MLGs

and have only been found in humans to date. They are significantly different from the

majority of Type 2 MLGs. They are also significantly different from each other. Due to

the lower number of ovine isolates analysed, they were not compared with the

22

bovine/human isolates in the GDA analysis but 9 out of the 11 isolates had MLGs also

found in human and cattle and the 2 new MLGs (43 and 44) were very similar to

previously described genotypes. This quite clearly shows that there is little evidence of

host specificity with regard to the parasites infecting sheep in this area, although analysis

of more samples will need to be undertaken to confirm this lack of host specificity.

Temporal sub-structuring of isolates in Scotland.

To understand the epidemiology of C. parvum Type 2 infections we need to consider the

possibility of temporal sub-structuring in addition to geographical and host sub-

structuring. Although Type 2 outbreaks can occur throughout the year, it is generally

observed that the number of cases peaks twice a year in spring and autumn in Scotland.

The MLGs in each of the spring peaks were compared and no significant differences in

either the MLG or their frequency was observed. Both time points have a similar

distribution of multilocus genotypes. The genetic distance was calculated between the

two populations and for this group of samples there does not appear to be temporal sub-

structuring. Therefore the results from each of the three areas are in complete agreement,

and suggest that temporal sub-structuring of Type 2 C. parvum does not occur within

Scotland. More work needs to be done to determine if this is the situation in other areas

and over greater time frames than were analysed in this study.

Application of genotyping methodology

In the spring of 2000 an outbreak of human cryptosporidiosis occurred in Scotland

involving about 90 cases. The samples were typed using the standard COWP-RFLP

genotyping system and shown to be Type 2 i.e., potentially of animal origin. At the time

no routine discriminatory genotyping was available, but the samples collected from

clinical cases were genotyped retrospectively using the markers developed in this project.

Appendix 19 shows the frequency of MLGs found in the outbreak. The overwhelming

23

predominance of a single genotype during the outbreak points to a single point source of

infection, confirming the conclusions of team investigating the outbreak. Interestingly,

the predominant MLG (genotype 6) associated with the outbreak represents a genotype

commonly found in both cattle and humans throughout Scotland. It is unclear whether the

other less frequent MLGs represent a background of sporadic cases from other sources or

are part of the outbreak

Application of the new genotyping methods to this outbreak would have potentially

helped the epidemiological investigation in two ways. (a) The identification of a

predominant single MLG would have strongly implicated a single point source

contamination at a very early stage (b) the correlation of the MLG with environmental

samples (water/animals) collected at the time of the outbreak would have helped track the

precise source of the outbreak. Unfortunately no such samples were collected at the time

of this incident for this analysis to be performed.

Unusual isolates of Cryptosporidium.

Analysis of the human isolates showed that in addition to the two classical genotypes

(Type 1 & Type2), 3 isolates were C. meleagridis, a parasite originally isolated from

turkeys. The source of such infections is unknown. Additionally, 2 isolates that appeared

to be Type 1 by COWP-RFLP gave PCR products with the 7 micro- and minisatellite

markers and the resulting multilocus genotypes (39 and 49) were found to form a separate

cluster in the dendrogram (Appendix 18) showing that they are completely distinct from

any of the Type 2 sub-groups, Type 1s or C. meleagridis. This is an important finding as

it shows how the multilocus genotyping system can be used to analyse C. parvum

genotypes other than human and bovine. These isolates were analysed by PCR-RFLP of

the 18S r-RNA and shown to give identical patterns to those originally identified from a

monkey based the sequence of the 18S rRNA gene by Xiao et al (1999). The monkey

genotype isolates described here were obtained as part of a routine sample collection

from symptomatic human individuals. Both were collected in November 2000, from

geographically diverse areas. Neither reported any recent travel nor was there any

24

additional information provided that could indicate how they became infected with this

unusual genotype. Xiao et al (1999) showed by the neighbour-joining method that the

monkey type formed a monophylactic clade with the C. parvum human type (Type 1)

which is more similar to C. parvum bovine (Type 2) than C. meleagridis. As there were

more difficulties amplifying C. meleagridis than C. parvum monkey type with our

primers and from the clustering patterns of the dendrogram, our results are in keeping

with those of Xiao et al (1999). The monkey genotypes share more alleles with other C.

parvum isolates than C. meleagridis.

A detailed description of the results and analysis from the Scottish Cryptosporidium

isolates is provided in a separate report to the Chief Scientists Office (Project Reference

CSO K/MRS/50/C2762).

MICRO AND MINISATELLITE MARKERS

TRANSFER OF TECHNOLOGY TO ENGLAND & WALES

Microsatellite Technology Transfer to CRU

As part of the collaborative project, the technology was transferred to the CRU. The first

phase of this was training and testing of selected samples in Glasgow and the second the

transfer of the technology to the CRU.

A clinical scientist was seconded from the CRU to the Wellcome Centre for Molecular

Parasitology for nine weeks from 12th February 2001 to 12th April 2001. PCR reactions

and DNA fragment analyses were conducted on 70 samples from the national oocyst

collection representing three discrete, well-defined outbreaks of human cryptosporidiosis

using the methods developed by the Glasgow group. The outbreak samples were from a

drinking water-borne outbreak in Clitheroe during March 2000 (n=46), a visit to an open

farm in North Wales during March 1999 (n=10), and an outbreak in a day nursery in

October 2000 (n=14). To elucidate the distinction between background and outbreak

genotypes, an additional group of isolates comprising a selection of indigenous sporadic

25

cases surrounding the nursery outbreak in terms of time and place (n=5) and those

reporting a history of recent foreign travel (n=23) were also examined for comparison.

Microsatellite DNA at seven markers were explored: MS1, MS5, MS9, MS12, TP14,

Caccio and GP15. The primers were dye-labelled with. The PCR products were initially

run on agarose gels to confirm the PCR reaction and the product sizes were then

evaluated by running on a slab-based polyacrylamide gels and analysed using the

Genescan Analysis software.

Results – work undertaken in Glasgow PCR reactions were undertaken on 98 isolates, generating 403 PCR products (Appendix

20) excluding training and optimisation reactions. As visualised on agarose gels, clean

PCR products in the region of 238 bp to 447 bp were obtained from MS1, MS5, MS9,

and the Caccio primers. MS12 gave products of up to 673 bp. Between 83% and 92%

DNA samples amplified with the MS1, MS5, MS9 and the Caccio primers, compared

with 69% samples that amplified with the MS12 primers and 64% with the TP14 primers.

Amplification of DNA with the GP15 primers resulted in uninterpretable banding

patterns and was not pursued for Genescan analysis. Microsatellite fragment sizes were

evaluated using the Genescan Analysis software for 250 / 403 PCR products from 5

markers: MS1 (n=53), MS5 (n=58), MS9 (n=58), MS12 (n=38) and Caccio (n=43)

(Appendix 21). Due to time constraints and the lower proportion of amplicons generated,

the TP14 and MS15 markers were not further evaluated.

For each microsatellite region, individual alleles were identified using Genescan analysis

software (Appendix 22). These showed that variation occurred from as little as 1 bp and

that some isolates contained more than one allele. Greatest variation was detected within

the MS12 microsatellite region, and sporadic samples showed more alleles than those

from outbreaks. Genotypes were not assigned to the isolates since testing was incomplete.

26

Adaption of method within CRU The PHLS CRU utilises two principal methods of determining the size of PCR products

such as those generated by micro-satellite analysis. The first, which is generally

employed for routine analysis of samples generating an expected and limited size range,

uses a digital camera with a gel documentation system (Kodak KDS1D). The second, an

automated system which provides size analysis to an accuracy of 1 base pair, is used to

analyse the electrophoresis of samples for which high levels of accuracy are required and

which yield products of unpredictable sizes. This system is based on capillary gel

electrophoresis (Beckman-Coulter CEQ8000), and is supported centrally by the PHLS.

Therefore one of the main considerations in the transfer of the micro-satellite analysis

technology from Glasgow University to the PHLS Cryptosporidium Reference Unit at

Swansea PHL was the necessary change from the Genescan slab-based gel analysis

system used at Glasgow University to the detection system available to the CRU.

The CEQ8000 fragment analysis software permits the development of typical algorithms

that allows rapid analysis and therefore characterisation of large numbers of samples.

This system does not rely on a slab-gel format, which can be prone to electrophoretic

migration errors and therefore inaccurate product size determination. In order to use the

CEQ8000 fragment analysis system the forward primers for each micro-satellite marker

initially provided for the project to the CRU by Glasgow University were replaced by the

incorporation of a specific phosphoramidite dye label. Labelled primers of known

concentrations were obtained, although not without difficulty due to synthesis problems

experienced by the suppliers. The original supplier has now been identified for any future

orders.

Following staff training in the use of the CEQ8000 fragment analysis software,

optimisation of micro-satellite amplification using PCR has been undertaken and

performed in parallel with the re-amplification of a number of samples already analysed

using the system favoured by Glasgow University, in order that consistency with results

already generated could be assured using the CEQ8000. Since the TP14 PCR

demonstrated a high negativity on samples in Glasgow, the GP15 had uninterpretable

27

banding patterns and the MS12 gave products outwith the accurate sizing range of the

CEQ, four markers (MS1 MS5 MS9 and Caccio) were selected for further investigation

using the CEQ.

28

DISCUSSION

A unique collection of over 6200 representative, well-documented Cryptosporidium

isolates has been collected from throughout England, Wales and Scotland and will serve

as a reference source for future studies. These isolates have been typed using the

conventional PCR-RFLP typing system, which has revealed trends in the molecular

epidemiology of human cryptosporidiosis.

In Scotland, these confirm previous suggestions that the majority of C. parvum isolates

are of genotype 2. However, in England and Wales as a whole there is no difference in

the prevalence of C. parvum genotypes 1 and 2, although geographical variation exists

when the distribution is explored by regional health authority areas. A greater prevalence

of genotype 1 is found in London, the South East, Eastern and West Midlands and a

greater prevalence of genotype 2 in Wales and the South West. This may reflect an

East/West difference driven by urban (human) / rural (zoonotic) cycles of infection

(Casemore and Jackson, 1984). The distribution is also season-dependent, and

genotyping has revealed that the bi-modal peak in reports of Cryptosporidium to CDSC

may be driven by exposure to different genotypes at different times of year, since the

spring peak is largely genotype 2 and the late summer/autumn peak is genotype 1.

However, during 2001 the numbers of reports to CDSC fell by 35% (PHLS data) and was

particularly marked in the North West. This has been further explored, with genotyping

data, by Hunter et al., (in press) and may be associated with control measures in place

during the epidemic of foot and mouth disease.

The molecular epidemiology of C. parvum in England and Wales demonstrates age

differences, indicating different exposures particularly in the under 1’s and over 64’s

where genotype 1 predominates, and different control measures may be required for these

age groups. The prevalence of genotype 1 was also elevated in patients reporting recent

foreign travel, although this is worthy of further exploration in terms of the regions

visited and the risk factors during travel.

29

Other Cryptosporidium species were identified during this study, including C.

meleagridis, C. felis and C. canis. The patient exposures for these infections are being

investigated further to generate hypothese for further investigation, but it is important that

these was not restricted to immunocompromised hosts, indicating circulation in the

community (Chalmers et al., 2002).

The new mini and microsatellite markers developed provide a much more discriminatory

genotyping system than was available before allowing the definition of several sub-

groups of Type 2 parasites. This system is likely to be of considerable use in the future

analysis of the origins and nature of outbreaks. Further work in ongoing at the CRU

following the successful technology transfer to adapt the method to the capillary gel

electrophoresis system. The utility of other subtyping systems is also being explored and

compared with the mini and microsatellites in terms of resolution and utility. Additional

markers have been identified in Glasgow that have the potential to provide an even higher

level of resolution if required. These were not worked up due to time constraints. The

Type 1 isolates showed much lower levels of variation and the only population studied

was primarily composed of three major multilocus genotypes. Further research is needed

on this genotype both in terms of developing further variable markers and extending the

analysis to more isolates.

The study has revealed that there is little evidence for geographical or temporal sub-

structuring within C. parvum Type 2 isolates in Scotland. Several distinct areas have now

been analysed encompassing 348 samples in total using a typing system with a high level

of resolution. To our knowledge this is the first such study of this scale making a detailed

analysis of samples from a single country with a series of polymorphic and well-

characterised markers. Whether the conclusions reached apply to other countries or is

particular to Scotland requires further investigation. It will be necessary to analyse

samples from more diverse areas to determine if the lack of geographical sub-structuring

could be due to the relatively small size of the country and frequent movement of hosts

between areas. Caccio et al (2000) identified a non-random geographical distribution of

ML1 alleles when Italian and other Northern European Type 2 samples were studied

30

suggesting possible geographical sub-structuring in samples from a wider area.

Therefore isolates of more geographically diverse origins need to be analysed using

sufficiently polymorphic markers before the issue of geographical sub-structuring can be

resolved. The seasonal distribution of samples showed that the majority of animal cases

occurs in spring in each of the areas studied possibly reflecting the peak in numbers of

young calves and lambs however one region also had a significant number of bovine

cases in autumn. The distribution of the human Type 2 cases also varies greatly in each

of the three regions. At present we are unable to explain this variation in distribution of

cases, as the current genotyping system does not indicate geographical or temporal sub-

structuring of these isolates. Whether this is due to these markers lacking the necessary

level of resolution to distinguish different transmission routes and sources of infection in

each of the areas remains to be seen.

There is some degree of host sub-structuring within C. parvum Type 2 populations. In

one geographical area we showed that the human Type 2 population was made up of at

least 3 different populations one of which, the most common, was identical to the bovine

population whereas the other two were made up of quite different MLGs that formed two

distinct clusters based on similarity analysis (sub-groups 1 and 5, Fig. 3). However, we

could not be sure that this was entirely due to host specificity i.e. an inability of groups 1

and 5 to infect cattle, as more human isolates were analysed compared to bovine.

However, as a larger number of bovine isolates were typed in addition to more human

isolates from another geographical region, it is clear that none of the genotypes that

grouped in the human-specific clusters were found in cattle or sheep yet two additional

MLGs, 57 and 53, were identified in humans that clustered into these two groups. The

genetic distances between the ‘human-specific’ Type 2 sub-groups were significantly

different from each other and the main human/bovine sub-groups. This suggests that they

are indeed different populations and that the human-infective population is made up of 3

different sub-groups. As similar genotypes have now been found in a different area, this

is not an area-specific phenomenon but occurs in both the areas where human and bovine

isolates have been analysed. Whether these unusual sub-groups are part of a human-

specific Type 2 cycle similar to that of the human-specific Type 1s or whether additional

31

hosts are involved is unclear at present. More diverse hosts need to be analysed in order

to resolve this issue. However the identification of these groups implies that there is some

host specificity, as they have not been found in cattle isolates. The basis for this

specificity is unclear at present and more work needs to be done to understand the basic

biology and infection mechanisms of this parasite if we are to resolve these issues. What

is evident from this work however is that the majority of human Type 2 infections are

caused by a main genotypic group of parasites that is also found in cattle and sheep. As

these are the only two additional hosts we have analysed with this system at the present

time it is unknown if there are other hosts involved which could play a role in human

infection.

Although only a small number of ovine samples were typed in this study there appears to

be no host sub-structuring between cattle, sheep and the majority of human isolates. This

is in contrast to the finding reported by Chalmers et al (2002) in which isolates from

sheep at Loch Katrine gave an unusual banding pattern after COWP PCR-RFLP analysis,

confirmed by DNA sequence analysis, which led to the conclusion that these isolates

represent a different genotype. Obviously more ovine isolates from a variety of areas

need to be studied before we can determine the role sheep have in the Type 2

transmission cycle or to what extent they contain unusual genotypes. None of the isolates

we have studied to date gave this unusual COWP RFLP pattern suggesting that this group

of isolates are likely to represent an ovine-specific genotype. Sequence data obtained

using ssu rRNA primers (Morgan et al., 1997) have also confirmed differences in the

sheep isolates, and it is critical that samples are analysed with a full range of polymorphic

markers to enable such questions to be answered as only limited information is obtained

with the conventional Type 1 and Type 2 PCR-RFLP analyses.

The evidence presented here indicates that C. parvum Type 1 has a clonal population

structure. Therefore, while the life cycle of this parasite is presumed to have an obligatory

sexual cycle, it seems that self-fertilisation occurs more often in nature leading to very

little genetic exchange between isolates. Consequently, the multilocus genotyping system

identifies MLGs that should be stable in time enabling it to be used to track outbreaks and

32

identify sources of infection. The situation is more complex with C. parvum Type 2 as

the majority of isolates appear to be randomly mating with each other in a panmictic

population structure. Whether this is connected with the Type 2 parasites ability to infect

a wider variety of hosts than Type 1 is unclear as it is unknown at present whether

recombination occurs to the same extent in all hosts. However, a relatively high rate of

transmission is required to enable mixed genotype infections to occur allowing mating

between different isolates which would lead to panmixia and this may be more likely

when the parasite can infect a wide variety of hosts. In each of the 3 areas studied with

these markers, there is a significant level of Type 2 mixes (10-25%), which was not

found in Type 1s (Mallon et al, 2002). Although only one population of Type 1s has been

analysed to date with these markers, this lack of mixes would be consistent with limited

cross-fertilisation as expected for a clonal population.

There is also some evidence for an epidemic population structure occurring in Type 2s

from one area in Scotland. This occurs when there is rapid clonal expansion of one or

more genotypes, which can obscure the genetic exchange that continues in the

population. There is already evidence of more than one Type 2 population based on the

unusual genotypes that constitute sub-groups 1 and 5 in Appendices 6 and 7. The genetic

distance and linkage equilibrium analyses showed that these groups are very different

from the majority of Type 2 isolates and with each other. As they occur at very low

frequencies, little can be said about their population structure but it is clear that they do

not undergo genetic exchange with the main panmictic population. Whether they undergo

a human-specific cycle similar to Type 1s or a cycle involving non-ruminant hosts

remains to be investigated. It seems unlikely that they represent another C. parvum

genotype as, for example, dog, monkey, pig, etc. as the 18S rRNA data showed that they

were identical to the other Type 2 isolates with the C. parvum bovine RFLP pattern.

However the role that these isolates and those that have initially been associated with

other hosts, such as the 2 monkey genotypes, have in the population genetics of C.

parvum and human Cryptosporidiosis remains to be determined at present. What is clear

is that the information obtained with the use of micro- and minisatellite markers will

33

enable us to further increase our understanding of this parasite and its population

structure.

34

CONCLUSIONS

The project has achieved the original objectives and, thanks to the establishment of a

representative national collection of Cryptosporidium oocysts, demonstrated that, in

principal, a molecular fingerprinting system can be developed that allows parasite isolates

to be typed with a much higher resolution than before. The key conclusions and

achievements are summarised below:

• Collection of a unique, characterised set of over 6200 isolates with details of

geographical origin and patient details. This is a major resource for future

developments and analysis.

• There are many polymorphic micro and mini satellite sequences in the

genome of C. parvum that could be used to develop a typing system with

even higher resolution than the one developed here.

• A panel of markers has been developed that identify 58 different genotypes

from Scotland.

• The previously defined Type 1 human isolates are clonal in their population

structure and are primarily represented by two frequent multilocus

genotypes.

• Humans can be infected with the turkey parasite (C. meleagridis), with a C.

parvum sub-type previously described in monkeys as well as Type 1 or 2 C.

parvum (the most common infections). The results suggest a diversity of

sources of infection.

• Multilocus genotyping has defined 5 sub-groups of Type 2 parasites. Three

of these sub-types are similar and commonly infect humans, cattle and

sheep. The two remaining sub-types have only been found in humans to

date and, although relatively uncommon, cannot have originated from local

livestock.

• There is limited geographical sub-structuring between the different areas of

Scotland that have been surveyed suggesting that there is free movement of

parasite strains between areas. Genotypes commonly found in humans are

also found in sheep and cattle.

35

• Analysis of the parasites from the Spring 2000 outbreak in Scotland

demonstrated that these were primarily of a single genotype commonly

found in cattle. Published data showed that the sheep on Loch Katrine are

infected with a novel genotype of C. parvum and, taken with the data from

this study, it is likely that the source of the infection was from cattle. Given

that many cattle are infected with more than one genotype, the homogeneity

of the genotype of parasites in the outbreak is suggestive of a point source.

• The multilocus genotyping system developed in the project has been

validated as a valuable tool for analysing the epidemiology and sources of

Cryptosporidium infection and warrants further development and

refinement.

Overall the project has been successful although further investment is warranted in

developing additional markers to provide further resolution and definition of parasite

isolates.

Quality Assurance statement

The CRU has full accreditation under the Clinical Pathology Accreditation (UK) Ltd

scheme. Standard operating procedures, COSHH and Risk Assessments exist for all

techniques used by the CRU and are available for inspection. Characterised positive and

negative control material was used throughout this project and incorporated into every

test procedure, including intra- and inter-test controls. External quality control was

verified in a sample (DNA) exchange programme with SPDL, which showed good

correlation of PCR-RFLP genotyping results.

Acknowledgements

The initial project was funded by the Chief Scientist Office (Project Reference CSO

K/MRS/50/C2762) in Scotland to develop the molecular typing of Cryptosporidium.

Additional resources from the Department for Environment Food and Rural Affairs,

36

managed through the Drinking Water Inspectorate enabled collaboration with the PHLS

Cryptosporidium Reference Unit (CRU) and allowed the establishment of a national

reference collection for England and Wales

Publications arising from this work Anon. Genotyping Cryptosporidium is an essential addition to microscopy. CDR Weekly 2001; 11: 7-8 Casemore DP and Jackson B. Hypothesis: cryptosporidiosis in human beings is not primarily a zoonosis. J Infect. 1984; 9: 153-156 Chalmers RM, Elwin K, Reilly WJ, Irvine H, Thomas AL, Hunter PR. Cryptosporidium in farmed animals: the detection of a novel isolate in sheep. Int J Parasitol. 2002; 32: 21-26. Chalmers RM, Elwin K. Editorial: The implications and importance of genotyping Cryptosporidium. Communicable Disease and Public Health 2000; 3: 155-157. Chalmers RM, Elwin K, Thomas A, Joynson DHM. Unusual types of cryptosporidia are not restricted to immunocompromised patients. J Inf Dis. 2002; 185: 270-271. Gasser RB, Zhu XQ, Caccio S, Chalmers R, Widmer G, Morgan U, Thompson RCA, Pozio E and Browning GF. Genotyping Cryptosporidium parvum by single-strand conformation polymorphism analysis of ribosomal and heat shock gene regions. Electrophoresis 2001; 22:433-437 Glaberman S, Moore JE, Lowery CJ, Chalmers RM, Sulaiman I, Elwin K, Rooney PJ, Millar BC, Dooley JSG, Lal AA, Xiao L. Three drinking-water-associated cryptosporidiosis outbreaks, Northern Ireland. Emerging Infectious Diseases. 2002; 8: 631-633 Hunter PR, Chalmers RM, Syed Q, Hughes S, Woodhouse S, Swift L. Foot and Mouth disease and cryptosporidiosis: possible interaction between two emerging infectious diseases. Emerging Infectious Diseases. In press.

37

APPENDIX 1

Human and Animal genotyping results in Scotland

Source Type 1 Type 2 Mixed C. meleagridis

Human

753 295 403 7 3

Animal

Bovine

403

2

401

Ovine

16

16

Appendix 2

PHLS Headquarters Office 61 Colindale Avenue London NW9 5DF

PUBLIC HEALTH LABORATORY SERVICE

From The Deputy Director of the Service (Programmes) Professor 81 Duerden BSc MD FRCPath

Tel 0181-2001295 ext 3635/3600 Fax 0181-9059729

PHLS DEAR GROUP/CENTRE DIRECTOR LETTER

Reference Number:

Issue date:

Status:

DG/CD 2000/09

1 February, 2000

For action

FOR ACTION:

Group and Centre Directors

FOR INFORMATION:

Directors of Public Health Laboratories (PHLs) Consultants, PHLS Collaborating Centres, London Deputy Director and Heads of Divisions CDSC Assistant Director and Laboratory Directors, CPHL Director Malaria Reference Unit Head CDSC Welsh Unit Professor AM Emmerson, Honorary CMM, PHL Nottingham Group Business Managers Group Technical Co-ordinators Head MLSOs, PHLs and CPHL Clinical Scientist Convenors Chairman, Infection Control Nurses Network Ha Distribution List

Furlher information from: Dr Rachel Chalmers Head of CRU Public Health Laboratory DX 6970200 Rhyl 90 LL or Dr Ed Guy Clinical Scientist Public Health Laboratory DX 6070300 Swansea 90 SA

ENHANCED SURVEILLANCE OF CRYPTOSPORIDIUM INFECTION

39

Dear Group and Centre Director,

Summary

The PHLS is taking part in a collaborative project for the evaluation of molecular typing as a tool for supporting enhanced surveillance of Cryptosporidium infection with SCIEH and the Scottish Parasite Diagnosis Laboratory. This requires a good selection of Cryptosporidium strains from sporadic cases and outbreaks to be sent to the Cryptosporidium Reference Unit, Swansea PHL, for molecular typing.

Action

Group Directors are asked to co-ordinate the submission of Cryptosporidium- positive faecal samples to the Cryptosporidium Reference Unit.

Background

1

2

3.

4

A collaborative project for the evaluation of molecular typing as a tool for supporting enhanced surveillance of Cryptosporidium infection has been agreed between the PHLS and its Scottish counter parts -the Scottish Centre for Infection and Environmental Health (SCIEH) and the Scottish Parasite Diagnosis Laboratory (SPDL). This is based on a joint project funded by the Scottish Executive and the Drinking Water Inspectorate to develop a standardised approach to the collection of national molecular epidemiological data on Cryptosporidium infections. The SCIEH/SPDL/PHLS collaborative initiative requires a broad selection of strains from sporadic cases as well as from outbreaks throughout England, Wales and Scotland.

The molecular typing of Cryptosporidium isolates from England and Wales will be done at the Cryptosporidium Reference Unit, Swansea PHL according to protocols developed with the SPDL and based upon published methods [1,2], and will complement the existing reference services provided- by the CRU at Rhyl and Swansea PHLs.

The molecular typing project is well established and Group Directors are asked to arrange with their laboratory Directors for samples of all Cryptosporidium positive faecal specimens diagnosed in their laboratories to be sent to the CRU at Swansea PHL, Singleton Hospital, Swansea SA2 8QA.

This new project aimed at supporting enhanced surveillance will not interfere with existing R&D projects on cryptosporidiosis, including in particular work undertaken at the Food Hygiene Laboratory , CPHL. For the convenience of submitting laboratories,

2

Dear Group and Centre Director,

.

1

2

3.

4

A collaborative project for the evaluation of molecular typing as a tool for supporting enhanced surveillance of Cryptosporidium infection has been agreed between the PHLS and its Scottish counter parts -the Scottish Centre for Infection and Environmental Health (SCIEH) and the Scottish Parasite Diagnosis Laboratory (SPDL). This is based on a joint project funded by the Scottish Executive and the Drinking Water Inspectorate to develop a standardised approach to the collection of national molecular epidemiological data on Cryptosporidium infections. The SCIEH/SPDL/PHLS collaborative initiative requires a broad selection of strains from sporadic cases as well as from outbreaks throughout England, Wales and Scotland.

The molecular typing of Cryptosporidium isolates from England and Wales will be done at the Cryptosporidium Reference Unit, Swansea PHL according to protocols developed with the SPDL and based upon published methods [1,2], and will complement the existing reference services provided- by the CRU at Rhyl and Swansea PHLs.

The molecular typing project is well established and Group Directors are asked to arrange with their laboratory Directors for samples of all Cryptosporidium positive faecal specimens diagnosed in their laboratories to be sent to the CRU at Swansea PHL, Singleton Hospital, Swansea SA2 8QA.

2

MOLECULAR TYPING AND ENHANCED SURVEILLANCE OF CRYPTOSPORIDIUM INFECTION

40

samples received at Swansea will be split and sent on to other sites contributing to the PHLS reference services for cryptosporidiosis, in particular CPHL (for further genotyping studies) and Rhyl PHL (for specialist microscopy).

5.

6.

7.

Standardised epidemiological information, including details relevant to risk (residency, travel, occupation etc.), will be collected about those infected. The Environmental Surveillance Unit and other CDSC colleagues will be involved in these aspects of the project with SCIEH.

Investigation of outbreaks will not be affected by this project as all samples will be examined initially by the current typing methods that are provided routinely by the reference laboratory .It is hoped that the new approach will contribute to improved understanding of outbreaks.

The duration of this phase of the project will be 18 months. It is likely that this will be extended provided their initial progress is satisfactory.

Further advice

Any further enquires regarding these arrangements should be addressed to the newly appointed Head of the CRU, Dr Rachel Chalmers or to Dr Edward Guy, Swansea PHL (Tel. 01792285055, Fax 01792202320, e.mail edward.guy@phls. wales.nhs. UK

Yours sincerely,

Professor Brian I Duerden Deputy Director of the Service (Programmes) PHLS Headquarters e.mail bduerden@phls.nhs.uk

References

1

2.

Spano F, Putignani L, McLauchlin J, Casemore DP, Crisanti A. PCR-RFLP analysis of the Cryptosporidium oocyst wall protein (COWP) gene discriminates between C. wrairi and C. parvum isolates of human and animal origin. FEMS Microbiol. Lett. 1997;150:209-217

Peng MM, Xiao L, Freeman AR, Arrowood MJ, Escalante M, Weltman AG, Ong GSL, MacKenzie WR, La! M, Beard GB. Genetic polymorphism among Cryptosporidium parvum isolates: evidence of two distinct human transmission cycles. Emerg. Infect. Dis. 1997;3:567-573

3

41

Appendix 3 Sending form

Cryptosporidium Reference Unit Swansea Public Health Laboratory Singleton Hospital Swansea SA2 8QA

For CRU use: Ref. number

DX 6070300 Swansea 90 SA

Telephone 01792 285341

A CPA accredited laboratory

Date received by CRU (dd/mm/yy)

Your name and laboratory address: Patient details: Your specimen number First name Surname Address Specimen collection date (dd/mm/yy) / / Post code Date sent to CRU / /

Date of birth (dd/mm/yy)

/ / Age Sex M F

Clinical details and diagnosis: Date of onset (dd/mm/yy)

/ /

Duration (days)

Type of incident Sporadic Outbreak I log number

Recent foreign travel Yes / No Details

Other exposures or risk factors?

Referral of clinical specimens to PHLS Cryptosporidium Reference Unit for:

!"Confirmation by microscopy !"Urgent genotyping (eg. Outbreak / cluster identification)

!"Detection by PCR Specimen type (eg faeces, sputum)

!"Reference genotyping

42

Appendix 4

Updates and covering letters to sending laboratories

Molecular typing and enhanced surveillance of Cryptosporidium infection. Update report from the Cryptosporidium Reference Unit, Swansea PHL , June 2001

Introduction Between February 2000 and the end of March 2001 some 3500 Cryptosporidium isolates were submitted to the Cryptosporidium Reference Unit, Swansea PHL and genotyped to support this collaborative study. This includes isolates from human sporadic cases, outbreaks, screening programmes for immunocompromised patients and environmental samples in support of outbreak/cluster investigations. All isolates in this study contribute to the National Collection of Oocysts, where isolates from England, Wales and Scotland, are collected and prepared under a common protocol. Samples from Ireland and other countries are also being tested. Methods We have used PCR RFLP targeting the COWP and TRAP C2 genes to identify C. parvum genotypes 1, 2 and (more rarely) unusual or novel species and genotypes. Genotype 1 has a host range largely limited to humans and is indicative of a human source of infection. Genotype 2 has a broader host range of humans and animals. We are now evaluating other, more discriminatory, PCR-based sub-typing methods, including microsatellite markers, with colleagues in Scotland and Australia, aiming to develop epidemiologically useful typing schemes for Cryptosporidium. Investigation of animal isolates also supports this. Progress and preliminary analysis to date We are currently “cleaning” our ever-growing existing database by gathering missing data on age, gender, location and so on by approaching local laboratories and regional CDSC units. However, preliminary analysis of the sporadic cases in the database shows that very slightly more isolates from England and Wales contain C. parvum genotype 1 than genotype 2. There is geographical variation with genotype 1 predominating in the Eastern, London, South East and Trent Regional Health Authorities and genotype 2 in Wales. In the North West, Northern and Yorkshire, South West and West midlands the distribution is more equal. The distribution of genotypes is even among males, but genotype 1 was detected slightly more frequently than genotype 2 in females. When data are analysed by age genotype 1 predominates over genotype 2 in both the under 1’s and over 65’s. Seasonal variation occurs, with genotype 1 detected more frequently in autumn and winter and genotype 2 in spring and summer. Additionally, genotype 1 is detected more frequently in those who had travelled than genotype 2. The most population travel destinations among sporadic cases where isolates were sent for genotyping were (in descending order) Majorca, Spain, Pakistan, unknown, Cyprus, India and Menorca. Where next? We are continuing with this study and, in addition to our service provision (see enclosed sheet) would like to carry on receiving as broad a range of isolates as possible, with

43

associated data, from local laboratories. More discriminatory typing methods are being developed and applied to isolates, and show promising results with emerging patterns within the vitally supportive epidemiological data.

Molecular typing and enhanced surveillance of Cryptosporidium infection.

Update report from the Cryptosporidium Reference Unit, Swansea PHL, April 2002

Introduction Since February 2000 over 5000 Cryptosporidium isolates have been sent to the PHLS Cryptosporidium Reference Unit, Swansea PHL and genotyped to support this collaborative study. This includes isolates from human sporadic cases, outbreaks, screening programmes for immunocompromised patients and environmental samples in support of outbreak/cluster investigations. All isolates in this study contribute to the National Collection of Oocysts, where isolates from England, Wales and Scotland, are collected and prepared under a common protocol. Samples from Ireland and other countries have also been tested. Methods We have used PCR RFLP targeting various genes including the Cryptosporidium Oocyst Wall Protein, small-subunit rRNA, 70-kDa heat shock protein and thrombospondin-related adhesive protein gene loci to identify C. parvum genotypes 1, 2 and (more rarely) unusual or novel species and genotypes. Genotype 1 has a host range largely limited to humans and is indicative of a human source of infection. Genotype 2 has a broader host range of humans and animals. We are now evaluating other, more discriminatory, PCR-based sub-typing methods, including microsatellite markers, single strand conformation polymorphisms and sequence-based methods with colleagues in Scotland, Australia and USA, to develop and apply epidemiologically useful typing schemes for Cryptosporidium. Investigation of animal and environmental isolates also supports this. The latest key findings Analysis of the sporadic cases in the database has shown that during 2001, when the number of Cryptosporidium reports to CDSC dropped by 40%, there was a distinct change in the predominance of genotypes. The most dramatic change has been the decrease in the proportion of cases with genotype 2 infections. This has been particularly noticeable in the North West of England and is subject to further investigation. Reasons for the change are unknown but could be linked to the epidemic of Foot and Mouth Disease last year, during which people were excluded from the countryside, which may have changed patterns of exposure to Cryptosporidium. We also continue to identify a small number of cases of C. meleagridis and more rarely other species of Cryptosporidium. Interestingly, these occur in otherwise healthy patients as well as those known to be immunocompromised. This is important since it shows that such isolates are circulating in the community.

44

Appendix 5 Distribution of Cryptosporidium species and genotypes in the national collection of oocysts

Cryptosporidium genotyping result

All confirmed isolates n = 5001

Outbreak isolates n = 327

Non-outbreak isolates n = 4674

Other (not multually exclusive) sample sets

Immuno-compromised patients n=46

Hospitalised patients n=62

Non-outbreak isolates - reporting foreign travel n=516

C. parvum gt1 2515 (50%)

114 (35%)

2401 (51%)

20 (43%)

27 (44%)

376 (73%)

C. parvum gt2 2250 (45%)

210 (64%)

2040 (44%)

16 (35%)

28 (45%)

98 (19%)

C. meleagridis 38 (1%)

0 38 2 1 14

C. felis 3 0 3 1 0 0 C. canis 1 0 1 0 0 0 Unidentified Cryptosporidium spp. or genotype

20 0 20 0 1 3

Equivocal PCR results

19 0 19 1 0 0

No PCR product

155 3 152 6 5 25

Total 5001 327 4674 46 62 516

45

Appendix 6

The distribution of Cryptosporidium genotypes among isolates from patients who reported recent foreign travel Location Individual countries Total

number of isolates

C. parvum genotype 1

C. parvum genotype 2

Other Cryptosporidium spp

No PCR product

Europe Albania, Crete, Cyprus, Denmark, Eire, France, Greece and the Greek Islands, Greenland, Holland, Malta, Portugal, Spain and the Spanish Islands, Turkey

298 240 (81%)

44 (15%)

4 (1%) 10 (3%)

Indian subcontinent

Bangladesh, India, Nepal, Pakistan

87 59 (68%)

12 (14%)

9 (10%) 7 (8%)

Asia and far east

Bali, China, Dubai, Saudi Arabia, Thailand

11 2 (18%) 4 (36%) 3 (27%) 2 (18%)

Africa Egypt, Ethiopia, Gambia, Ghana, Kenya, Malawi, Nigeria, Somalia, South Africa, Sudan, Tanzania, Tunisia, Zimbabwe

45 26 (58%)

16 (36%)

1 (2%) 2 (4%)

Central and South American and the Caribbean

Brazil, Carribean Island Cruise, Chile, Cuba, Dominican Republic, Equador, Guatemala, Jamaica, Mexico, Peru, Venezuela

29 18 (62%)

7 (24%) 0 (0%) 4 (14%)

Antipodes Australia

1 0 1 0 0

North America

USA 5 3 2 0 0

Mixed locations

Various 5 3 2 0 0

Not known Not known

35 25 10 0 0

All countries

All countries 516 376 98 17 25

46

Appendix 7

Outbreaks of cryptosporidiosis in patients tested by laboratories in England and Wales January 2000 to July 2002 CDSC ref. no.

Health Authority

Region

Year Month Vehicle / route Cases ill (lab. conf)

Faecal specimens

received and confirmed

by CRU

C. parvum genotype

(no. typed) 00/219 North West 2000 March Municipal drinking

water supply 58 (58) 47 (46) 2

00/413 North West 2000 May Municipal drinking water supply

130 (129) 13 type 1 116 type 2

00/406 Trent 2000 May/ June

Public swimming pool

41 (41) 34 (34) 2

00/440 South West 2000 May/ June

Farm holiday center / PWS

8 (3) 3 (3) 2

~ London 2000 July/ Aug

Club swimming pool

9? 7 (7) 6 type 1 1 type 2

~ Mallorca

2000 Summer Hotel swimming pool

>250 49 (48) 1

00/723 London

2000 July / August

Public swimming pool

5 (5) 1 (1) 1

00/656 London

2000 Sept Public swimming pool

10 (10) 10 (10) 1

00/870 South West

2000 Sept Public swimming pool

12 (7) 1 (1) 2

00/806 London 2000 Oct Day care nursery

14 (14) 1

00/972 South West 2000 Oct/ Nov

Club swimming pool

5 (5) (5) 5 4 type 1 1 type2

01/347 South East

2001 June School swimming pool

152* (8) 5 (5) 1

01/440 South West 2001 August Environmental contact

14 5 (5) 3 type 2, 2 type 1

01/442 South East

2001 Sept Day care nursery

? (7) 8 (8) 1

01/528 South West

2001 Oct/ Nov

Club swimming pool

3 3 (3) 1

02/018 North West

2002 March College PWS 50** (1) 1 (1) 2

~ Wales

2002 May PWS/farm/person to person

4 (4) 4 (4) 2

Total 327 (324)

*concurrent community outbreak of NLV may account for a proportion of cases. **outbreak of diarrhoea and vomiting. 1 Cryptosporidium case and 1 Campylobacter case confirmed. PWS = Private water supply

47

Appendix 8 Distribution of Cryptosporidium genotypes in non-outbreak isolates in England and Wales by sex C. parvum

genotype 1 C. parvum genotype 2

Other Cryptosporidium spp / genotypes

Total

Male

1149 (51%) 983 (43%) 128 (6%) 2260

Female

1240 (52%) 1050 (44%) 102 (4%) 2392

NK

12 (54%) 7 (32%) 3 (14%) 22

Total 2401 (51%) 2040 (44%) 233 (5%) 4674

48

Appendix 9

Distribution of Cryptosporidium genotypes in non-outbreak isolates in England and Wales by age Age group C. parvum

genotype 1 C. parvum genotype 2

Other cryptosporidia

Total

<1 year 101 (64%) 49 (31%) 8 (5%) 158

1 to 4 years 681 (48%) 691 (49%) 40 (3%) 1412

5 to 14 years 643 (51%) 562 (45%) 53 (4%) 1258

15 to 44 years 767 (53%) 585 (40%) 99 (7%) 1451

45 to 64 years 133 (49%) 114 (42%) 24 (9%) 271

>64 years 49 (56%) 33 (38%) 6 (7%) 88

Age not known 27 (75%) 6 (16%) 3 (8%) 36

All ages 2401 (51%) 2040 (44%) 233 (35%) 4674

49

Appendix 10 Distribution of Cryptosporidium genotypes in non-outbreak isolates in England and Wales by year Specimen Year

C. parvum genotype 1

C. parvum genotype 2

Other cryptosporidia

Total

2000

1226 (52%) 1050 (44%) 89 (4%) 2365

2001

900 (57%) 561 (36%) 106 (7%) 1567

To July

2002

275 (37%) 429 (58%) 38 (5%) 742

50

Appendix 11 Distribution of Cryptosporidium parvum genotypes 1 and 2 in England and Wales during 2000, 2001 and to the end of July 2002

0

50

100

150

200

250

300

350

400

450

Jan-

00Fe

b-00

Mar

-00

Apr

-00

May

-00

Jun-

00Ju

l-00

Aug

-00

Sep-

00O

ct-0

0N

ov-0

0D

ec-0

0Ja

n-01

Feb-

01M

ar-0

1A

pr-0

1M

ay-0

1Ju

n-01

Jul-0

1A

ug-0

1Se

p-01

Oct

-01

Nov

-01

Dec

-01

Jan-

02Fe

b-02

Mar

-02

Apr

-02

May

-02

Jun-

02Ju

l-02

Month by specimen date

Num

ber o

f iso

late

s

Genotype 2Genotype 1

51

Appendix 12 Seasonal distribution of foreign travel-related Cryptosporidium parvum genotypes in England and Wales

0

50

100

150

200

250

300

350

Jan-

00Fe

b-00

Mar

-00

Apr

-00

May

-00

Jun-

00Ju

l-00

Aug

-00

Sep-

00O

ct-0

0N

ov-0

0D

ec-0

0Ja

n-01

Feb-

01M

ar-0

1A

pr-0

1M

ay-0

1Ju

n-01

Jul-0

1A

ug-0

1Se

p-01

Oct

-01

Nov

-01

Dec

-01

Jan-

02Fe

b-02

Mar

-02

Apr

-02

May

-02

Jun-

02Ju

l-02

Month by specimen date

Num

ber o

f iso

late

s

Reportingforeign travelNot reportingforeign travel

0

50

100

150

200

250

300

350

Jan-

00Fe

b-00

Mar

-00

Apr

-00

May

-00

Jun-

00Ju

l-00

Aug

-00

Sep-

00O

ct-0

0N

ov-0

0D

ec-0

0Ja

n-01

Feb-

01M

ar-0

1A

pr-0

1M

ay-0

1Ju

n-01

Jul-0

1A

ug-0

1Se

p-01

Oct

-01

Nov

-01

Dec

-01

Jan-

02Fe

b-02

Mar

-02

Apr

-02

May

-02

Jun-

02Ju

l-02

Month by specimen date

Num

ber o

f iso

alte

s

Reporting foreigntravelNot reportingforeign travel

C. parvum genotype 1

C. parvum genotype 2

52

Appendix 13 The epidemiological distribution of Cryptosporidium parvum genotypes 1 and 2 in England and Wales during 2000, 2001 and to the end of July 2002. Year

2000 2001 To end of July 2002 C. parvum

genotype 1

C. parvum genotype 2

C. parvum genotype 1

C. parvum genotype 2

C. parvum genotype 1

C. parvum genotype 2

Sex Male

554/1109 (50%)

504/1109 (45%)

453/794 (57%)

285/794 (36%)

142/357 (40%)

194/357 (54%)

Female

667/1247 (53%)

544/1247 (44%)

443/765 (58%)

273/765 (36%)

130/380 (34%)

233/380 (61%)

Not known

5/9 (56%)

2/9 (22%)

4/8 (50%)

3/8 (38%)

3/5 (60%)

2/5 (40%)

Age <1 46/74

(62%) 24/74 (32%)

40/62 (65%)

19/62 (31%)

15/22 (68%)

6/22 (27%)

1 to 4 371/762 (49%)

376/762 (49%)

242/452 (54%)

190/452 (42%)

68/198 (34%)

125/198 (63%)

5 to 14 353/672 (53%)

294/672 (44%)

234/411 (57%)

154/411 (37%)

56/175 (32%)

114/175 (65%)

15-44 356/677 (52%)

287/677 (42%)

313/514 (61%)

160/514 (31%)

98/260 (38%)

138/260 (53%)

45-64 53/110 (48%)

50/110 (45%)

50/93 (54%)

29/93 (31%)

30/68 (44%)

35/68 (51%)

>64 24/41 (59%)

14/41 (34%)

17/28 (60%)

8/28 (29%)

8/19 (42%)

11/19 (58%)

NK 23/29 (79%)

5/29 (17%)

4/7 (57%)

1/7 (14%)

0/0 0/0

Month Jan 3/ 4

(75%) 1/ 4 (25%)

40/74 (54%)

30/74 (41%)

80/110 (73%)

17/110 (15%)

Feb 8/32 (25%)

21/32 (66%)

25/61 (41%)

32/61 (52%)

50/87 (57%)

35/87 (40%)

March 25/104 (24%)

73/104 (70%)

13/61 (21%)

46/61 (75%)

49/91 (54%)

39/91 (43%)

April 15/107 (14%)

85/107 (79%)

11/84 (13%)

66/84 (79%)

40/150 (27%)

102/150 (68%)

May 35/261 (13%)

220/261 (84%)

14/85 (16%)

65/85 (76%)

16/95 (17%)

73/95 (77%)

June 41/223 (18%)

179/223 (80%)

14/48 (29%)

31/48 (65%)

15/130 (12%)

113/130 (87%)

July 51/129 (40%)

76/129 (59%)

21/50 (42%)

25/50 (50%)

25/79 (32%)

50/79 (63%)

August 162/241 (67%)

74/241 (31%)

82/154 (53%)

54/154 (35%)

September 315/440 (72%)

102/440 (23%)

239/329 (73%)

63/329 (19%)

October 286/390 (73%)

91/390 (23%)

192/262 (73%)

53/262 (20%)

November 207/309 90/309 160/232 64/232

53

(67%) (29%) (50%) (20%) December 78/125

(62%) 38/125 (30%)

89/127 (70%)

32/127 (25%)

Region Eastern 120/207

(58%) 81/207 (39%)

135/179 (75%)

32/179 (18%)

46/78 (59%)

26/78 (33%)

London 67/84 (80%)

14/84 (16%)

34/54 (63%)

13/54 (24%)

4/7 (57%)

2/7 (29%)

North West

335/675 (50%)

326/675 (48%)

186/314 (59%)

109/314 (35%)

118/295 (40%)

160/295 (54%)

Northern and Yorkshire

86/173 (50%)

79/173 (46%)

62/105 (59%)

31/105 (30%)

13/47 (28%)

32/47 (68%)

South East

83/115 (72%)

29/115 (25%)

130/174 (75%)

33/174 (19%)

28/62 (45%)

30/62 (48%)

South West

186/431 (43%)

231/431 (54%)

103/243 (42%)

125/243 (51%)

14/63 (22%)

47/63 (75%)

Trent 170/258 (66%)

72/258 (28%)

99/172 (58%)

59/172 (34%)

31/70 (44%)

36/70 (51%)

Wales 99/261 (38%)

145/261 (56%)

85/194 (44%)

100/194 (52%)

11/83 (13%)

71/83 (86%)

West Midlands

80/161 (50%)

73/161 (45%)

66/132 (50%)

59/132 (45%)

10/37 (27%)

25/37 (68%)

Reported foreign travel

No 1020/2097 (49%)

1003/2097 (48%)

760/1377 (55%)

530/1377 (38%)

245/684 (36%)

409/684 (60%)

Yes 206/268 (77%)

47/268 (18%)

140/190 (74%)

31/190 (16%)

30/58 (52%)

20/58 (34%)

Total 1226/2365

(52%) 1050/2365 (44%)

900/1567 (57%)

561/1567 (36%)

275/742 (37%)

429/742 (58%)

54

Appendix 14 Geographical distribution of Cryptosporidium parvum genotypes in England and Wales during 2000 and 2001 Regions with equal distribution of genotypes

Regions with more C. parvum genotype 1 than 2

Regions with more C. parvum genotype 2 than 1

2000 2001 2000 2001 2000 2001 North West Northern and Yorkshire

Eastern London South East Trent West Midlands

Eastern London North West Northern and Yorkshire South East Trent West Midlands

South West Wales

South West Wales

55

APPENDIX 15

Micro and minisatellite markers used for analysis

Marker Repeat No of alleles

TP14 (CAA)22 5

MS5 (CCTCCCTCAGCTCCTCCGACTGCA)7 10

MS9 (TGGATC)25 7

MS12 (CCAACAACCACTTCTACAACTGGAAAT)15 3

ML1 (GAG)30 4

MS1 (GGTGGTATGCCA)11 5

GP15 (TCA)25 13

The sequences of the primers used for amplification were as follows:

MS1 1B-5’AATTAGTCGACCTCTCAACAGTTGG-3’

and 1D-5’GGAACACCATCCAAGAACCAAAGGT-3’

TP14 14C-5’CTAACGTTCACAGCCAACAGTACC-3’

and 14D-5’GTACAGCTCCTGTTCCTGTTG-3’

MS9 9C-5’GGACTAGAAATAGAGCTTTGGCTGG-3’

and 9D-5’ GTCTGAGACAGAATCTAGGATCTAC-3’

MS5 5A-5’GCATGTAGTCGTATCCGGAAC-3’

and 5B-5’GTATGCTGGGGAATATAGCCAAG-3’

GP15 15A-5’GCCGTTCCACTCAGAGGAAC-3’

and 15E-5’ CCACATTACAAATGAAGTGCCGC-3’

MS12 12F-5’ TGGACTCAGACTCAAGGGAGACCAAACACTACC-3’

and 12B-5’ CTAACGAAACTGCATATTTTGGTGG-3’

56

APPENDIX 16

Allele sizes and the numbers allocated for each of the 7 micro- and minisatellite markers.

N.A: no amplification product. The TP14 allele sizes correspond to primers CB

(24bp<CD) and the GP15 alleles to primers AE (60bp<AI).

MARKER ALLELE ALLELE NO. MARKER ALLELE ALLELE NO.

MS 1 352bp 1 ML 1 220bp 1

355bp 2 223bp 2

364bp 3 226bp 3

376bp 4 229bp 4

388bp 5 238bp 5

400bp 6 N.A. 6

328bp 7

TP 14 234bp 1 MS 12 544bp 1

254bp 2 571-4bp 2

260bp 3 665bp 3

291bp 4 N.A. 4

300bp 5 568bp 5

309bp 6

GP 15 273bp 1 MS 9 303bp 1

312bp 2 375bp 2

327bp 3 385bp 3

330bp 4 432bp 4

333bp 5 450bp 5

336bp 6 456bp 6

339bp 7 462bp 7

342bp 8 522bp 8

345bp 9 528bp 9

57

366bp 10 433bp 10

396bp 11

411bp 12 MS 5 181bp 1

435bp 13 262bp 2

456bp 14 277bp 3

N.A. 15 286bp 4

366bp 16 301bp 5

384bp 17 304bp 6

411bp 18 10bp 7

414bp 19 325bp 8

417bp 20 328bp 9

349bp 10

352bp 11

N.A. 12

323bp 13

58

APPENDIX 17

Multilocus genotypes (MLG’s) identified for all samples analysed, together with the

corresponding COWP/18S genotype. Type 2 refers to the C. parvum bovine genotype;

Type 1 C. parvum to the human genotype and monkey genotype refers to the genotype

described by Xiao et al (1999). A, T O & D are different regions in Scotland; Bold-area

common; * Only region A sampled; ! - most common genotypes

MLG MS1 MS9 TP14 MS5 GP15 ML1 MS12 Species/Genotype Area

1 1 1 1 12 1 6 4 C. meleagridis A

2 1 8 4 4 5 3 2 Type 2 A

3 1 9 4 2 5 3 2 Type 2 A

4 3 4 5 9 4 5 2 Type 2 A

5 3 4 5 9 6 5 2 Type 2 A

6! 3 5 5 9 5 5 2 Type 2 A, O, T, D

7 3 5 5 9 5 5 1 Type 2 A, O, T. D

8! 3 5 5 9 6 5 2 Type 2 A, O, T, D

9 3 5 5 9 6 5 1 Type 2 A, O, T, D

10 3 5 5 9 7 5 2 Type 2 A, D

11 3 5 5 9 8 5 2 Type 2 A, D

12 3 5 5 9 9 5 1 Type 2 A

13 3 5 5 11 5 5 2 Type 2 A

14 3 5 5 6 6 5 2 Type 2 A

15 3 7 5 9 5 2 2 Type 2 A

16 5 7 5 9 5 5 1 Type 2 A

17 3 4 6 7 6 2 2 Type 2 A

18 3 4 6 9 2 2 2 Type 2 A

19 3 4 6 9 3 2 2 Type 2 A

20 3 4 6 9 6 2 2 Type 2 A

21 3 4 6 9 8 3 2 Type 2 A

22! 3 5 6 9 5 5 2 Type 2 A, O, T, D

23 3 5 6 9 5 5 1 Type 2 A, D

24 3 5 6 9 6 5 2 Type 2 A, O, T, D

25! 3 5 6 9 6 5 1 Type 2 A, D

26 3 6 6 9 5 5 2 Type 2 A, O, T, D

27 3 6 5 9 6 5 2 Type 2 A, D

28 4 5 5 9 5 5 1 Type 2 A

59

29 4 5 6 9 5 5 1 Type 2 A

30 5 5 5 9 5 5 2 Type 2 A

31 6 5 5 9 5 5 2 Type 2 A

32 4 2 2 5 10 4 3 Type 1 A*

33 4 2 2 8 10 4 3 Type 1 A*

34 4 2 2 3 14 4 3 Type 1 A*

35 4 2 3 8 10 4 3 Type 1 A*

36 4 2 3 8 13 4 3 Type 1 A*

37 4 2 3 8 15 4 3 Type 1 A*

38 4 2 3 10 12 4 3 Type 1 A*

39 2 3 3 1 11 1 2 'monkey' genotype A

40 3 5 5 9 9 5 2 Type 2 O, T

41 3 5 6 9 5 2 2 Type 2 O, T

42 3 5 6 9 7 5 2 Type 2 O, T

43 7 5 5 9 5 5 1 Type 2 O, T

44 3 10 5 9 5 5 1 Type 2 O, T

45 3 10 5 9 5 5 2 Type 2 O, T

46 3 6 5 9 5 5 1 Type 2 D

47 3 5 5 9 3 5 2 Type 2 D

48 3 5 5 9 4 5 2 Type 2 D

49 2 3 3 1 10 1 2 'monkey' genotype D

50 3 7 5 9 6 5 2 Type 2 D

51 3 10 5 4 6 5 2 Type 2 D

52 3 5 6 9 9 5 2 Type 2 D

53 3 4 6 9 17 2 2 Type 2 D

54 3 5 5 9 18 5 2 Type 2 D

55 3 6 5 9 19 5 2 Type 2 D

56 3 5 5 9 20 5 1 Type 2 D

57 1 6 4 2 16 3 5 Type 2 D

58 3 5 5 9 19 5 1 Type 2 D

60

APPENDIX 18

Dendrogram of similarity between multilocus genotypes (H=Human, A=Animal)

1 57 2 3 51 55 4 5 27 50 6 7 8 9 54 48 47 40 10 11 58 12 56 13 14 30 31 15 16 46 44 45 22 23 24 25 42 52 26 41 43 28 29 21 17 20 53 18 19 39 49 34 32 33 38 37 35 36

C. meleagridis

Sub-group 1 (Type 2, H)

Sub-groups 2,3,4 (Type 2, H &A)

Sub-group 5 Type 2, H

Monkey type

Type 1, H

61

APPENDIX 19

Multilocus genotype of human clinical cases of Cryptosporidiosis during the, spring

outbreak, Scotland 2000

��������������������������������

������������

��������������

����������������

������������

C ryp to sp o rid iu m o u tb reak , S co tlan d S p rin g 2000

0

1

2

3

4

5

6

7

8

9

10

1 2 3 4 5 6W eek

M LG 6

M LG 7�������� M LG 9����

M LG 23

M LG 59

62

Appendix 20

Number of samples generating PCR products from each set of microsatellite

primers

number samples positive / number tested

Sample set MS1 MS5 MS9 MS12 TP14 Caccio

Clitheroe outbreak 44/46 45/46 44/46 31/46 29/46 37/46

Open farm outbreak 7/10 8/10 7/10 5/10 6/8 8/10

Middlesex nursery outbreak 14/14 12/14 14/14 12/14 8/13 13/14

Sporadic cases near the nursery 5/5 3/5 3/5 nt nt nt

Foreign travel cases 19/22 15/23 14/23 nt nt nt

TOTAL 89/97

(92%)

83/98

(85%)

82/98

(84%)

48/70

(69%)

43/67

(64%)

58/70

(83%)

Nt = not tested

63

Appendix 21

Number of samples in which microsatellite alleles were identified by Genescan

Number samples analysed by Genescan /

number samples generating PCR products

Sample set MS1 MS5 MS9 MS12 Caccio

Clitheroe outbreak 21/44 23/45 24/44 21/31 22/37

Open farm outbreak 5/7 8/8 7/7 5/5 8/8

Middlesex nursery outbreak 9/14 12/12 11/14 12/12 13/13

Sporadic cases near the nursery 5/5 3/3 3/3 nt nt

Foreign travel cases 13/19 12/15 13/14 nt nt

TOTAL 53/89 58/83 58/82 38/48 43/58

nt = not tested

64

Appendix 22

Microsatellite alleles detected in outbreak and sporadic case sample sets

Sample set MS1 alleles MS5 alleles MS9 alleles MS12 alleles Caccio alleles Clitheroe outbreak

21 samples 18 @ 364 bp 3 @ 363 bp

23 samples 19@ 325 bp 4 @ 326 bp

24 samples 19 @ 447 bp 3 @ 448 bp 2 @ 488 bp

21 samples 2 @ 571 bp 3 @ 572 bp 7 @ 573 bp 3 @ 574 bp 4 @ 575 bp 2 @ 576 bp

22 samples 1 @ 235 bp 19 @ 238 bp 2 @ 239 bp

Open farm outbreak

5 samples 5 @ 364 bp

8 samples 4 @ 325 bp 4 @ 326 bp

7 samples 7 @ 447 bp

5 samples 1 @ 550 bp 1 @ 574 bp 1 @ 578 bp 1 @ 580 bp 1 @ 582 bp

8 samples 1 @ 235 bp 1 @ 238 bp 5 @ 239 bp 1 @ 240 bp

Middlesex nursery outbreak

9 samples 3 @ 375 bp 4 @ 376 bp 2 @ 377 bp

12 samples 12 @ 323 bp

11 samples 11 @ 373 bp

12 samples 3 @ 663 bp 2 @ 664 bp 1 @ 667 bp 2 @ 668 bp 2 @ 669 bp 2 @ 671 bp

13 samples 13 @ 230 bp

Sporadic cases near the nursery

5 samples 3 @ 376 bp 1 @ 377 bp 1 @ 364/377 bp

3 samples 1 @ 323 bp 1 @ 300/326 bp 1 @ 182/277 bp

3 samples: 2 @ 373 bp 1 @ 447 bp

nt nt

Foreign travel cases

13 samples 1 @ 352 bp 1 @ 353 bp 1 @ 364 bp 1 @ 365 bp 6 @ 376 bp 3 @ 377 bp

12 samples 1 @ 323 bp 3 @ 326 bp 1 @ 300/323 bp 1 @ 326/374 bp 1 @ 308/326 bp 1 @ 303/326 bp 2 @ 277/326 bp 2 @ 206/323 bp

13 samples 6 @ 373 bp 1 @ 428 bp 1 @ 446 bp 1 @ 447 bp 2 @ 458 bp 1 @ 490 bp 1 @ 446/458 bp

Nt

nt

65

REFERENCES

Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W and Lipman DJ.

Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.

Nucleic Acids Research 1997; 25: 3389-3402.

Anon. Genotyping Cryptosporidium is an essential addition to microscopy. CDR Weekly

2001; 11: 7-8

Benson, G. 1999. Tandom repeats finder: a program to analyse DNA sequences. Nucleic

Acids Res. 27, 573-580

Caccio S, Homan W, Camilli R, Traldi G, Kortbeek T, Pozio E. 2000. A microsatellite

marker reveals population heterogeneity within human and animal genotypes of

Cryptosporidium parvum. Parasitology 120, 237-44.

Caccio S, Spano F, Pzio E. 2001. Large sequence variation at two microsatellite loci

among zoonotic (genotype C) isolates of Cryptosporidium parvum. Int. J. Parasitol.

31,1082-1086.

Casemore DP. Broadsheet 128: Laboratory methods for diagnosing cryptosporidiosis.

Journal of Clinical Pathology 1991; 44: 445-51.

Casemore DP and Jackson FB. 1984. Hypothesis: cryptosporidiosis in human beings in

not primarily a zoonosis. J. Infect. 9, 153-6.

Chalmers RM, Elwin K, Reilly WJ, Irvine H, Thomas A and Hunter PR. 2002.

Cryptosporidium in farmed animals: the detection of a novel isolate in sheep. Int. J.

Parasitol. 32,21-26.

66

Dean AD, Dean JA, Burton AH and Dicker RC. EpiInfo, Version 5: a word processing

database and statistic program for epidemiology on microcomputers. USD Incorporated,

Stone Mountain, Georgia, 1990.

Elwin K, Chalmers RM, Roberts R, Guy EC, Casemore DP. The modification of a rapid

method for the identification of gene-specific polymorphisms in Cryptosporidium

parvum, and application to clinical and epidemiological investigations. App Env

Microbiol 2001; 67: 5581-5584.

Haubold B and Hudson RR. 2000. LIAN version 3: a program for detecting linkage

disequilibrium in multilocus data. Bioinformatics 16,847-848.

Jaccard P. 1908, Nouvelles recherché sur la distribution florale. Bull. Soc. Vaudoise Sci.

Nat. 44, 223-270.

Khramtsov NV, Tilley M, Blunt DS, Montelone BA and Upton SJ. 1995. Cloning and

analysis of a Cryptosporidium parvum gene encoding a protein with homology to

cytoplasmic form HSP70. J. Euk. Microbiol. 42,416-422.

MacLeod A, Tweedie A, Welburn SC, Maudlin I, Turner CMR and Tait A. 2000.

Minisatellite marker analysis of Trypanosoma brucei: Reconciliation of clonal,

panmictic, and epidemic population genetic structures. Proc. Natl. Acad. Sci. 97, 13442-

13447.

Mallon M, Wastling J, Smith HV, Reilly W.and Tait A. (2002) submitted

Maynard-Smith J, Smith NH, O’Rourke M and Spratt BG (1993) How clonal are

bacteria? Proc. Natl. Acad. Sci. 90, 4384-4388

67

Morgan UM, Constantine CC, Forbes DA and Thompson RC. (1997). Differentiation

between animal and human isolates of Cryptosporidium parvum using rDNA sequencing

and direct PCR analysis. J. Parasitol.83, 825-30.

Nei M. 1978, Estimation of average heterozygosity and genetic distance from a small

number of organisms. Genetics. 89, 583-590

Nichols RAB and Smith HV. 2002. Optimising DNA extraction for molecular detection

of Cryptosporidium oocysts in natural mineral water sources and human faeces. Mol.

Diagnostics (in press).

Ryley JF, Meade R, Hazelhurst J and Robinson TE. Methods in coccidiosis research:

separation of oocysts from faeces. Parasitology 1976; 73: 311-326.

Slavin D. 1955. Cryptosporidium meleagridis (sp. nov.). J. Comp. Pathol. 65, 262-266.

Smith HV and Rose JB. (1998). Waterborne Cryptosporidiosis: current status. Parasitol.

Today 14, 14-22.

Spano F, Putignani L, McLauchlin J, Casemore DP and Crisanti A. 1997. PCR-RFLP

analysis of the Cryptosporidium oocyst wall protein (COWP) gene discriminates between

C. wrairi and C. parvum, and between C. parvum isolates of human and animal origin.

FEMS Microbiol. Lett. 150,209-217.

StataCorp. 1999. Stata Statistical Software: Release 6.0. College Station, Texas: Stata

Corporation.

Strong WB, Gut J and Nelson RG. (2000). Cloning and sequence analysis of a highly

polymorphic Cryptosporidium parvum gene encoding a 60-kilodalton glycoprotein and

characterisation of its 15- and 45- kilodalton zoite surface antigen products. Infect.

Immun. 68, 4117-4134.

68

Xiao L, Morgan UM, Limor J, Escalante A, Arrowood M, Shulaw W, Thompson RC,

Fayer R and Lal AA. 1999. Genetic diversity within Cryptosporidium parvum and related

Cryptosporidium species. Appl. Environ. Microbiol. 65,3386-91.