Cloning and Characterization of the Human Activity-dependentNeuroprotective Protein*

Received for publication, August 15, 2000, and in revised form, September 19, 2000Published, JBC Papers in Press, September 29, 2000, DOI 10.1074/jbc.M007416200

Rachel Zamostiano‡§, Albert Pinhasov‡§, Edgar Gelber‡, Ruth A. Steingart‡, Eyal Seroussi¶,Eliezer Giladi‡, Merav Bassan‡, Yoram Wollmani, Helen J. Eyre**, John C. Mulley**‡‡,Douglas E. Brenneman§§, and Illana Gozes‡¶¶

From the ‡Department of Clinical Biochemistry, Sackler Faculty of Medicine, Tel Aviv University, Tel Aviv 69978, Israel,the ¶Institute of Animal Science, Volcani Center, Bet-Dagan 50250, Israel, the iDepartment of Nephrology, Tel AvivMedical Center, Tel Aviv 64239, Israel, the **Centre for Medical Genetics, Department of Cytogenetics and MolecularGenetics, Women’s & Children Hospital, and the ‡‡Department of Genetics, University of Adelaide, Adelaide 5006, SouthAustralia, and the §§Section on Developmental and Molecular Pharmacology, Laboratory of Developmental Neurobiology,NICHD, National Institutes of Health, Bethesda, Maryland 20892

We have recently cloned the mouse activity-depend-ent neuroprotective protein (ADNP). Here, we disclosethe cloning of human ADNP (hADNP) from a fetal braincDNA library. Comparative sequence analysis of thesetwo ADNP orthologs indicated 90% identity at the mRNAlevel. Several single nucleotide polymorphic sites werenoticed. The deduced protein structure contained ninezinc fingers, a proline-rich region, a nuclear bipartitelocalization signal, and a homeobox domain profile, sug-gesting a transcription factor function. Further compar-ative analysis identified an ADNP paralog (33% identityand 46% similarity), indicating that these genes belongto a novel protein family with a nine-zinc finger motiffollowed by a homeobox domain. The hADNP gene struc-ture spans ;40 kilobases and includes five exons andfour introns with alternative splicing of an untranslatedsecond exon. The hADNP gene was mapped to chromo-some 20q12–13.2, a region associated with aggressivetumor growth, frequently amplified in many neoplasias,including breast, bladder, ovarian, pancreatic, and co-lon cancers. hADNP mRNA is abundantly expressed indistinct normal tissues, and high expression levels wereencountered in malignant cells. Down-regulation ofADNP by antisense oligodeoxynucleotides up-regulatedthe tumor suppressor p53 and reduced the viability ofintestinal cancer cells by 90%. Thus, ADNP is implicatedin maintaining cell survival, perhaps through modula-tion of p53.

Mouse activity-dependent neuroprotective protein (mADNP),1

a novel vasoactive intestinal peptide (VIP)-responsive gene,

was recently cloned (1). The relative enrichment of mADNPtranscripts in the cerebellum, cortex, hippocampus, medulla,and midbrain and the increases found in the presence of VIP,an established neuroprotective substance (2), implied a poten-tial function in brain metabolism. Specifically, mADNP mRNAincreased 2–3-fold in astroglial cells incubated for 3 h in thepresence of nanomolar amounts of VIP (1). Another tissuecontaining increased mADNP transcripts is the mouse testis, ahighly proliferative tissue, suggesting the involvement ofADNP in cell division.

As deregulation of oncogenes has been associated with neu-rodegeneration (3), pathways that regulate neuronal survivalmay impinge upon cancer proliferation. VIP regulates bothneuronal survival and cell division (2). A system whereby la-beled VIP is suggested as a tumor marker has been proposed,localizing in vivo tumors of patients with gastrointestinal neu-roendocrine cancers as well as pancreatic and colonic adeno-carcinomas (4). Other studies have identified a very high inci-dence of VIP receptor binding in breast, ovarian, endometrial,prostate, bladder, lung, esophageal, colonic, and pancreatictumors as well as in neuroendocrine and brain tumors (5).However, the VIP effect on cancer growth depends on thespecific tumor and may be stimulatory (6, 7) or inhibitory (8). Inview of the high incidence of tumors containing VIP receptors,a potential intervention in tumor growth may employ a genedownstream of VIP action that is directly associated with stim-ulation of cell proliferation and survival.

This report mapped the human ADNP (hADNP) gene (Gen-BankTM/EBI accession number AF250860) to a chromosomalregion amplified in cancer, and ADNP mRNA expression wasfound to increase in proliferative tissues. Inhibition of ADNPprotein expression by antisense oligodeoxynucleotides resultedin marked reduction in metabolic activity in the target cellscoupled with increases in the tumor suppressor p53 (3). Fur-thermore, a paralogous protein was discovered, suggesting anovel protein family containing zinc fingers and a homeoboxdomain.

EXPERIMENTAL PROCEDURES

RNA Preparation—Neuroblastoma cells (6) were incubated in thepresence of 25 nM VIP in phosphate-buffered saline (PBS) for 3 h. TotalRNA was prepared using RNAzol B solution (Tel-Test, Inc., Friend-swood, TX). A similar extraction method was used for tumor tissues,obtained fresh, post-surgery, and frozen immediately on liquid nitrogen.

* This work was supported in part by the United States-Israel Bina-tional Science Foundation (to I. G. and D. E. B.) and the Israel ScienceFoundation. Patents have been applied for hADNP and the antisenseoligodeoxynucleotides. The costs of publication of this article were de-frayed in part by the payment of page charges. This article musttherefore be hereby marked “advertisement” in accordance with 18U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submittedto the GenBankTM/EBI Data Bank with accession number(s) AF250860.

§ Performed this work in partial fulfillment of Ph.D. requirements atTel Aviv University.

¶¶ Incumbent of the Lily and Avraham Gildor Chair for the Investi-gation of Growth Factors. To whom correspondence should be ad-dressed. Tel.: 972-3-6407240; Fax: 972-3-6408541; E-mail: igozes@post.tau.ac.il.

1 The abbreviations used are: mADNP, mouse activity-dependentneuroprotective protein; VIP, vasoactive intestinal peptide; hADNP,

human ADNP; PBS, phosphate-buffered saline; FISH, fluorescent insitu hybridization; contig, group of overlapping clones.

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 276, No. 1, Issue of January 5, pp. 708–714, 2001Printed in U.S.A.

This paper is available on line at http://www.jbc.org708

by guest, on May 10, 2010

ww

w.jbc.org

Dow

nloaded from

FIG. 1. The hADNP cDNA and gene. Shown is the hADNP sequence (based on clone H7). The left side of the sequence shows nucleotidesnumbers, and the right side shows amino acid numbers. The beginnings of the exons are labeled and indicated by downward-pointing arrows.Alternative polyadenylation sites are numbered and indicated by upward-pointing arrows: clone H4 (11); clones H6 and H2 (21); clone H10 (31);and clones H3, H5, and H7 (41). The calculated molecular mass of the protein was 12,3562.8 Da, and the theoretical pI was 6.97. Antisenseoligonucleotides are underlined and labeled (AS-1, AS-8, AS-9, AS-7, AS-67, and AS-68). Zinc finger domains are shown in boldface with dottedunderlining. The second, sixth, and seventh dotted zinc finger domains are designated as trusted by Pfam (protein families database of alignments;alignments can be trusted—certain or potential). The bipartite nuclear localization signal is shown in boldface with dotted/dashed underlining.The homeobox domain is shown in boldface with double underlining. The proline-rich region is shown in boldface with dashed underlining. Thepartial glutaredoxin (thiotransferase) active site is shown in boldface with double-dotted and dashed underlining. The leucine-rich nuclear exportsequence is as follows: 1KLAASLWLWKSDIASHF1.

Cloning and Characterization of hADNP 709

by guest, on May 10, 2010

ww

w.jbc.org

Dow

nloaded from

cDNA Isolation and Sequencing—Oligodeoxynucleotide primerswere synthesized in accordance with the mADNP cDNA sequence (Gen-BankTM/EBI accession numbers AF068198 and NM_009628) (1). Theseprimers (ACCTGCAGCAAAACAACTAT and GCTCGTTACAGATTG-TAC, sense and antisense, respectively, for the mADNP cDNA) werethereafter used for reverse transcriptase-polymerase chain reactionwith human neuroblastoma RNA, including murine mammary leuke-mia virus reverse transcriptase (Life Technologies, Inc.) and AmpliTaqDNA polymerase (PerkinElmer Life Sciences). The resulting polymer-ase chain reaction product was sequenced automatically (Applied Bio-systems sequencer) at the Weizmann Institute of Science Core Facili-ties (Rehovot, Israel). A human neuroblastoma ADNP reversetranscriptase polymerase chain reaction product utilizing primers 59-ATCTGTAGGCCAGGGTTACA-39 and 59-TTGAGGAAGTGTTACCT-GGG-39 (sense (positions 1350–1369) and antisense (positions 1653–1672), respectively) (see Fig. 1) was labeled with [a-32P]dCTP (3000Ci/mmol; Amersham Pharmacia Biotech, Buckinghamshire, UnitedKingdom). The labeled product was used to screen a cDNA libraryderived from human whole fetal brain (male-female pooled, Caucasian,19–23 weeks of gestation, cloned unidirectionally into the Uni-ZAPTMXRvector (Stratagene, La Jolla, CA)).

Northern Blot Hybridization—RNA (10–12 mg) was subjected to elec-trophoresis followed by Northern blot hybridization on 0.45-mm Nitranfilters (Schleicher & Schull, Dassel, Germany). For probe labeling, thecDNA was subjected to polymerase chain reaction as described above.rRNA stained with ethidium bromide and actin mRNA amounts wereused as internal standards (e.g. Ref. 1).

Chromosomal Mapping—The chromosomal localization of hADNPwas performed using several methods, as follows: 1) radiation hybridmapping (Stanford Human Genome Center), 2) fluorescent in situ hy-bridization (FISH) with a genomic human contig (GenBankTM/EBI ac-cession number dj914P20.02099), and 3) FISH with hADNP. The H7cDNA (see Fig. 1) was nick-translated with biotin-14-dATP and hybrid-ized in situ at a final concentration of 20 ng/ml to metaphase cells fromtwo normal males. The FISH procedure was modified from that previ-ously described (9) in that no pre-reassociation was necessary, andchromosomes were stained before analysis with both propidium iodide(as a counterstain) and the fluorescent DNA stain 4,6-diamidino-2-phenylindole for chromosome identification. Images of metaphase prep-arations were captured by a cooled CCD camera using the ChromoScanimage collection and enhancement system (Applied Imaging Interna-tional, Ltd.). FISH signals and 4,6-diamidino-2-phenylindole bandingwere merged for figure preparation.

Western Analysis—For ADNP analysis, cultures were washed withPBS and subjected to lysis (15 min, 4 °C) in a buffer containing 1 mM

EDTA, 150 mM NaCl, 0.1 mM ZnCl2, 1 mM MgCl2, 50 mM Tris (pH 8.5),0.1% SDS, and 0.1% Triton X-100. Nuclear DNA was fragmented bysonication, and supernatants (10,000 3 g, 10 min) were collected andfrozen until further measurements. For p53 analysis, cells were washedwith PBS, and cell lysis (10 min, 4 °C) was conducted in a buffercontaining 5 mM EDTA, 150 mM NaCl, 10 mM Tris (pH 7.4), 1% TritonX-100, 0.23 units/ml aprotinin, 10 mM leupeptin, 1 mM phenylmethyl-

sulfonyl fluoride, and 1 mM benzamidine. Protein supernatants werecollected following sonication by centrifugation (16,000 3 g, 20 min,4 °C). 5 mg of the soluble proteins were separated by electrophoresis ona 10% polyacrylamide gel and electrotransferred to nitrocellulose fil-ters. Membranes were treated with 10% milk 1 PBS/Tween (0.2%) for1 h and incubated overnight at 4 °C in 2% milk 1 PBS/Tween (0.2%)and the appropriate antibody. After incubation with peroxidase-conju-gated secondary antibodies (Roche Molecular Biochemicals), signalswere revealed by chemiluminescence using the ECL kit (AmershamPharmacia Biotech).

Antibody Preparation—The following commercial antibodies wereused: mouse monoclonal IgG anti-human p53 antibodies (Santa CruzBiotechnology, Santa Cruz, CA), rabbit anti-b-actin antibodies (Sigma,Rehovot), peroxidase-conjugated goat anti-mouse IgG (AffiniPure,Jackson ImmunoResearch Laboratories, Inc., West Grove, PA), andhorseradish peroxidase-linked donkey anti-rabbit Ig (Amersham Phar-macia Biotech). Anti-ADNP antibody was prepared against a syntheticpeptide (989CEMKPGTWSDESSQSEDARSSKPAAKK1015) fused tokeyhole limpet hemocyanin through the N-terminal cysteine moiety. Ina parallel experiment, the carrier protein was bovine serum albumin.Affinity chromatography was performed on the peptide attached toSepharose as described before (1).

Cell Culture and Inhibition of Growth by Antisense Oligodeoxynucle-otides—The human colon cancer cell line HT29 (10) was cultured inDulbecco’s modified Eagle’s medium supplemented with 10% heat-in-activated fetal calf serum, 2 mM L-glutamine, and 1% Pen-Strep-Nys-tatin (Biological Industries, Beit Haemek, Israel). The adherent cellswere split when a subconfluent monolayer was formed following treat-ment with 0.25 units of trypsin and 0.02% EDTA and naturalizationwith serum-containing medium. For growth inhibition experiments,subconfluent adherent cells were washed with PBS, treated with tryp-sin as described above, and resuspended in Dulbecco’s modified Eagle’smedium containing 5% fetal calf serum to a final concentration of50,000 cells/ml. 100-ml aliquots were seeded into individual wells of96-well microtiter plates (Nunclon, Nunc Brand Products, Roskilde,Denmark). Each plate had a blank column and the appropriate controls.Plates were incubated for 24 h in a humidified atmosphere containing95% air and 5% CO2 at 37 °C; the medium was then replaced to containan antisense oligodeoxynucleotide (10 mM) in Dulbecco’s modified Ea-gle’s medium without fetal calf serum. Following an additional 24-hincubation period, the medium was replaced again to contain Dulbecco’smodified Eagle’s medium and 5% fetal calf serum, and cells were sub-jected to a further 48-h incubation period. Viable cell number wasdetermined by a 3-h incubation period with the MTS reagent (CellTiter96 AQueous cell proliferation kit, Promega, Madison, WI). The MTSreagent is oxidized by active mitochondria, resulting in increases inlight absorbance at 490 nm (evaluated by a Multiscan plate reader). Forprotein preparation, cells were harvested (as described above) after a30-h incubation period.

Statistical Analysis—Analysis of variance with Student-Neuman-Kuel’s multiple comparison of means test was used to assess the results.

RESULTS

hADNP Structure—To isolate and characterize hADNP, thehuman ortholog of mADNP (1), a cDNA library derived fromhuman fetal brain (19–23 weeks of gestation) was screened,and eight clones were isolated. The complete sequences of twocDNA clones (clones H7 and H3) indicated 90% identity tomADNP at the mRNA level. Fig. 1 shows the sequence ofhADNP (clone H7) with additional deduced upstream ex-pressed sequence tags (AW453069, AW452644, AW139427,and AW17331) (11), human genomic contig sequences contain-ing ADNP (dJ914P20 contig ID 02099 and genomic clone

TABLE IExon-intron junctions of the hADNP gene

ExonNo.

mRNAlocation Gene location Exon-intron junctionsa

1 1–165 1–165 GTCAAGgtaagcccggcgccgccgcg2 166–340 2166–2340 TcctcttgttatttccatagGTGTGA. . .ACACCGgtggggtatattcattttgga3 341–453 26990–27102 taaatttttttttccaatagAAACTA. . .ATAGAAgtaagtagcatgtcattttt4 454–546 28882–28974 CttatttcactgttttctagGATTTT. . .AACCAGgtaagtggcacaggagactt5 547–4716 36479–40648 agtttttgtgtttactttagGACTAT

a Exon sequences are in uppercase; introns are in lowercase.

TABLE IIPolymorphic sites in hADNP (see Fig. 1)

Comparison among different hADNPs indicated a few polymorphicsites that result in no changes in the deduced protein.

Base No. Polymorphism Sequences found in comparison with H7

2421 G/A H7 (11)2913 C/T H7 (11)3672 A/G H7/H3 (11); dJ914P20.02099 contig.

Of the 8 hADNP clones, 50% had G, and50% had A.

3704 C/A H7/dJ914P20.02099 contig.

Cloning and Characterization of hADNP710

by guest, on May 10, 2010

ww

w.jbc.org

Dow

nloaded from

AL034553). Table I shows the exon-intron junctions of the fiveexons of the gene. The estimated gene size is 40,647 base pairs.A CpG island that stretches over 1135 bases as predicted byGRAIL was observed around exon 1 (69% GC). As particularlyCG-rich dinucleotides have been previously associated withpromoter regions, we tested this sequence using promoter pre-diction programs TSSW and TSSG. Results gave low scoringpromoter (TSSW at base 106 with LDF 5.69 (LDF 5 statisticalpromoter score . 4.00 indicates a potential promoter); TSSGgave no promoter). Alternative splicing of the second exon hasbeen observed in expressed sequence tags (AI827420 andAW007743). Only the three 39-exons are protein-coding. Theproximal gene upstream of the ADNP gene is DPM1 (dolichyl-phosphate mannosyltransferase polypeptide 1 catalytic sub-unit) separated by 3438 base pairs.

At the protein structure level (Fig. 1), nine potential zinc

finger motifs that are identical between hADNP and mADNP(1) were identified. These zinc finger domains (12), a proline-rich region (12), a nuclear bipartite localization signal (13), anda partial homeobox domain profile (14) suggest nuclear local-ization (12–14). Furthermore, a glutaredoxin active site (15) aswell as a leucine-rich nuclear export sequence (16) were found.One striking difference between mouse and human was a poly-glutamic acid stretch of nine residues in mouse (1) shortened toone residue in human (position 931) (Fig. 1).

The second cDNA clone (H3) was identical to clone H7 exceptfor several polymorphic regions (Table II) and utilization of adifferent polyadenylation site (Fig. 1). Moreover, clone H3 con-tained a frameshift mutation (an additional A nucleotide atposition 3393) (Fig. 1), with a premature termination codon atposition 3408 (Fig. 1). Unexpectedly, the H3 cDNA containedan additional protein-coding sequence downstream of a short

FIG. 2. The ADNP gene is conserved among species. Comparative studies identified a new family member, KIAA0863. Dashed lines are zincfinger domains; the solid line is a presumptive homeobox domain region.

Cloning and Characterization of hADNP 711

by guest, on May 10, 2010

ww

w.jbc.org

Dow

nloaded from

poly(A) stretch, encoding the human immunodeficiency virusTat TBP1 protein (transactivator-binding protein 1) (17, 18).

Comparative analysis utilizing BLAST identified part of ratADNP (GenBankTM/EBI accession number AAF40431) (90%identity) (Fig. 2). Further analysis revealed 33% identity and46% similarity to the paralogous brain protein KIAA0863 (Gen-BankTM/EBI accession number AB020670) (19). This protein re-vealed similar nine-zinc finger domains and a similar homeoboxdomain as found in ADNP, suggesting a new gene family (Fig. 2).

hADNP Expression—Northern blot hybridization utilizingmADNP (1) and hADNP identified one major mRNA band (5.5kilobases) (Fig. 3A). This mRNA showed increased expressionin the heart, skeletal muscle, kidney, and placenta. As ADNPwas originally cloned from embryonic brain tissue (see aboveand also Ref. 1), further analysis of different brain regions wasperformed (Fig. 3B). The results indicated increased expressionin the cerebellum and cortex (Fig. 3B). Serial analysis of geneexpression was also performed. The results obtained suggestedincreased expression in tumor tissues, adenocarcinoma (breastand ovaries), medulloblastoma (brain), and glioblastoma(brain) and colon cancer. In normal tissues, ADNP sequenceswere found in microvascular endothelial cells and in brain(mostly white matter). Serial analysis of gene expression of therelated KIAA0863 (cDNA isolated from human brain; Gen-BankTM/EBI accession number AB020670) revealed increasedexpression in tumors (colon and prostate) and in brain whitematter as well as in the kidney and testis.

Chromosomal Localization—20 metaphase cells from a nor-mal male were examined by FISH. All of these metaphase cellsshowed signal on one or both chromatids of chromosome 20 inthe region 20q12–13.2; 40% of this signal was at 20q12, 32%was at 20q13.1, and 28% was at 20q13.2 (Fig. 4). Similarresults were obtained utilizing public data bases, localizing thegene to chromosome 20q13.2 (with identity to the orderedmarkers G30243 and W45435 in linkage to the Genome DataBase locus D20S831) and to 20q13.13–13.2 utilizing a humancontig sequence containing the hADNP gene. KIAA0863 waslocalized to human chromosome 18 using public data bases.

hADNP and Cancer—Since serial analysis of gene expres-sion identified increased ADNP expression in cancer cell linesand since the chromosomal region 20q12–13 is amplified in awide variety of tumors (19–23), we investigated the associationof hADNP with cancer growth. Three lines of experimentalstudies were conducted. 1) hADNP mRNA was quantitated inhuman primary cancer tissue (breast and colon) in comparisonwith adjacent normal tissue and was shown to be significantlyincreased in the cancer. A 2.5–3.5-fold increase was observed incolon cancer (data not shown). The increased expression wasmost evident in breast cancer and was 14.4 6 4.6-fold (mean 6S.E.). When the ADNP mRNA content was compared with theactin mRNA content in the same breast cancer samples, theincrease was 10.9 6 5-fold (Fig. 5).

2) Six antisense oligodeoxynucleotides were synthesized(Fig. 1) and further utilized to inhibit cell proliferation. The

FIG. 3. Patterns of expression of the hADNP mRNA. A, masterblot (human 12-lane multiple tissue Northern blot 7780-1, CLON-TECH, Palo Alto, CA). Lane 1, brain; lane 2, heart; lane 3, skeletalmuscle; lane 4, colon; lane 5, thymus; lane 6, spleen; lane 7, kidney; lane8, liver; lane 9, small intestine; lane 10, placenta; lane 11, lung; lane 12,peripheral blood leukocytes. B, hADNP mRNA in brain tissues. Thehuman brain RNA master blot (7755-1) was purchased from CLON-TECH. Hybridization was performed as described under “ExperimentalProcedures.” Lane 1, cerebellum; lane 2, cerebral cortex; lane 3, me-dulla; lane 4, spinal cord; lane 5, occipital lobe; lane 6, frontal lobe; lane7, temporal lobe; lane 8, putamen. kb, kilobases.

FIG. 4. Chromosomal localization of hADNP. Shown are photo-graphs and idiogram (insert) of the hybridization sites of clone H7. Atotal of two nonspecific background dots were observed in the 20 met-aphases tested. A similar result was obtained from hybridization of theprobe to 10 metaphases from a second normal male (not shown). Tworepresentative pictures are shown.

Cloning and Characterization of hADNP712

by guest, on May 10, 2010

ww

w.jbc.org

Dow

nloaded from

oligodeoxynucleotides were chosen as complementary to the59-most methionines (indicated in Fig. 1). The results showedthat antisense oligodeoxynucleotide 1 inhibited cell division(measured as metabolic activity) in the human intestinal can-cer cell line HT29 (p , 0.001) (Fig. 6). A similar inhibition wasobserved with antisense oligodeoxynucleotide 8 (p , 0.001)(Fig. 6). Furthermore, antisense oligodeoxynucleotide 9 inhib-ited by ;37.5 6 3%, and antisense oligodeoxynucleotide 68 alsoinhibited growth (by 45 6 3%; p , 0.001). In contrast to anti-sense oligodeoxynucleotides 8 and 9, the sequence of antisenseoligodeoxynucleotide 68 is shared by other cDNA sequences;hence, it may not be specific. Further specificity was deter-mined with a control sense oligodeoxynucleotide complemen-tary to antisense oligodeoxynucleotide 8 and with an antisenseoligodeoxynucleotide 8 with all internucleotide bonds of thephosphorothioated type (Fig. 6). In addition, antisense oligode-oxynucleotides 7 and 67 did not inhibit growth.

3) To determine that the antisense oligodeoxynucleotidesindeed inhibited ADNP expression, Western blot analyses wereperformed with actin and the tumor suppressor p53 as internalstandards. The results show that ADNP (114,000 Da) wasdecreased by ;3-fold in comparison with actin (densitometricscan results: 1.11 6 0.23 versus 0.31 6 0.11, respectively; p ,0.023; n 5 3), whereas p53 levels showed an apparent increase(1.04 6 0.04 versus 2.41 6 0.41; p , 0.029; n 5 3) (Fig. 7).

DISCUSSION

This report characterizes the hADNP gene, encoding anmRNA that is abundantly expressed in distinct normal tissuesand that may be alternatively spliced. The 59-untranslatedregion of the mRNA is GC-rich, as has been recently shown forseveral other genes (e.g. Refs. 24–26). hADNP was found tocontain zinc fingers and a homeobox domain profile. Further-more, a family including at least two genes of significant ho-mologies is described.

Based on cDNA and deduced protein sequence (12–14),hADNP and KIAA0863 may represent nuclear DNA-bindingproteins, putative transcription factors. The thiotransferase/glutaredoxin active site (15) found in ADNP (Fig. 1) may mod-ulate its own DNA binding activity or that of other DNA-binding proteins in response to oxidative stress and signaltransduction pathways implicated in the redox state of the cell(27). We have previously hypothesized that mADNP is a se-creted protein (1). To reconcile this discrepancy, one hypothesismay involve alternate utilization of the seven putative initiatormethionine residues at the N terminus of hADNP (Fig. 1),resulting in processing pathways that may yield secreted por-tions. An alternative hypothesis was put forward by us in a

recent report suggesting the existence of a nuclear export sig-nal within the ADNP mRNA (Fig. 1) (28). A similar sequencewas discovered in the engrailed transcription factor (16) as wellas in the ADNP-related protein KIAA0863.

The ADNP-containing locus, the 20q12–13.2 chromosomalregion, is amplified in many tumors (19–23). In breast tumors,comparative genomic hybridization revealed ;20 regions ofrecurrent increased DNA sequence copy number (23, 29–31).These regions are predicted to encode dominant genes that mayplay a role in tumor progression or response to therapy. Threeof these regions have been associated with established onco-genes: ERBB2 at 17q12, MYC at 8q24, and CCND1 and EMS1at 11q13. Amplification at 20q13 occurs in a variety of tumortypes, but up to date, does not involve a previously knownoncogene (20). Another aspect of ADNP/cancer/neuroprotectioninteraction is the fact that ADNP and p53 expression may beinterrelated, as shown here, and both proteins may influencetumor growth as well as brain function (1, 3).

The hADNP cDNA (clone H3) contained the TBP1 cDNAsequence downstream of the coding region of ADNP. Previ-ously, the TBP1 gene was localized to chromosome 11p12–13(18), and the TBP1 gene product was associated with the cellcycle. The finding of TBP1 downstream of hADNP either maybe trivial, resulting from molecular cloning manipulations, ormay indicate translocation involved with cancer abnormalities.

The discovery of ADNP (1) as a VIP-responsive gene inastroglial cells (a major component of brain white matter) isnow extended to the serial analysis of gene expression findingof ADNP-encoding sequences in brain (mostly white matter) aswell as in microvascular endothelial cells. VIP-binding siteshave been described in astrocytes (32) as well as in endothelialcells (33). In both cases, developmental functions (33, 34) andproliferation (34–36)/survival (32, 37) functions have been hy-pothesized. The homeobox-containing protein ADNP may thusmediate some of the VIP developmental/survival-associated ef-

FIG. 5. ADNP mRNA content is increased in tumors. RNA wasextracted from human primary tumors (breast) and from adjacent nor-mal tissue and subjected to Northern blot hybridization. C, controltissue; T, tumor. This is a breast cancer sample from a 48-year-oldfemale. Shown are autoradiograms of ADNP and actin mRNAs andethidium bromide-stained RNA.

FIG. 6. HT29 cell growth is inhibited in the presence of anti-sense oligodeoxynucleotides specific for ADNP mRNA. Five oli-godeoxynucleotides were synthesized (see Fig. 1) and utilized to inhibitcancer growth. A representative figure is shown. Bar 1, control; bar 2,antisense oligodeoxynucleotide 1; bar 3, sense oligodeoxynucleotide 8;bar 4, antisense oligodeoxynucleotide 8; bar 5, antisense 8 with allinternucleotide bonds of the phosphorothioated type.

FIG. 7. Western blot analysis: reduction in ADNP in HT29 cellsin comparison with actin and p53. Experiments were performed asdescribed under “Experimental Procedures.” 2, no antisense oligode-oxynucleotide; 1, cells incubated in the presence of the antisenseoligodeoxynucleotide.

Cloning and Characterization of hADNP 713

by guest, on May 10, 2010

ww

w.jbc.org

Dow

nloaded from

fects involving normal growth and cancer proliferation. Theabundance of ADNP mRNA in heart, skeletal muscle, kidney,and placenta may represent, in part, an astrocyte-like cellpopulation (38) or enrichment in blood microvessels (39). In-deed, the original characterization of VIP was as a vasodilator(40); and since endothelial cells play a major role in vasodila-tation, endothelial ADNP points toward a new avenue for re-search on potential VIP/ADNP interactions.

Our original findings related ADNP to VIP-mediated neuro-protection. Thus, ADNP mRNA increased in glial cells incu-bated with VIP, and a very short peptide fragment derivedfrom ADNP (NAPVSIPQ, termed NAP) provided potent neuro-protection (1). Given the abundant expression of ADNP, futureexperiments are aimed at further assessing the question ofgeneral normal cell protection and of secreted processed formsof ADNP providing cellular protection against external toxicity.The increased ADNP mRNA expression in the cerebellum (astructure enriched in VIP-binding sites) (41) suggests a furtheravenue of research dealing with tissue-specific expression andfunction.

From a clinical perspective, this report provides methods ofusing hADNP nucleic acid probes to detect and identify patho-logically proliferating cells, including cancer cells. Further-more, our results suggest that ADNP is important for cellsurvival, and the antisense ADNP oligodeoxynucleotides maybe developed as antitumor therapeutics.

Acknowledgments—We are grateful to Prof. Samuel Berkovic forinvaluable help with the chromosomal mapping. We are grateful toJoshua Steinerman and Sharon Furman for critical reading of themanuscript.

REFERENCES

1. Bassan, M., Zamostiano, R., Davidson, A., Pinhasov, A., Giladi, E., Perl, O.,Bassan, H., Blat, C., Gibney, G., Glazner, G., Brenneman, D. E., and Gozes,I. (1999) J. Neurochem. 72, 1283–1293

2. Gozes, I., Fridkin, M., Hill, J. M., and Brenneman, D. E (1999) Curr. Med.Chem. 6, 1019–1034

3. Amson, R., Lassalle, J. M., Halley, H., Prieur, S., Lethrosne, F., Roperch, J. P.,Israeli, D., Gendron, M. C., Duyckaerts, C., Checler, F., Dausset, J., Cohen,D., Oren, M., and Telerman, A. (2000) Proc. Natl. Acad. Sci. U. S. A. 97,5346–5350

4. Virgolini, I. (1997) Eur. J. Clin. Invest. 27, 793–8005. Reubi, J. C. (1996) Ann. N. Y. Acad. Sci. 805, 753–7596. Lilling, G., Wollman, Y., Goldstein, M. N., Rubinraut, S., Fridkin, M.,

Brenneman, D. E., and Gozes, I. (1995) J. Mol. Neurosci. 5, 231–2397. Zia, H., Hida, T., Jakowlew, S., Birrer, M., Gozes, Y., Reubi, J. C., Fridkin, M.,

Gozes, I., and Moody, T. W. (1996) Cancer Res. 56, 3486–34898. Maruno, K., Absood, A., and Said, S. I. (1998) Proc. Natl. Acad. Sci. U. S. A. 95,

14373–143789. Callen, D. F., Baker, E., Eyre, H. J., Chernos, J. E., Bell, J. A., and Sutherland,

G. R. (1990) Ann. Genet. 33, 219–22110. Tew, K. D., O’Brien, M., Laing, N. M., and Shen, H. (1998) Chem. Biol.

Interact. 111–112, 199–21111. Nagase, T., Ishikawa, K., Suyama, M., Kikuno, R., Hirosawa, M., Miyajima,

N., Tanaka, A., Kotani, H., Nomura, N., and Ohara, O. (1998) DNA Res. 5,277–286

12. Taguchi, E., Muramatsu, H., Fan Q. W., Kurosawa, N., Sobue, G., andMuramatsu, T. J. (1998) J. Biochem. (Tokyo) 124, 1220–1228

13. Williams, S. C., Angerer, N. D., and Johnson, P. F. (1997) Gene Expr. 6,371–385

14. Gehring, W. J., Affolter, M., and Burglin, T. (1994) Annu. Rev. Biochem. 63,487–526

15. Johnson, G. P., Goebel, S. J., Perkus, M. E., Davis, S. W., Winslow, J. P., andPaoletti, E. (1991) Virology 181, 378–381

16. Maizel, A., Bensaude, O., Prochiantz, A., Joliot, A., and Nelbock, P. (1999)Development 126, 3183–3890

17. Dillom, P. J., Perkin, A., and Rosen, C. A. (1990) Science 248, 1650–165318. Hoyle, J., Tan, K. H., and Fisher, E. M. (1997) Hum. Genet. 99, 285–28819. Nagase, T., Ishikawa, K., Suyama, M., Kikuno, R., Hirosawa, M., Miyajima,

N., Tanaka, A., Kotani, H., Nomura, N., and Ohara, O. (1998) DNA Res. 5,355–364

20. Collins, C., Rommens, J. M., Kowbel, D., Godfrey, T., Tanner, M., Hwang, S.,Polikoff, D., Nonet, G., Cochran, J., Myambo, K., Jay, K. E., Froula, J.,Cloutier, T., Kuo, W.-L., Yaswen, P., Dairkee, S., Giovanola, J., Hutchinson,G. B., Isola, J., Kallioniemi, O.-P., Palazzolo, M., Martin, C., Ericsson, C.,Pinkel, D., Albertson, D., Li, W.-B., and Gray, J. W. (1998) Proc. Natl. Acad.Sci. U. S. A. 95, 8703–8708

21. Palmedo, G., Fischer, J., and Kovacs, G. (1997) Lab. Invest. 77, 633–66822. El-Rifai, W., Harper, J. C., Cummings, O. W., Hyytinen, E. R., Frierson, H. F.,

Jr., Knuutila, S., and Powell, S. M. (1998) Cancer Res. 58, 34–3723. Sonoda, G., Palazzo, J., du Manoir, S., Godwin, A. K., Feder, M., Yakushiji, M.,

and Testa, J. R. (1997) Genes Chromosomes Cancer 20, 320–32824. Zabarovsky, E. R., Gizatullin, R., Podowski, R. M., Zabarovska, V. V., Xie, L.,

Muravenko, O. V., Kozyrev, S., Petrenko, L., Skobeleva, N., Li, J.,Protopopov, A., Kashuba, V., Ernberg, I., Winberg, G., and Wahlestedt, C.(2000) Nucleic Acids Res. 28, 1635–1639

25. Jeong, J., Choi, S., Gu, C., Lee, H., and Park S. (2000) DNA Cell Biol. 19,291–300

26. Reichwald, K., Thiesen, J., Wiehe, T., Weitzel, J., Poustka, W. A., Rosenthal,A., Platzer, M., Stratling, W. H., and Kioschis, P. (2000) Mamm. Genome 11,182–190

27. Kallioniemi, A., Kallioniemi, O.-P., Piper, J., Tanner, M., Stokke, T., Chen, L.,Smith, H. S., Pinkel, D., Gray, J. W., and Waldman, F. M. (1994) Proc. Natl.Acad. Sci. U. S. A. 91, 2156–2160

28. Gozes, I., Zamostiano, R., Pinhasov, A., Bassan, M., Giladi, E., Steingart, R. A.,and Brenneman, D. E. (2000) Ann N. Y. Acad. Sci. U. S. A., in press

29. Bandyopadhyay, S., Starke, D. W., Mieyal, J. J., and Gronostajski, R. M. (1998)J. Biol. Chem. 273, 392–397

30. Isola, J. J., Kallioniemi, O.-P., Chu, L. W., Fuqua, S. A., Hilsenbeck, S. G.,Osborne, C. K., and Waldman, F. M. (1995) Am. J. Pathol. 147, 905–911

31. Albertson, D. G., Ylstra, B., Segraves, R., Collins C., Dairkee S. H., Kowbel D.,Kuo W. L., Gray, J. W., and Pinkel, D. (2000) Nat. Genet. 25, 144–146

32. Gozes, I., Mccune, S. K., Jacobson, L., Warren, D., Moody, T. W., Fridkin, M.,and Brenneman, D. E. (1991) J. Pharmacol. Exp. Ther. 257, 959–966

33. Lange, D., Funa, K., Ishisaki, A., Bauer, R., and Wollina, U. (1999) Histol.Histopathol. 14, 821–825

34. Gressens, P., Hill, J. M., Gozes I., Fridkin, M., and Brenneman, D. E. (1993)Nature 362, 155–158

35. Brenneman, D. E., Nicol, T., Warren, D., and Bowers, L. M. (1990) J. Neurosci.Res. 25, 386–394

36. Zupan, V., Hill, J. M., Brenneman, D. E., Gozes, I., Fridkin, M., Robberecht, P.,Evrard, P., and Gressens, P. (1998) J. Neurochem. 70, 2165–2173

37. Ashur-Fabian, O., Giladi, E., Brenneman, D. E., and Gozes, I. (1997) J. Mol.Neurosci. 9, 211–222

38. Buniatian, G., Gebhardt, R., Traub, P., Mecke, D., and Osswald, H. (1999) Biol.Cell 91, 675–684

39. Said, S. I., and Mutt, V. (1972) Eur. J. Biochem. 28, 199–20440. Lee, T. J. (2000) J. Biomed. Sci. 7, 16–2641. Hill, J. M., Lee, S. J., Dibbern, D. A., Fridkin, M., Gozes, I., and Brenneman

D. E. (1999) Neuroscience 93, 783–791

Cloning and Characterization of hADNP714

by guest, on May 10, 2010

ww

w.jbc.org

Dow

nloaded from