the global evolution and adaptation of vibrio cholerae across multiple niche dimensions rob edwards...
TRANSCRIPT
![Page 1: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/1.jpg)
![Page 2: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/2.jpg)
The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob
Edwards
Flinders2015
![Page 3: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/3.jpg)
How to annotate a coupleof hundred genomes
RobEdwards
Flinders2015
![Page 4: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/4.jpg)
Annotation of microbial genomesand comparison across differences
Cholerae Haiti Genome Sequencing ORF Calling Annotation Global evolution Niche dimensions
![Page 5: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/5.jpg)
Cholera is caused by Vibrio cholerae
![Page 6: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/6.jpg)
About 3-5 million cases per year
About 100 - 200,000 deaths world wide per year
Notable deaths: Tchaikovsky Polk (11th President USA)
A world wide pandemic
![Page 7: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/7.jpg)
About 75% of patients have no symptoms
25-50 PINTS of diarrhea per DAY
Severe symptoms are by dehydration
Treatment
Clean water
Electrolytes
Vaccine
Not antibiotics
Symptoms
![Page 8: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/8.jpg)
1st – 1817 to 1823 Started at the Ganges, spread by colonialists
2nd – 1829 to 1849 Worldwide spread via immigrants
3rd – 1852 to 1859 John Snow first epidemiologist
Multiple Pandemics
![Page 9: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/9.jpg)
John Snow
Portrait painted in
1847 when he was
34 years old.
First epidemiological study
![Page 10: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/10.jpg)
John Snow
Cholera outbreak in Soho, London 1854
Plotted all cases on a map
Found big cluster around water well
First epidemiological study
![Page 11: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/11.jpg)
John Snow’s Map
First epidemiological study
![Page 12: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/12.jpg)
On the mode of communication
of Cholera
1854
![Page 13: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/13.jpg)
Cholera caused by bacteria
Outbreaks of cholera
![Page 14: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/14.jpg)
1st – 1817 to 1823 Started at the Ganges, spread by colonialists
2nd – 1829 to 1849 Worldwide spread via immigrants
3rd – 1852 to 1859 John Snow first epidemiologist
4th – 1863 to 1879 Originated in mecca
5th – 1881 to 1896 First cholerae vaccine (1892)
6th – 1899 to 1923 Killed 800,000 people
7th – 1961 to present 1991: South America killed > 100,000
people
Multiple Pandemics
![Page 15: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/15.jpg)
Earthquake Jan 12th, 2010
No cholera in Haiti for > 50 years
First case, October 22nd, 2010
By February, 2011 250,000 cases and ~5,000 deaths
What was the original source?
Haitian Outbreak
![Page 16: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/16.jpg)
http://www.ph.ucla.edu/
Haitian cholera outbreaks
![Page 17: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/17.jpg)
Source: Final Report of the Independent Panel of Experts on the Cholera Outbreak in Haiti
![Page 18: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/18.jpg)
Cases by day – Mirebalais Hospital
![Page 19: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/19.jpg)
Cases by Age – St Marc HospitalOn October 20th, 2010
![Page 20: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/20.jpg)
Two hypotheses:
Endemic, waterborne strain that has been in Haiti but not caused disease for 50 years
Imported from another country
Haitian Outbreak
![Page 21: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/21.jpg)
"They have been fortunate in Haiti that for 50 years the conditions have been such that they haven’t had an intense increase in cholera bacterial populations. ... But they’ve had an earthquake, they’ve had destruction, they’ve had a hurricane ... I think it’s very unfortunate to look for a scapegoat. It is an environmental phenomenon that is involved”
Rita ColwellJohns Hopkins School of Public Health
The environmental hypothesis
![Page 22: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/22.jpg)
“The organism that is causing the disease is very uncharacteristic of (Haiti and the Caribbean), and is quite characteristic of the region from where the soldiers in the base came. ... I don't see there is any way to avoid the conclusion that an unfortunate and presumably accidental introduction of the organism occurred."
John MekalanosHarvard Medical School
The human hypothesis
![Page 23: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/23.jpg)
Source: Final Report of the Independent Panel of Experts on the Cholera Outbreak in Haiti
Conditions favor human hypothesis
![Page 24: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/24.jpg)
Conditions favor human hypothesis
Source: Final Report of the Independent Panel of Experts on the Cholera Outbreak in Haiti
![Page 25: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/25.jpg)
Conditions favor human hypothesis
Source: Final Report of the Independent Panel of Experts on the Cholera Outbreak in Haiti
![Page 26: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/26.jpg)
Global evolution of Vibrio
Can we use genomics to identify the global evolution of Vibrio?
Which gene(s) are important for temporal/spatial variation?
![Page 27: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/27.jpg)
Prototype Vibrio cholerae
sequence
TIGRNature 406, 477-483(3 August 2000)
![Page 28: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/28.jpg)
Sequenced genomes
2011 – 32 Vibrio strains sequenced
![Page 29: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/29.jpg)
Fabiano Thompson's Lab @ UFRJ
![Page 30: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/30.jpg)
Fundação Oswaldo Cruz
![Page 31: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/31.jpg)
![Page 32: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/32.jpg)
Ion quality scores
![Page 33: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/33.jpg)
Sequenced genomes
2011 – 32 Vibrio strains sequenced
2011 – 171 Vibrio strains sequenced
![Page 34: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/34.jpg)
How do you analyze 250+ genomes?
![Page 35: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/35.jpg)
The steps in genome sequencing
Generate genome sequence Assembly ORF calling tRNA identification rRNA identification Functional annotation
![Page 36: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/36.jpg)
www.sigmaaldrich.com
![Page 37: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/37.jpg)
Putative protein
Open Reading Frame (ORF)
A stretch of amino acids with no stop codon
Coding Sequence (CDS) An ORF that could encode a protein
Protein encoding gene (PEG) An ORF that could encode a protein
Hypothetical protein = putative protein
Something that has not been experimentally shown
Polypeptide
Short stretch of ~50 amino acids. Often a domain
![Page 38: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/38.jpg)
Reads per chromosome (Chr. I)
![Page 39: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/39.jpg)
Reads per chromosome (Chr. II)
![Page 40: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/40.jpg)
Cholera Toxin Phage
![Page 41: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/41.jpg)
Assembly
![Page 42: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/42.jpg)
ORF Calling
![Page 43: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/43.jpg)
Annotation
![Page 44: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/44.jpg)
Annotated Vibrio using RAST
![Page 45: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/45.jpg)
Single nucleotide polymorphisms
ATCATCGATCAGCATGCATCAGCATCGATCAGCATCATCGATCAGCATGCATCAGCATCGATCAGCATCATCGATCAGCATGCATCAGCCTCGATCAGCATCATCGATCAGCATGCATCAGCCTCGATCAGCATCATCGATCAGCAAGCATCAGCCTCGATCAGCATCATCGATCAGCAAGCATCAGCCTCGATCAGCATCATCGATCAGCAAGCATCAGCCTCGATCAGCATCATCGATCAGCAAGCATCAGCCTCGAGCAGCATCATCGATCAGCAAGCATCAGCCTCGAGCAGC
![Page 46: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/46.jpg)
Global evolution
Mutreja et al 2011
![Page 47: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/47.jpg)
Mutreja et al 2011
Waves of spread of cholera
![Page 48: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/48.jpg)
Mutreja et al 2011
Different evolution for each wave
![Page 49: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/49.jpg)
On the source of Haitian cholera
Cholerae
Mimicus
Parahemolyticus
Harveyi
Vibrio cholerae from Bangladesh in 1994 Vibrio cholerae from Haiti in 2010 Vibrio cholerae from Bangladesh in 2002 Vibrio cholerae from Haiti in 2010 Vibrio cholerae from Haiti in 2010
![Page 50: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/50.jpg)
Outbreak in Khatmandu, Nepal before the soldiers left
Outbreaks downstream (not upstream) along the river from the nepalese UN camp
But that could have come from river trade. Ships used to fly the yellow flag when they were quarantined by cholera
Nepalese soldiers?
![Page 51: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/51.jpg)
http://www.ph.ucla.edu/
Haitian cholera outbreaks
![Page 52: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/52.jpg)
Conservation of the ~120 kb superintegron region across 210 strains
Evolution not only by SNPs
![Page 53: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/53.jpg)
Mother
Daughter Daughter
SNPs HGT
Horizontal gene transferversus
Vertical evolution
![Page 54: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/54.jpg)
210 Vibrio genomes
Reassembled
Reannotated
Find interesting genes!
Year Continent Country Lat/Lon
Coordinates Clinical or
Environmental Source Serogroup Serotype Biotype Mutreja wave
Niche dimensions
![Page 55: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/55.jpg)
Serogroup
Vibrio cholerae
Non-cholera toxin
No disease
Cholera toxin
O1 O139
ClassicalEl Tor
Ogawa Inaba
Epidemics
Biotype
Serotype
V. cholerae classification
![Page 56: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/56.jpg)
15,000 genes in the pangenome
933 subsystems (pathways) present in at least one genome
SNPs (after Mutreja)
Response variables
![Page 57: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/57.jpg)
Recreate evolution of the Vibrios
What are the important genes for each niche dimension
Who, what, when, where!
Use random forests to identifyimportant variables
Analysis
![Page 58: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/58.jpg)
O-antigenExopoly-
saccharideCapsule Sialic Acid
DNA recomb.
01 10 20 5 10
01 10 20 5 10
01 10 20 5 10
0139 100 1 8 10
0139 100 1 8 10
0139 100 1 8 10
0139 100 1 8 10
Random Forest
![Page 59: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/59.jpg)
O139O1
Exopoly-saccharide
<50
Random Forest
O1 O139
DNA-recombination
10
O1 O139
Capsule
<10
![Page 60: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/60.jpg)
Random Forest
Each tree votes on the importance of each variable.
Typically, run 10,000 trees
![Page 61: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/61.jpg)
Responsevariablesand nichedimensions
![Page 62: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/62.jpg)
Genes important for who ?(serogroup)
![Page 63: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/63.jpg)
Genes important for what? (clinical, environmental, ...)
![Page 64: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/64.jpg)
Genes important for where?(continent)
![Page 65: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/65.jpg)
Separation of functions by continent
![Page 66: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/66.jpg)
Genes important for when?(year)
DNA Repair
![Page 67: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/67.jpg)
DNA repair & phages
Normal DNA repair(134 strains)
umuC umuDAdditional DNA repair(4 strains; not O1)
umuCumuDPhage borne DNA repair(72 strains) umuCprophage
![Page 68: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/68.jpg)
Mutreja et al 2011
Waves 2 & 3 have phage Interrupted repair
Different evolution for each wave
![Page 69: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/69.jpg)
Conclusions
Unraveling evolution and spread of new pathogens
Mining genomes and niche dimensions
Don't get scooped!
![Page 70: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/70.jpg)
Multi-genome projects??
![Page 71: The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards Flinders 2015](https://reader035.vdocuments.net/reader035/viewer/2022062222/5697bf9e1a28abf838c945f9/html5/thumbnails/71.jpg)
Organism Number Organism Number
S. pyogenes 3,615 Mycobacterium tuberculosis
390
S. pneumoniae 3,085 Salmonella in cattle and humans
373
Rice (Oryza sativa) 3,000 Vibrio 274
C. elegans 2,007 Shigella sonnei 263
Clostridium difficile 1,250 Mycobacterium tuberculosis
259
The thousand (human) genome project
1,092 Streptococcus pneumoniae
240
Mycobacterium tuberculosis
1,000 Methicillin-resistant Staphylococcus aereus
193
Plasmodium falciparum
825 Campylobacter jejuni
192
Streptococcus pneumoniae
616 Mycobacterium abscessus in CF
170
Nick Loman: http://lab.loman.net/
Current multigenome projects