Toxicology 224 (2006) 44–55

The human apurinic/apyrimidinic endonuclease-1 suppressesactivation of poly(adp-ribose) polymerase-1 induced by

DNA single strand breaks�

Srinivasa R. Peddi a, Ranajoy Chattopadhyay b, C.V. Naidu c, Tadahide Izumi a,∗a Stanley S. Scott Cancer Center and Department of Otolaryngology, 533 Bolivar St. 5th Floor,

Louisiana State University Health Sciences Center, New Orleans, LA 70112, United Statesb Sealy Center for Molecular Science, University of Texas Medical Branch, Galveston, TX 77555, United States

c Department of Biotechnology, S.V. University, Tirupati 517502, India

Received 11 August 2005; received in revised form 31 March 2006; accepted 7 April 2006Available online 27 April 2006

Abstract

DNA single-strand breaks (SSB) activate poly (ADP-ribose) polymerase 1 (PARP1), which then polymerizes ADP-ribosyl groupson various nuclear proteins, consuming cellular energy. Although PARP1 has a role in repairing SSB, activation of PARP1 alsocauses necrosis and inflammation due to depletion of cellular energy. Here we show that the major mammalian apurinic/apyrimidinic(AP) endonuclease-1 (APE1), an essential DNA repair protein, binds to SSB and suppresses the activation of PARP1. APE1’s high

affinity for SSB requires Arg177, which is unique in mammalian APEs. PARP1’s binding to the cleaved DNA was inhibited, andPARP1 activation was suppressed by the wild-type APE1, but not by the R177A mutant APE1 protein. Cells transiently transfectedwith the wild-type APE1 decreased the PARP1 activation after H2O2 treatment, while such suppression did not occur with theexpression of the R177A APE1 mutant. These results suggest that APE1 suppresses the activation of PARP1 during the repairprocess of the DNA damage generated by oxidative stress, which may have an important implication for cells to avoid necrosis dueto energy depletion.© 2006 Elsevier Ireland Ltd. All rights reserved.

Keywords: Oxidative stress; AP endonuclease; PARP1; DNA base excision repair; Necrosis

Abbreviations: AP site, apurinic/apyrimidinic site; APE1, APendonuclease 1; BER, DNA base excision repair; NIR, nucleotide inci-sion repair; PARP1, poly (ADP-ribose) polymerase 1; ROS, reactiveoxygen species; SSB, single-strand break; THF, tetrahydrofuran; WT,wild-type

� This study was supported by NIH (CA98664 to TI and CA53791to SM) and by DOE (DE-FG-03-00ER63041 to WB).

∗ Corresponding author. Tel.: +1 504 568 4785;fax: +1 504 568 4460.

E-mail address: tizumi@lsuhsc.edu (T. Izumi).

1. Introduction

The genomic DNA is continuously attacked by envi-ronmental genotoxicants such as reactive oxygen species(ROS), ionizing radiation, and alkylating reagents. ROSare also generated endogenously in cells by cellu-lar metabolisms, e.g. by respiration and inflammatoryresponses (Dedon and Goldberg, 1992; Ward, 1994;Breen and Murphy, 1995). It has been suggested thatROS is a major cause of mutation, tumorigenesis, andage-related pathophysiology (Niedermuller et al., 1985;Messripour et al., 1994). To maintain the genomic

0300-483X/$ – see front matter © 2006 Elsevier Ireland Ltd. All rights reserved.doi:10.1016/j.tox.2006.04.025

S.R. Peddi et al. / Toxicology 224 (2006) 44–55 45

integrity, multiple DNA repair mechanisms are presentin cells. Among them, DNA base excision repair (BER)is primarily responsible for the repair of base lesions,apurinic/apyrimidinic (AP) sites, and DNA single-strandbreaks (SSB) that are directly or indirectly generated byROS (Wilson, 1998; Izumi et al., 2003). The nucleotideincision repair (NIR) pathway that incises DNA back-bone at base damage has been also recently identified(Ischenko and Saparbaev, 2002). The BER pathway isknown to be a multi-step pathway (Friedberg et al.,1995). Base lesions, including 8-oxoguanine, thymineglycol, and alkylated bases are removed at their N-glycosylic bonds by DNA glycosylases, which leaveeither AP sites or SSB at the damaged sites (Nash etal., 1996; Krokan et al., 1997; Roy et al., 1998). Impor-tantly, 3′-ends of these SSB contain 3′-�,�-unsaturatedaldehyde or 3′-phosphate groups, both of which blockthe subsequent repair synthesis carried out by DNA poly-merases (Wiederhold et al., 2004). The mammalian APendonuclease (APE1) removes these 3′-blocking groupsfrom SSB or cleaves AP sites to generate 3′-OH ends inDNA (Krokan et al., 1997). APE1 also catalyzes the inci-sion reaction at some of ROS-generated base damage inthe NIR pathway, such as 5,6-dihydro-2′-deoxyuridine,to generate 3′OH termini (Gros et al., 2004). The cleav-ing reactions, although crucial, do not complete theBER/NIR pathways, and APE1 instead leaves SSB atthe damaged sites. SSB are also directly generated byROS and ionizing radiation, both of which mainly pro-duce SSB with 3′-blocking ends, i.e., 3′-phosphate or3Opfi(n(eaDtabIilPsBAAt

endonuclease activity than that of the wild-type (WT)protein (Mol et al., 2000b; Izumi et al., 2004). Thesedata suggested that after the endonucleolytic reaction,APE1 remains at the nicked site in DNA, which mayfacilitate the recruitment of downstream BER enzymessuch as DNA polymerase beta (pol �) (Bennett, 1999;Mol et al., 2000a; Wilson and Kunkel, 2000; Izumi etal., 2003).

SSB activate poly(ADP-ribose) polymerase 1(PARP1) which attaches ADP-ribose moieties ontoitself and other nuclear proteins. For this reaction,PARP1 utilizes intracellular NAD+, and causes ATPconsumption (D’Amours et al., 1999). PARP’s rolein the repair of ROS-induced DNA damage has longbeen studied (Satoh and Lindahl, 1992; de Murcia etal., 1997a; Wang et al., 1997; Masson et al., 1998).PARP1 was reported to enhance long-patch repairsynthesis by pol � (Prasad et al., 2001). Paradoxically,however, over-activation of PARP1 causes necrotic celldeath, because the polymerization reaction depletescellular energy. PARP’s role in neuronal cell deathafter ROS insult was studied; using control and PARP1homozygous knockout (−/−) mice, PARP1 activationand necrosis after treatment of cells with N-methyl-d-aspartate, which induces ROS in neuronal cells,were specifically observed in normal mice, but werevirtually undetectable in PARP1−/− mice (Eliassonet al., 1997; Endres et al., 1997). The activation ofPARP1 was dependent on the generation of SSB, andthe necrotic death of the wild-type cells was prevented

′-phosphoglycolate ends (Henner et al., 1983). The 3′-H termini, generated by the APE reaction, serves asrimers for DNA polymerases to fill the gap in DNA;nally, DNA ligase I or III completes the BER reactionTomkinson and Mackey, 1998; Wilson, 1998). APE1ull mice do not survive through the embryogenesisXanthoudakis et al., 1996; Ludwig et al., 1998; Meirat al., 2001), and recently it was shown that APE1 islso required for cultured cells to be viable (Fung andemple, 2005; Izumi et al., 2005). The DNA repair func-

ion of APE1 is thus arguably essential for mammals,lthough APE1’s gene regulatory functions may alsoe crucial (Fritz and Kaina, 1999; Fritz et al., 2003).t has been postulated that APE1 not only plays a crit-cal role by providing 3′OH termini, but also is rate-imiting for the whole BER pathway (Izumi et al., 2000;arsons et al., 2004). In addition, a crystallographictudy indicated a novel role for APE1 in coordinatingER (Mol et al., 2000b). The amino acid side chain,rg177 (R177), interacts with phosphate backbones atP sites via hydrogen bonding. Remarkably, Ala substi-

ution for the Arg177 (R177A) resulted in a higher AP

by PARP1 inhibitors (Eliasson et al., 1997). The PARP1activation by SSB thus results in cell death due todepletion of NAD+ and ATP, contrary to the notionthat PARP1 protects cells from toxicity caused by SSB.Other pathophysiological studies also indicate thatPARP1 deletion in mice protects cells. For example,toxicity caused by PARP1 activation was observed aftermyocardial ischemia (Eliasson et al., 1997), duringinflammation elicited by treatment with zymosan,bacterial lipopolysaccharide with interferon-�, andtrinitrobenzenesulfonic acid (Szabo et al., 1997; Oliveret al., 1999; Zingarelli et al., 1999), as well as instreptozotocin-induced diabetes (Burkart et al., 1999;Masutani et al., 1999; Pieper et al., 1999). It was alsoobserved that the basal level of DNA strand breaks inthe central nervous system was higher than in othertissues, and that the basal level of PARP1 activationwas consistently elevated in the brain tissues (Pieperet al., 2000). More recently, necroinflammation causedby PARP1 was shown to be responsible directly for theinitiation and progression of skin cancer (Martin-Olivaet al., 2004).

46 S.R. Peddi et al. / Toxicology 224 (2006) 44–55

Moreover, it is estimated that spontaneous depurina-tion occurs at the rate of 10,000/cell under normal phys-iological conditions (Lindahl, 1979), producing about1.5 × 105 oxidative DNA lesions/cell (Beckman andAmes, 1997). Therefore, the level of activated PARP1in the basal level may already be high enough to triggerthe necrotic pathway with even a small increase of thecellular ROS concentration.

During the BER process, APE1 generates SSBs at APsites. Although these intermediate lesions are eventuallyrepaired by BER, PARP1 recognizes them as SSB, andthus may be activated. Consequently, the BER processmay lead to energy depletion in cells and thus necro-sis. In the present study, we examined APE1’s ability tocompete with PARP1 for binding to SSB, and therebysuppress PARP1 activation, for which the R177 residueplays an important role.

2. Materials and methods

2.1. DNA and proteins

A duplex DNA with a single-strand break (a gap with3′OH/5′phosphate end) was prepared by annealing threeoligonuleotides originally used by Lee and Wilson (1999). Topupstream: 5′AGG ATC CCC GCT AGC GGG3′; top down-stream: 5′pAC CGA GCT CGA ATT CAC TGG3′, and reversecomplementary: 5′TC CAG TGA ATT CGA GCT CGG TACCCG CTA GCG GGG ATCC3′. Annealing these oligonu-cleotides yields a 39-mer duplex DNA with one-nucleotide gap

CCC CGG GTA3′, where the THF site is denoted as X, and thecomplementary oligo was: 5′TTA CCC GGG GAT CCT CTAGAG TCG ACC TGC AGG GAT GCA AGC TTT TGT TCCCTT TAG TGA3′.

For the PARP1 activation assay in vitro, pBluescriptSK (−) DNA was treated with bleomycin to produce 3′-phosphoglycolate termini at SSB. Preparation of the damagedDNA was described previously (Izumi et al., 2000). The humanPARP1 cDNA was cloned by PCR using quick-cDNA clonefrom HeLa cells (Clontech), and inserted into pcDNA3.1Zeo(Invitrogen). The entire cDNA sequence was confirmed byDNA sequencing.

The expression vector for the WT APE1 (pET15b deriva-tive) and purification of APE1 protein was described previ-ously (Izumi et al., 1999). The R177A mutant was createdfrom the WT APE1 cDNA by site-directed mutagenesis usingPCR. The sequence of the oligonucleotide for introducingthe R177A mutation is: 5′ACAGCATATG TACCTAATGCAGGCGCGGGT CTGGTA3′, in which the intrinsic NdeI sitein the human APE1 cDNA is underlined and the R177A siteis shown in bold. PCR was carried out with a 3′-vector primerand swapped with the WT APE1 at the NdeI and XhoI. ThePARP1 protein was purchased from Trevigen and used for elec-trophoretic mobility shift assay.

2.2. Electrophoretic mobility shift assay (EMSA)

For EMSA with the gapped duplex DNA, the top-upstreamoligo was labeled with [�-32P]ATP at its 5′-end with T4polynucleotide kinase (Gibco), which was inactivated at 65 ◦Cfor 10 min. The labeled oligo was annealed with the top-downstream and the reverse complementary oligos to build

between the two top strands (Table 1), which mimics SSB pro-

duced by reactions of DNA glycosylases (Hazra et al., 1998).A 43-mer duplex DNA containing an AP site analog

(tetrahydrofuran, THF) at residue 30 in one DNA strand wasused as described previously (Barzilay et al., 1995; Izumi et al.,1999, 2004). A 60-mer duplex DNA with a THF was synthe-sized, HPLC-purified, and analyzed with mass spectrometryby Midland Corporation. The reverse-complementary oligowas purchased from Invitrogen. The 60-mer oligonucleotidesequence with THF was: 5′CTC ACT AAA GGG AAC AAAAGC TXG CAT CCC TGC AGG TCG ACT CTA GAG GAT

Table 1Diagram of the structures of the duplex DNA used in this study

Structure of the duplex DNA

One base-gap

AP-site (substrate)

Cleaved (product)

a duplex DNA with a strand break. The DNA was then purifiedthrough a G-25 Sephadex gel filtration (Amersham). Similarly,the 43- and 60-mer oligos with THF were labeled with [�-32P]ATP at the 5′-ends. The oligos were subsequently annealedwith their corresponding reverse complementary oligos byboiling and cooling to room temperature, and purified by G25gel filtration. About 50 fmol of the labeled oligo was usedfor each EMSA reaction in a binding buffer (20 �l) contain-ing 10% glycerol, 20 mM Tris (pH 8.0), 100 mM KCl, 2 mMDTT, and with or without 1 mM MgCl2. The binding reac-tion was carried out at 23 ◦C for the indicated time periods,and the bound complex was separated from the free probe in5% non-denaturing acrylamide electrophoresis in a hypotonicbuffer (Ausubel et al., 1990) containing 7.7 mM Tris (8.0),3.3 mM sodium acetate, and 1 mM EDTA at 4 ◦C. DNA:proteincomplexes were quantified with a PhosphoImaging system(STORM, Molecular Dynamics). EMSA for cleaved DNA wascarried out in the same way as above, except that the 60-merDNA was incised in an APE1 reaction (Izumi et al., 1999) priorto EMSA. The cut DNA (cleaved DNA, Table 1) was thenpurified from 20% non-denaturing polyacrylamide gel elec-trophoresis, and labeled with [�-32P]ATP. Apparent Kd valuesof APE1 proteins for cleaved DNA was determined as previ-ously (Izumi et al., 2004).

S.R. Peddi et al. / Toxicology 224 (2006) 44–55 47

2.3. Measurement of PARP1 activity in vitro

The PARP1 activity was assayed in HeLa whole cellextract as described previously (Satoh and Lindahl, 1992).The extract was prepared from a one liter HeLa suspensionculture in late log-phase grown in S-MEM medium (Gibco),as described (Manley et al., 1983; Hazra et al., 1998). Thedamaged or undamaged plasmid DNA was incubated with theextract (40 �g) at 30 ◦C for 15 min in a 40 �l reaction mix-ture containing 3% glycerol, 50 mM HEPES (pH 7.8), 5 mMMgCl2, 50 mM KCl, 0.5 mM DTT, 0.4 mM EDTA, 20 �g/mlbovine serum albumin, 2 mM ATP, 40 mM phosphocrea-tine, 2.5 �g creatine phosphokinase, and 0.5 �Ci [32P]NAD+(3000 mCi/mol, Amersham). When necessary, the DNA waspre-incubated with purified APE1 (0.3 �g) for 30 min at 23 ◦Cbefore the addition of the HeLa extract. The reaction wasstopped by the addition of 50 �l acetone. The samples werethen analyzed by 8% SDS polyacrylamide gel electrophoresisand autoradiography for incorporation of NAD+ into proteinsusing ImageQuant software in STORM (Molecular Dynam-ics). The gel was later stained with Coomassie blue.

2.4. Analysis of transiently transfected PARP1−/−cells

The PARP1−/− mouse embryonic fibroblast cells (deMurcia et al., 1997b), a generous gift from Dr. de Murcia, werespread on 60 mm dishes 1 day before the transfection. The plas-mid DNA containing APE1 (WT or R177A) and PARP1 cDNA(0.25 �g/dish) were mixed with lipofectamine2000 (Invitro-gen), and then added to attached cells in OptiMEM (Invit-rogen), according to manufacturer’s instructions. After 24 h,cells were treated with 0.2 mM H2O2 and harvested for nucleareieaw(gA1C

3

3

sAaAWDt

Fig. 1. Binding of APE1 to duplex DNA with a 3′OH/5′P gap. (A)A 39-mer duplex DNA with SSB (one-nucleotide gap) was incubatedwith the WT (lanes 2–4) or R177A (lanes 5–7) APE1 proteins (20 ng).A cold (unlabeled) duplex DNA, identical to the labeled DNA (lanes3 and 6) or with identical sequence but no SSB (lanes 4 and 7), wasadded in excess (25×-fold) for competition. Arrows indicate positionsof duplex 39-mer DNA containing a gap with (filled arrow) or without(open arrow) bound APE1. The asterisk denotes duplex DNA withoutthe top-downstream oligo. (B) The SSB-containing labeled oligo as in(A) was incubated with 10 ng (lanes 2 and 5), 20 ng (lanes 3 and 6),or 40 ng (lanes 4 and 7) of the WT (lanes 2–4) or R177A (lanes 5–7)APE1 proteins. In both A and B, the bound complexes were analyzedin 5% non-denaturing polyacrylamide gels after incubation for 30 minat 23 ◦C. The binding reactions were reproducibly repeated for morethan three times.

WT APE1 for the SSB-containing DNA was comparedwith that of R177A mutant APE1 (Fig. 1). The WT APE1formed a stable complex with the gap-containing DNA(Fig. 1A lane 2, filled arrow), as the amount of unboundDNA (open arrow) decreased. This indicated that APE1formed a complex with the gap-containing DNA, andnot to the 5′-overhanging DNA without the downstreamoligo (indicated by an asterisk). The binding decreasedwith the addition of excess (25-fold) amount of the iden-tical DNA, which was not radioactively labeled (Fig. 1Alane 3). However, the formation of the bound complexeswas not affected by the addition of non-labeled DNAwith the identical sequence but no gap (Fig. 1A lane4). In contrast, the affinity of APE1 for the SSB sig-nificantly decreased by the R177A mutation. (Fig. 1Alanes 5–7). The formation of complexes increased as

xtract preparation (Schreiber et al., 1989). The PARP1 activ-ty in the cells was then measured with 5 �g of the nuclearxtracts as described above, without addition of damaged DNAnd recombinant proteins. Immunoblot assays were carried outith 20 �g of nuclear extract as described in a previous report

Kuninger et al., 2002), except that 12% SDS polyacrylamideel and the ECL detection system from Amersham was used.nti-APE1 antibody was generated previously (Izumi et al.,996), and anti-PARP1 antibody was purchased from Santaruz Biotechnology.

. Results

.1. Importance of R177 in SSB binding by APE1

An earlier observation showed that APE1 formed atable complex with product DNA, which resulted fromPE1’s endonucleolytic cleavage reaction (Waters et

l., 1999). The observation raised a question whetherPE1 is capable of binding to a gap-containing DNA.e tested if APE1 could form a stable complex withNA containing a one base-gap (Table 1). To examine

he importance of R177 for the binding, the affinity of the

48 S.R. Peddi et al. / Toxicology 224 (2006) 44–55

more WT APE1 was present in the reaction, whereasthe complex formation by R177A APE1 was negligibleunder the same conditions (Fig. 1B).

3.2. Complex formation of APE1 with DNAcontaining AP sites

APE1 binds to AP sites in the absence of Mg2+, acondition in which APE1 does not have endonucleaseactivity (Wilson et al., 1997; Masuda et al., 1998). Aspecific complex between APE1 and the substrate DNAwas detected (lane 2, Fig. 2A). To examine the effectof the R177A mutation on the substrate binding, EMSAwith R177A APE1 was carried out (lane 3, Fig. 2A). Asimilar complex between the mutant APE1 and the sub-strate DNA (Table 1) was observed. The binding wasas specific to the AP site as that with the WT APE1,because the complex was competed by excess substrate,

but not by control oligo (no AP sites) with the samesequence as the substrate DNA (data not shown). Theamount of the complex with R177A was lower thanthat with WT APE1, probably because the Ala substitu-tion disturbed the local structure important for substraterecognition, which is consistent with the increased Kmand Kd values with the mutant (Mol et al., 2000b; Izumiet al., 2004). The cleavage reaction was monitored bydenaturing polyacrylamide electrophoresis (Fig. 2B). Asexpected, neither reaction generated cleaved products inthe absence of Mg2+.

3.3. Complex formation of APE1 with DNAcontaining incision

The co-crystal structures of APE1:DNA complexesindicated a specific interaction of the enzyme not onlywith AP sites but also with cleaved DNA (Mol et al.,

-mer) inn (lane

Fig. 2. Binding of APE1 to an AP site-containing oligonucleotide (43carried out in 5% non-denaturing polyacrylamide gels with no protei

with (C) 1 mM MgCl2. Arrows indicate the points of DNA migration in the gD) the same sets of the samples (A and C, respectively) were analyzed in 20filled arrows: cleaved DNA. The results were reproducibly repeated. (E) Titracleaved DNA and the WT (closed circle) or R177A (open triangle) mutant Aconcentration [Et] was tested. Sb/St: ratio between DNA bound to protein (SbSigma plot as described previously (Izumi et al., 2004).

the absence and presence of a divalent cation. (A and C) EMSA was1), or 20 ng of WT APE1 (lane 2) or R177A (lane 3), without (A) or

el; free DNA probe (open) and the APE1-bound (filled) DNA. (B and% denaturing gel containing 8 M urea. Open arrows: substrate DNA;tion curve for apparent Kd values, based on the binding reaction of thePE1 proteins in the presence of 1 mM MgCl2. Five different protein) and total amount of DNA (St). The line fitting was determined using

S.R. Peddi et al. / Toxicology 224 (2006) 44–55 49

2000b). We sought to identify the complex in our bind-ing reaction. APE1 was incubated with the AP site-containing DNA in the same buffer as in Fig. 1A, but alsoin the presence of 1 mM Mg2+. WT APE1 formed a com-plex with the cleaved DNA (lane 2, Fig. 2C). The cleavedDNA:APE1 complex was competed out with the additionof a 50-fold excess of non-radioactive substrate DNA,but not with control DNA, so the formation of this com-plex was specific to the cleaved DNA (data not shown).With R177A, the complex observed with the WT APE1was decreased to an almost undetectable level (lane 3,Fig. 2C). Under this condition, both APE1 proteins werefully active, as the samples were analyzed in denaturinggels to monitor APE1 activity (Fig. 2D). The completecleavage of the substrate DNA was observed for thereactions with both WT and R177A APE1 (Fig. 2D).Therefore, the R177A was released very efficiently afterits cleavage reaction (Mol et al., 2000a; Izumi et al.,2004).

3.4. Comparison of the binding affinity of the WTand R177A APE1 for the cleaved DNA

A previous comparison of the Kd values of the WTand R177A for the substrates, i.e., AP sites, indicatedthat the affinity of the mutant APE1 for the substrate isdecreased by seven-fold (Izumi et al., 2004). To examinethe effect of the mutation of the product binding, EMSAwas carried out with the AP site-containing DNA in thepresence of Mg2+ and various amounts of APE1 proteins.

The formation of the complexes of the WT APE1 andthe product DNA increased as the concentration of theprotein was increased, while no distinct complex wasdetectable with the R177A APE1 (Fig. 2E). The Kd valuefor the R177A was more than 500 times higher than thatwith the WT APE1 (Fig. 2E).

3.5. Competition between APE1 and PARP1 forSSB-binding

We asked whether APE1, after its reaction at AP sites,would prevent PARP1 from binding to the nicked sitesin DNA, due to APE1’s binding. APE1 formed a spe-cific complex with pre-cleaved DNA (lane 2, Fig. 3A).PARP1 also generated a distinct band shift with muchslower migration than APE1 (lane 3, Fig. 3A). However,pre-incubation of DNA with APE1 caused a significantdecrease in the amount of the PARP1:DNA complex(lane 4, Fig. 3A), whereas the APE1:DNA complex wasformed as efficiently as in the absence of PARP1. Theseresults suggest that PARP1’s binding to the cleaved DNAwas inhibited by APE1.

3.6. Inhibition of PARP1 activation by APE1 in vitro

APE1 generates 3′-OH ends at 3′-blocking SSB,including 3′-�,�-unsaturated aldehyde produced byDNA glycosylases (Hazra et al., 1998) and 3′-phosphoglycolate produced by direct ROS attacks onDNA (Breen and Murphy, 1995). Using an in vitro

F . EMSAi additiob 3 �g of6 WT in1 hosphorw firm the

ig. 3. (A) Inhibition of PARP1’s binding to nicked DNA by APE1ncubated with the DNA in the presence of 1 mM Mg2+ before PARP1y APE1. HeLa cell extract was incubated at 30 ◦C for 15 min with 0.), or no DNA (lane 1) in the presence of [32P]NAD+. APE1 (0.3 �g;). The samples were separated by 8% SDS/PAGE and exposed on Pith Coomassie blue (bottom). The experiments were repeated to con

with pre-cleaved 60-mer oligo. APE1 (20 ng, lanes 2 and 4) wasn (10 ng, lanes 3 and 4). (B) Inhibition of automodification of PARP1bleomycin-treated DNA (lanes 3, 5, 7), undamaged DNA (lanes 2, 4,lanes 4 and 5; R177A in lanes 6 and 7) was added (no APE1 in laneImager cassette (top) without drying. The same gel was later stainedir reproducibility.

50 S.R. Peddi et al. / Toxicology 224 (2006) 44–55

PARP1 assay (Satoh and Lindahl, 1992), we tested theeffect of APE1 on PARP activation by 3′-blcoking SSB,namely, SSB containing 3′-phosphoglycolate producedby bleomycin. HeLa whole cell extracts were incu-bated with the plasmid DNA, undamaged or damagedby bleomycin (Izumi et al., 2000), in the presence of[32P]NAD+ (Satoh and Lindahl, 1992) (Fig. 3B). Incor-poration of NAD+ was observed only with the damagedDNA (lane 3), and no incorporation was detected withthe addition of undamaged, control DNA (lane 2). Thesize of the band matched with the PARP’s molecularmass (about 110 kDa), and so the incorporation repre-

sents the extent of PARP1 activation by SSB. Whenthe DNA was pre-incubated with the WT APE1 proteinbefore the addition of HeLa whole cell extracts, PARP1activation was decreased significantly (3.1 ± 0.5 reduc-tion, lane 5 versus lane 3). To probe the importance ofthe R177 residue in the suppression, undamaged or dam-aged DNA was pre-incubated with the same amount ofthe R177A protein (lanes 6 and 7, respectively) as theWT APE1 (lanes 4 and 5). Contrary to WT APE1, theband intensity was not affected by R177A APE1, indi-cating that R177A APE1 did not block PARP’s bindingto DNA and its activation.

Fig. 4. Suppression of PARP1 activation by the WT but not by the R177A APARP−/− MEF cells 24 h after transfection. The nuclear extracts (20 �g) werhorizontal arrows. Cells were transfected with empty vector controls (Vector),WT APE1 c DNA (PARP + WT APE1), or R177A APE1 cDNA (PARP + R17nuclear extracts from the PARP1−/− cells after transient transfection of PARP3, 4), or R177A APE1 (lanes 5 and 6). Cells were either mock treated (lanes 1,the PARP activity assay. (C) PARP1 activity standardized with the control vaindependent experiments (n = 5, 6, and 6 for control, WT APE1, and R177A, runtreated and treated samples in each set (V, WT APE1, or R177A APE1) wawas plotted separately due to its unusually high basal/activated PARP activiInvitrogen).

PE1. (A) Western blot showing PARP1 and APE1 expression in thee blotted using anti-APE1 or anti-PARP1 antibodies as indicated withthe WT PARP1 expression vector with a control vector (PARP + Vec),7A APE1). (B) A representative result of PARP1 activity assay using1 cDNA (lanes 1–6, 8) plus vector alone (lanes 1, 2), WT APE1 (lanes

3, 5, 7, 8) or treated with 0.2 mM H2O2 for 10 min (lanes 2, 4, 6) beforelue (transfected with PARP1 but not with APE1). Average values of

espectively) with standard deviation are shown. The variance betweens significant (P < 0.05). A particular data set on the R177A expressionty, and shown as open/filled circles. V, a control vector (pcDNA3.1,

S.R. Peddi et al. / Toxicology 224 (2006) 44–55 51

3.7. Inhibition of PARP1 activation by APE1 in vivo

The nuclear DNA in cells is assembled into chro-matin. It is likely that this high-order structure of thegenome affects the accessibility of APE1 and PARP1 toSSB. To examine the effect of APE1 and the role of theR177 residue on the PARP1 activity in cells, the humanPARP1 cDNA was transiently transfected with eitherWT or R177A APE1 cDNA into PARP1−/− mouseembryonic fibroblast cells. The increases of expressionof the APE1 proteins were only moderately higher (about1.8-fold) than that with the vector control (lane 3 and4 versus lane 2, Fig. 4A), due to the abundance of theendogenous APE1 in cell lines (unpublished observa-tion). Nevertheless, the levels of expression of WT andR177A APE1 were almost identical to each other (lanes3 and 4, Fig. 4A). Thus the missense mutation did notaffect the expression of APE1 nor PARP1 in cells.

To avoid background PARP1 activity due to theendogenous PARP1 from untransfected cells, a PARP-deficient (PARP1−/−) mouse fibroblast cell line wasused (de Murcia et al., 1997b). The efficiency of co-transfection, i.e., the chance for a cell to express bothPARP1 and APE1 ectopically, is more than 90% inour experimental condition, which was determined byco-transfection of two different fluorescence proteins(enhanced cyan fluorescence protein and DsRed2 pro-teins, data not shown). Therefore, we could examine theeffect of the increase of APE1 on the PARP1 activation.

The activation of PARP1 was observed by treat-i(SietawiR(

4

aergfis

cells to ROS, as well as alkylating reagents (de Murciaet al., 1997a). To understand the mechanism by whichPARP1 participates in BER, Satoh et al. reported thataddition of NAD+ to the BER reaction significantlyenhanced the efficiency of the repair in vitro (Satoh andLindahl, 1992). Because of its high affinity for SSB, itwas inferred that PARP1 might recognize and protectthe SSB before other BER enzymes bind to these sites.More recent in vitro studies (Lavrik et al., 2001; Prasadet al., 2001) showed that PARP1 interacts with pol �,and then facilitates the transition of the reaction modeof pol �, i.e., from the single nucleotide incorporation tothe long-patch repair synthesis in its gap-filling reaction.However, when NAD+ was added to the reconstitutedreaction, PARP1 could no longer enhance pol � for thelong patch repair (Prasad et al., 2001), suggesting thatPARP1 should be in the non-activated form for this par-ticular BER process. Enhancement of BER after additionof exogenous NAD+ suggested that PARP1 activationwas beneficial to repair (Satoh and Lindahl, 1992). How-ever, given that cellular energy is limited, PARP1 mayrestrict the cellular BER capacity in vivo, unlike the invitro condition where practically unlimited NAD+ wasavailable. Moreover, PARP1 might be harmful in vivo,and induce necrosis/inflammation by depleting the cel-lular energy supply. There is evidence to suggest thatPARP1 activation is harmful to cells in a number of invivo situations, because the polymerization reaction caninduce cellular energy depletion and acidification, whichthen induces necrosis due to oxidative damage and alky-

ng the transfected cells with 0.2 mM H2O2 for 10 minlanes 2, 4, 6, Fig. 4B), as previously observed (Ha andnyder, 1999). The band appearance due to [32P]-NAD+

ncorporation was completely dependent on the PARP1xpression, because it was not detected without PARP1ransfection (lane 7 versus lane 8 in Fig. 4B, Fig. 4C). Thectivation due to H2O2 treatment significantly decreasedhen the WT APE1 was co-transfected (lanes 3 and 4

n Fig. 4B, Fig. 4C). On the other hand, however, the177A APE1 failed to suppress the PARP1 activation

lanes 5 and 6 in Fig. 4B, Fig. 4C).

. Discussion

Studies support the notion that PARP1 functionss a BER modulator, and cooperates with other BERnzymes to facilitate the repair process. In the earliereport by Wang et al., introduction of a PARP1 homozy-ous null mutation revealed that PARP1 was not essentialor repair of DNA double-strand breaks induced by �-rradiation (Wang et al., 1995). However, other groupsubsequently reported that the null mutation sensitized

lation of DNA (Zong et al., 2004). The levels of activatedversus dormant PARP1 molecules may be in a delicatebalance, lest cells undergo necrosis. In the present study,APE1 was found to stay bound to the nicked DNA, whichincludes DNA lesions generated by APE1’s reaction atAP sites, and APE1 competes with PARP1 for bindingto SSB, and thus suppresses PARP1’s activation.

Studies on mammalian BER have exposed new ram-ifications in the repair process, in which APE1 appearsto play a key role. For the repair of base adducts, severalgroups showed that after removal of abnormal bases byDNA glycosylases, APE1 can facilitate the release of theglycosylases, enhance their turnover (Waters et al., 1999;Hill et al., 2001; Yang et al., 2001), and then produce3′OH at either AP sites or 3′-�,�-unsaturated aldehyde,depending on the catalytic mechanisms of the DNA gly-cosylases. Furthermore, interaction of APE1 with suchdownstream BER proteins as pol � and FEN1 werereported (Bennett et al., 1997; Dianova et al., 2001; Izumiet al., 2003). Therefore, it is likely that the whole BERrepair process, from base removal to base gap-filling, isseamlessly coordinated (Mol et al., 2000b; Wilson and

52 S.R. Peddi et al. / Toxicology 224 (2006) 44–55

Kunkel, 2000). Based on our observations in this study,we further infer that by sequestering SSB, APE1 pro-vides an important protective mechanism to avoid excessactivation of PARP1 until the entire BER process is com-pleted. The affinity of APE1 for SSB is crucial for thisprotection. Here we showed that the R177 residue isessential for the SSB binding, probably because of itsinteraction with the phosphate backbone at the immedi-ate downstream of the AP site (Mol et al., 2000b). APE1was found to bind specifically to SSBs that are inter-mediate lesions during the BER reaction, produced byDNA glycosylases (Fig. 1) or by APE1’s cleavage reac-tion (Fig. 2). It is possible that the intermediate lesionsneed to be handed over by the repair enzymes throughthe completion of BER, so that the intermediate lesionsdo not cause more harmful situation, such as the over-activation of PARP1 and energy depletion in cells. Herein the in vitro experiments, we showed that APE1 com-peted with PARP1 for the binding to SSBs and thus sup-pressed PARP1’s activation (Fig. 3). The affinity for theproduct DNA dramatically decreased when the Arg177was missing (Fig. 2). The Arg residue thus plays a keyrole in binding to SSBs and in suppressing PARP1 acti-vation. Interestingly, our preliminary data suggest thatthe N-terminal 60 residues, present in mammalian butabsent in prokaryotic APEs, are also necessary for effi-cient SSB binding (unpublished). Given that the R177is also unique in mammalian APEs, it is an intriguingspeculation that APE1 acquired evolutionarily the bind-ing affinity for cleaved DNA to facilitate the process of

uous and spontaneous damage generation, because ofthe BER activity using APE1 as an essential compo-nent. Recent findings by two independent studies clearlyindicate that these spontaneously generated AP sites arelethal if APE1 is depleted (Fung and Demple, 2005;Izumi et al., 2005). Therefore, we argue that AP sites arelethal if left unrepaired, but also cells would die whenthe lesions are left as single-strand breaks (by R177AAPE1). We thus infer that the R177 residue in APE1 isnecessary for a proper coordination of BER.

The BER pathway, originally thought to be a simpleprocess, now is understood as a mechanism with capabil-ity for transcription-coupled and replication-associatedrepair (Le Page et al., 2000; Tsutakawa and Cooper,2000; Hayashi et al., 2002; Dou et al., 2003; Hazra etal., 2003; Izumi et al., 2003). These complicated reac-tions can be accomplished by interactions among BERproteins. APE1 is one of the key proteins of which inter-action with other BER proteins has been shown to playcrucial roles for an efficient BER process (Bennett et al.,1997; Lavrik et al., 2001; Vidal et al., 2001; Cistulli et al.,2004). Our present results suggest that a change in theinteraction of APE1 with DNA may also affect the BERefficiency. It should thus be necessary to examine effectsof polymorphisms and mutations in APE1 not only onits enzymatic activity, but also on its affinity for varioustypes of DNA damage, including SSB with different 3′-and 5′-end structures. The potential importance of suchAPE1 alterations has been implied by their associationwith amyotrophic lateral sclerosis and endometrial can-

BER coordination only in higher eukaryotes (Mol et al.,2000b; Wilson and Kunkel, 2000).

The mechanism to maintain the balance between acti-vated/dormant PARP1 is complex. The effect of nucle-osomal structure and chromosomal assembly on thePARP1 and APE1’s affinity to SSB-containing DNA alsoneeds to be elucidated. Nonetheless, in this study sup-pression of the PARP1 activation by APE1 was observedin vivo as in Fig. 4. This indicates that the competitionbetween APE1 and PARP1 for SSB indeed occurs invivo, and therefore underscores the biological signifi-cance of APE1’s ability to bind to SSB. Interestingly,the activation of PARP1 with R177A was higher thanthat with the normal control even without H2O2 treat-ment (lanes 1 and 5, Fig. 4B, also Fig. 4C). This may beexplained by the fact that R177A APE1 is a fully func-tional enzyme (Mol et al., 2000a; Izumi et al., 2004), butdoes not bind to SSB as efficiently as the WT APE1;R177A APE1 may have generated SSB from AP sitesand thus exposed more SSB to PARP. AP sites aregenerated spontaneously at the rate of 10,000/cell/day(Lindahl, 1995). Cells can survive despite the contin-

cer (Olkowski, 1998; Hadi et al., 2000; Tomkins et al.,2000).

Acknowledgements

The authors would like to thank Drs. de Murcia forproviding PARP1−/− cells, and Dr. J.W. Hill for histechnical suggestion on EMSA; Drs. S. Mitra and A.Yasui for their critical discussions; and Dr. D. Konkelfor his critical reading of the manuscript. Mrs. Q. Guo’stechnical assistance is also acknowledged. Finally, weare grateful for all of our colleagues who have beensupportive for our recovery process after the hurricanedisaster in 2005. This work was supported by NIH grantsCA98664 and CA53791.

References

Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G.,Smith, J.A., Struhl, K., 1990. Current Protocols in Molecular Biol-ogy. John Wiley and Sons, New York.

Barzilay, G., Walker, L.J., Robson, C.N., Hickson, I.D., 1995. Site-directed mutagenesis of the human DNA repair enzyme HAP1:

S.R. Peddi et al. / Toxicology 224 (2006) 44–55 53

identification of residues important for AP endonuclease andRNase H activity. Nucleic Acids Res. 23, 1544–1550.

Beckman, K.B., Ames, B.N., 1997. Oxidative decay of DNA. J. Biol.Chem. 272, 19633–19636.

Bennett, R.A., 1999. The Saccharomyces cerevisiae ETH1 gene, aninducible homolog of exonuclease III that provides resistance toDNA-damaging agents and limits spontaneous mutagenesis. Mol.Cell. Biol. 19, 1800–1809.

Bennett, R.A., Wilson III, D.M., Wong, D., Demple, B., 1997. Inter-action of human apurinic endonuclease and DNA polymerase betain the base excision repair pathway. Proc. Natl. Acad. Sci. U.S.A.94, 7166–7169.

Breen, A.P., Murphy, J.A., 1995. Reactions of oxyl radicals with DNA.Free Rad. Biol. Med. 18, 1033–1077.

Burkart, V., Wang, Z.Q., Radons, J., Heller, B., Herceg, Z., Stingl, L.,Wagner, E.F., Kolb, H., 1999. Mice lacking the poly(ADP-ribose)polymerase gene are resistant to pancreatic beta-cell destructionand diabetes development induced by streptozocin. Nat. Med. 5,314–319.

Cistulli, C., Lavrik, O.I., Prasad, R., Hou, E., Wilson, S.H., 2004. APendonuclease and poly(ADP-ribose) polymerase-1 interact withthe same base excision repair intermediate. DNA Repair (Amst) 3,581–591.

D’Amours, D., Desnoyers, S., D’Silva, I., Poirier, G.G., 1999.Poly(ADP-ribosyl)ation reactions in the regulation of nuclear func-tions. Biochem. J. 342, 249–268.

de Murcia, J.M., Niedergang, C., Trucco, C., Ricoul, M., Dutrillaux,B., Mark, M., Oliver, F.J., Masson, M., Dierich, A., LeMeur, M.,Walztinger, C., Chambon, P., de Murcia, G., 1997a. requirementof poly(ADP-ribose) polymerase in recovery from DNA dam-age in mice and in cells. Proc. Natl. Acd. Sci. U.S.A. 94, 7303–7307.

de Murcia, J.M., Niedergang, C., Trucco, C., Ricoul, M., Dutrillaux,B., Mark, M., Oliver, F.J., Masson, M., Dierich, A., LeMeur, M.,Walztinger, C., Chambon, P., de Murcia, G., 1997b. Requirement

D

D

D

E

E

F

F

Fritz, G., Kaina, B., 1999. Phosphorylation of the DNA repair proteinAPE/REF-1 by CKII affects redox regulation of AP-1. Oncogene18, 1033–1040.

Fung, H., Demple, B., 2005. A vital role for ape1/ref1 protein inrepairing spontaneous DNA damage in human cells. Mol. Cell.17, 463–470.

Gros, L., AA, I., Ide, H., Elder, R., Saparbaev, M., 2004. The majorhuman AP endonuclease (Ape1) is involved in the nucleotide inci-sion repair pathway. Nucleic Acids Res. 32, 1–9.

Ha, H.C., Snyder, S.H., 1999. Poly(ADP-ribose) polymerase is a medi-ator of necrotic cell death by ATP depletion. Proc. Natl. Acad. Sci.U.S.A. 96, 13978–13982.

Hadi, M.Z., Coleman, M.A., Fidelis, K., Mohrenweiser, H.W., Wilson,I.D., 2000. Functional characterization of Ape1 variants iden-tified in the human population. Nucleic Acids Res. 28, 3871–3879.

Hayashi, H., Tominaga, Y., Hirano, S., McKenna, A.E., Nakabeppu,Y., Matsumoto, Y., 2002. Replication-associated repair of adenine:8-oxoguanine mispairs by MYH. Curr. Biol. 12, 335–339.

Hazra, T.K., Izumi, T., Kow, Y.W., Mitra, S., 2003. The discoveryof a new family of mammalian enzymes for repair of oxidativelydamaged DNA, and its physiological implications. Carcinogenesis24, 155–157.

Hazra, T.K., Izumi, T., Maidt, L., Floyd, R.A., Mitra, S., 1998. Thepresence of two distinct 8-oxoguanine repair enzymes in humancells: their potential complementary roles in preventing mutation.Nucleic Acids Res. 26, 5116–5122.

Henner, W., Rodriguez, L., Hech, S., Haseltine, W., 1983. gamma Rayinduced deoxyribonucleic acid strand breaks. 3′-Glycolate termini.J. Biol. Chem. 258, 711–713.

Hill, J.W., Hazra, T.K., Izumi, T., Mitra, S., 2001. Stimulation of human8-oxoguanine-DNA glycosylase by AP-endonuclease: potentialcoordination of the initial steps in base excision repair. NucleicAcids Res. 29, 430–438.

Ischenko, A.A., Saparbaev, M.K., 2002. Alternative nucleotide inci-

of poly(ADP-ribose) polymerase in recovery from DNA damagein mice and in cells. Proc. Natl. Acad. Sci. U.S.A. 94, 7303–7307.

edon, P.C., Goldberg, I.H., 1992. Free-radical mechanisms involvedin the formation of sequence-dependent bistranded DNA lesionsby the antitumor antibiotics bleomycin, neocarzinostatin, andcalicheamicin. Chem. Res. Toxicol. 5, 311–332.

ianova II, Bohr, V.A., Dianov, G.L., 2001. Interaction of human APendonuclease 1 with flap endonuclease 1 and proliferating cellnuclear antigen involved in long-patch base excision repair. Bio-chemistry 40, 12639–12644.

ou, H., Mitra, S., Hazra, T.K., 2003. Repair of oxidized bases in DNAbubble structures by human DNA glycosylases NEIL1 and NEIL2.J. Biol. Chem. 278, 49679–49684.

liasson, M.J.L., Sampei, K., Mandir, A.S., Hurn, P.D., Traystman,R.J., Bao, J., Pieper, A., Wang, Z.-Q., Dawson, T.M., Snyder, S.H.,Dawson, V.L., 1997. Poly(ADP-ribose) polymerase gene disrup-tion renders mice resistant to cerebral ischemia. Nat. Genet. 3,1089–1095.

ndres, M., Wang, Z.Q., Namura, S., Waeber, C., Moskowitz, M.A.,1997. Ischemic brain injury is mediated by the activation ofpoly(ADP-ribose)polymerase. J. Cereb. Blood. Flow. Metab. 17,1143–1151.

riedberg, E.C., Walker, G.C., Siede, W., 1995. DNA Repair and Muta-genesis. ASM Press, Washington, DC.

ritz, G., Grosch, S., Tomicic, M., Kaina, B., 2003. APE/Ref-1 and themammalian response to genotoxic stress. Toxicology 193, 67–78.

sion repair pathway for oxidative DNA damage. Nature 415,183–187.

Izumi, T., Brown, D.B., Naidu, C.V., Bhakat, K.K., Macinnes, M.A.,Saito, H., Chen, D.J., Mitra, S., 2005. Two essential but distinctfunctions of the mammalian abasic endonuclease. Proc. Natl. Acad.Sci. U.S.A. 102, 5739–5743.

Izumi, T., Hazra, T.K., Boldogh, I., Tomkinson, A.E., Park, M.S., Ikeda,S., Mitra, S., 2000. Requirement for human AP endonuclease 1 forrepair of 3′-blocking damage at DNA single-strand breaks inducedby reactive oxygen species. Carcinogenesis 21, 1329–1334.

Izumi, T., Henner, W.D., Mitra, S., 1996. Negative regulation of themajor human AP-endonuclease, a multifunctional protein. Bio-chemistry 35, 14679–14683.

Izumi, T., Malecki, J., Chaudhry, M.A., Weinfeld, M., Hill, J.H., Lee,J.C., Mitra, S., 1999. Intragenic suppression of an active site muta-tion in the human apurinic/apyrimidinic endonuclease. J. Mol. Biol.287, 47–57.

Izumi, T., Schein, C.H., Oezguen, N., Feng, Y., Braun, W., 2004. Effectsof backbone contacts 3′ to the abasic site on the cleavage andthe product binding by human apurinic/apyrimidinic endonucle-ase (APE1). Biochemistry 43, 684–689.

Izumi, T., Wiederhold, L.R., Roy, G., Roy, R., Jaiswal, A., Bhakat,K.K., Mitra, S., Hazra, T.K., 2003. Mammalian DNA base excisionrepair proteins: their interactions and role in repair of oxidativeDNA damage. Toxicology 193, 43–65.

Krokan, H.E., Standal, R., Slupphaug, G., 1997. DNA glycosylases inthe base excision repair of DNA. Biochem. J. 325, 1–16.

54 S.R. Peddi et al. / Toxicology 224 (2006) 44–55

Kuninger, D., Izumi, T., Papaconstantinou, J., Mitra, S., 2002. HumanAP-endonuclease 1 and hnRNP-L interact with a nCaRE-likerepressor element in the AP-endonuclease 1 promoter. NucleicAcids Res. 30, 823–829.

Lavrik, O.I., Prasad, R., Sobol, R.W., Horton, J.K., Ackerman, E.J.,Wilson, S.H., 2001. Photoaffinity labeling of mouse fibroblastenzymes by a base excision repair intermediate. Evidence for therole of poly(ADP-ribose) polymerase-1 in DNA repair. J. Biol.Chem. 276, 25541–25548.

Le Page, F., Kwoh, E.E., Avrutskaya, A., Gentil, A., Leadon, S.A.,Sarasin, A., Cooper, P.K., 2000. Transcription-coupled repair of8-oxoguanine: requirement for XPG, TFIIH, and CSB and impli-cations for Cockayne syndrome. Cell 101, 159–171.

Lee, B.I., Wilson 3rd, D.M., 1999. The RAD2 domain of human exonu-clease 1 exhibits 5′ to 3′ exonuclease and flap structure-specificendonuclease activities. J. Biol. Chem. 274, 37763–37769.

Lindahl, T., 1979. DNA glycosylases, endonucleases for apurinic/apyrimidinic sites, and base excision-repair. Prog. Nucleic. AcidRes. Mol. Biol. 22, 135–192.

Lindahl, T., 1995. Recognition and processing of damaged DNA. J.Cell. Sci. 19 (Suppl.), 73–77.

Ludwig, D.L., MacInnes, M.A., Takiguchi, Y., Purtymun, P.E., Hen-rie, M., Flannery, M., Meneses, J., Pedersen, R.A., Chen, D.J.,1998. A murine AP-endonuclease gene-targeted deficiency withpost-implantation embryonic progression and ionizing radiationsensitivity. Mutat. Res. 409, 17–29.

Manley, J.L., Fire, A., Samuels, M., Sharp, P.A., 1983. In vitro tran-scription: whole-cell extract. Meth. Enz. 101, 568–582.

Martin-Oliva, D., O’Valle, F., Munoz-Gamez, J.A., Valenzuela, M.T.,Nunez, M.I., Aguilar, M., Almodovar, J.R., Moral, R.G., Oliver,F.J., 2004. Crosstalk between PARP-1 and NF-kappaB modulatesthe promotion of skin neoplasia. Oncogene 23, 5275–5283.

Masson, M., Niedergang, C., Schreiber, V., Muller, S., Menissier-deMurcia, J., de Murcia, G., 1998. XRCC1 is specifically associatedwith poly(ADP-ribose) polymerase and negatively regulates its

excision DNA-repair protein superfamily. Curr. Biol. 6, 968–980.

Niedermuller, H., Hofecker, G., Skalicky, M., 1985. Changes of DNArepair mechanisms during the aging of the rat. Mech. Age. Dev.29, 221–238.

Oliver, F.J., Menissier-de, M.J., Nacci, C., Decker, P., Andriantsito-haina, R., Muller, S., de la Rubia, G., Stoclet, J.C., de Murcia, G.,1999. Resistance to endotoxic shock as a consequence of defectiveNF-kappaB activation in poly (ADP-ribose) polymerase-1 defi-cient mice. EMBO J. 18, 4446–4454.

Olkowski, Z.L., 1998. Mutant AP endonuclease in patients with amy-otrophic lateral sclerosis. Neuroreport 9, 239–242.

Parsons, J.L., Dianova II, Dianov, G.L., 2004. APE1 is the major 3′-phosphoglycolate activity in human cell extracts. Nucleic AcidsRes. 32, 3531–3536.

Pieper, A.A., Blackshaw, S., Clements, E.E., Brat, D.J., Krug, D.K.,White, A.J., Pinto-Garcia, P., Favit, A., Conover, J.R., Snyder,S.H., Verma, A., 2000. Poly(ADP-ribosyl)ation basally activatedby DNA strand breaks reflects glutamate-nitric oxide neurotrans-mission. Proc. Natl. Acad. Sci. U.S.A. 97, 1845–1850.

Pieper, A.A., Brat, D.J., Krug, D.K., Watkins, C.C., Gupta, A.,Blackshaw, S., Verma, A., Wang, Z.Q., Snyder, S.H., 1999.Poly(ADP-ribose) polymerase-deficient mice are protected fromstreptozotocin-induced diabetes. Proc. Natl. Acad. Sci. U.S.A. 96,3059–3064.

Prasad, R., Lavrik, O.I., Kim, S.J., Kedar, P., Yang, X.P., Vande Berg,B.J., Wilson, S.H., 2001. DNA polymerase beta -mediated longpatch base excision repair. Poly(ADP-ribose)polymerase-1 stim-ulates strand displacement DNA synthesis. J. Biol. Chem. 276,32411–32414.

Roy, R., Biswas, T., Hazra, T.K., Roy, G., Grabowski, D.T., Izumi,T., Srinivasan, G., Mitra, S., 1998. Specific Interaction of wildtype and truncated mouse N-methylpurine-DNA glycosylase withethenoadenine-containing DNA. Biochemistry 37, 580–589.

Satoh, M.S., Lindahl, T., 1992. Role of poly(ADP-ribose) formation

activity following DNA damage. Mol. Cell. Biol. 18, 3563–3571.

Masuda, Y., Bennett, R.A., Demple, B., 1998. Rapid dissociation ofhuman apurinic endonuclease (Ape1) from incised DNA inducedby magnesium. J. Biol. Chem. 273, 30360–30365.

Masutani, M., Suzuki, H., Kamada, N., Watanabe, M., Ueda, O.,Nozaki, T., Jishage, K., Watanabe, T., Sugimoto, T., Nakagama,H., Ochiya, T., Sugimura, T., 1999. Poly(ADP-ribose) polymerasegene disruption conferred mice resistant to streptozotocin-induceddiabetes. Proc. Natl. Acad. Sci. U.S.A. 96, 2301–2304.

Meira, L., Devaraj, S., Kisby, G., Burns, D., Daniel, R., Hammer, R.,Grundy, S., Jialal, I., Friedberg, E., 2001. Heterozygosity for themouse Apex gene results in phenotypes associated with oxidativestress. Cancer Res. 61, 5552–5557.

Messripour, M., Weltin, D., Rastegar, A., Ciesielski, L., Kopp, P.,Chabert, M., Mandel, P., 1994. Age-associated changes of rat brainneuronal and astroglial poly(ADP-ribose) polymerase activity. J.Neurochem. 62, 502–506.

Mol, C.D., Hosfield, D.J., Tainer, J.A., 2000a. Abasic site recognitionby two apurinic/apyrimidinic endonuclease families in DNA baseexcision repair: the 3′ ends justify the means. Mutat. Res. 460,211–229.

Mol, C.D., Izumi, T., Mitra, S., Tainer, J.A., 2000b. DNA-bound struc-tures and mutants reveal abasic DNA binding by APE1 and DNArepair coordination. Nature 403, 451–456.

Nash, H.M., Bruner, S.D., Scharer, O.D., Kawate, T., Addona, T.A.,Spooner, E., Lane, W.S., Verdine, G.L., 1996. Cloning of a yeast8-oxoguanine DNA glycosylase reveals the existence of a base-

in DNA repair. Nature 356, 356–358.Schreiber, E., Matthias, P., Muller, M.M., Schaffner, W., 1989. Rapid

detection of octamer binding proteins with ‘mini-extracts’, pre-pared from a small number of cells. Nucleic Acids Res. 17,6419.

Szabo, C., Lim, L.H., Cuzzocrea, S., Getting, S.J., Zingarelli, B.,Flower, R.J., Salzman, A.L., Perretti, M., 1997. Inhibition of poly(ADP-ribose) synthetase attenuates neutrophil recruitment andexerts antiinflammatory effects. J. Exp. Med. 186, 1041–1049.

Tomkins, J., Dempster, S., Banner, S.J., Cookson, M.R., Shaw, P.J.,2000. Screening of AP endonuclease as a candidate gene for amy-otrophic lateral sclerosis (ALS). Neuroreport 11, 1695–1697.

Tomkinson, A., Mackey, Z., 1998. Structure and function of mam-malian DNA ligases. Mutat. Res. 407, 1–9.

Tsutakawa, S., Cooper, P., 2000. Transcriptioncoupled repair of oxida-tive dna damage in human cells: mechanisms and consequences.Cold Spring Harbor Laboratory Press, p. 201.

Vidal, A.E., Boiteux, S., Hickson, I.D., Radicella, J.P., 2001. XRCC1coordinates the initial and late stages of DNA abasic site repairthrough protein–protein interactions. EMBO J. 20, 6530–6539.

Wang, Z.Q., Auer, B., Stingl, L., Berghammer, H., Haidacher, D.,Schweiger, M., Wagner, E.F., 1995. Mice lacking ADPRT andpoly(ADP-ribosyl)ation develop normally but are susceptible toskin disease. Genes Dev. 9, 509–520.

Wang, Z.Q., Stingl, L., Morrison, C., Jantsch, M., Los, M., Schulze-Osthoff, K., Wagner, E.F., 1997. PARP is important for genomicstability but dispensable in apoptosis. Gen. Dev. 11, 2358–2374.

S.R. Peddi et al. / Toxicology 224 (2006) 44–55 55

Ward, J.F., 1994. The complexity of DNA damage: relevance to bio-logical consequences. Int. J. Rad. Biol. 66, 427–432.

Waters, T.R., Gallinari, P., Jiricny, J., Swann, P.F., 1999. Humanthymine DNA glycosylase binds to apurinic sites in DNA but isdisplaced by human apurinic endonuclease 1. J. Biol. Chem. 274,67–74.

Wiederhold, L., Leppard, J.B., Kedar, P., Karimi-Busheri, F., Rasouli-Nia, A., Weinfeld, M., Tomkinson, A.E., Izumi, T., Prasad, R.,Wilson, S.H., Mitra, S., Hazra, T.K., 2004. AP endonuclease-independent DNA base excision repair in human cells. Mol. Cell.15, 209–220.

Wilson 3rd, D.M., Takeshita, M., Demple, B., 1997. Abasic sitebinding by the human apurinic endonuclease, Ape, and determi-nation of the DNA contact sites. Nucleic Acids Res. 25, 933–939.

Wilson, S.H., 1998. Mammalian base excision repair and DNA poly-merase beta. Mutat. Res. 407, 203–215.

Wilson, S.H., Kunkel, T.A., 2000. Passing the baton in base excisionrepair. Nat. Struct. Biol. 7, 176–178.

Xanthoudakis, S., Smeyne, R.J., Wallace, J.D., Curran, T., 1996. Theredox/DNA repair protein, Ref-1, is essential for early embryonicdevelopment in mice. Proc. Natl. Acad. Sci. U.S.A. 93, 8919–8923.

Yang, H., Clendenin, W.M., Wong, D., Demple, B., Slupska, M.M.,Chiang, J.-H., Miller, J.H., 2001. Enhanced activity of adenine-DNA glycosylase (Myh) by apurinic/apyrimidinic endonuclease(Ape1) in mammalian base excision repair of an A/GO mismatch.Nucleic Acids Res. 29, 743–752.

Zingarelli, B., Szabo, C., Salzman, A.L., 1999. Blockade of poly(ADP-ribose) synthetase inhibits neutrophil recruitment, oxidant genera-tion, and mucosal injury in murine colitis. Gastroenterology 116,335–345.

Zong, W.X., Ditsworth, D., Bauer, D.E., Wang, Z.Q., Thompson, C.B.,2004. Alkylating DNA damage stimulates a regulated form ofnecrotic cell death. Genes Dev. 18, 1272–1282.