the molecular pathogenesis of noonan syndrome-associated ... · 1.2 noonan syndrome and the...
TRANSCRIPT
THE MOLECULAR PATHOGENESIS OF NOONAN
SYNDROME-ASSOCIATED RAF1 MUTATIONS
by
Xue Wu
A thesis submitted in conformity with the requirements
for the degree of Doctor of Philosophy
Department of Medical Biophysics
University of Toronto
© Copyright by Xue Wu 2013
ii
THE MOLECULAR PATHOGENESIS OF NOONAN SYNDROME-
ASSOCIATED RAF1 MUTATIONS
Xue Wu
Doctor of Philosophy
Department of Medical Biophysics
University of Toronto
2013
ABSTRACT
Noonan syndrome (NS) is one of several autosomal dominant “RASopathies” caused by
mutations in components of the RAS-RAF-MEK-ERK MAPK pathway. Germ line mutations in
RAF1 (encoding the serine-threonine kinase for MEK1/2) account for ~3-5% of NS, and unlike
other NS alleles, RAF1 mutations that confer increased kinase activity are highly associated with
hypertrophic cardiomyopathy (HCM). Notably, some NS-associated RAF1 mutations show
normal or decreased kinase activity. To explore the pathogenesis of such mutations, I generated
“knock-in” mice that express kinase-activating (L613V) or -impaired (D486N) Raf1 mutants,
respectively. Knock-in mice expressing the kinase-activated allele Raf1L613V developed typical
NS features (short stature, facial dysmorphia, haematological abnormalities), as well as HCM.
As expected, agonist-evoked Mek/Erk activation was enhanced in multiple cell types expressing
Raf1L613V. Moreover, postnatal Mek inhibition normalized the growth, facial, and cardiac defects
in L613V/+ mice, showing that enhanced Mek/Erk activation by Raf1 mutant is critical for
evoking NS phenotypes. D486N/+ female mice exhibited a mild growth defect. Male and female
iii
D486N/D486N mice developed concentric cardiac hypertrophy and incompletely penetrant, but
severe, growth defects. Remarkably, Mek/Erk activation was enhanced in Raf1D486N-expressing
cells compared with controls. In both mouse and human cells, RAF1D486N, as well as other
kinase-impaired RAF1 mutants, show increased heterodimerization with BRAF, which is
necessary and sufficient to promote increased MEK/ERK activation. Furthermore, kinase-
activating RAF1 mutants also require heterodimerization to enhance MEK/ERK activation. Our
results suggest that increased heterodimerization ability is the common pathogenic mechanism
for NS-associated RAF1 mutations.
iv
ACKNOWLEDGMENTS
Foremost, I would like to thank my supervisor Dr. Benjamin Neel for all your guidance,
continuous support and encouragement during my Ph.D study. You have been a tremendous
mentor for me with your immense knowledge, inspiration, enthusiasm, and criticism. I also thank
you for the critical reading of this thesis.
I am very grateful to Dr. Toshiyuki Araki as a co-supervisor for my research project.
Thank you for sharing your knowledge, good discussions and friendship.
I thank the Department of Medical Biophysics at University of Toronto for giving me the
opportunity to study here. I greatly appreciate the insightful discussions and comments from all
my supervisory committee members, Dr. Peter Backx, Dr. Vuk Stambolic and Dr. Benjamin
Alman. Your advice on both research, as well as on my career, have been invaluable.
This research project would not have been possible without the help of many people.
Special thanks to Dr. Peter Backx and Dr. Jeremy Simpson as important collaborators on the
cardiology studies of my mouse model. Dr. Jeremy Simpson performed all the echocardiography,
invasive hemodynamic analysis and transverse aortic constriction experiments. Our collaboration
has continued after he established his own lab at the University of Guelph. Thanks to Dr.
Kyoung-Han Kim for preparing the neonatal cardiomyocytes for me, and for your patience in
teaching me this technique. I also thank Dr. Tara Paton at The Centre for Applied Genomics
(TCAG) at SickKids for helping me with the mouse genotyping array and Dr. Pingzhao Hu in the
same facility for providing statistical analysis support. I would also like to thank Dr. Jason
Moffat (University of Toronto) for providing lentiviral shRNA vectors and Dr. Bruce Gelb (Mt
Sinai Hospital, NY) for provding the human RAF1 cDNA construct used in my research.
I am thankful to all of the past and present members in the Neel lab, Jocelyn Stewart, Rob
Karish, Shengqing Gu, Xiannan Wang, Peter Bayliss, Angel Sing, Cathy Iorio, Gordon Chan,
Ziqiang Yang, Richard Marcotte, Dong Hu, Robert Banh, Yang Xu, Lingyan Jiang, Anderson
Chang, Erica Tiberia, Kwan Ho Tang, Paulina Cybulska, Richard Chan and many others. The
group has been a source of friendships, as well as good advice and collaboration. All of them
made my study in this lab a cherished memory. Thank you Shengqing Gu for your help of
v
analyzing the hematological defects in my mice, and for your biostatistics support. I am honored
to have had the opportunity to supervise two talented and hard-working summer students, Jenny
Hong and Connie Yin. I am grateful for all their help in many aspects of my project. I also would
like to thank our previous lab member, Dr. Nirusha Thavarajah, for synthesizing the MEK
inhibitor. I thank Peter Bayliss, and Angel Sing for their technical support, and our lab manager,
Cathy Iorio, for making the lab organized and functional.
The Frederick Banting and Charles Best Canada Graduate Scholarship from Canadian
Institutes of Health Research (CIHR) is greatly appreciated. This research also was supported by
grants from the CIHR, the National Institutes of Health (NIH) and the Heart and Stroke
Foundation of Ontario (H&SFO).
Finally, I dedicate this thesis to my parents, Feng Yu and Shouzhi Wu, my husband,
Kevin Hu, and my beloved daughter, Claire Hu, for their constant support and unconditional love.
vi
TABLE OF CONTENTS
ABSTRACT II
ACKNOWLEDGMENTS IV
TABLE OF CONTENTS VI
LIST OF FIGURES X
LIST OF TABLES XIV
LIST OF ABBREVIATIONS XV
CHAPTER 1 INTRODUCTION 1
1.1 The RAS-RAF-MEK-ERK MAPK pathway 2
1.1.1 MAPK pathways 2
1.1.2 The RAS-RAF-MEK-ERK MAPK pathway 5
1.2 Noonan syndrome and the RASopathies 13
1.2.1 Noonan syndrome 13
1.2.2 RASopathies: disorders clinically related to Noonan syndrome 21
1.2.3 Noonan syndrome mouse models 25
1.3 Function and regulation of RAF1 26
1.3.1 Structure of RAF family kinases 27
1.3.2 Regulation of RAF1 29
1.3.3 MEK-independent functions of RAF1 39
1.4 Hypertrophic cardiomyopathy and the RAS/ERK pathway 41
1.4.1 Cardiac hypertrophy and hypertrophic cardiomyopathy 41
1.4.2 Signaling pathways involved in cardiac hypertrophy 45
vii
1.5 Rationale and hypothesis 50
CHAPTER 2 MATERIALS AND METHODS 52
2.1 Mice 53
2.1.1 Generation of Raf1L613V knock-in mice 53
2.1.2 Generation of Raf1D486N knock-in mice 55
2.2 Cell culture 57
2.2.1 Mouse embryonic stem (ES) cells 57
2.2.2 Mouse embryonic fibroblasts (MEFs) 57
2.2.3 Neonatal cardiomyocytes and cardiac fibroblasts 58
2.2.4 Flp-In T-REx 293 cell lines 58
2.3 Generation of Flp-In T-REx 293 expression cell lines 59
2.4 Inducible RAF1/BRAF heterodimerization 59
2.5 Lentivirus production and transduction 59
2.6 Retrovirus production and transduction 60
2.7 Biochemical analysis 60
2.8 Body size analysis and morphometry 61
2.9 Histology and immunohistochemistry 61
2.10 BrdU incorporation assays 62
2.11 Hematopoietic analysis 62
2.12 Echocardiographic and hemodynamic measurements 62
2.13 Transverse aortic constriction (TAC) 63
2.14 MEK inhibitor treatment 63
viii
2.15 Quantitative real time RT-PCR 64
2.16 Statistics 64
CHAPTER 3 MEK-ERK PATHWAY MODULATION AMELIORATES DISEASE
PHENOTYPES IN A MOUSE MODEL OF NOONAN SYNDROME ASSOCIATED
WITH THE RAF1L613V MUTATION 65
3.1 Abstract 66
3.2 Background 66
3.3 Results 70
3.3.1 Generation of L613V/+ mice 70
3.3.2 L613V/+ mice show multiple NS phenotypes 72
3.3.3 L613V/+ mice show cardiac hypertrophy with chamber dilatation 72
3.3.4 Enhanced hypertrophic response and functional decompensation in L613V/+ hearts
following pressure overload
81
3.3.5 The Raf1L613V mutant increases Mek and Erk activation in response to multiple stimuli
85
3.3.6 MEK inhibitor treatment normalizes NS phenotypes in L613V/+ mice 95
3.4 Discussion 102
CHAPTER 4 INCREASED BRAF HETERODIMERIZATION IS THE COMMON
PATHOGENIC MECHANISM FOR NOONAN SYNDROME-ASSOCIATED RAF1
MUTANTS 106
4.1 Abstract 107
4.2 Background 107
4.3 Results 109
4.3.1 Generation of Raf1D486N mice 109
ix
4.3.2 Phenotypes of D486N/+ and D486N/D486N mice 112
4.3.3 Raf1D486N expression increases Mek/Erk activation in response to multiple stimuli 113
4.3.4 Quantitative differences in effects of NS-associated Raf1 D486N and L613V mutants
on Mek/Erk activation 117
4.3.5 Kinase-impaired Raf1 mutants enhance Mek/Erk activation by promoting
heterodimerization with Braf
124
4.3.6 Heterodimerization with BRAF is required for RAF1D486N to enhance MEK/ERK
activation 127
4.4 Discussion 138
CHAPTER 5 SUMMARY AND FUTURE DIRECTIONS 143
5.1 Summary and Key Findings 144
5.2 Future Directions 145
5.2.1 Optimizing therapy for NS-associated HCM 145
5.2.2 Downstream target(s) of the RAS/ERK signaling in NS and HCM 150
5.2.3 Cell(s)-of-origin for Raf1 mutant-induced HCM 153
5.2.4 The roles of specific Erk isoforms in Raf1-induced HCM 158
5.2.5 Genetic modifiers in D486N/D486N mice 163
5.3 Concluding Remarks 169
References 170
x
LIST OF FIGURES
Figure 1-1. Schematic overview of MAPK pathways. ................................................................... 3
Figure 1-2. Schematic representation of the structure of RAS-RAF-MEK-ERK MAPK pathway.
......................................................................................................................................................... 6
Figure 1-3. Downstream targets of ERK signaling. ...................................................................... 11
Figure 1-4. Facial dysmorphism in Noonan syndrome. ................................................................ 15
Figure 1-5. RASopathies and the RAS-RAF-MEK-ERK MAPK pathway. ................................ 18
Figure 1-6. RAF1 domain structure and location of residues altered in NS. ................................ 20
Figure 1-7. Common structure of RAF proteins. .......................................................................... 28
Figure 1-8. Overview of RAF1 activation/deactivation. .............................................................. 31
Figure 1-9. Regulatory phosphorylation sites of RAF proteins. ................................................... 32
Figure 1-10. Allosteric mechanism for activation of the kinase domain of RAF1. ...................... 36
Figure 1-11. Scaffolding proteins in RAF-MEK-ERK signaling. ................................................ 37
Figure 1-12. MEK-independent RAF1 signaling pathways. ........................................................ 40
Figure 1-13. Types of cardiac hypertrophy. .................................................................................. 43
Figure 1-14. Signaling pathways involved in cardiac hypertrophy. ............................................. 47
Figure 3-1.Generation of inducible Raf1L613V knock-in mice. ..................................................... 71
Figure 3-2. Short stature in L613V/+ mice. .................................................................................. 73
Figure 3-3. L613V/+ mice have facial dysmorphia. ..................................................................... 74
Figure 3-4. L613V/+ mice have hematological defects. ............................................................... 75
Figure 3-5. L613V/+ mice show cardiac hypertrophy with normal cardiomyocyte proliferation
and valve development. ................................................................................................................ 77
Figure 3-6. L613V/+ mice show cardiac hypertrophy with chamber dilatation. .......................... 79
xi
Figure 3-7. L613V/+ mice show a shift from alpha-Mhc to beta-Mhc expression in hearts. ...... 83
Figure 3-8. Abnormal response of L613V/+ mice to pressure overload. ..................................... 84
Figure 3-9. Severe perivascular fibrosis and infarct in L613V/+ mice after TAC. ...................... 86
Figure 3-10. Echocardiographic parameters in WT and L613V/+ mice following pressure
overload. ........................................................................................................................................ 87
Figure 3-11. Hemodynamic parameters in WT and L613V/+ mice following pressure overload.
....................................................................................................................................................... 88
Figure 3-12. Raf1L613V mutant causes increased Mek and Erk activation in multiple cell types. 90
Figure 3-13. Raf1L613V mutant increases Mek and Erk activation in cardiomyocytes. ................. 91
Figure 3-14. Raf1L613V mutant increases Mek and Erk activation in cardiac fibroblasts. ............ 92
Figure 3-15. Enhanced Mek and Erk activation in L613V/+ hearts after pressure overload. ...... 93
Figure 3-16. Other signaling pathways are unaffected in neonatal cardiac myocytes and
fibroblasts. ..................................................................................................................................... 94
Figure 3-17. MEK inhibitor treatment rescues growth defect and cardiac hypertrophy in L613V/+
mice. .............................................................................................................................................. 97
Figure 3-18. Normalized cardiac morphology and function after MEK inhibitor treatment. ....... 98
Figure 3-19. MEK inhibitor treatment normalizes cardiac function in L613V/+ mice. ............... 99
Figure 3-20. Early post-natal MEK inhibitor treatment rescues facial dysmorphia in L613V/+
mice. ............................................................................................................................................ 101
Figure 4-1. Generation of Raf1D486N knock-in mice. .................................................................. 111
Figure 4-2. Phenotypes of D486N/+ and D486N/D486N mice. ................................................. 115
Figure 4-3. Additional phenotyping of D486N/+ and D486N/D486N mice. ............................. 116
Figure 4-4. Raf1D486N mutant increases Mek and Erk activation. ............................................... 119
Figure 4-5. Mek/Erk activation in WT and D486N/D486N neonatal cardiomyocytes. ............. 120
xii
Figure 4-6. Mek/Erk activation in WT and D486N/D486N neonatal cardiac fibroblasts. ......... 121
Figure 4-7. NS-associated Raf1 mutants differentially activate Mek/Erk. ................................. 123
Figure 4-8. Severity of cardiac phenotype in D486N/D486N and L613V/+ mice correlates with
Mek/Erk activation. ..................................................................................................................... 126
Figure 4-9. RAF1D486N forms more heterodimers with BRAF. .................................................. 129
Figure 4-10. Kinase-impaired RAF1 mutants associated with NS enhance MEK/ERK activation
and form more RAF1/BRAF heterodimers. ................................................................................ 130
Figure 4-11. BRAF is required for RAF1D486N to enhance MEK/ERK activation. .................... 131
Figure 4-12. Heterodimerization with BRAF is required for RAF1D486N mutant to enhance
MEK/ERK activation. ................................................................................................................. 135
Figure 4-13. Induced RAF1/BRAF heterodimerization restores activity of RAF1R401H/D486N
mutant to enhance MEK/ERK activation. .................................................................................. 136
Figure 4-14. RAF1L613V mutant enhances MEK/ERK activation via RAF1/BRAF heterodimer
formation. .................................................................................................................................... 137
Figure 5-1. Lower dose MEK inhibitor treatment rescues growth defect, but not cardiac
hypertrophy and chamber dilatation in L613V/+ mice. .............................................................. 148
Figure 5-2. Lower dose MEK inhibitor treatment partially normalizes cardiac function in
L613V/+ mice. ............................................................................................................................ 149
Figure 5-3. Increased pS6 (S235/236) in cardiomyocytes and cardiac fibroblasts from L613V/+
mice. ............................................................................................................................................ 151
Figure 5-4. Rapamycin treatment does not rescue growth defect and cardiac hypertrophy in
L613V/+ mice. ............................................................................................................................ 152
Figure 5-5. Cardiomycyte-specific expression of Raf1L613V does not cause significant cardiac
hypertrophy. ................................................................................................................................ 154
xiii
Figure 5-6. Cardiomycyte-specific expression of Raf1L613V causes mild increase in cardiac
function. ...................................................................................................................................... 156
Figure 5-7. Cardiomycyte-specific expression of Raf1L613V causes mild increase in cardiac
contractility. ................................................................................................................................ 157
Figure 5-8. Reducing Erk1 levels in L613V/+ mice does not rescue the cardiac hypertrophy and
chamber dilatation. ...................................................................................................................... 159
Figure 5-9. Reducing Erk1 levels in L613V/+ mice does not rescue the cardiac function. ....... 160
Figure 5-10. Reducing Erk1 levels in L613V/+ mice rescues the cardiac contractility. ............ 161
Figure 5-11. Reducing Erk2 levels in L613V/+ mice does not rescue the cardiac hypertrophy. 162
Figure 5-12. Distributions of the body weight data for all the 56 samples. ................................ 164
Figure 5-13. Genome-wide LOD score plot of the quantitative trait. ......................................... 165
Figure 5-14. Genome-wide LOD score plot of the binary trait. ................................................. 166
Figure 5-15. LOD score plot of the binary trait on Chromosome 8. .......................................... 167
Figure 5-16. Boxplots of body weight for mice with different genotypes. ................................. 168
xiv
LIST OF TABLES
Table 1-1. Clinical features of Noonan syndrome. ....................................................................... 14
Table 2-1. PCR primers for generating the Raf1L613V mice. ......................................................... 54
Table 2-2. PCR primers for generating the Raf1D486N mice.......................................................... 56
Table 3-1. Echocardiographic parameters in WT and L613V/+ mice. ......................................... 80
Table 3-2. Additional hemodynamic parameters of hearts from 4 month-old mice. .................... 82
Table 4-1. Comparison of cardiac phenotypes in D486N/D486N and L613V/+ mice. ............. 122
xv
LIST OF ABBREVIATIONS
ADHD attention deficit-hyperactive disorder
ALL acute lymphoblastic leukemia
AML acute myeloid leukemia
AMPK adenosine monophosphate-activated protein kinase
AN anal-nasal
Ang-II angiotensin-II
ANP atrial natriuretic peptide
AP1 activating protein-1
AS aortic stenosis
ASK1 apoptosis signal-regulating kinase 1
ATF1 activating transcription factor 1
BNP B-type natriuretic peptide
CaMK calmodulin-dependent kinase
CDK cyclin-dependent kinase
CFCS cardio-facio-cutaneous syndrome
CHD congenital heart defects
CK2 casein kinase 2
CNK connector enhancer of KSR
CO cardiac output
COT Cancer Osaka Thyroid oncogene
CR conserved region
CRD cysteine-rich domain
CREB cAMP response element binding protein
CS Costello syndrome
CSK C-terminal SRC kinase
DAG diacylglycerol
DMEM Dulbecco’s modified Eagle’s medium
DUSP dual specificity phosphatase
ECM extracellular matrix
xvi
EDC epidermal differentiation cluster
EDV end-diastolic volume
EF ejection fraction
elF-4E eukaryotic initiation factor-4E
ELK-1 Ets-like gene 1
ERK extracellular signal-regulated kinase
ES embryonic stem
ESV end-systolic volume
ET-1 endothelin-1
FACS fluorescence activated cell sorting
FBS fetal bovine serum
FIAU 1-(2-deoxy-2-fluoro-β-D-arabinofuranosyl)-5 iodouracil
FS fractional shortening
GAP GTPase activating protein
GATA4 GATA binding protein 4
GC-A guanylyl cyclase-A
GEF guanine nucleotide exchange factor
GH growth hormone
GHD growth hormone deficiency
G-loop glycine-rich loop
Gp130 glycoprotein-130
GPCR G-protein coupled receptor
GRB2 growth factor receptor-bound protein 2
GSK3β glycogen synthase kinase-3β
HCM hypertrophic cardiomyopathy
HDAC histone deacetylase
IEG immediate-early gene
IGF-I insulin-like growth factor I
IKK inhibitor of NF-κB kinase
IL-6 interleukin-6
IP intraperitoneally
IQGAP IQ motif-containing GTPase-activating protein
xvii
IκB inhibitor of NF-κB
JMML juvenile myelomonocytic leukemia
JNK c-Jun N-terminal kinase
KSR1 kinase suppressor of Ras 1
LAH loose anagen hair
LAMP2 lysosome-associated membrane protein-2-α-galactosidase
LD linkage disequilibrium
LEOPARD Lentigines, ECG conduction abnormalities, Ocular hypertelorism,
Pulmonic stenosis, Abnormal genitalia, Retardation of growth, and
sensorineural Deafness
LPA lysophosphatidic acid
LS LEOPARD syndrome
LV left ventricle
LVH left ventricular hypertrophy
LVIDd left ventricular internal end-diastolic dimention
LVIDs left ventricular internal end-systolic dimention
LVPWd left ventricular diastolic posterior wall thickness
MAP mean arterial pressure
MAPK mitogen-activated protein kinase
MAPKK mitogen-activated protein kinase kinase
MAPKKK mitogen-activated protein kinase kinase kinase
MEF mouse embryonic fibroblast
MEF2 myocyte enhancer factor 2
MEK1 MAPK/ERK kinase 1
MI myocardial infarction
MKP MAP kinase phosphatase
MLP muscle LIM-domain protein
MNK MAPK-interacting kinase
MORG1 MAPK organizer 1
MHC myosin heavy chain
MP1 MEK partner-1
MPNST malignant peripheral nerve sheath tumors
xviii
MSK mitogen- and stress-activated protein kinase
MST2 mammalian STE20-like protein kinase 2
MSV murine sarcoma virus
mTOR mammalian target of rapamycin
NEAA non-essential amino acid
NF1 neurofibromatosis type 1
NFAT nuclear factor of activated T cells
NFLS NF1-like syndrome
NF-κB nuclear factor-κB
NIK NF-κB-inducing kinase
NS Noonan syndrome
NS/LAH Noonan-like syndrome with loose anagen hair
OPG optic pathway gliomas
PDK phosphoinositide-dependent kinase
PH plekstrin homology
PHB prohibitin
PI3K phosphoinositide-3 kinase
PKC protein kinase C
PKCθ protein kinase C theta
PLA2 phospholipase A2
PLC phospholipase C
PP2A protein phosphatase 2A
PP5 protein phosphatase 5
PS pulmonic stenosis
PTB phosphotyrosine binding
PTK protein-tyrosine kinase
PTP protein-tyrosine phosphatase
RAF rapid accelerated fibrosarcoma
RASSF1A Ras association domain-containing protein 1A
RBD Ras binding domain
REM Ras exchanger motif
RKIP Raf kinase inhibitor protein
xix
ROS reactive oxygen species
RSK ribosomal S6 kinase
RTK receptor tyrosine kinase
RV right ventricle
SAP1 SRF accessory protein 1
SAPK stress-activated protein kinase
SEF similar expression to FGF
SERCA2a sarcoplasmic reticulum Ca2+-ATPase
SH2 Src homology 2
SH3 Src homology 3
SHPS-1 Shp Substrate-1
SOS son of sevenless
SPRED1 Sprouty-related EVH1 domain-containing protein 1
SRE serum response element
SRF serum response factor
SPRY SPROUTY
SV stroke volume
TAC transverse aortic constriction
TAK TGFβ-activated kinase
TCF ternary complex factor
TGFβ transforming growth factor-β
TNF-α tumor necrosis factor-α
TPL2 tumor progression locus 2
UBF upstream binding factor
VDAC voltage-dependent anion channel
WGA wheat germ agglutinin
1
Chapter 1
Introduction
2
1.1 The RAS-RAF-MEK-ERK MAPK pathway
1.1.1 MAPK pathways
Mitogen-activated protein kinase (MAPK) pathways are evolutionarily conserved kinase
modules that link extracellular signals to the machinery that controls fundamental cellular
processes, such as proliferation, differentiation, migration and apoptosis (1). MAPK pathways
are comprised of a three-tier kinase module in which a MAPK is activated upon phosphorylation
by a mitogen-activated protein kinase kinase (MAPKK) which, in turn, is activated when
phosphorylated by a mitogen-activated protein kinase kinase kinase (MAPKKK) (Figure 1-1).
To date, three main families of MAPKs have been characterized in mammals, which are
grouped by their structures and functions: extracellular signal-regulated kinase (ERK), c-Jun N-
terminal kinase (JNK, also known as stress-activated protein kinase or SAPK)1/2/3 and the p38
isoforms α/β/γ (ERK6)/δ (2-5). Members of the ERK family can be divided further into four
subgroups: the ERK1/2 group, comprising classic MAPKs that consist primarily of a kinase
domain, and the three large MAPK groups, ERK3/4, ERK5 and ERK7/8, containing enzymes
that consist of both a kinase domain and a C-terminal domain ranging in size from 60 kDa to
greater than 100 kDa (6-9). The C-terminal regions function as protein interaction domains that
regulate kinase localization (10), activation (9, 11), and transcriptional activity (7).
All MAPKs contain a TXY (Thr-X-Tyr) motif within their activation loops. The
phosphorylation of both the threonine and the tyrosine within the activation loop is necessary and
sufficient for their activation. The majority of ERK family members contain a TEY (Thr-Glu-Tyr)
activation motif (12), except for ERK3/4, which possesses an SEG (Ser-Glu-Gly) sequence (6).
The p38 family has a TGY (Thr-Gly-Tyr) activation motif (13), whereas JNK family members
contain TPY (Thr-Pro-Tyr) in their activation loop (14).
The ERK pathway is the best studied mammalian MAPK pathway and is activated by
numerous extracellular signals (Figure 1-1). In the ERK1/2 MAPK module, ERK1/2 are
activated upon phosphorylation by MAPK/ERK kinase1/2 (MEK1/2), which is itself activated
when phosphorylated by Rapid Accelerated Fibrosarcoma (RAF) family proteins. The details of
this signaling cascade will be discussed later. Although RAF isoforms are the primary
MAPKKKs in the ERK1/2 module, MAP3K8, also called TPL2 (tumor progression locus 2) or
3
Figure 1-1. Schematic overview of MAPK pathways.
4
COT (Cancer Osaka Thyroid oncogene) also can act as a MAPKKK that regulates the ERK1/2,
ERK5, JNK and p38 pathways in a cell type- and stimulus-specific manner (15). MEKK1 (16)
and MOS (17) are two additional ERK1/2 MAPKKKs utilized in more restricted cell type- and
stimulation-specific situations. The MAPKK for ERK5 is MEK5, which is activated upon
phosphorylation by MEKK2/3 or TPL2 (15, 18). The MAPKKs and MAPKKKs for ERK3/4 and
ERK7/8 remain unknown.
Many MAPK pathways participate in stress signaling. Stress-activated MAPK cascades
contain a large number of MAPKKKs, probably because stresses come in many forms (Figure
1-1). JNK family kinases can be activated by cytokines, UV radiation, oxidative stress, growth
factor deprivation and DNA-damaging agents (19). JNK activation requires dual phosphorylation
on the TPY motif, which is catalyzed by MEK4 or MEK7. MEK4/7 are themselves
phosphorylated and activated by a wide range of MAPKKKs, including MEKK1–4, DLK,
MLK2/3, TPL-2, TAO1/2, TAK1 and ASK1/2. Like ERKs, JNKs translocate from the cytoplasm
to the nucleus following activation, and phosphorylate transcription factors (e.g., c-JUN, ATF-2
and STAT3) (20). Active JNK also functions in the cytoplasm, although relatively little is known
about cytoplasmic JNK substrates.
p38 MAPKs are strongly activated by physical and chemical stresses, such as high
osmolarity, oxidative stress, hypoxia and UV irradiation, and pro-inflammatory cytokines, such
as endotoxin, TNF-α, and IL-1 (21, 22). In addition to its role in stress responses, the p38
pathway also helps regulate apoptosis, cell cycle progression, growth and differentiation, which
reflects its activation by a broad range of extracellular stimuli, including growth factors (e.g.,
FGF, IGF-I, PDGF and nerve growth factor) and hormones. The conserved TGY
phosphorylation motif of p38 isoforms is phosphorylated by MEK3 or MEK6, which themselves
are activated by various MAPKKKs shared with JNK, including TAK1, ASK1/2, DLK,
MEKK4, TAO1/2/3 and MLK2/3. In some instances, p38 can be activated by MEK4 (23). The
downstream targets of the active p38 MAPKs include a wide array of cytoplasmic (e.g., Caspase-
3/6, Caspase 8, and MNK1/2) and nuclear (e.g., ATF2, p53, ELK1 and STAT1) targets (22).
5
1.1.2 The RAS-RAF-MEK-ERK MAPK pathway
The RAS-RAF-MEK-ERK MAPK signal transduction cascade (hereafter, the RAS/ERK
pathway) functions in many cellular processes, including proliferation, differentiation, survival,
cell adhesion, migration and metabolism (Figure 1-2) (24). The pathway is initiated by the
activation of one of three small guanosine triphosphatases (GTPases) KRAS, NRAS or HRAS,
which are stimulated by guanine-nucleotide exchange factors (GEFs), such as son of sevenless
(SOS) (25). Active RAS proteins interact with a wide range of effectors and stimulate
downstream signaling components, including RAF kinases, phosphoinositide-3 kinase (PI3K),
RAL guanine nucleotide dissociation stimulator (RALGDS), MEKK1, RAS
interaction/interference 1 (RIN1), ALL-1 fusion partner in chromosome 6 (AF-6), phospholipase
C epsilon, and novel RAS effector (NORE)/mammalian STE20-like protein kinase (MST) (26,
27). In the RAS/ERK pathway, RAS recruits RAF proteins to the cell membrane, where they are
activated and subsequently form complexes with MEK1/2 and ERK1/2, aided by scaffolds, such
as KSR. Activated RAF proteins phosphorylate MEK1/2, which in turn phosphorylate ERK1/2.
ERKs phosphorylate cytosolic substrates and also translocate to the nucleus to stimulate diverse
gene expression programs by phosphorylating several transcription factors (26, 28).
Deregulation of the RAS/ERK pathway is associated with various pathologies, most
notably cancer (29, 30), but also developmental abnormalities (31, 32). Oncogenic mutations in
human KRAS occur in about 90% of pancreatic, 40% of colorectal, and 30% of biliary cancers,
whereas NRAS mutations occur in approximately 15-20% of melanomas. Overall, RAS genes are
activated in about 30% of all human cancers (26, 33, 34). Activating mutations in BRAF occur in
approximately 7% of all human cancers, including 27-70% of malignant melanomas, 36-53% of
papillary thyroid cancers, 30% of ovarian cancers, and 5-22% of colorectal cancers (35, 36). The
RASopathies are a group of developmental syndromes caused by germline mutations in genes
that alter the RAS/ERK pathway (31, 32), and will be discussed later in detail.
The conversion of inactive guanine diphosphate (GDP)-bound form to active guanine
triphosphate (GTP)-bound form of RAS is promoted by the action of several receptor tyrosine
kinases (RTKs), including those of the epidermal growth factor receptor (EGFR) family, the
insulin-like growth factor receptor (IGFR), the vascular endothelial growth factor receptor
(VEGFR) family, and many others (37). Membrane-spanning cell surface RTKs are endowed
6
Figure 1-2. Schematic representation of the structure of RAS-RAF-MEK-ERK MAPK
pathway.
7
with intrinsic tyrosine kinase activity. All RTKs contain an extracellular ligand-binding domain,
a single hydrophobic transmembrane helix, and a cytoplasmic region that contains a conserved
protein-tyrosine-kinase domain (TKD) plus additional C-terminal and juxamembrane regulatory
regions that are subject to autophosphorylation and phosphorylation by other kinases. Most
RTKs are monomers at the cell membrane, with ligand binding or ectopic over-expression
resulting in receptor dimerization and tyrosine “autophosphorylation” in trans, although some
RTKs exist as oligomers; e.g., the insulin receptor and IGFR, which form disulfide-linked dimers
in the absence of activating ligand. Whether the “inactive” state is monomeric or oligomeric,
activation of the RTKs still requires the bound ligand to stabilize the individual receptor
molecules in an “active” dimer or oligomer. In some RTKs, such as the insulin receptor, KIT,
and TIE2, trans-phosphorylation of tyrosines within the activation loop, the juxtamembrane
segment, and/or the C-terminal region disrupts their cis-autoinhibitory interaction with TKD, and
promotes receptor activation (38-40). However, the EGFR family and RET are exceptions. Their
activation does not require trans-phosphorylation of their activation loop or elsewhere. Instead,
dimerization of these receptors promotes conformational changes and thereby allosteric
activation of their TKDs (41, 42).
Following RTK activation, additional tyrosines are autophosphorylated in other parts of
the receptor cytoplasmic region. The resulting phospho-tyrosines provide a mechanism for the
recognition and assembly of signaling complexes, functioning as binding sites for a variety of
cytoplasmic signaling molecules containing Src homology 2 (SH2) domain (43) and/or
phosphotyrosine binding (PTB) (44) domains. One such signaling protein is growth factor
receptor-bound protein 2 (GRB2). GRB2, a cytosolic adaptor, contains a central SH2 domain,
flanked by two Src homology 3 (SH3) domains, which allow constitutive association with the
proline-rich regions of SOS (45). For example, phospho-tyrosine 1068 of the activated EGFR is
a binding site for the SH2 domain of GRB2 (46), either directly or through the assistance of
another SH2 adaptor, SHC (47). Activated EGFR phosphorylates SHC on Tyr317, which
promotes the interaction between SHC and GRB2 (48). The recruitment of GRB2 from the
cytoplasm to the plasma membrane brings SOS near membrane-bound RAS, where SOS
enhances GDP release and GTP binding to RAS, converting this GTPase into its active
conformation. It is well accepted that the protein-tyrosine phosphatase SHP2 (encoded by
PTPN11) has a positive effect on RAS/ERK activation, but the mechanisms involved have
8
remained elusive (49). Several mechanisms have been proposed, one of which is that SHP2 may
act as an adaptor protein leading to the recruitment of the GRB2/SOS complex to the cell
membrane (50-53). Alternatively, SHP2 can dephosphorylate several targets, which, when
dephosphorylated, will promote ERK activation. One possible target is SPROUTY (SPRY),
which, when phosphorylated, purportedly sequesters GRB2/SOS in the cytoplasm (54-56). SHP2
also can dephosphorylate RAS-GAP binding site borne by RTKs or GAB1, and thereby exclude
GAPs from signaling complexes and promote RAS activation (57, 58). Several studies suggest
that SHP2 could act upstream of the SRC family kinases through dephosphorylation of SRC-
regulatory proteins (59-61).
In addition to RTKs, signals that activate G-protein coupled receptors (GPCRs), such as
lysophosphatidic acid (LPA), angiotensin II and beta-adrenergic agonists, can activate the
RAS/ERK pathway (62, 63). Integrins, which are integral membrane proteins that mediate
cellular adhesion to the extracellular matrix (ECM) and to other cells, also can lead to the
activation of the RAS/ERK cascade (64).
RAS family members belong to a large family of small GTPases that bind and hydrolyze
GTP. First discovered as transforming oncogenes of murine sarcoma viruses, three highly related
21 kDa mammalian proteins, Harvey-RAS (HRAS), Kirsten-RAS (KRAS), and Neuroblastoma-
RAS (NRAS) have been identified (65). RAS family members are anchored to the cytoplasmic
face of the plasma membrane, and such anchoring is essential for their biological function.
Membrane-targeting of RAS is achieved through lipid-anchors by post-translational lipid
modification of its C-terminal Cys residues (66). Unlike KRAS, NRAS and HRAS also signal
from endomembranes and cycle between the plasma membrane and Golgi apparatus depending
on their palmitoylation status (67). The localization to the inner leaflet brings RAS into close
proximity with RAS-GEFs, catalyzing the exchange of GDP for the more abundant GTP. GTP
loading alters RAS conformation, allowing it to interact with a number of downstream effectors
(68). Within the ERK signaling cascade, active RAS functions as an adaptor that binds to
effector RAF kinases with high affinity, causing their translocation to the cell membrane, where
RAF activation takes place. The detailed mechanism of RAF activation will be discussed later.
Active RAS-GTP is converted to the inactive RAS-GDP when its intrinsic RAS-GTPase activity
is stimulated by GTPase activating proteins (GAPs) (69). The balance between GEF and GAP
activity determines the guanine nucleotide status of RAS, thereby regulating RAS activity.
9
The RAF family kinases, including ARAF, BRAF and RAF1/CRAF in vertebrates,
catalyze the phosphorylation and activation of the dual-specificity protein kinases, MEK1 and
MEK2 (also known as MKK1 and MKK2) (70). RAF family activation of MEK1/2 occurs
through phosphorylation of two serine residues, at positions 218 and 222 in the activation loop of
MEK1 (S222 and S226 on MEK2). Different RAF isoforms are not equal in their ability to
activate MEK: ARAF appears to be a poor MEK activator (71); BRAF displays a higher affinity
for MEK1 and MEK2 than RAF1, and is more efficient in phosphorylating MEKs (71-74).
MEK1/2 catalyze the phosphorylation of threonine and tyrosine residues in the activation
segment of ERK1/2, their only known physiological substrates (75). Several regulatory
phosphorylation sites on MEK outside the activation loop either positively or negatively regulate
the MAPKK. Phosphorylation of Ser298 by p21-activated kinase-1 (PAK1), downstream of the
small G-protein RAC, enhances the association of MEK with ERK, and results in RAF-
independent activation of MEK1 (76, 77). Conversely, in vivo phosphorylation by an unknown
kinase at Ser212, a site conserved in all MAPKKs, sharply decreases MEK1 activity (78). MEK1
and MEK2 can form heterodimers subject to negative feedback by ERK-catalyzed
phosphorylation of MEK1 on T292, which is absent on MEK2, facilitating the
dephosphorylation of S218/222 in the MEK1 activation loop (79).
The MAP kinases ERK1 and ERK2, also known as MAPK3 and MAPK1, are 44- and
42-kDa protein serine/threonine kinases, respectively (80). Initially isolated and cloned as
kinases activated in response to insulin and nerve growth factor (NGF) (81, 82), ERK1 and
ERK2 are expressed ubiquitously, with ERK2 levels generally higher than ERK1 (83). All
known cellular stimuli of the ERK1/2 pathway lead to the parallel activation of ERK1 and ERK2
(83, 84). Knocking-down ERK1 and/or ERK2 by RNA interference indicates that both ERK1
and ERK2 are positive regulators of cell proliferation and immediate-early gene (IEG)
transcription, and the positive role of ERK1 on cell proliferation is uncovered only when the
ERK2 level is markedly reduced and becomes limiting (83). Gene ablation studies in mice
demonstrate that either ERK may at least partially compensate for the other's loss, although some
evidence has been provided for differential functions of ERK1 and ERK2. The Erk1 gene is
dispensable for the development of mice, but ablation of the Erk2 gene is embryonic lethal (85,
86). Erk2-null mice fail to form mesoderm, although embryonic stem (ES) cell proliferation is
unaffected (86). The development of embryonic trophoblast and placental vasculature is severely
10
impaired in Erk2-deficient mice, which leads to embryonic lethality (87, 88). Taken together,
these studies suggest that Erk1 is unable to compensate for Erk2 deficiency in vivo. Erk1-
deficient mice are viable, fertile, and of normal size with minor defects, such as impaired
terminal differentiation of T lymphocytes (85), and decreased adiposity with fewer adipocytes
(89), suggesting a specific role of Erk1 in thymocyte development and adipogenesis.
Dual threonine and tyrosine phosphorylations activate both ERKs, at Thr202/Tyr204 for
human ERK1 and Thr185/Tyr187 for human ERK2. Unlike MEK, significant ERK activation
requires phosphorylation at both sites, with tyrosine phosphorylation preceding that of threonine
(90). The ERKs are proline-directed protein kinases, phosphorylating Pro-neighboring Ser or Thr
residues. Docking sites present on physiological substrates confer additional specificity (91).
These docking interactions, through non-catalytic regions on ERK, team with scaffold proteins to
ensure signaling fidelity and enzymatic efficiency both to and from the MAPK. Unlike the RAF
kinases and MEK1/2, which have narrow substrate specificity, ERK1 and ERK2 have more than
175 documented cytoplasmic and nuclear substrates (92) (Figure 1-3).
Cytosolic substrates for ERK include several pathway components involved in negative
feedback regulation (Figure 1-3). Negative feedback by ERK has been proposed to occur through
direct phosphorylation of the EGFR at Thr669, which inhibits EGFR kinase activity (93, 94).
Multiple residues on SOS are phosphorylated by ERK following growth factor stimulation (95,
96). SOS phosphorylation destabilizes the SOS-GRB2 complex, eliminating SOS recruitment to
the plasma membrane and interfering with RAS activation of the ERK pathway. The RAF family
kinases also are substrates of activated ERK (97, 98). Six phosphorylation sites on RAF1 and
four phosphorylation sites on BRAF have been identified, which contribute to the down-
regulation of RAS/ERK pathway by inhibiting binding to activated RAS or disrupting
BRAF/RAF1 heterodimers (98). Finally, ERKs have also been demonstrated to negatively
regulate themselves by phosphorylating MAP kinase phosphatases (MKPs), which reduces the
degradation of these phosphatases through the ubiquitin-directed proteasome complex (99, 100).
MAPK-interacting kinase 1 (MNK1) and MNK2 are cytosolic serine/threonine protein
kinases initially discovered as ERK-interacting proteins (101). Both ERK and p38, but not JNK,
activate MNK by phosphorylation at Thr197 and Thr202. Activated MNK1, and possibly
MNK2, upregulates eukaryotic initiation factor-4E (eIF-4E) in vitro through phosphorylation at
11
Figure 1-3. Downstream targets of ERK signaling.
ERK1 and ERK2 positively regulate transcription directly and indirectly via phosphorylation of
p90 ribosomal protein S6 kinases (RSKs), mitogen- and stress-activated protein kinases (MSKs),
and ternary complex factors (TCFs). Additionally, ERK1/2 indirectly regulate translation.
ERK1/2 also provide negative feedback loops for the RAS/ERK signaling pathway.
12
Ser209, which is believed to enhance translation efficiency (102). The 90 kDa ribosomal S6
kinases (RSK) family of proteins are directly activated by ERK1/2 in response to growth factors,
many polypeptide hormones, chemokines and other stimuli (103, 104). RSKs are characterized
by the presence of two functional domains, the N-terminal kinase domain and the C-terminal
kinase domain, connected by a linker region, which are activated in a sequential manner by a
series of phosphorylation events following the binding of active ERK1 or ERK2 to an ERK
docking site (D domain) located at the extreme carboxyl terminus of cytoplasmic RSK (105).
RSKs phosphorylate many cytosolic and nuclear targets, regulating diverse cellular processes,
including cell proliferation, survival, growth and motility (106). For example, RSKs regulate
translation by modulating the PI3K-mTOR pathway at various steps (107-110). RSKs also play a
direct role in cell-cycle regulation. For example, RSKs have been shown to phosphorylate the
cyclin-dependent kinase (CDK) inhibitor p27KIP1, which promotes its association with 14-3-3,
prevents its translocation to the nucleus, and thereby promotes G1-phase progression (111).
Activated RSKs also translocate to nucleus and regulate transcription by direct phosphorylation
of transcription factors involved in IEG expression or by post-translational modification of IEG
products (104, 112) (Figure 1-3).
Upon phosphorylation, ERK1 and ERK2 translocate into the nucleus (113), where they
phosphorylate a wide range of targets, including transcription factors and a family of RSK-
related kinases, the mitogen- and stress-activated protein kinases (MSKs) (114). MSK1 and
MSK2 share the same tandem kinase structure as the RSKs, and also appear to be activated by
sequential phosphorylation following ERK docking. MSKs phosphorylate and activate the
activating transcription factor 1 (ATF1) at Ser63 (115), and the cAMP response element binding
protein (CREB) at Ser133 (116). MSKs also are the major kinases for Histone H3 and high-
mobility-group protein HMG-14, facilitating rapid induction of IEGs in response to mitogenic
and stress stimuli in fibroblasts (117). The best-characterized transcription factor substrates of
ERKs are ternary complex factors (TCFs), including Ets-like gene 1 (ELK-1) and SRF
Accessory Protein 1 (SAP1) and SAP2, which are directly phosphorylated by ERKs at multiple
sites (118, 119). Phosphorylated TCFs form complexes with the serum response factor (SRF) and
activate the transcription of numerous mitogen-inducible genes regulated by serum response
elements (SREs) (120). Another direct target of ERK is the proto-oncogene protein MYC, which
is a transcription factor that regulates cell-fate decisions, including proliferation, growth and
13
apoptosis (121). Phosphorylation on Ser62 by ERK stabilizes MYC, and allows it to activate
transcription as a heterodimeric partner with MAX (122). ERK can also directly phosphorylate
components of activating protein-1 (AP1) family of transcription factors, c-JUN and c-FOS
(123).
Finally, the ERK pathway has been demonstrated to directly link growth factor signaling
to ribosome biogenesis. Following serum stimulation, ERK directly binds to and phosphorylates
the BRF1 subunit of the RNA polymerase (pol) III-specific transcription factor TFIIIB, which
enhances translational efficiency by affecting tRNA and 5S rRNA synthesis (124). ERK also
activates ribosomal RNA transcription following EGF stimulation by POL I through
phosphorylation of upstream binding factor (UBF), preventing its interaction with DNA (125).
1.2 Noonan syndrome and the RASopathies
1.2.1 Noonan syndrome
Noonan syndrome (NS; OMIM 163950) is the eponymous name for the genetic disorder
described by the pediatric cardiologist Jacqueline Noonan (126). NS is thought to be relatively
common, although its prevalence has not been determined accurately to date. Most authors cite
the figure of 1 in 1,000–2,500 live births first reported by Nora and colleagues (127). NS is
characterized by short shature, distinctive facial dysmorphic features, a wide spectrum of
congenital heart defects (CHD), and an increased risk of hematopoietic malignancy. Other
relatively common features are bleeding diathesis, ectodermal anomalies, lymphatic dysplasias,
cryptorchidism, and cognitive deficits (128-130) (Table 1-1).
Facial features of NS include high forehead, hypertelorism, downslanting palpebral
fissures, epicantal folds, ptosis, and low-set and/or posteriorly rotated ears (Figure 1-4). Besides
the short and/or webbed neck, a low posterior hairline is common. Cardiac defects and short
stature are the major reasons that patients with NS seek medical attention. While birth length is
typically normal, growth parameters usually drop below the 3rd centile during the first years of
life. Because there is often some attenuation and/or delay of the pubertal growth spurt, the
prevalence of short stature in NS is highest during the age of normal puberty. This is
accompanied by a delay in bone age. Although there have been reports of growth hormone (GH)
deficiency, neurosecretory dysfunction, or GH resistance in NS (131-133), a consistent pattern of
14
Table 1-1. Clinical features of Noonan syndrome.
Short stature
Facial dysmorphism
Triangular face shape
Broad forehead
Hypertelorism (widely set eyes)
Epicanthal folds (extra fold of skin at the inner corner of the eye)
Ptosis (drooping of the eyelids)
Down-slanting palpebral fissures
Low set and/or backward rotated ears
Cardiovascular defects
Pulmonic stenosis
Atrial septal defects
Ventricular septal defects
Mitral valve defects
Hypertrophic cardiomyopathy
Hematological disorders
Bleeding diathesis
Thrombocytopenia
Leukemia
Lymphedema
Developmental
Delay
Attention deficit/hyperactivity disorder
Skeletal
Pectus excavatum and/or carinatum
Vertebral anomalies
Webbed neck with low posterior hairline
Cryptorchidism (undescended testicles)
Dental/Oral problems
Feeding difficulties
15
Figure 1-4. Facial dysmorphism in Noonan syndrome.
Series of affected individuals heterozygous for mutations in different NS-associated genes are
shown. Adopted from Tartaglia M et al. Best Practice & Research Clinical Endocrinology &
Metabolism. 2011. 25(1): 161-179.
16
abnormal GH secretion or action has not been shown so far, and it seems unlikely that there is a
simple link between GH and the growth deficits in NS. GH treatment in NS is still a matter of
debate. Recent research using our NS mouse model expressing the D61G mutant of Shp2,
showed that NS-causing Shp2 mutants inhibit insulin-like growth factor 1 (IGF-I) release via
GH-induced Erk hyperactivation, contributing to early postnatal growth delay (134).
NS patients exhibit a wide spectrum of cardiac disease (135, 136). Pulmonic stenosis
(PS), septal defects, and HCM occur most commonly, but other lesions also are observed.
Feeding problems are noted in the majority of affected infants and can cause failure to thrive
(137). Developmental delay and learning problems are quite common. Some motor delay can be
attributed to the hypotonia often observed in affected infants. An increased incidence of attention
deficit/hyperactivity disorder and frank mental retardation also are observed. Available data
indicate that the heterogeneity in the cognitive abilities observed in NS is at least partially
attributed to the specific causative gene mutation (138, 139). Skeletal anomalies most frequently
consist of pectus deformities, cubitus valgus, vertebral defects, and scoliosis. Children with NS
also are at increased risk of developing myeloproliferative disorder (MPD) (140). Juvenile
myelomonocytic leukemia (JMML; OMIM 607785), a rare MPD of childhood (141), arises at
increased prevalence in NS, although it affects only a small percentage of patients (142). The
MPD in most children with NS usually regresses without treatment, but occasionally follows an
aggressive clinical course.
The diagnosis of NS depends primarily on clinical features, although the prevalence of
the characteristic features among affected individuals has not been assessed rigorously and
depends on the patient’s age (143). In newborns, the facial features can be less apparent and
length is typically normal, but lymphedema and excess nuchal folds may be present. With time,
several features become more obvious, including facial dysmorphism, pectus deformities, and
reduced growth. Hypertrophic cardiomyopathy (HCM) also may develop during the first few
years of life. The facial features also can become more difficult to detect in later adolescence and
adulthood.
NS is a Mendelian trait transmitted in an autosomal dominant manner, and as observed
for other dominant disorders, a significant percentage of cases is due to de novo mutations.
Although NS is genetically heterogeneous (31, 32, 144), all known cases are caused by germ-line
17
mutations in conserved components of the canonical RAS/ERK pathway. Mutations in PTPN11,
which encodes the protein tyrosine phosphatase SHP2, account for approximately half of NS
cases (145). Other known NS genes include SOS1 (~10%) (146, 147), RAF1 (3-5%) (148, 149),
KRAS (<2%) (150, 151), NRAS (152) and BRAF (153) (<1%). The causative genes responsible
for the remaining 30% of NS cases remain to be identified. Mutations in some of these genes, as
well as in genes encoding other RAS/ERK pathway components, also cause phenotypically
related disorders, such as neurofibromatosis type 1 (NF1), Costello syndrome, cardio-facio-
cutaneous syndrome (CFCS), and LEOPARD syndrome; together with NS, these syndromes are
now termed “RASopathies” (32) (Figure 1-5).
The most common gene associated with NS is PTPN11, which accounts for
approximately 50% of cases. SHP2, the protein product of PTPN11, is a non-receptor protein-
tyrosine-phosphatase (PTP) that positively modulates RAS/ERK signaling (154). SHP2 is
composed of two tandem N-terminal SH2 domains (N-SH2 and C-SH2), which function as
phospho-tyrosine binding domains and mediate the interaction of this PTP with its substrates,
followed by a catalytic PTP domain and a C-terminal tail with tyrosyl phosphorylation sites and
a proline-rich motif (155). In the basal state, the catalytic function of the protein is auto-inhibited
by interaction between the N-SH2 domain and the PTP domain, which blocks substrate access.
Binding of an appropriate phosphotyrosyl peptide alters the conformation of the N-SH2 domain,
prevents its binding to the PTP domain and causes catalytic activation of the protein (156). Most
NS-causing missense mutations in PTPN11 affect residues involved in the N-SH2/PTP auto-
inhibitory binding and up-regulate SHP2 function by impairing the switch from the active to
inactive conformations. There also are mutations affecting residues located in the
phosphopeptide-binding pocket of the N-SH2 or C-SH2 domains or in the linker stretch
connecting these domains, which promote SHP2 gain of function by increasing the binding
affinity, altering the binding specificity, or changing the flexibility of the N-SH2 domain in a
manner that inhibits the N-SH2/PTP interaction (157-159).
SOS1 is the second most frequently mutated NS disease gene, accounting for
approximately 10% of cases (146, 147, 160). The majority of NS-associated SOS1 mutations
affect multiple domains that are responsible for stabilizing the protein in a catalytically
autoinhibited conformation. Approximately half affect residues located in the short helical linker
connecting the plekstrin homology (PH) and the RAS exchanger motif (REM) domains. A
18
Figure 1-5. RASopathies and the RAS-RAF-MEK-ERK MAPK pathway.
Schematic diagram showing the RAS/ERK pathway and affected disease genes in RASopathies.
NS, Noonan syndrome; NS/LAH, Noonan-like syndrome with loose anagen hair; LS,
LEOPARD syndrome; CS, Costello syndrome; CFCS, cardiofaciocutaneous syndrome; NF1,
neurofibromatosis type 1; NFLS, neurofibromatosis type 1-like syndrome (also known as Legius
syndrome).
19
second mutation cluster is located within the PH domain, while a third functional cluster resides
at the interacting regions of the Dbl homology and REM domains. A single amino acid change
(E846K) within the Cdc25 domain accounts for more than 10% of NS cases with SOS1
mutations. Biochemical data demonstrate that NS-causing SOS1 mutations disrupt the auto-
inhibition of SOS1 RAS-GEF activity resulting in gain-of-function of SOS1 and a subsequently
enhanced RAS/ ERK activation (146, 147).
Germline KRAS mutations account for a small percentage (< 2%) of affected subjects in
NS (150, 151, 161). NS-causing KRAS mutations up-regulate protein function and increase
signaling down the RAS/ERK pathway by either reducing the intrinsic or GAP-stimulated
GTPase activity and, consequently, impairing the switch between the active and inactive
conformation, or by interfering with the binding of KRAS to guanine nucleotide (150, 162).
More recently, two germline missense mutations of NRAS (T50I and G60E) conferring enhanced
stimulus-dependent MAPK activation, were reported to account for a few NS cases (152).
Two groups (148, 149) identified multiple missense mutations of RAF1 in NS, which
cluster in three regions (Figure 1-6). Approximately 70% of NS-associated RAF1 alleles alter the
motif flanking S259 within the so-called CR2 domain, which binds to 14-3-3 proteins and is
critical for auto-inhibition (163, 164). The second group of mutations (~15%) affects residues
within the activation segment of the kinase domain (D486 and T491). The remaining alleles
(~15%) involve two adjacent residues (S612 and L613) located C-terminal to the kinase domain.
Transient transfection studies indicate that mutations affecting the 14-3-3 binding motif or the C-
terminus of the protein enhance RAF1 kinase activity and increase MEK/ERK activation in cells.
By contrast, mutations that cluster in the activation segment are kinase-impaired and reportedly
act as dominant negative or null alleles (148, 149). Previous work suggested that the increased
kinase activity of NS-associated CR2 domain mutants results from decreased S259
phosphorylation and consequent dissociation from 14-3-3 (149, 165, 166), but the mechanism
underlying increased kinase activity of the RAF1 C-terminal mutants remained unclear.
Likewise, how kinase-defective RAF1 alleles cause NS had remained obscure, if not paradoxical.
Studies of kinase-defective BRAF alleles strongly implicate enhanced MEK/ERK activation and
heterodimerization with RAF1 in human melanoma pathogenesis (167, 168). The paradoxical
activation of the MEK/ERK pathway in wild type cells treated with selective small molecule
20
Figure 1-6. RAF1 domain structure and location of residues altered in NS.
RAF1 protein domains are indicated (CR, conserved region) along with two serine residues
(below the cartoon), phosphorylation of which serve as 14-3-3 binding sites. The mutations
observed in NS are shown above the cartoon.
21
BRAF inhibitors also has been attributed to the ability of these inhibitors to induce BRAF/RAF1
heterodimer formation (169, 170). The relevance of these observations for RAF1 alleles
expressed at physiological expression levels remained to be determined.
Germline BRAF mutations have also been documented in a small percentage of subjects
with phenotypes fitting or suggestive of NS (< 1% of cases) (153). Of note, BRAF has previously
been identified as a major disease gene underlying CFCS (50-75% of cases) (171, 172). NS-
associated mutations largely do not overlap with those occurring in CFCS, suggesting a
genotype-phenotype correlation.
NS is characterized by marked phenotypic variability, which can be explained, in part, by
the underlying molecular lesions. PTPN11 mutations are more prevalent among subjects with PS
and short stature, and less common in individuals with HCM and/or severe cognitive deficits
(173, 174). JMML is associated with a narrow spectrum of mutations affecting the PTPN11 gene
(142, 175), but also can be associated with certain germline KRAS mutations (150). Germline
KRAS mutations are generally associated with a highly variable but generally severe phenotype
(150, 151, 161). Subjects with a mutated SOS1 allele tend to exhibit a distinctive phenotype
characterized by ectodermal abnormalities and generally associated with a lower prevalence of
cognitive deficits and short stature (146, 160). NS patients with RAF1 mutations have a much
higher incidence (~75%) of hypertrophic cardiomyopathy (HCM) than is found in the overall NS
population (~18%). Notably, kinase-activating and kinase-impaired RAF1 alleles are associated
with different syndromic phenotypes. Only RAF1 alleles encoding kinase-activated mutants are
highly associated (~95%) with HCM (148, 149).
1.2.2 RASopathies: disorders clinically related to Noonan syndrome
1.2.2.1 LEOPARD syndrome
LEOPARD syndrome (LS; OMIM 151100) is a rare autosomal dominant disorder that
overlaps phenotypically with NS, including a ‘Noonan-like’ appearance as well as Lentigines,
ECG conduction abnormalities, Ocular hypertelorism, Pulmonic stenosis, Abnormal genitalia,
Retardation of growth, and sensorineural Deafness (acronym LEOPARD). Similar to NS, there
are age-dependent aspects of the phenotype. Craniofacial dysmorphism is similar to that of NS
22
but is usually milder (176). Multiple lentigines, which are flat, black-brown macules, are
dispersed primarily on the face, neck, and upper part of the trunk, sparing the mucosae. Growth
retardation is observed in 25% of affected individuals. Approximately half of affected
individuals have heart defects, which are similar to those in NS but occur with different
frequencies. ECG anomalies, progressive conduction defects and HCM are the most frequent
features. Of note, HCM is detected in up to 80% of LS patients with heart defects, most
commonly appearing during infancy. LS is allelic with NS with a restricted spectrum of
mutations in PTPN11 that cause decreased phosphatase activity and account for the vast majority
of affected individuals (~90%) (Figure 1-5) (177-180). In a small proportion of cases, LS has
been linked to mutations in RAF1 or BRAF (149, 153, 181).
1.2.2.2 Noonan-like syndrome with loose anagen hair
Patients with Noonan-like syndrome with loose anagen hair (NS/LAH; OMIM 607721)
show facial features reminiscent of NS, including macrocephaly, high forehead, hypertelorism,
and low-set and posteriorly rotated ears, in addition to short and wedded neck and pectus
abnormalities (182-184). Ectodermal involvement, severe short stature associated with proven
GH deficiency (GHD), significant cognitive deficits and distinctive hyperactive behavior are
other common features associated with these subjects. The hair anomalies include easily
pluckable, sparse, thin, and slow-growing hair in the anagen phase, which fit a well-known
condition termed loose anagen hair (LAH) syndrome (185), and suggest that this is a disorder
distinct from NS. Most affected individuals also have darkly pigmented skin with eczema or
ichthyosis. Cardiac anomalies are observed in the majority of cases, with mitral valve and septal
defects significantly overrepresented compared with the general NS population. The voice of
affected individuals is characteristically hypernasal. To date, NS/LAH appears to be genetically
homogeneous, as all affected individuals share the same 4A>G missense mutation (an S2G
amino acid substitution) in SHOC2 (Figure 1-5) (183), which encodes a leucine-rich repeat-
containing scaffold protein required for the efficient transmission of information from RAS to
the MAPK cascade (186). Functional studies of the SHOC2-S2G mutant demonstrated aberrant
protein N-myristoylation, which resulted in aberrant targeting of SHOC2 to the plasma
membrane and impaired translocation to the nucleus upon growth factor stimulation.
23
1.2.2.3 CBL-mutation associated Noonan-like syndrome
Three independent studies recently reported that heterozygous germline mutations in the
CBL tumor suppressor gene, which is mutated in myeloid malignancies and encodes a
multivalent adaptor protein with E3 ubiquitin ligase activity, underlie a previously unrecognized
condition with clinical features fitting or partially overlapping NS in some individuals (Figure
1-5) (187-189). Missense mutations alter the evolutionarily conserved residues located in the
RING finger domain or the linker connecting this domain to the N-terminal tyrosine kinase
binding domain, a known mutational hot spot in myeloid malignancies that affects CBL-
mediated receptor ubiquitylation and dysregulates signal flow through RAS (187). Common
features occurring in CBL mutation-positive subjects include variable developmental delay,
reduced growth, facial dysmorphism, café-au-lait spots, and predisposition to JMML during
childhood (188, 189).
1.2.2.4 Neurofibromatosis type 1 and related phenotypes
Neurofibromatosis type 1 (NF1; OMIM 162200) is one of the most common autosomal
dominant disorders (1 in 3000–4000 live births) caused by a single gene (190, 191). NF1 is
characterized by multiple café-au-lait spots, axillary and inguinal freckling, Lisch nodules of the
iris, cutaneous, subcutaneous and/or plexiform neurofibromas, skeletal dysplasia including short
stature, dystrophic scoliosis and sphenoid wing dysplasia, learning deficits and behavioral
abnormalities, and a predisposition for developing benign and malignant neoplasms, such as
malignant peripheral nerve sheath tumors (MPNST) and optic pathway gliomas (OPG).
Cardiovascular abnormalities in NF1 include congenital heart defects such as pulmonary artery
stenosis, vasculopathy and hypertension. Heterozygous mutations of the NF1 gene, which
encodes Neurofibromin, a RAS-GTPase activating protein (RASGAP) that activates the intrinsic
GTPase activity of RAS and negatively regulates its role in signal transduction, are observed in
the vast majority of affected individuals (>90%) (Figure 1-5) (192). Loss-of-function mutations
or deletions of the NF1 gene lead to increased RAS/ERK signalling.
A disorder related to NF1 is NF1-like syndrome (NFLS; OMIM 611431), also known as
Legius syndrome (193, 194). The most common clinical features of NFLS are multiple café-au-
lait spots, axillary freckling, macrocephaly, NS-like facial dysmorphism, learning disabilities,
24
and attention deficit-hyperactive disorder (ADHD). Despite the clinical overlap with NF1, some
typical features of NF1, such as Lisch nodules, neurofibromas and central nervous system tumors
are absent in NFLS patients. NFLS is caused by loss-of-function mutations of the SPRED1 gene
(193, 195), which encodes Sprouty-related EVH1 domain-containing protein 1 (SPRED1), a
negative modulator of RAS/ERK pathway that suppresses phosphorylation and activation of
RAF (Figure 1-5) (196).
1.2.2.5 Cardiofaciocutaneous syndrome
Cardiofaciocutaneous syndrome (CFCS; OMIM 115150) is an extremely rare and severe
genetic disorder characterized by cardiac abnormalities, distinctive craniofacial dysmorphism,
cutaneous abnormalities, failure to thrive, severe feeding problems, developmental delay,
reduced growth, and abnormalities of the gastrointestinal tract and central nervous system (197,
198). Recurrent craniofacial features include macrocephaly, which is usually associated with
prominent forehead, bitemporal constriction, and facial dysmorphia that is coarser compared
with NS. The skin abnormalities include dryness and hyperkeratosis, ichthyosis, eczema,
unusually sparse, brittle and curly scalp hair, and absent/sparse eyebrows and eyelashes.
Pigmentary changes (such as café-au-lait spots, nevi or lentigines) and hemangiomas are
observed. Cardiac defects occur in the majority of affected individuals, and consist of pulmonic
stenosis and other valve dysplasias, septal defects, HCM and rhythm disturbances. Some form of
neurologic and/or cognitive delay (ranging from mild to severe) is seen in all affected
individuals; seizures are also frequent. CFCS is genetically heterogeneous, and is usually the
result of a de novo dominant mutations in the KRAS, BRAF, MAP2K1 or MAP2K2 genes, which
occurr in approximately 60-90% of affected individuals (Figure 1-5) (171, 172).
1.2.2.6 Costello syndrome
Costello syndrome (CS; OMIM 218040) is the eponymous name for a rare genetic
disorder described by pediatrician Dr. Jack Costello in 1970, as a condition characterized by
prenatal overgrowth followed by severe failure to thrive, delayed development and mental
retardation, distinctive coarse facial features, short stature, and cardiac defects (most commonly
HCM, septal defects, valve thickening and/or dysplasia, and tachycardia), and musculoskeletal
and skin abnormalities (unusually flexible joints and loose folds of extra skin on hands and feet)
25
(199, 200). Beginning in early childhood, affected individuals are predisposed to certain
malignancies (most commonly rhabdomyosarcoma, neuroblastoma and transitional cell
carcinoma) (201). Cutaneous papillomas in the perinasal and perianal regions are the most
common benign tumors seen with this condition. CS is caused by germline missense mutations in
HRAS (Figure 1-5) (202), but not in other RAS family genes. CS-associated HRAS mutations at
codons 12 and 13 promote the active, GTP-bound conformation and constitutively activate
downstream effectors such as MAP kinase, PI-3 kinase and RALGDS (203).
1.2.3 Noonan syndrome mouse models
In order to study the molecular pathogenesis of NS, several mouse models carrying NS-
associated mutations have been generated and characterized in our and other laboratories. Araki
et al. generated the first knock-in mouse model expressing the NS-associated gain-of-function
mutant Shp2D61G (204). When homozygous, the D61G mutant causes embryonic lethality,
whereas heterozygotes have decreased viability. Surviving Ptpn11D61G/+ embryos (approximately
50%) have short stature, craniofacial abnormalities similar to those in NS patients, and MPD.
Severely affected Ptpn11D61G/+ embryos (approximately 50%) have multiple cardiac defects,
including atrial, atrioventricular or ventricular septal defects, double-outlet right ventricle
(DORV), and markedly enlarged outflow tract and atrioventricular valve primordia, similar to
those in mice lacking Nf1 (205, 206). Their endocardial cushions have increased Erk activation,
but Erk hyperactivation is cell- and pathway-specific. These data show that a single Ptpn11 gain-
of-function mutation can evoke all major features of Noonan syndrome by acting on multiple
developmental lineages in a gene dosage-dependent and pathway-selective manner. Transgenic
mice expressing a different NS-associated Ptpn11 mutant (Q79R) also show valvulospetal
defects and facial abnormalities seen in NS patients, which are prevented by the genetic ablation
of Erk1/2 or pre-natal pharmacological inhibition of Mek (207-209).
Later, using an inducible gene knock-in approach, our laboratory further elucidated the
mechanism underlining the cardiac defects in NS caused by Ptpn11 mutations, and showed that
all cardiac defects in NS result from mutant Shp2 expression in the endocardium, not in the
myocardium or neural crest (210). Moreover, the penetrance of NS defects is affected by genetic
background and the specific Ptpn11 allele. Finally, ex vivo assays and pharmacological
approaches showed that NS mutants cause cardiac valve defects by increasing Erk MAPK
26
activation. However, we did not observe HCM in these NS mouse models caused by Ptpn11
mutations.
Chen et al., in collaboration with our laboratory, observed that activation of multiple
signaling pathways causes developmental defects in mice with a Noonan syndrome–associated
Sos1E846K gain-of-function mutation (211). Both heterozygous and homozygous mutant mice
showed many NS-associated phenotypes, including growth defects, distinctive facial dysmorphia,
hematologic abnormalities, and cardiac defects. The phenotypes in Sos1E846K mice and our NS-
associated Ptpn11 mutation mouse models (204, 210) overlap to some degree, but are
distinguishable. Sos1E846K/+ mice develop left ventricular hypertrophy (LVH) and fibrosis, with
or without aortic stenosis (AS). Sos1E846K mutation appears to selectively affect semilunar valves,
whereas Ptpn11D61G has a more profound effect on atrioventricular valves. Although NS patients
with SOS1 mutations develop PS, PS was not observed in the Sos1E846K/+ hearts. The Ras/Erk
pathway, as well as Rac and Stat3, are activated in Sos1E846K mutant hearts, suggesting that Rac
and Stat3 activation might also contribute to NS phenotypes. Furthermore, prenatal
administration of a MEK inhibitor ameliorated the embryonic lethality, cardiac defects, and NS
features of the homozygous mutant mice.
1.3 Function and regulation of RAF1
The first raf gene was described in 1983 as a retroviral oncogene, v-raf, transduced by
the murine sarcoma virus (MSV-3611) (212). Later, an avian homolog, v-mil, was found in the
acutely transforming avian retrovirus MH2 (213). These two retroviruses encoded the first
oncogene with serine/threonine kinase activity to be discovered (214). After the cellular proto-
oncogenes c-raf (215) and c-mil (216) were cloned, RAF proteins have been studied intensely.
Initial studies demonstrated that CRAF (also known as RAF1) plays a critical role in mediating
the cellular effects of growth factor signals (217-219). Later, RAF proteins were identified as the
direct activators of MEK (220, 221) and as downstream effectors of RAS (222-226), acting as
essential connectors between RAS and the MEK-ERK pathway. Most subsequent work focused
on understanding this role and the regulation of RAF proteins in detail, until new kinase-
independent functions of RAF1 in the regulation of apoptosis (227-229) and cell migration (230)
emerged in the last decade.
27
Three different RAF isoforms, originating from three independent genes, are present in
mammals: RAF1/CRAF, BRAF, and ARAF. All Raf isoforms are expressed ubiquitously in
embryonic and adult mouse tissues. However, the Araf and Braf genes are more restricted in their
expression, with Araf mRNA expressed particularly highly in urogenital organs and Braf mRNA
abundant in neuronal tissues (231-233). Genetic studies in mice have shown that the Raf proteins
have non-redundant functions in development. On a predominantly C57BL/6 genetic background,
Araf-deficient mice survive to birth, but die between 7 and 21 days post-partum, displaying
neurological and gastrointestinal defects (234). By contrast, Araf-/- animals on a 129/OLA
background, survive to adulthood, are fertile and do not display obvious intestinal abnormalities,
although they do have a subset of the neurological defects seen on the C57BL/6 background.
Mice with a targeted disruption in Braf die of vascular defects during mid-gestation. Braf-/-
embryos show growth retardation, an increased number of endothelial precursor cells,
dramatically enlarged blood vessels and apoptotic death of differentiated endothelial cells (235).
Raf1-deficient embryos also are growth retarded and die at mid-gestation with vascular defects in
the yolk sac and placenta, abnormalities in the fetal liver, as well as increased apoptosis of
embryonic tissues (236-238). The lack of compensation between the Raf proteins in mice does
not seem to be the result of differences in expression patterns, which implies that the different
isoforms have distinct functions.
1.3.1 Structure of RAF family kinases
All RAF isoforms share a common structure, consisting of three conserved regions (CR)
with distinct functions (Figure 1-7). The CR1 region contains elements required for membrane
recruitment, including a RAS binding domain (RBD), which binds to active RAS-GTP, and a
cysteine-rich domain (CRD), which has a zinc finger structure homologous to those of protein
kinase C (PKC). The CRD stabilizes the association with RAS through interaction with the lipid
moiety present on processed RAS, and also is necessary for the interaction of CR1 with the
kinase domain for RAF autoinhibition (222, 239-242). CR2 contains important inhibitory
phosphorylation sites participating in negative regulation of RAS binding and RAF activation
(243). Finally, CR3 comprises the kinase domain, including the activation segment, whose
phosphorylation is crucial for kinase activation (244). In addition, phosphorylation of residues in
the negatively-charged (N) region upstream of the CR3 is necessary for RAF activation (245).
Functionally, the RAF structure can be split into a regulatory N-terminal region, containing CR1
28
Figure 1-7. Common structure of RAF proteins.
Schematic structure of RAF proteins depicting the three conserved region (CR1-3), the RAS-
binding domain (RBD) and cysteine-rich domain (CRD), as well as the negative-charged
regulatory region (N-region), glycine-rich loop (G-loop) and activation segment in which the
phosphorylation sites crucial for activation are located.
29
and CR2, which is critical for activation as well as inhibitory phosphorylation, and a catalytic C-
terminal region, which includes the phosphorylation sites necessary for kinase activation. The
regulatory domain restrains the activity of the kinase domain (240, 246, 247) and its removal
results in constitutive oncogenic activation (248). However, the activity of the isolated RAF1
kinase domain is subjected to further regulation and can be stimulated by phorbol esters, v-Src,
and phosphorylation (247, 249). This observation is in keeping with the finding that the most
common oncogenic mutation in BRAFV600E activates BRAF kinase activity by mimicking
phosphorylation of the activation loop that releases its inhibitory interaction with the ATP-
binding domain (167).
1.3.2 Regulation of RAF1
RAF regulation is highly complex and involves many steps, including membrane
recruitment, dimerization, protein-protein interaction, conformational changes and
phosphorylation (250-252).
1.3.2.1 The RAF1 activation/deactivation cycle
In the quiescent state, RAF1 is thought to exist in a closed, inactive conformation
wherein the N-terminal regulatory region folds over and blocks the catalytic region (Figure 1-8)
(253). This conformation is stabilized by 14-3-3 dimer binding to an N-terminal site, phospho-
S259 (pS259), and a C-terminal site, pS621 (Figure 1-9). Although RAF1 activation is
incompletely understood, numerous studies have suggested the following sequence of events
(Figure 1-8).
Dephosphorylation of pS259 at the cell membrane by specific phosphatases, including
protein phosphatase 2 (PP2A) and PP1, releases 14-3-3 from its N-terminal binding site on RAF1,
allowing conformational changes to occur that unmask the RBD and CRD in the CR1 region to
enable RAS binding and membrane recruitment (164, 254-258). RAS activation is under
negative feedback regulation mediated by ERK and its downstream substrate RSK, which
phosphorylate and inhibit SOS1 (95, 259). On the other hand, binding of RAF1 to RAS can be
facilitated by the scaffolding protein SUR-8/SHOC2 (186). The CRD is necessary, but not
sufficient, for stable membrane recruitment and activation of RAF1 (260, 261). RAF
translocation to the membrane also is aided by the ability of RAF to interact with lipids (262,
30
263). These data suggest that the CRD may stabilize the primary recruitment of RAF1 exerted by
the RBD through forging interactions with the lipid tails of RAS proteins (264). Furthermore,
RAS isoforms reside in different subcellular compartments, which can influence interactions
with RAF family members, and can profoundly influence the mechanism and kinetics of RAF
activation (265).
Phosphorylation of multiple residues in the N-region upstream of CR3 and in the
activation segment in CR3 is required for full RAF1 activation (Figure 1-8 and Figure 1-9). The
N-region in RAF1 contains the S338/9 and Y340/1 phosphorylation sites, which are not only
essential for full kinase activation but also for interaction with the substrate MEK (266-268).
PAK (269, 270) and SRC family tyrosine kinases (271, 272), respectively, reportedly
phosphorylate these sites. Other studies suggest that Ser338 is autophosphorylated upon RAF
dimerization induced by mitogens (273), whereas others demonstrate that casein kinase 2 (CK2)
phosphorylates Ser338 as a component of the KSR1 scaffold complex recruited to RAF (274).
S338/9 phosphorylation itself only slightly elevates RAF1 kinase activity and mainly seems to
serve as a priming event that initiates further activating modifications (266). S471 has been
identified as a growth factor-induced RAF1 phosphorylation site, which is critical for RAF1
kinase activity and MEK binding (275). Finally, the phosphorylation of T491/S494 in the
activation loop is RAS-dependent and required for full activation (244, 276), but the identity of
the respective kinase(s) is unknown. Beside these major sites, phosphorylation at several minor
sites also has been reported, including T268/269 (277, 278), T481 (275) and S497/499 (279).
The role of these phosphorylations in RAF1 regulation remains unresolved, but they do not
notably affect RAF1 activation. RAF homodimerization and heterodimerization have recently
emerged as important regulatory mechanisms that drastically enhance kinase activity and
downstream signaling, and are discussed in detail later.
Deactivation of RAF1 is initiated by specific binding of protein phosphatase 5 (PP5) to
activated RAF1, which results in the dephosphorylation of pS338 (280). The phosphorylated N-
region also serves as a binding site for the RAF kinase inhibitor protein (RKIP) (281, 282),
which dissociates RAF1 from its substrate MEK (283, 284). In addition, RAF1 is subjected to
direct feedback phosphorylation on multiple sites by ERK (Figure 1-9), which inhibit the
activation of RAF1 by RAS and promote the subsequent dephosphorylation and resensitization
of RAF1 by PP2A (97). Negative feedback from ERK to RAF1 also is suggested by a systematic
31
Figure 1-8. Overview of RAF1 activation/deactivation.
In quiescent cells, intramolecular autoinhibition of RAF1 is stabilized by the binding of 14-3-3 to
the pS259 and pS621 residues. Upon membrane recruitment by activated RAS, pS259 is
dephosphorylated by PP1 or PP2A. Subsequently, phosphorylation of the N-region and
activation loop by as yet incompletely defined upstream kinases, and homodimerization or
heterodimerization with other RAF isoforms, cause full activation of RAF1. Following
MEK/ERK activation, RAF1 is deactivated through PP5-mediated dephosphorylation of pS338,
and ERK-mediated feedback phosphorylation, which desensitize the kinase. PP2A, through the
prolyl isomerase PIN1, and maybe other unknown phosphatases, dephosphorylate the remaining
activating sites and the ERK feedback sites. RAF1 ultimately reverts to its closed, inactive
conformation upon rephosphorylation of S259 by AKT, PKA or unknown kinases, allowing
intramolecular bidentate 14-3-3 rebinding. Activating events are colored red and deactivating
processes are in black.
32
Figure 1-9. Regulatory phosphorylation sites of RAF proteins.
The structure and phosphorylation residues of the three RAF isoforms. Red residues indicate
activating phosphorylation sites, black are ERK feedback phosphorylation sites, and blue are 14-
3-3 binding sites.
33
analysis of feedback regulation of the RAS/ERK pathway based on mathematical modeling (285),
although several ERK feedback phosphorylation sites also were described as stimulating RAF1
activity (286).
RAF1 also is negatively regulated by cAMP–activated kinase (PKA)-catalyzed
phosphorylation of several sites, including S43, S233, S259 and S621. The phosphorylation of
S43 interferes with RAS binding (287, 288), whereas phosphorylation of S233 and S259
enhances the binding of 14-3-3 and suppresses RAF1 kinase activity (289, 290). Studies also
show that S259 could be phosphorylated by AKT directly or indirectly (291-293). The
phosphorylation of S621 and binding of 14-3-3 to pS621 appears to have multiple roles in RAF1
regulation. On the one hand, it serves as a negative regulatory phosphorylation site to stabilize
the closed, inactive conformation in resting cells (294, 295); on the other hand, its inhibitory
function is converted into an essential component of RAF1 activation following stimulation
(296). For example, pS621 increases the stability of RAF1 by preventing proteasome-mediated
degradation (297). Binding of 14-3-3 to pS621 also enhances RAF dimerization (98, 168, 298,
299), and is required for the kinase domain to bind ATP (296). However, several studies
demonstrate that S621 phosphorylation is largely mediated by autophosphorylation (296, 297).
The phosphatase(s) responsible for dephosphorylating S621 is(are) currently unknown.
1.3.2.2 RAF homodimers and heterodimers
Dimerization is a frequent mechanism for the activation of kinases. Homodimerization
was initially highlighted as a potentially important step of RAF1 activation by two studies
showing that forced interaction of RAF1 monomers tagged with inducible dimerizing tags
robustly induced kinase activity (300, 301). Both studies proposed that active RAS would
promote the formation of dimers. This hypothesis was later extended to heterodimerization
between RAF1 and BRAF, which was found to be inducible by active RAS (302). These initial
studies showed that homodimerization and heterodimerization can hyperactivate RAF kinases.
Later, Rushworth et al. demonstrated that endogenous BRAF and RAF1 heterodimerize in
multiple cell lines in response to mitogens (298). Biochemical fractionation of RAF heterodimers
from homodimers and monomers showed that RAF1/BRAF heterodimers accounted for the
majority of the mitogen-induced RAF kinase activity, suggesting that RAF1 and BRAF
cooperate to drastically elevate their kinase activity when forming heterodimers. Given that
34
heterodimers between wild-type RAF1 and kinase-defective BRAF still display elevated kinase
activity, as do heterodimers between wild-type BRAF and kinase-impaired RAF1, either kinase-
competent RAF isoform is sufficient to confer high catalytic activity to the heterodimers.
Heterodimerization plays a pathological role in certain cancers. When BRAF mutations
were discovered in cancer (35), a puzzling observation was that while the most frequent mutation,
V600E, massively enhanced BRAF kinase activity, several less frequent BRAF mutations only
mildly increased, or even impaired, kinase activity (167). Nevertheless, even kinase-impaired
BRAF mutants could hyperactivate the MEK/ERK pathway. Intriguingly, this activation was
dependent on the presence of RAF1, and a subsequent study demonstrated that the kinase-
impaired BRAF mutants found in human cancers indeed could promote RAF1 heterodimer
formation (168). Although physiological RAF1/BRAF heterodimerization is induced by RAS
activation, oncogenic BRAF mutants constitutively dimerize with RAF1 (168, 298). More
recently, an important role for RAF heterodimers in response to ATP-competitive RAF kinase
inhibitors was described. The original observation that RAF inhibitors paradoxically induce ERK
cascade signaling can now been explained by the ability of RAF inhibitors to promote RAF
heterodimerization and activation in the presence of oncogenic or normally activated RAS (169,
170, 303).
Mutation of S621 abrogates RAF heterodimerization, suggesting that 14-3-3 binding to
pS621 is essential for RAF heterodimerization (302). Indeed, heterodimerization is enhanced by
wild type 14-3-3, but not a dimerization-negative 14-3-3 mutant, suggesting that the 14-3-3
dimer crosslinks RAF1 and BRAF by binding to the C-terminal sites on each kinase (298). This
observation suggests a mechanism for how 14-3-3 can stabilize both inactive and active RAF1
conformations. In the inactive conformation, 14-3-3 clasps the RAF1 regulatory domain to the
kinase domain via intramolecular binding to pS259 in the N-terminus and p621 in the C-terminus.
Dephosphorylation of pS259 and binding to activated RAS displaces 14-3-3 from S259, leaving
one 14-3-3 arm free to contact with the 14-3-3 binding site on BRAF in order to facilitate
heterodimerization. RAF heterodimerization also is regulated by ERK-mediated feedback
phosphorylation on RAF (97, 298). The feedback phosphorylation mainly serves to limit the
lifetime of RAF1/BRAF heterodimers, and mutation of the relevant sites enhances ERK
signaling and the associated biological activities. Other regulators include KSR1 (304) and
MLK3 (305), which both enhance heterodimerization.
35
The precise mechanism by which the juxtaposition of RAF molecules stimulates kinase
activity was elucidated recently by Rajakulendran et al. (299). They demonstrated that activation
of the kinase domain of RAF is controlled by an allosteric interaction between two kinase
domains in a specific side-to-side dimer configuration, which is thought to position a critical
helix (helix αC) in the kinase domain in a productive conformation necessary for catalytic
activity (Figure 1-10). The dimer interface region in the RAF kinase domain is conserved in the
KSR kinase domain, which also can serve as an allosteric activator of RAF by forming
KSR/RAF side-to-side heterodimers. Given that all isoforms of RAF and KSR share a nearly
identical side-to-side dimer interface, the question still remains as to how the cell regulates
specific dimer formation between the multiple isoforms of RAF and KSR proteins found in
higher-order metazoans. Presumably, cells must have a separate mechanism for selectively
driving dimer formation between any two specific isoforms. For example, a recent study showed
that most RAF inhibitors induce KSR1/BRAF binding, but promote little complex formation
between KSR1 and RAF1 (306). These works also found that KSR1 competes with RAF1 for
inhibitor-induced binding to BRAF.
1.3.2.3 Scaffolds and modulators of RAF signaling
Multiple studies have revealed scaffolding as a mechanism that helps the ERK cascade to
transduce signals with high efficiency and specificity. Scaffolds also appear to be involved in the
spatial restriction of ERK activity and signaling to distinct subcellular compartments (Figure
1-11) (307). Therefore, scaffolds can have a huge impact on the biochemical and biological
behavior of the ERK pathway (308, 309). However, our knowledge of their role in the functional
modulation of the pathway and their exact mechanism of action is still limited.
The best-characterized scaffold of the ERK pathway is kinase suppressor of Ras (KSR)
(310). KSR1 has a kinase domain with high homology with RAF1. But this kinase domain
contains mutations in residues critical for catalytic activity. Whether KSR1 has kinase activity or
is a pseudokinase have been debated. As a scaffold for the ERK pathway, KSR1 can interact
with all kinases of the ERK pathway. MEK is bound constitutively, while RAF and ERK are
recruited to KSR1 upon mitogen stimulation (311, 312). However, KSR1 binds less than 5% of
endogenous RAF1 (313), indicating that it might affect only a subset of RAF functions.
Experiments with KSR-deficient mice indicate that KSR is not absolutely required, but enhances
36
Figure 1-10. Allosteric mechanism for activation of the kinase domain of RAF1.
RAF1 exists in an inactive conformation characterized by the monomeric state of its kinase
domain. The N- and C-terminal lobes of RAF or KSR kinase domains are indicated. Following
RAS activation, the kinase domain of RAF1 transitions from an inactive monomeric state to an
active side-to-side dimer, characterized by the juxtaposition of a critical helix (helix αC) in the
N-lobe. The cellular pool of RAF/KSR proteins contains multiple isoforms, and the mechanism
by which the cell selectively drives dimer formation between two given isoforms is currently
unknown.
37
Figure 1-11. Scaffolding proteins in RAF-MEK-ERK signaling.
Scaffolding proteins form RAF-MEK-ERK signaling platforms at different subcellular
localizations. See text for details.
38
signaling from RAS (314). Recent studies have shown that KSR is a functional protein kinase,
presumably stimulated allosterically by forming side-to-side dimers with RAF, and catalyzes
phosphorylation of MEK1 on non-activation segment residues to facilitate RAF-mediated
phosphorylation of MEK1 activation segment serines (315, 316).
Another group of RAF scaffolds is the connector enhancer of KSR (CNK) family of
proteins, which lack kinase activity but contain different protein-protein interaction domains that
can bind a variety of proteins, including RAF (309, 317). CNK1 can augment RAF1 activation
by increasing tyrosine phosphorylation of the N-region through the recruitment of c-SRC (318).
Interestingly, CNK1 also can bind Ras association domain-containing protein 1A (RASSF1A)
and enhance apoptosis in a MST2-dependent manner, which may play a role in balancing
apoptosis and proliferation by coordinating MST2 binding to RASSF1A or RAF1 (319). Another
family of multi-domain scaffolding proteins is IQ motif containing GTPase-activating proteins
(IQGAPs), which directly interact with, and modulate the functions of, BRAF, MEK, and ERK
(320, 321). Prohibitin (PHB) facilitates the displacement of 14-3-3 from RAF1 by activated RAS,
thereby promoting plasma membrane localization and phosphorylation of RAF1 at the activating
S338 (322, 323).
Scaffolding proteins also are crucial for the localization of members of the ERK pathway
to different subcellular signaling platforms. Similar expression to FGF (SEF1), which is located
at the Golgi apparatus, is a transmembrane scaffold for MEK and ERK (324). Importantly, SEF1
only binds activated MEK and inhibits the dissociation of the MEK-ERK complex, which blocks
nuclear translocation of ERK, allowing the activation only of cytoplasmic ERK targets (324).
The β-arrestins are proposed to augment ERK activation in clathrin-coated pits by scaffolding
RAF1, MEK, and ERK (325). Similar to SEF1, β-arrestins also prevent ERK nuclear
translocation and therefore restrict RAS signaling to cytoplasmic effectors of the pathway. The
small scaffold MEK partner-1(MP1) is an obligatory heterodimer with p14, and this complex
interacts with MEK and ERK, targeting them to late endosomes (326, 327). In addition, MP1
may target MEK-ERK to high molecular weight protein complexes (328), organized by MAPK
organizer 1 (MORG1), which was identified as an interaction partner of MP1 as well as RAF1,
BRAF, MEK, and ERK (329). MP1 also forms the Ragulator complex with p14 and p18, which
is required for the recruitment and activation of mTORC1 at the lysosomal surface (330). The
39
multidomain protein paxillin is a component of focal adhesions, providing a structural and
signaling link between the actin cytoskeleton and the extracellular matrix (ECM) (331). Paxillin
constitutively interacts with MEK, but also binds to activated RAF and ERK in response to
growth factors, directing activated ERK to focal adhesions (332).
1.3.3 MEK-independent functions of RAF1
Studies using conventional and conditional Raf1 knockout mice (237, 238, 333) led to the
discovery of new RAF1 effector pathways in which regulation occurs through protein-protein
interactions. For some of these pathways, RAF1 kinase activity is dispensable (Figure 1-12).
1.3.3.1 RAF1 and apoptosis
RAF1 regulates apoptosis through multiple targets. A mitochondrial pool of RAF1 has
been shown to protect cells from apoptosis (Figure 1-12). RAF1 can be targeted to the
mitochondria via its interaction with BCL2 (334). In addition, RAF1 serves as a scaffold to
recruit protein kinase C theta (PKCθ) to phosphorylate and inactivate the pro-apoptotic BCL-2
family member BAD (335, 336). Another possible mechanism is the direct interaction between
RAF1 and mitochondrial voltage-dependent anion channels (VDACs), which may be responsible
for the RAF-induced inhibition of cytochrome c release from mitochondria (337).
Raf1 ablation in mice demonstrated that Raf1 is required for survival and protection
against apoptosis (237, 238). Surprisingly, reconstituting Raf1–/– mice with a kinase-impaired
Raf1 mutant (Raf-1YY340/1FF) fully rescues the apoptotic phenotype and produces viable mice
(238). Studies have shown that several mechanisms account for the anti-apoptotic function of
Raf1 (Figure 1-12). These may operate in a tissue-specific manner, but none requires Raf1 kinase
activity. One mechanism is through the deregulation of the Rho effector kinase Rok-α, which is
up-regulated and mislocalized to the membrane in Raf1-deficient cells (229). This results in a
defect in the internalization of the Fas death receptor, which increases Fas clustering and
membrane expression, enhancing Fas sensitivity.
The other targets of RAF1 in apoptosis suppression include two pro-apoptotic kinases,
apoptosis signal-regulating kinase 1 (ASK1) (227, 338) and MST2 (228, 339) (Figure 1-12).
ASK1 is a member of the MAP kinase kinase kinase family that selectively activates JNK and
p38 to promote apoptosis induced by various cytotoxic stresses, such as reactive oxygen species
40
Figure 1-12. MEK-independent RAF1 signaling pathways.
RAF1 can suppress apoptosis in a MEK-independent fashion in several ways: 1) by binding to
and inhibiting ASK1; 2) by suppressing cytochrome C release from mitochondria through
voltage-dependent anion channels (VDACs); 3) by acting as scaffold to recruit PKCθ to
phosphorylate and inactivate BAD; 4) by binding to and inhibiting the mammalian MST2
pathway; and 5) by inhibiting ROK-α-induced FAS maintenance and clustering at the cell
membrane. Inhibition of ROK-α by RAF1 binding also is required for regulating motility
through the actin cytoskeleton and for skin tumorigenesis by preventing keratinocyte
differentiation and sustaining MYC expression.
41
(ROS), or by death receptors, such as the TNF-α receptor or FAS (340). RAF1 interacts with the
N-terminal regulatory fragment of ASK1 and inhibits its proapoptotic function (227). Cardiac-
specific disruption of Raf1 results in heart dilation and dysfunction with a significant increase in
cardiomyocyte apoptosis, all of which are rescued by the ablation of Ask1 (338). MST2 was
identified in a proteomics screen for RAF1-associated proteins (228). RAF1 binds to the SARAH
domain of MST2, thereby preventing the dimerization and phosphorylation of the activation loop
of MST2, independent of RAF1 kinase activity. RASSF1A, a tumor suppressor, can disrupt the
RAF1–MST2 complex and promote the assembly of a proapoptotic signaling complex consisting
of RASSF1A, MST2, LATS1, and YAP1 (339, 341). Activated YAP1 translocates into the
nucleus and interacts with p73, promoting the expression of proapoptotic BH3-only protein p53-
upregulated modulator of apoptosis (PUMA) to induce apoptosis (341). Interestingly, RAS
binding to RAF1 enables RAF1 to activate the MEK-ERK pathway and promote proliferation,
but also induces dissociation of the RAF1-MST2 complex and promotes apoptosis (342).
1.3.3.2 RAF1 regulates cell motility and differentiation through ROK-α
Conditional gene ablation of Raf1 in keratinocytes delays migration and wound healing
(230). The target of Raf1 in motility is Rok-α (Figure 1-12). Raf1 knockout fibroblasts and
keratinocytes show a contracted appearance and fail to migrate due to the hyperactivity and
incorrect localization of Rok-α to the plasma membrane. Similar to Raf1, Rok-α is regulated by
auto-inhibition, and its C-terminal regulatory region features a domain highly homologous to the
CRD in Raf1. The Raf1 regulatory domain can cross-regulate Rok-α by binding to the Rok-α
kinase domain and repressing its function in trans (343). The biological relevance of the Raf1:
Rok-α complex was observed in a Ras-induced skin tumor mouse model (344). In this model, the
inhibition of Rok-α by Raf1 was required for Ras transformation by decreasing the expression of
epidermal differentiation cluster (EDC) and activating the Stat3/Myc pathway, thereby
promoting dedifferentiation of tumor cells.
1.4 Hypertrophic cardiomyopathy and the RAS/ERK pathway
1.4.1 Cardiac hypertrophy and hypertrophic cardiomyopathy
The mammalian heart is a dynamic organ, which is composed of cardiomyocytes, non-
myocytes (e.g., fibroblasts, endothelial cells, mast cells and vascular smooth muscle cells) and
42
surrounding extracellular matrix (345, 346). Cardiomyocytes are specialized muscle cells
composed of bundles of myofibrils, which contain repeating contractile units known as
sarcomeres (347). It is generally believed that most cardiomyocytes lose their ability to
proliferate at or soon after birth, and that the subsequent growth of heart occurs primarily as a
result of an increase in myocyte size (348). In adults, the growth of heart is closely matched to its
functional load. In response to elevated workload, the heart undergoes a hypertrophic response,
which is characterized by an increase in the size of individual cardiomyocytes, to compensate for
the increase in wall stress (345). This hypertrophic response can be classified as one of two
general types, physiological or pathological, which are caused by different stimuli, are
functionally distinguishable, and are associated with distinct structural and molecular phenotypes
(Figure 1-13) (349, 350).
Physiological growth of the heart includes the embryonic and fetal stages of development
and the rapid postnatal growth stage (345). In the adult, physiological hypertrophy usually occurs
in response to chronic exercise training (351) or pregnancy (352). Pathological cardiac
hypertrophy is caused by genetic mutations (primary) (353, 354) or in response to diverse
stimuli, such as hypertension, valvular stenosis or myocardial infarction (secondary) (345, 355).
With increased cardiac stress, pathological cardiac hypertrophy might initially represent a
compensatory mechanism for increasing cardiac function and decreasing ventricular wall
tension. However, chronic pathological hypertrophy eventually leads to functional
decompensation, and predisposes individuals to ventricular dilatation, heart failure, arrhythmia
and/or sudden death (356, 357). By contrast, physiological hypertrophy does not decompensate
into dilated cardiomyopathy or heart failure (351, 358).
Physiological and pathological hypertrophy can be further sub-classified as concentric
(hearts with thick walls and relatively small cavities) or eccentric (hearts with chamber
enlargement and a proportional change in wall thickness) (359, 360). Isotonic exercise (e.g.,
running, walking or swimming) causes volume overload and produces eccentric physiological
hypertrophy, whereas isometric or static exercise (e.g., weight lifting) causes pressure overload
and results in concentric physiological hypertrophy (345, 358). Pathological stimuli causing
pressure overload, such as hypertension or aortic stenosis, produce concentric hypertrophy. By
contrast, volume overload (e.g., mitral or aortic regurgitation) that causes increased diastolic wall
stress or myocardial infarction (MI), can result in eccentric hypertrophy (359, 360). Concentric
43
Figure 1-13. Types of cardiac hypertrophy.
RV, right ventricle; LV, left ventricle.
44
hypertrophy is characterized by assembly of sarcomeres in parallel, resulting in a relative
increase in the width of individual cardiomyocytes. By contrast, eccentric hypertrophy is
characterized by assembly of sarcomeres in series, leading to a relatively greater increase in the
length than in the width of cardiomyocytes. As mentioned above, concentric pathological
hypertrophy may progress to eccentric hypertrophy, and then eventually to cardiac dilation with
associated systolic heart failure (361).
Animal studies have demonstrated that physiological and pathological hypertrophy are
associated with distinct histological and molecular characteristics (362-364). In mice, a surgical
model of pathological hypertrophy can be established by transverse aortic constriction (TAC),
which causes pressure overload on the left ventricle (365, 366). TAC initially leads to
compensated hypertrophy, which often is associated with a temporary increase of cardiac
contractility. However, over time, the response to the chronic hemodynamic overload becomes
maladaptive, resulting in cardiac dilatation and heart failure. Pathological hypertrophy usually is
associated with increased apoptosis, necrosis and interstitial fibrosis (367). In response to
pathological stimuli, cardiac fibroblasts and extracellular matrix proteins accumulate
disproportionately and excessively surrounding the cardiomyocytes, which can lead to
mechanical stiffness, and contribute to cardiac dysfunction (368). Pathological cardiac
hypertrophy typically is associated with reactivation of fetal genes, including atrial natriuretic
peptide (ANP), B-type natriuretic peptide (BNP) and genes for the fetal isoforms of contractile
proteins, such as skeletal α-actin and β-myosin heavy chain (β-MHC). These changes can be
accompanied by down-regulation of genes normally expressed at higher levels in the adult, such
as α-MHC and sarcoplasmic reticulum Ca2+-ATPase (SERCA2a) (369). This altered gene
expression program affects cardiac function, leading to altered contractility, elevated end-
diastolic pressure and arrhythmias. By contrast, these histological and molecular changes are not
observed in models of physiological cardiac hypertrophy induced by exercise training (364, 370,
371).
Primary hypertrophic cardiomyopathy (HCM) is the prototypical genetic form of
pathological hypertrophy. The hallmark of HCM is cardiac hypertrophy in the absence of an
obvious inciting hypertrophic stimulus (372). Complications of HCM include left ventricular
outflow tract obstruction, arrhythmias, diastolic dysfunction, MI, stroke, infective endocarditis
45
and sudden cardiac death (373). Hearts from HCM patients commonly show cardiomegaly and
left ventricular hypertrophy (LVH). In end-stage disease, cardiac remodeling occurs, leading to
dilatation of the ventricles and atria and thinning of the ventricular wall due to myocardial
scarring (374). Myocyte disarray, the loss of the normal parallel alignment of cardiomyocytes, is
the most characteristic and common histological finding in HCM (373). Also, HCM usually is
associated with interstitial myocardial fibrosis and variation in the size of myocyte nuclei.
Autosomal dominant mutations in several genes encoding proteins of the cardiac
sarcomeric apparatus (e,g., β-MHC, cardiac troponin T, and myosin-binding protein C) account
for 60-70% of all cases of primary HCM (373). Such mutations usually alter sarcomere structure
and function and result in mechanical, biochemical and/or bioenergetic stresses that activate
cardiomyocyte signaling pathways to mediate the hypertrophic phenotype (375-378). Non-
sarcomeric genes responsible for myocardial metabolism also have been identified in HCM, such
as lysosome-associated membrane protein-2-α-galactosidase (LAMP2) (379). Aberrant
activation of hypertrophic signaling pathways can themselves result in hypertrophy. For
example, germ line mutations in adenosine monophosphate-activated protein kinase (AMPK) are
a rare cause of HCM (380-382).
Moreover, the discovery of mutated RAS/ERK pathway-related genes in RASopathies
has underlined the relevance of this signaling pathway to HCM (32). HCM occurs with a high
incidence in CS (200, 383) and LS (176, 384), whereas it is less common in CFCS (171, 385)
and NS (146, 173) patients. However, NS-associated kinase-activating RAF1 mutants are highly
associated with HCM (148, 149).
1.4.2 Signaling pathways involved in cardiac hypertrophy
Studies of transgenic and knockout mice, in combination with surgical and exercise
models, have revealed signaling cascades that play important roles in regulating cardiac
hypertrophy, such as the GPCR signaling, the calcineurin-nuclear factor of activated T cells
(NFAT) pathway, the insulin-like growth factor-I (IGF-I)-phosphoinositide-3 kinase (PI3K)
cascade, and the MAPK pathway (349, 350, 386) (Figure 1-14). To date, the best characterized
examples of pathways that play distinct roles in pathological and physiological hypertrophy are
Gαq/α11- dependent and IGF-I signaling, respectively.
46
The secretion of cardiac paracrine and/or autocrine factors, including angiotensin-II
(Ang-II), endothelin-1 (ET-1) and catecholamines (α-adrenergic), in response to a pathological
stimulus plays an important role in the development of pathological cardiac hypertrophy (387-
391) (Figure 1-14). These ligands bind to specific GPCRs that are coupled to heterotrimeric G
proteins of the Gαq/α11 subclass, which leads to the activation of downstream signaling molecules,
such as protein kinase C (PKC), and the mobilization of internal Ca2+. Ca2+ stores have been
shown to regulate cardiac hypertrophy by activating the calcineurin-NFAT pathway (392, 393)
and by promoting the calmodulin-dependent kinase (CaMK)-mediated nuclear export of histone
deacetylases (HDACs) (394). Calcineurin, which is a Ca2+-dependent serine/threonine protein
phosphatase, binds to and dephosphorylates transcription factors of the NFAT family, resulting
in their nuclear translocation and the activation of pro-hypertrophic gene expression (392). The
class II HDACs are implicated in cardiac hypertrophy by means of chromatin remodelling and
altered gene expression. Nuclear export of class II HDACs triggered by CaMKII-mediated
phosphorylation releases the suppression of hypertrophic gene transcription and induces cardiac
hypertrophy (394). Activation of Gαq/α11 also can induce MAPK pathways in cardiomyocytes,
although the exact mechanism remains unknown (395).
IGF-I has been implicated in the regulation of developmental and physiological growth of
the heart, and is released in response to exercise training (396-400) (Figure 1-14). IGF-I acts via
the IGF-I receptor, a receptor tyrosine kinase that activates class IA PI3K (PI3Kα). PI3K
activation results in the sarcolemmal recruitment and activation of the kinase AKT (also known
as PKB) (401). Glycogen synthase kinase-3β (GSK-3β), which is inhibited by AKT-mediated
phosphorylation, is an important downstream target of AKT in the heart. GSK-3β negatively
regulates hypertrophic transcriptional effectors (e.g., GATA4, β-catenin, c-Myc and NFAT), and
inhibits the translation initiation factor elF2B. AKT also enhances protein synthesis and cell
growth by activating the mTOR pathway (402). However, the role of the PI3K-AKT signaling
pathway in promoting cardiac hypertrophy is complex, as each of the effectors in this pathway
can have adaptive or maladaptive influences on the myocardium, depending on the type and
duration of the stimuli (350, 354). For example, short-term activation of AKT in cardiomyocytes
results in physiological adaptive hypertrophy, whereas chronic activation produces pathological
hypertrophy (403). Excessive PI3K-AKT-mTOR signaling also has been recently associated
with pathological cardiac hypertrophy in LS, wherein rapamycin treatment reverses LS cardiac
47
Figure 1-14. Signaling pathways involved in cardiac hypertrophy.
ANP, atrial natriuretic peptide; Ang II, angiotensin II; BNP, B-type natriuretic peptide; CaMK,
calmodulin-dependent kinase; CDK, cyclin dependent kinase; DAG, diacylglycerol; Endo-1,
endothelin-1; GC-A, guanyl cyclase-A; GPCR, G-protein coupled receptors; GSK3β, glycogen
synthase kinase-3β; HDAC, histone deacetylases; IκB, inhibitor of NF-κB; IGF-I, insulin-like
growth factor-I; IKK, inhibitor of NF-κB kinase; MEF, myocyte enhancer factor; mTOR,
mammalian target of rapamycin; NFAT, nuclear factor of activated T cells; NF-κB, nuclear
factor-κB; NIK, NF-κB-inducing kinase; PDK, phosphoinositide-dependent kinase; PI3K,
phosphatidylinositol 3-kinase; PKB, protein kinase B; PKC, protein kinase C; PKD, protein
kinase D; PLA2, phospholipase A2; PLC, phospholipase C; Pol II, RNA polymerase II; TAK,
TGFβ-activated kinase; TGFβ, transforming growth factor-β; TNFα, tumour necrosis factor-α.
Adopted from Heineke and Molkentin, Nature Reviews Molecular Cell Biology 7, 589-600 (350).
48
defects (404).
MAPK signaling is initiated in cardiomocytes by GPCRs (395), RTKs (e.g. IGF-I, EGF
and FGF receptors) (405), receptor serine/threonine kinases (e.g. transforming growth factor-β1
(TGF- β1) receptor) (406), glycoprotein-130 (gp130), the receptor for the interleukin-6 (IL-6)-
related cytokines (407), and by stress stimuli, such as mechanical stretch (408) (Figure 1-14).
Activated MAPKs each phosphorylate numerous downstream targets, including transcription
factors that induce the reprogramming of cardiac gene expression.
The role of the RAS/ERK pathway in cardiac hypertrophy has been controversial. Some
data argue that excessive activity of this pathway causes HCM, whereas other evidence suggests
its involvement in physiological, but not pathological, cardiac hypertrophy (409, 410).
Transgenic mice with cardiac-specific expression of oncogenic HRas (G12V) display significant
cardiac hypertrophy, decreased contractility, diastolic dysfunction associated with interstitial
fibrosis, induction of cardiac fetal genes and sudden death (411-413), all of which are consistent
with HCM. However, besides RAF-MEK-ERK activation, RAS also can activate the JNK
branch of the MAPK cascade, PI3K and other signaling pathways. Therefore, the cardiac defects
observed with constitutive RAS activation could be independent of MEK-ERK signaling. In
cultured cardiomyocytes, depletion of Erk1/2 with antisense oligonucleotides, or
pharmacological inhibition of Mek1/2, attenuates the hypertrophic response to agonist
stimulation (414, 415). Mice with cardiac-specific over-expression of “dominant-negative” Raf1
show reduced phosphorylation of the Erk target Elk1 and have no overt phenotype, but they are
resistant to the development of cardiac hypertrophy in response to pressure overload (416).
These data suggest that signals from Raf1 are necessary for promoting the pathological
hypertrophic response. The RAS/ERK pathway also has been implicated in inducing the re-
expression of fetal cardiac genes by altering the levels and activities of cardiac transcription
factors, such as GATA4, MEF2 and NFAT (417).
On the other hand, transgenic mice expressing an activated Mek1 allele under the control
of the α-MHC promoter have concentric hypertrophy with enhanced contractility, show no signs
of decompensation over time and reportedly do not progress to pathological hypertrophy up to 6
months of age (418). This study also found that the Mek1-Erk1/2 pathway induces cardiac
hypertrophy partially by enhancing the transcriptional activity of Nfat, indicating crosstalk
49
between the Ras/Erk and the calcineurin-Nfat pathways (419). Another study argued against any
role for Erk1/2 in cardiac hypertrophy, as Erk1-/-Erk2+/- mice, as well as transgenic mice with
cardiac-specific expression of dual specificity phosphatase 6 (Dusp6), an Erk1/2-specific
phosphatase, showed a normal hypertrophic response to pressure overload and exercise (420). A
more recent study from the same group using mice lacking all Erk1/2 proteins in the heart
demonstrated that Erk1 and Erk2 regulate the balance between eccentric and concentric cardiac
growth (421). Although loss of Erk1/2 in the heart (Nkx2.5-Cre) or specifically in the
cardiomyocytes (α-MHC-Cre) does not block the cardiac hypertrophic response to either aging
or pathological stimuli, it does dramatically alter how the heart grows: adult cardiomyocytes
from the Erk1-/-Erk2fl/fl:Cre heart show eccentric growth with a significant increase in length,
whereas myocytes from activated Mek1 transgenic hearts show concentric growth with increased
width.
The MEK5-ERK5 branch of MAPKs pathways also has been identified as a regulator of
cardiac growth. Transgenic mice with cardiac-specific expression of activated Mek5 show
eccentric cardiac hypertrophy, and progress to dilated cardiomyopathy and sudden death (422).
Consistent with this, targeted deletion of Erk5 in the heart attenuates the hypertrophic response
following pressure overload, and induces apoptosis in the heart (423). By contrast, activation of
p38 (transgenic mice expressing activated Mek3 or Mek6) (424) or JNK (transgenic mice
expressing activated Mek7) (425, 426) in the heart does not induce cardiac hypertrophy. Such
mice develop lethal cardiomyopathy as juveniles, characterized by reduced functional
performance, fibrosis and dilated ventricular walls.
Finally, in addition to signaling events that are initiated by ligand-receptor interactions,
cardiomyocytes can directly sense biomechanical deformation or stretch through an internal
sensory apparatus (427, 428). The integrin-interacting molecule melusin has been implicated as a
mechanical stress sensor in cardiomyocytes, essential for the inactivation of GSK-3β (428). The
muscle LIM-domain protein (MLP) might be a second sensory apparatus at the level of the Z-
disc within sarcomeres (427). MLP anchors to specific proteins at the Z-disc and functions as an
internal stretch sensor through a complex of transducing proteins that regulate calcineurin-NFAT
signaling (429).
50
1.5 Rationale and hypothesis
The RAS/ERK pathway controls fundamental cellular processes, such as proliferation,
differentiation and apoptosis, so it is not surprising that malfunction of this pathway results in the
multiple clinical manifestations seen in RASopathies. Yet, how mutations in the same signaling
pathway cause similar, yet clearly distinct, phenotypes remains unclear. Consequently, detailed
understanding of RASopathy pathogenesis could yield new insights into RAS/ERK pathway
regulation.
Primary HCM is the most common inherited cardiovascular disorder (1 in 500
individuals in the general population) (373, 430) and a leading cause of sudden death in the
young (431). Genetic and cellular models have identified multiple signaling pathways that can
cause or contribute to pathological hypertrophy, but the detailed mechanism by which aberrant
activation of these pathways evokes HCM remains incompletely understood. Delineating the
molecular pathways that distinguish physiological and pathological cardiac hypertrophy, and
identifying ways to reverse the latter, are of obvious medical importance. The role of the
RAS/ERK pathway in cardiac hypertrophy has been controversial, and remains to be resolved.
Given the fact that HCM is found in nearly all (~95%) NS patients bearing RAF1 mutations that
cause increased kinase activity (148, 149), this disorder provides a good opportunity to study the
role of RAS/ERK pathway in the pathogenesis of HCM.
The hypotheses of my project were: (1) Specific RAF1 mutations identified in NS
patients cause the common features of NS; (2) Kinase-activating RAF1 mutations cause NS with
HCM, whereas kinase-impaired RAF1 mutations are not associated with HCM; (3) Different
RAF1 mutations cause NS through distinct molecular mechanism(s), and/or by acting in different
cell types. To test my hypotheses, I generated and analyzed lines of knock-in mice with HCM-
associated kinase-activating (L613V) or non-HCM-associated kinase-impaired (D486N) Raf1
mutations, respectively. I also investigated the effects and biochemical properties of various
other NS-associated RAF1 mutants expressed at more physiological levels than in previous
transient transfection studies. Together, my project aimed to advance the field in understanding
the molecular pathogenesis of NS as well as HCM, which could provide us with potentially
important prognostic, diagnostic and even therapeutic implications for this disease. My findings
51
could also increase our understanding of other forms of cardiac disease, as well as normal
cardiac development.
52
Chapter 2
Materials and methods
53
2.1 Mice
All animal studies were approved by the University Health Network Animal Care
Committee (Toronto, ON, Canada) and performed in accordance with the standards of the
Canadian Council on Animal Care.
2.1.1 Generation of Raf1L613V knock-in mice
To construct the targeting vector for inducible Raf1L613V knock-in mice, a “short arm”,
containing Raf1 exon 12 (SacII-NotI genomic fragment) and a “long arm”, which includes exons
13-16 (BamHI-ClaI genomic fragment) were ligated into the vector pGK Neo-HSV-1 TK (432).
The L613V (exon 16) mutation, marked by a unique DraIII site, was introduced by site-directed
mutagenesis. A splice acceptor sequence, a Raf1 cDNA fragment encoding wild-type exons 13-
16 and a pGK-Neo (Neo) gene were positioned after the first loxP site as a SalI-XbaI fragment.
The targeting vector was linearized with SacII and electroporated into G4 ES cells (129S6 x
C57BL/6 F1 background). Genomic DNA, isolated from doubly G418/1-(2-deoxy-2-fluoro-β-D-
arabinofuranosyl)-5 iodouracil (FIAU)-resistant (positive and negative selection, respectively)
ES clones, was screened by PCR using primers outside and inside the targeting vector (Table
2-1), followed by NotI digestion, which marks the targeting vector. Homologous recombinants
were confirmed by Southern blotting using Neo and external (5’ and 3’) probes (Table 2-1). For
these experiments, genomic DNA was digested with XbaI (5’ and Neo probes) or BamHI (3’
probe).
To validate the desired properties of the targeted locus, correctly targeted ES cells were
transfected with a Cre-expressing plasmid (MSCV-GFP-Cre) to excise the cDNA-Neo cassette
(see below for detailed methods). Expression of Raf1L613V mRNA was confirmed by RT-PCR
(Table 2-1), followed by digestion with DraIII, which marks the L613V allele. Chimeras were
generated by outbred morula aggregation (Toronto Centre of Phenogenomics), and germ line
transmission was obtained (L613Vfl/+ mice). L613Vfl/+ mice (129Sv X C57BL/B6) were
crossed to CMV-Cre (C57BL/B6) mice, which express Cre ubiquitously, and then to WT
(129S6) mice to generate mice with global Raf1L613V expression (L613V/+, 129Sv X
C57BL/B6). Mice on a 129Sv X C57BL/B6 mixed background were used for all experiments.
54
PCR Screening
sense 5’-TCCAGCTAATTGACATTGCCCGACAGACAGCTCAG-3’
antisense 5’-GAACGGGTTGTCATCCTGCATCCGGATTACTTCTG-3’
Neo probe sense 5’-GGATTGCACGCAGGTTCTCCG-3’
antisense 5’-CGCCGCCAAGCTCTTCAGCAA-3’
5’ probe sense 5’-TGCTCTGGAGCTCAAACCCTCAGTGTAG-3’
antisense 5’-CATGGCTGAGTGGACGGTCAGGCTG-3’
3’ probe sense 5’-GAGACGGCAGATCCTCAGTAGTACTTG-3’
antisense 5’-ACGGTGGTAGTTGTGTCTTTGGCCATG-3’
RT-PCR for Raf1 mRNA
sense 5’-TCTCCATGAAGGCCTCACGGTG-3’
antisense 5’-AGACTGGTAGCCTTGGGGATGTAG-3’
Genotyping for Raf1L613V
sense 5’-ATCCCCTGATCTCAGCAGGCTCTAC-3’
antisense 5’-AGTAGTCTAGGTCCTTAGCAGCAGC-3’
Table 2-1. PCR primers for generating the Raf1L613V mice.
55
For genotyping, genomic DNA was prepared from tails, and then subjected to PCR (Table 2-1)
and digestion with DraIII.
2.1.2 Generation of Raf1D486N knock-in mice
To construct the targeting vector for our inducible Raf1D486N knock-in mice, a “short
arm”, containing Raf1 exon 12 (SacII-NotI genomic fragment), and a “long arm,” which includes
exons 13-16 (BamHI-ClaI genomic fragment), were ligated into the vector pGK Neo-HSV-1 TK
(432). The D486N (exon 13) mutation, marked by a unique ApoI site, was introduced by site-
directed mutagenesis. A splice acceptor sequence, a Raf1 cDNA fragment encoding wild-type
exons 13-16, and a pGK-Neo (Neo) gene were positioned after the first loxP site as a SalI-XbaI
fragment. The targeting vector was linearized with SacII and electroporated into G4 ES cells
(129Sv x C57BL/6 F1 background). Genomic DNA, isolated from doubly G418/FIAU-resistant
ES clones, was screened by PCR using primers outside and inside the targeting vector (Table
2-2). Homologous recombinants were confirmed by Southern blotting, using Neo and external
(5’ and 3’) probes (Table 2-2). For these experiments, genomic DNA was digested with XbaI (5’
and Neo probes) or BamHI (3’ probe).
To validate the desired properties of the targeted locus, correctly targeted ES cells were
transfected with a Cre-expressing plasmid (pMSCV-GFP-Cre) to excise the cDNA-Neo cassette
(see below for detailed methods). Expression of Raf1D486N mRNA was confirmed by RT-PCR
(Table 2-2) followed by digestion with ApoI, which marks the D486N allele. Chimeras were
generated by outbred morula aggregation (Toronto Centre of Phenogenomics), and germ line
transmission was obtained (D486Nfl/+ mice). D486Nfl/+ mice (129Sv X C57BL/6 background)
were crossed to EIIa-Cre (129Sv) mice, which express Cre ubiquitously, and then to WT
(C57BL/6) mice to generate mice with global Raf1D486N expression (D486N/+, 129Sv X
C57BL/6). Mice on a 129Sv X C57BL/6 mixed background were used for all experiments. For
genotyping, genomic DNA was prepared from tails, and then subjected to PCR (Table 2-2) and
digestion with ApoI.
56
PCR screening
for 5’loxP site
sense 5’-TCCAGCTAATTGACATTGCCCGACAGACAGCTCAG-3’
antisense 5’-GAACGGGTTGTCATCCTGCATCCGGATTACTTCTG-3’
PCR screening
and probe for
sense 5’-GGA TTG CAC GCA GGT TCT CCG-3’
antisense 5’-CGC CGC CAA GCT CTT CAG CAA-3’
5’ probe
sense 5’-TGC TCT GGA GCT CAA ACC CTC AGT GTA G -3’
antisense 5’-CAT GGC TGA GTG GAC GGT CAG GCT G-3’
3’ probe
sense 5’-GAG ACG GCA GAT CCT CAG TAG TAC TTG-3’
antisense 5’-ACG GTG GTA GTT GTG TCT TTG GCC ATG-3’
RT-PCR for
Raf1 mRNA
sense 5’-TCT CCA TGA AGG CCT CAC GGTG-3’
antisense 5’-AGA CTG GTA GCC TTG GGG ATG TAG-3’
PCR screening
& genotyping
for Raf1D486N
sense 5’-TGTGCGCATGCCATCGTTCCCTGTC -3’
antisense 5’-GCACCCTACTCTGGCCCAGTAATTC -3’
Table 2-2. PCR primers for generating the Raf1D486N mice.
57
2.2 Cell culture
2.2.1 Mouse embryonic stem (ES) cells
ES cells (G4) were cultured on γ-irradiated mouse embryonic fibloblast (MEF) feeders in
knockout Dulbecco's modified Eagle's medium (DMEM) (Invitrogen), containing 15% ES-tested
(HyClone, Thermo Scientific) fetal bovine serum (FBS), 2mM L-glutamine (Invitrogen), 0.1mM
Non-Essential Amino Acids (NEAA) (Invitrogen), 0.1mM β-mercaptoethanol (Sigma), 100
U/ml penicillin/streptomycin (Invitrogen), and 500U/ml LIF (ESGRO, Chemicon). ES cells
were transfected with MSCV-GFP-Cre plasmid using Lipofectamine 2000 reagent (Invitrogen),
according to the manufacturer’s protocol. GFP-positive cells were purified by Fluorescence
Activated Cell Sorting (FACS) at 48 hours post-transfection, and then used for RNA isolation.
For biochemical studies, ES cells were cultured under feeder-free condition, starved in
knockout DMEM containing 1% FBS for 6 hr and then stimulated with 103U/ml LIF before
harvesting.
2.2.2 Mouse embryonic fibroblasts (MEFs)
Primary MEFs were prepared from E13.5 embryos as described (433). In brief, embryos
were incubated in 0.25% trypsin/EDTA (Invitrogen) for 30 min at 37°C, and dissociated cells
were collected by centrifugation and cultured in DMEM (WISENT INC.) containing 10% FBS
and 100 units/ml penicillin/streptomycin (Invitrogen). Different independent MEF strains were
used for experiments, with similar results.
Primary MEFs were immortalized by the 3T3 protocol (434). Immortalized MEFs were
cultured in DMEM containing 10% FBS and 100units/ml penicillin/streptomycin.
For biochemical studies, MEFs were starved in serum-free DMEM for 16 hr before
stimulation with 10ng/ml EGF or 50ng/ml PDGF (both from PeproTech) before harvesting.
58
2.2.3 Neonatal cardiomyocytes and cardiac fibroblasts
Neonatal mouse ventricular myocytes (neonatal cardiomyocytes) were isolated using
methods adapted from a previous study (435). In brief, 1-day-old mouse hearts were harvested
and pre-digested with 0.15 mg/mL trypsin (Invitrogen) at 4°C for 12-16 hours, followed by
50U/ml Type II Collagenase (Worthington Biochemical) and 0.2 mg/mL trypsin in calcium- and
bicarbonate-free Hank’s buffer with HEPES (pH 7.5) (137mM NaCl, 5.36mM KCl, 0.81mM
MgSO4, 5.55 mM Dextrose, 0.44mM KH2PO4, 0.34mM NaH2PO4·H2O and 20mM HEPES) for
1-2 hr at 37°C. Non-cardiomyocytes were depleted by differential plating for 1 hour.
Cardiomyocytes were counted, seeded at 2.5 × 105 cells/ml on Falcon Primaria™ tissue-culture
plates (BD Biosciences), and cultured at 37°C in DMEM/Ham's F-12 [1:1 (v/v); Invitrogen],
10% FBS, and 100 U/ml penicillin/streptomycin (Invitrogen), supplemented with 0.1 mM
bromodeoxyuridine (Sigma-Aldrich) and 20 μM arabinosylcytosine (Sigma-Aldrich) to inhibit
rapidly proliferating cells. For biochemical studies, the medium was replaced with serum-free
DMEM/Ham’s F12 (1:1) medium supplemented with 1% insulin-transferrin-selenium
supplements-X (Invitrogen) after 24 hr. After an additional 24 hr, cardiomyocytes were
stimulated with 10ng/ml IL-6 (PreproTech), 1µg/ml Angiotensin II (Sigma-Aldrich), 100ng/ml
IGF-I (PreproTech), 50ng/ml EGF (PreproTech) or 100ng/ml NRG (heregulin β1, PeproTech)
before harvesting.
Non-cardiomyocytes from the above preparation, mainly comprising cardiac fibroblasts,
were cultured in DMEM containing 10% FBS and 100 units/ml penicillin/streptomycin. For
biochemical studies, cardiac fibroblasts were starved in serum-free DMEM for 16 hr, and then
stimulated with EGF (50 ng/ml), IGF-I (100ng/ml), PDGF (100ng/ml), or FGF2 (100ng/ml), all
from PeproTech, before harvesting.
2.2.4 Flp-In T-REx 293 cell lines
Flp-In T-REx 293 cell lines were cultured in DMEM (WISENT INC.) containing 10%
tetracycline-tested GIBCO® FBS (Invitrogen) and 100units/ml penicillin/streptomycin
(Invitrogen). To induce expression of the indicated gene, a final concentration of 1µg/ml
tetracycline (Sigma-Aldrich) was added to the cells, followed by incubation for 24 hours before
harvesting for analysis.
59
For biochemical studies, Flp-In T-REx 293 cell lines were starved in serum-free DMEM
for 16 hr before stimulation with 50ng/ml EGF before harvesting.
2.3 Generation of Flp-In T-REx 293 expression cell lines
RAF1 mutations were introduced into a Flag-tagged human RAF1 construct (a gift from
Dr. Bruce Gelb, Mt Sinai Hospital, NY, NY) by site-directed mutagenesis. Flag-tagged human
WT or mutant RAF1 coding sequences were cloned into the KpnI and XhoI restriction sites of
the vector pcDNA5/FRT/TO (Invitrogen). Flp-In T-Rex 293 host cells (Invitrogen) were co-
transfected with pOG44 (Invitrogen) and pcDNA5/FRT/TO expression plasmid DNAs, using
FuGENE HD Transfection Reagent (Promega), according to the manufacturer’s protocol.
Hygromycin-resistant colonies were picked and expanded to assay for tetracycline-regulated
expression of Flag-RAF1.
2.4 Inducible RAF1/BRAF heterodimerization
Inducible RAF1/BRAF heterodimerization was achieved by using the ARGENT
regulated heterodimerization kit (ARIAD). A Flag-tagged human RAF1R401H/D486N cDNA was
cloned into the EcoRI and XbaI restriction sites of the vector pC4EN-F1. A human BRAF cDNA
was cloned into the XbaI restriction site of the vector pC4-RHE. The resultant FKBP and FRB
fusion protein constructs were co-transfected into Flp-In T-REx 293 host cells, using FuGENE
HD Transfection Reagent (Promega), as above.
2.5 Lentivirus production and transduction
Lentiviral shRNA expression plasmids (hairpin-pLKO.1) were obtained from Dr. Jason
Moffat (University of Toronto). shRNA oligonucleotide sequences against murine Braf (5’
CCACATCATTGAGACCAAATT 3’ or 5’ CGAGGATACCTATCTCCAGAT 3’), murine Araf
(5’ CAGGCTCATCAAAGGAAGAAA 3’) and a control shRNA against Luciferase (5’
CAAATCACAGAATCGTCGTAT 3’) were used. To generate lentiviruses, 2X106 293T
packaging cells in growth medium (DMEM+10%FBS) were transfected with 3µg lentiviral
shRNA construct, 2.7 µg packaging plasmid (pCMV-dR8.91) and 0.3 µg envelope plasmid
(VSV-G) in 10cm cell culture plates, using FuGENE HD Transfection Reagent (Promega)
according to the manufacturer’s protocol. Transfection medium was changed the following
60
morning and replaced with 10ml high serum growth medium (DMEM+30%FBS) for viral
harvest. Virus-containing supernatants were collected at 48h post-transfection, and subsequently
passed through a 0.45µm filter to remove cell debris, aliquotted, and stored at -80°C.
For knock-down experiments, cells were transduced in 10cm cell culture plates with 1ml
virus in the presence of 6µg/ml polybrene for 24 hours, followed by selection with 2.5µg/ml
puromycin for 48 hours. After puromycin selection, transduced cells were re-plated for
biochemical analysis.
2.6 Retrovirus production and transduction
A Myc epitope tag was added to the N-terminus of human BRAF cDNA (The Centre for
Applied Genomics) by using PCR. The BRAFR509H mutation was introduced by site-directed
mutagenesis. RNAi-insensitive BRAFWT and BRAFR509H mutants were generated by introducing
three silent mutations into the shRNA target sequence in BRAF by site-directed mutagenesis.
Blunt-ended Myc-BRAFWT or Myc-BRAFR509H coding sequence was cloned into the blunt-ended
XhoI site of the pMSCV-IRES-EGFP vector upstream of the IRES sequence.
To generate retroviruses, 1X106 293T packaging cells in growth medium
(DMEM+10%FBS) in 6cm cell culture plates were transfected with 3µg pMSCV retroviral and 3
µg EcoPac packaging plasmid using FuGENE HD Transfection Reagent (Promega), according to
the manufacturer’s protocol. Transfection media was changed the following morning and
replaced with 5ml fresh growth medium for viral harvest. Virus-containing supernatants were
collected at 48h post-transfection, and passed through a 0.45µm filter to remove cell debris.
MEFs were transduced in 15cm cell culture plates with 5ml virus in the presence of 6µg/ml
polybrene for 24 hours, followed by fluorescence-activated cell sorting (FACS) to select for GFP
positive cells.
2.7 Biochemical analysis
Total protein extracts from cells or tissues were prepared by homogenization in RIPA
buffer (50mM Tris-HCl, pH7.5, 150mM NaCl, 2mM EDTA, 1% NP40, 0.5% Na deoxycholate,
0.1% SDS) containing a protease and phosphatase inhibitor cocktail (40 g/ml PMSF, 20mM
NaF, 1mM Na3VO4, 10mM β-glycerophosphate, 10mM sodium pyrophosphate, 2g/ml antipain,
61
2g/ml pepstatinA, 20g/ml leupeptin, and 20g/ml aprotinin). Homogenates were centrifuged
at 16,100 x g for 15 min at 4 °C, and the supernatants were collected. Lysates (10-25g protein)
were resolved by SDS-PAGE and analyzed by immunoblotting.
For immunoprecipitations, total cell extracts were prepared in NP40 buffer (20mM Tris-
HCl, pH8.0, 137mM NaCl, 2mM EDTA, 1% NP40 and 10% glycerol) containing the protease
and phosphatase inhibitor cocktail described above. Homogenates were centrifuged at 16,100 x g
for 15 min at 4 °C, and the supernatants were collected. Lysates were incubated with anti-Raf1
antibody (BD Biosciences) and Protein-G Sepharose 4 Fast Flow (GE Healthcare), or anti-FLAG
M2 affinity agarose gel (Sigma-Aldrich) for 3 hours at 4 °C with rotation. Beads were washed
four times with NP40 buffer, and immunoprecipitates were analyzed by immunoblotting.
Antibodies for immunoblots included: Raf1 (BD Biosciences), SH-PTP2 (C-18) and
ERK2 (D2) (Santa Cruz Biotechnology Inc.), and phospho-MEK1/2, MEK1/2, phospho-p44/42
MAPK, phospho-S6 (Ser235/236), p38, phospho-p38, phospho-JNK1/2, Akt1, phospho-Akt
(Ser473), phospho-GSK3β (Ser9), phospho-P70S6K (Cell Signaling Technology). Primary
antibody binding was visualized by IRDye infrared secondary antibodies using the Odyssey
Infrared Imaging System (LI-COR Biosciences). Quantification of immunoblots was performed
by using Odyssey V3.0 software.
2.8 Body size analysis and morphometry
For growth curves, body length [anal-nasal (AN) length] and weight were measured
weekly. For skeletal morphometry, mice were anesthetized with 2% isoflurane and scanned by
using a Locus Ultra microCT scanner (GE Healthcare). Three-dimensional images of the
skeleton were generated and analyzed with GEHC MicroView software (GE Healthcare). Skull
measurements were made according to the Standard Protocol and Procedures from the Jackson
Laboratory (http://craniofacial.jax.org/standard_protocols.html).
2.9 Histology and immunohistochemistry
Hearts for morphometry and histochemistry were fixed in the relaxed state by infusion of
1% KCl in PBS, followed by 10% buffered formalin. Hearts were then incubated in 10%
buffered formalin overnight and embedded in paraffin. Sections (5µm) were prepared and
62
stained with H&E, Picro sirius red (PSR) or Masson-Trichrome. Cell membranes were stained
with TRITC-conjugated wheat germ agglutinin (WGA) (Sigma-Aldrich), according to the
manufacturer’s protocol. Nuclei were stained with DAPI. Cross-sectional area of cardiomyocytes
with centrally located nuclei (to ensure the same plane of sectioning) was measured by using
ImageJ. Five individual samples were analyzed for each genotype, with 200 cells measured in
each.
2.10 BrdU incorporation assays
For proliferation assays, pregnant mice (E16.5) were injected intraperitoneally (IP) with
BrdU (100 μg/g body weight) 1 h before sacrifice. Embryos were fixed in 10% buffered formalin
overnight and embedded in paraffin. BrdU incorporation was detected by using rat anti-BrdU
primary antibody (1:50; Abcam). Immune complexes were visualized using F(ab)2 biotin-
conjugated donkey anti-rat IgG (1:500; Research Diagnostics Inc.) and the VECTASTAIN Elite
ABC Kit (Vector Laboratories). Sections were counterstained with hematoxylin. For each
sample, BrdU+ cells were counted in 10 randomly selected fields.
2.11 Hematopoietic analysis
Myeloid colony assays (in the absence of added cytokines) were performed as described
previously (436). In brief, bone marrow (BM) cells were suspended in MethoCult® M3234
without cytokines (Stem Cell Technologies) at 105 cells/ml, and colonies were scored after 7-9
days. Complete blood counts were determined by using a Hemavet 850FS (Drew Scientific).
2.12 Echocardiographic and hemodynamic measurements
For echocardiography and cardiac catheterization, mice were anesthetized with
isoflurane/oxygen (2%/100%), and body temperature was maintained at ~37.5°C. Transthoracic
2D and M-mode echocardiography was performed from the long axis view of the heart at the
level of the papillary muscle with a Visualsonics Vevo 770 imaging system (Visualsonics)
equipped with a 30-MHz linear transducer (RMV707B). Measurements of the left ventricular
(LV) end-systolic diameter (LVIDs) and end-diastolic diameter (LVIDd) internal dimensions and
of the LV diastolic posterior wall thickness (LVPWd) were made under Time Motion-mode. The
papillary muscles were excluded from all measurements. Measurements were averaged from at
63
least 3 separate cardiac cycles. From TM-mode measurements, end-diastolic volume (EDV) was
calculated as (4.5 x normalized LVIDd 2), end-systolic volume (ESV) was calculated as (3.72 x
normalized LVIDs 2), and stroke volume (SV) was calculated as EDV-ESV. Cardiac output (CO)
was calculated as SV X Heart rate. Fractional shortening (FS) was calculated as (LVIDd –
LVIDs)/ LVIDd x 100%, and ejection fraction (EF) was calculated as (EDV – ESV)/EDV x
100%.
For invasive hemodynamic assessments, a 1.2F catheter (model # FTS-1211B-0018,
Scisense Inc.) was inserted via the right carotid artery into the left ventricle. Hemodynamic
signals were digitized at a sampling rate of 1kHz and acquired to a computer using the MP100
imaging system and Acqknowledge software (BIOPAC Systems, Inc). Following recording of
left ventricular pressure, the catheter was relocated to the ascending aortic for measurement of
aortic blood pressure. Mean arterial pressure (MAP) was calculated as (Systolic pressure +
Diastolic pressure x 2)/3.
2.13 Transverse aortic constriction (TAC)
Eight to nine week-old male mice (25-30g body weight) were anesthetized with 2%
isoflurane, intubated, connected to a ventilator (Harvard Apparatus) and ventilated at a tidal
volume of ~230ul and 135 breaths/min. A para-sternal thoracotomy was performed to expose the
transverse aorta, which was then constricted with a 7/0 silk suture tied around a 27G needle.
Pressure overload was maintained for various times as indicated in Results and Figure Legends.
2.14 MEK inhibitor and Rapamycin treatment
N-[(R)-2,3-dihydroxy-propoxy]-3,4-difluoro-2-(2-fluoro-4-iodo-phenylamino)-
benzamide (PD0325901) was synthesized according to the disclosure in document
WO2007042885(A2). All chemicals necessary for the synthesis were purchased from Sigma
Aldrich.
PD0325901 was dissolved in DMSO at a concentration of 50mg/ml, then resuspended in
vehicle (0.5% hydroxypropylmethylcellulose with 0.2% Tween 80) at a concentration of
0.5mg/ml, and injected intraperitoneally (5mg/kg body weight) daily for the indicated times.
64
Control mice were injected with vehicle. The same protocol was used to inject lactating females
for early post-natal treatment.
Rapamycin (LC Laboratories) was dissolved in DMSO at a concentration of 20mg/ml,
then resuspended in vehicle (0.5% hydroxypropylmethylcellulose with 0.2% Tween 80) at a
concentration of 0.2mg/ml, and injected intraperitoneally (2mg/kg body weight) daily for the
indicated times. Control mice were injected with vehicle.
2.15 Quantitative real time RT-PCR
Total RNA from the left ventricle was prepared using the RNeasy mini-kit (QIAGEN).
RNA (2 µg) was reverse transcribed using SuperScriptIII (Invitrogen). TaqMan probe-based
gene expression analyses (Applied Biosystems) for Myh7 (Mm00600555_m1), Myh6
(Mm00440359_m1), Nppa (Mm01255748_g1) and Nppb (Mm00435304_g1) were conducted
according to the manufacturer’s instructions. Each sample was measured in triplicate, and their
relative expression was normalized to Gapdh (4352932E).
2.16 Statistics
All data are presented as mean±SEM. Statistical significance was determined using
Student’s t-test, one-way ANOVA or two-way repeated measure ANOVA, as appropriate. If
ANOVA was significant, individual differences were evaluated using Bonferroni post-test.
Deviation of progeny from Mendelian frequency was assessed by χ2 test. Kaplan–Meier survival
curves were analyzed using the Log-rank test. For experiments in Figure 3-19, significant
outliers were identified using Grubbs’s test. All statistical analyses were performed with
GraphPad Prism 5. For all studies, p<0.05 was considered significant.
65
Chapter 3
MEK-ERK Pathway Modulation Ameliorates Disease Phenotypes in
a Mouse Model of Noonan Syndrome Associated with the Raf1L613V
Mutation
This Chapter is a modified version of a paper published in the Journal of Clinical Investigation
(2011 Mar;121(3):1009-25).
66
3.1 Abstract
Hypertrophic cardiomyopathy (HCM) is a leading cause of sudden death in children and
young adults. Abnormalities in several signaling pathways are implicated in the pathogenesis of
HCM, but the role of the RAS-RAF-MEK-ERK MAPK pathway has been controversial. Noonan
syndrome (NS) is one of several autosomal-dominant conditions known as “RASopathies”,
which are caused by mutations in different components of this pathway. Germ-line mutations in
RAF1 (which encodes the serine-threonine kinase RAF1) account for approximately 3–5% of
cases of NS. Unlike other NS alleles, RAF1 mutations that confer increased kinase activity are
highly associated with HCM. To explore the pathogenesis of such mutations, we generated
“knock-in” mice expressing the NS-associated Raf1L613V mutation. Like NS patients, mice
heterozygous for this mutation (referred to herein as L613V/+ mice) had short stature,
craniofacial dysmorphia, and hematologic abnormalities. Valvuloseptal development was
normal, but L613V/+ mice exhibited eccentric cardiac hypertrophy and aberrant cardiac fetal
gene expression, and decompensated following pressure overload. Agonist-evoked MEK/ERK
activation was enhanced in multiple cell types, and post-natal MEK inhibition normalized the
growth, facial, and cardiac defects in L613V/+ mice. These data show that different NS genes
have intrinsically distinct pathological effects, demonstrate that enhanced MEK-ERK activity is
critical for causing HCM and other RAF1-mutant NS phenotypes, and suggest a mutation-
specific approach to the treatment of RASopathies.
3.2 Background
Cardiac hypertrophy is a major way by which cardiomyocytes respond to various
stresses, including abnormal neuro-hormonal stimuli, hemodynamic overload and injury. There
are two general types of cardiac hypertrophy (349, 350): physiological, which is associated with
exercise or pregnancy, and pathological, caused by genetic defects (primary), or excessive
afterload, resulting from conditions such as hypertension or valvular stenosis (secondary). With
increased cardiac stress, cardiac hypertrophy may initially represent a compensatory response of
the myocardium. However, chronic pathological hypertrophy predisposes to ventricular
dilatation, heart failure, arrhythmia and/or sudden death (356, 357). Physiological hypertrophy is
typically concentric, with preservation of chamber shape, the absence of inflammation or fibrosis
and normal cardiac gene expression. By contrast, pathological hypertrophy eventually progresses
67
to chamber dilatation (eccentric hypertrophy), is often associated with fibrosis, and typically
leads to the reactivation of a fetal gene expression program, characterized by increased levels of
(among others) atrial natriuretic peptide (ANP), brain natriuretic peptide (BNP) and beta-myosin
heavy chain (β-MHC) (437). Delineating the molecular pathways that distinguish physiological
and pathological hypertrophy, and identifying ways to reverse the latter, are of obvious medical
importance.
Primary hypertrophic cardiomyopathy (HCM), the prototypic genetic form of pathologic
hypertrophy, is a leading cause of sudden death in the young (431). The hallmark of HCM is
cardiac hypertrophy in the absence of an obvious inciting hypertrophic stimulus (372). Mutations
in genes encoding sarcomeric proteins (e,g., β-MHC, cardiac troponin T, and myosin-binding
protein C) account for most (~75%) cases of primary HCM. Such mutations usually alter
sarcomere structure and function and result in mechanical, biochemical and/or bioenergetic
stresses that activate cardiomyocyte signaling pathways to mediate the hypertrophic phenotype
(375-378). Aberrant activation of hypertrophic signaling pathways can themselves result in
hypertrophy. For example, germ line mutations in adenosine monophosphate-activated protein
kinase (AMPK) are a rare cause of HCM (380-382). Moreover, genetic and cellular models have
identified multiple signaling systems that can cause or contribute to pathological hypertrophy,
including the calcineurin/NFAT, PI3K/Akt/mTOR, GSK3β and JNK pathways (349, 350, 386).
The detailed mechanism by which aberrant activation of these pathways evokes pathological
hypertrophy remains incompletely understood.
The RAS-RAF-MEK-ERK MAPK pathway (hereafter, the RAS/ERK pathway) is a
central signaling cascade evoked by multiple agonists, including growth factors (e.g., Heregulin,
IGF-1, EGF, PDGF), cytokines (e.g., IL6, cardiotrophin, LIF), G-protein coupled receptor
agonists (angiotensin-II, beta-adrenergic agonists), and physical stimuli (e.g., mechanical
stretch), in cardiomyocytes as well as other cell types (26, 349, 350). The pathway is initiated by
the activation of RAS, which requires RAS-guanine nucleotide exchange factors (RAS-GEFs)
such as SOS1 and, in most cell types, the protein-tyrosine phosphatase SHP2 (encoded by
PTPN11 gene). RAS recruits RAF proteins (RAF1, BRAF, ARAF) to the cell membrane, where
they are activated and subsequently form complexes with MEK1/2 and ERK1/2, aided by
scaffolds, such as KSR. Activated RAF proteins phosphorylate MEK1,2 which, in turn,
phosphorylate ERK1,2. ERKs phosphorylate cytosolic substrates and also translocate to the
68
nucleus to stimulate diverse gene expression programs by phosphorylating several transcription
factors (26, 28).
The role of the RAS/ERK pathway in cardiac hypertrophy has been controversial. Some
data argue that excessive activity of this pathway causes HCM, whereas other evidence suggests
involvement in physiological, but not pathological, hypertrophy (409, 410). Transgenic mice
with cardiac-specific expression of oncogenic HRas (G12V) display significant cardiac
hypertrophy, decreased contractility, diastolic dysfunction associated with interstitial fibrosis,
induction of cardiac fetal genes and sudden death (411-413), all of which are consistent with
HCM. In cultured cardiomyocytes, depletion of Erk1/2 with antisense oligonucleotides or
pharmacological inhibition of Mek1/2 attenuates the hypertrophic response to agonist stimulation
(414, 415). Mice with cardiac-specific over-expression of “dominant-negative” Raf1 have no
overt phenotype, but they are resistant to the development of cardiac hypertrophy in response to
pressure overload (416), suggesting that signals from Raf1 are necessary for the hypertrophic
response. On the other hand, transgenic mice expressing an activated Mek1 allele under the
control of the alpha-MHC promoter have concentric hypertrophy with enhanced contractile
performance, show no signs of decompensation over time and reportedly do not progress to
pathological hypertrophy (418). A recent study even argued against any role for ERK1/2 in
cardiac hypertrophy, as Erk1-/-Erk2+/- mice, as well as transgenic mice with cardiac-specific
expression of dual specificity phosphatase 6 (Dusp6), an ERK1/2-specific phosphatase, showed a
normal hypertrophic response to pressure overload and exercise (420).
Over the past ten years, germ line mutations in genes encoding several members of the
RAS/ERK pathway have been identified in a set of related, yet distinct, human developmental
syndromes (31, 32, 144, 438, 439), now collectively termed the RASopathies (32, 439). These
disorders, some (but not all) of which include HCM as a syndromic phenotype, present an
opportunity to clarify the role of the RAS/ERK pathway in cardiac hypertrophy. Noonan
syndrome (NS), a relatively common autosomal dominant disorder (~1/1,000–2500 live births),
typically presents with proportional short stature, facial dysmorphia, and cardiovascular
abnormalities. Many (25-50%) NS patients exhibit some form of myeloproliferative disorder
(MPD), which is usually transient and resolves spontaneously; rarely, NS patients develop the
severe childhood MPD, juvenile myelomonocytic leukemia (JMML) or other forms of leukemia
(440). Mutations in PTPN11 that increase SHP2 phosphatase activity account for ~50% of NS
69
cases (145); other known NS genes include SOS1 (~10%) (146, 147), RAF1 (3-5%) (148, 149),
KRAS (1-2%) (150, 151), NRAS (<1%) (152) and SHOC2 (<1%) (183).
Although NS patients typically have valvuloseptal defects, ~20% have HCM (441).
Moreover, different NS genes are differentially associated with HCM. Only ~10% of NS patients
with PTPN11 mutations (442) and ~20% of those with mutations in SOS1 (146) develop HCM.
By contrast, HCM is found in nearly all (~95%) patients bearing RAF1 mutations that cause
increased kinase activity (148, 149). The frequency of HCM also varies in other RASopathies.
HCM is the most frequent (~80%) cardiovascular manifestation of LEOPARD syndrome (LS),
caused by phosphatase-inactivating mutations of PTPN11 (158, 179, 180, 384), but also is
common (~50% in each) in Costello Syndrome (CS), caused by gain-of-function mutations in
HRAS (202, 383), and Cardio-facio-cutaneous (CFC) syndrome, caused by BRAF, MEK1 or
MEK2 mutations (171, 172, 385). Whether these differences represent differential effects of
specific RAS/ERK pathway mutations, the effects of modifiers in the outbred human population,
or both, remains unclear.
Mouse models have begun to address such issues and to provide insight into the detailed
pathogenesis and potential therapeutic approaches to these disorders. For example, we previously
generated a knock-in mouse model of the NS-associated Ptpn11D61G mutation, which
recapitulates the major features of NS, including short stature, facial dysmorphia, mild MPD and
valvuloseptal defects. These mice, like most PTPN11 mutant NS patients, do not have HCM
(204). Transgenic mice expressing a different NS-associated Ptpn11 mutant (Q79R) also show
valvulospetal defects and facial abnormalities seen in NS patients, which are prevented by the
genetic ablation of Erk1/2 and or pre-natal pharmacological inhibition of Mek, respectively (207-
209). Genetic ablation of Erk1 also prevents the development of valvuloseptal defects in mice
expressing a highly activated Ptpn11 mutant in endocardial cells (210). A knock-in mouse model
of CS, caused by HRasG12V mutation shows HCM, but these mice also have aortic stenosis,
making it unclear whether hypertrophy is primary or secondary (443).
Here, we have generated “knock-in” mice expressing the kinase-activating NS mutant
Raf1L613V (L613V). We find that, whereas similar to Ptpn11 mutant mice, mice expressing this
Raf1 allele have short stature, facial dysmorphia, and hematological abnormalities, they do not
have valvuloseptal abnormalities but instead develop HCM. Remarkably, nearly all phenotypic
70
abnormalities in Raf1 mutant mice are reversed by post-natal MEK inhibitor treatment. Our
results show that different NS genes have intrinsically distinct pathological effects, and
demonstrate that enhanced MEK/ERK activity is critical for causing HCM and other RAF1-
mutant NS phenotypes. Along with the companion study on LS-associated HCM by Marin et al.
(444), these findings suggest a mutation-specific approach to the treatment of RASopathies.
3.3 Results
3.3.1 Generation of L613V/+ mice
Expression of an activated Raf1 mutant during development might cause embryonic
lethality. Therefore, to investigate the effects of the NS-associated, kinase-activating RAF1L613V
mutant, we designed an “inducible knock-in” Raf1L613V allele (L613Vfl) (Figure 3-1A). The
targeting vector included a cassette containing a splice acceptor sequence, a Raf1 cDNA
fragment encoding wild type (WT) exons 13-16 and a pGK-Neo (Neo) gene. The fusion
cDNA/Neo cassette was flanked by loxP sites and was positioned upstream of exons 13-16 of the
Raf1 gene itself, with an L613V mutation introduced into exon 16 and an HSV-TK cassette for
negative selection. In the absence of Cre recombinase (445), Raf1 exon 12 should be spliced to
the cDNA (exon 13-16), leading to the production of WT Raf1. When Cre is present, the floxed
cassette should be excised, evoking transcription of the mutant Raf1 allele.
The targeting construct was electroporated into G4 embryonic stem (ES) cells, and
correctly targeted clones (L613Vfl/+) were identified by PCR and confirmed by Southern
blotting (Figure 3-1B). We also validated the desired properties of the targeted locus in
L613Vfl/+ ES cells (Figure 3-1C). As expected, expression of the mutant allele was undetectable
(by RT- PCR) in the absence of Cre, but it was induced effectively upon introduction of a Cre-
expression vector (MSCV-GFP-Cre). Mutant Raf1 (protein) also was expressed at levels
comparable to WT Raf1. Chimeras were then generated by outbred morula aggregation, and
germ line transmission was obtained. L613Vfl/+ progeny were crossed to CMV-Cre mice, which
express Cre ubiquitously, and then to WT mice, thereby generating mice with global Raf1L613V
expression (L613V/+ mice) on a 129S6 x C57BL/6 mixed background.
L613V/+ mice were obtained at the expected Mendelian ratio at weaning, indicating that
on this mixed background, Raf1L613V expression during development is compatible with
71
Figure 3-1.Generation of inducible Raf1L613V knock-in mice.
(A) Targeting strategy. Structures of the Raf1 locus, targeting vector, mutant allele and location
of probes for Southern blotting are shown. (B) Correct targeting of ES cells. Genomic DNA
from WT ES cells and PCR-positive L613Vfl/+ ES clones was digested with XbaI (5’ and Neo
probe) or BamHI (3’ probe) and subjected to Southern blotting with 5’, 3’ or Neo probes,
respectively. Blots with 5’ and 3’ probes represent non-adjacent lanes on the same gel. (C)
Expression of Raf1L613V allele is inducible. RNA was isolated from WT and L613Vfl/+ ES cells
with or without prior transfection of MSCV-Cre-GFP plasmid and reverse transcribed into
cDNA. A PCR product, obtained by using primers within exon 11 and at the end of exon 16 of
the Raf1 cDNA, was digested with DraIII. Note that the mutant allele is silent until Cre is
introduced, and then is expressed efficiently.
72
embryonic viability. However, similar to mice expressing NS-associated Ptpn11 mutant alleles
(204), L613V/+ mice could not be obtained after (>three generations) backcrossing to C57BL/6
mice. Consequently, all experiments herein were performed on the 129S6 x C57BL/6 mixed
background.
3.3.2 L613V/+ mice show multiple NS phenotypes
L613V/+ newborns showed normal size at birth (Figure 3-2A). At weaning, though,
L613V/+ mice were significantly smaller than their WT littermates, and they remained shorter
throughout their lives (Figure 3-2B and Figure 3-2C). Although their overall body proportions
were normal, L613V/+ mice exhibited facial dysmorphia (Figure 3-3). Consistent with their
decreased body size, the skulls of L613V/+ mice were significantly shorter than WT. Their skull
width was increased, however, resulting in a significantly greater width/length ratio. As a result,
L613V/+ mice had a ‘triangular’ facial appearance with a blunter snout and widely-set eyes
(increased inner canthal distance). These features are reminiscent of the facial phenotype of mice
expressing NS-associated Ptpn11 mutations (204, 209, 210) and represent the mouse equivalent
of the facial abnormalities seen in NS patients (446).
Like mouse models of Ptpn11 mutation-associated NS (204, 210) and many NS patients
(447), L613V/+ mice had hematological defects. There was abnormal expansion of myeloid
progenitors, and bone marrow (BM) from L613V/+ mice yielded factor-independent myeloid
colonies (Figure 3-4A). L613V/+ mice also developed splenomegaly, which became more severe
as they aged (Figure 3-4B). Peripheral blood counts were normal at 4 months, but by 1 year,
L613V/+ mice had developed subtle but statistically significant leukocytosis, neutrophilia and
monocytosis (Figure 3-4C) with normal hematocrit and platelet counts.
3.3.3 L613V/+ mice show cardiac hypertrophy with chamber dilatation
Unlike PTPN11 alleles, which are negatively associated with hypertrophic
cardiomyopathy (HCM) in NS patients (442) and in mouse models (204, 208, 210), RAF1
mutations that encode proteins with increased kinase activity are strongly associated with HCM
(148, 149). Remarkably, L613V/+ mice showed evidence of cardiac hypertrophy as early as 2
weeks after birth, as indicated by an increased heart weight to body weight ratio (Figure 3-5A)
73
Figure 3-2. Short stature in L613V/+ mice.
(A) Body weight of neonatal WT (n=30) and L613V/+ (n=35) mice. ns, not significant. (B)
Gross appearance of 2-month-old WT and L613V/+ male mice. (C) Growth curves of WT
(n=45) and L613V/+ (n=45) male and female mice. Differences were significant at all time
points (p<0.0001, two-way repeated measure ANOVA; *** p<0.0001, Bonferroni post-test).
74
C
Morphometry of skulls
Genotype WT (n=13) L613V/+ (n=11)
Length (mm) 22.9±0.1 21.4±0.3***
Width (mm) 10.4±0.1 10.9±0.1***
Width/Length 0.46±0.01 0.51±0.01***
Inner canthal distance (mm) 6.1±0.1 6.5±0.1***
Figure 3-3. L613V/+ mice have facial dysmorphia.
(A) Gross facial appearance of WT and L613V/+ mice. (B) Representative microCT scans of
skulls from WT and L613V/+ mice. Double-headed arrows indicate inner canthal distance. (C)
Morphometric measurements from microCT scans of a cohort of 2-month-old WT and L613V/+
male mice. *** p<0.0001, 2-tailed Student’s t-test.
75
Figure 3-4. L613V/+ mice have hematological defects.
(A) Cytokine-independent myeloid colonies from bone marrow of 2 month-old mice (n=6 for
each genotype). *** p<0.0001, 2-tailed Student’s t-test. (B) Splenomegaly in L613V/+ mice.
Representative gross appearance (left) and spleen weight/body weight (mg/g) ratio (448) in WT
(n=25) and L613V/+ (n=25) mice at 4 months. *** p<0.0001, 2-tailed Student’s t-test. (C)
Increased total white blood cells (WBC), neutrophils (NE) and monocytes (MO) in 1 year-old
L613V/+ mice (n=8 for each genotype). * p<0.05; *** p<0.0001, 2-tailed Student’s t-test.
76
Cardiac enlargement became even more obvious in adult L613V/+ mice, with histological
analysis revealing substantial thickening of the ventricular wall and septum (Figure 3-5B).
Increased heart size can reflect a larger number of cardiomyocytes (e.g., as a consequence of
excess proliferation during development) and/or cardiomyocyte hypertrophy. Cardiomyocyte
proliferation, as measured by BrdU incorporation assays, was comparable in E16.5 L613V/+ and
WT embryos (Figure 3-5C). By contrast, cross-sectional area was markedly (~35%) increased in
cardiomyocytes from 8-week-old L613V/+, compared with WT, mice (Figure 3-5D), indicative
of cardiac hypertrophy.
Cardiac hypertrophy can be secondary to pressure overload caused by stenotic valves or
hypertension. Notably, mice expressing the NS-associated Ptpn11D61G mutation have severe
valvuloseptal abnormalities, including atrial, atrioventricular or ventricular septal defects and
double-outlet right ventricle (204). By contrast, valvuloseptal development, as assessed by
histology, appeared normal in 1 week-old L613V/+ mice (Figure 3-5E). Invasive hemodynamic
studies established that ventricular pressure was actually lower in L613V/+ mice compared with
WT controls (see below).
To assess cardiac morphology and function, we performed echocardiography on
L613V/+ mice and littermate controls at 2 and 4 months of age. As expected, left ventricular
diastolic posterior wall thickness (LVPWd) was increased in L613V/+ mice (Figure 3-6A and
Figure 3-6B). Although chamber size was normal in 2 month-old mice, by 4 months, L613V/+
hearts showed an increase in left ventricular internal end-diastolic dimension (LVIDd). Left
ventricular end-systolic dimension (LVIDs) remained within normal limits (Figure 3-6A and
Figure 3-6C), indicating preserved or enhanced function. Consistent with the latter interpretation,
stroke volume (SV), ejection fraction (EF), fractional shortening (FS), and cardiac output (CO)
were increased in L613V/+ mice (Table 3-1).
Invasive hemodynamic studies confirmed and extended these conclusions (Figure 3-6D
and Table 3-2). L613V/+ mice showed increased dP/dt Max, consistent with enhanced
contractility, but no change in cardiac relaxation (-dP/dt). Afterload (systolic pressure) was
slightly lower in L613V/+ mice. Although this finding rules out hypertension as a cause of
hypertrophy in L613V/+ mice, it complicates comparison of dP/dt Max values. For this reason,
77
78
Figure 3-5. L613V/+ mice show cardiac hypertrophy with normal cardiomyocyte
proliferation and valve development.
(A) L613V/+ mice show cardiac hypertrophy, as indicated by heart weight/body weight ratio
(mg/g) as early as 2 weeks after birth (n=14 for each genotype). (B) Representative gross
appearance (left top) and H&E-stained cross-sections (left bottom; original magnification, 4X;
black bar, 2mm) of WT (n=25) and L613V/+ (n=25) hearts (8 weeks); heart weight/body weight
(mg/g) ratio of 4 month-old WT and L613V/+ mice is shown at right. (C) No difference in BrdU
incorporation in E16.5 WT (n=4) and L613V/+ (n=3) hearts. (D) Cross-sectional area of
cardiomyocytes (original magnification, 400X; white bar, 100µm), measured in WGA-strained
sections from 8 week-old mice (n=5 samples for each genotype, with 200 cells counted for each
sample using ImageJ). (E) Representative H&E-stained cross-sections of aortic valves in 1 week-
old mice (original magnification, 40X; two individual samples are shown for each genotype). No
obvious abnormalities were noted in other cardiac valves either. *** p<0.0001, 2-tailed Student’s
t-test.
79
Figure 3-6. L613V/+ mice show cardiac hypertrophy with chamber dilatation.
(A) Representative echocardiograms of hearts from 4 month-old mice. Arrows indicate left
ventricular diastolic dimension. (B) Left ventricular diastolic posterior wall thickness (LVPWd)
at 2 and 4 months, measured by echocardiography (n=13 for WT; n=11 for L613V/+). (C) Left
ventricular chamber dimensions of 2 and 4 month-old WT (n=13) and L613V/+ hearts (n=11).
LVIDd, left ventricular internal end-diastolic dimension; LVIDs, left ventricular internal end-
systolic dimension. (D) Cardiac contractility of 4-month-old WT (n=13) and L613V/+ hearts
(n=11) hearts, as measured by invasive hemodynamic analysis. * p<0.05; ** p<0.005, 2-tailed
Student’s t-test.
80
2 month 4 month
WT (n=13) L613V/+ (n=11) WT (n=12) L613V/+ (n=11)
Heart rate (bpm) 456±19 454±17 485±12 485±22
SV (µl) 38±1 49±3** 40±1 57±3***
EF% 56±1 63±2* 54±2 63±2**
FS% 29±1 34±2** 28±1 34±1***
CO (ml/min) 18±1 22±2* 19±1 28±2***
Table 3-1. Echocardiographic parameters in WT and L613V/+ mice.
Shown are data from 2 and 4 month-old mice. SV, stroke volume; EF, ejection fraction; FS,
fractional shortening; CO, cardiac output. * p<0.05; ** p<0.005; *** p<0.0001, 2-tailed
Student’s t-test.
81
we also compared dP/dt estimated at left ventricular pressure (LVP) of 40mm Hg
(dP/dt@LVP40), therefore reducing or eliminating the influence of afterload (449). Importantly,
dP/dt@LVP40 was increased in L613V/+ animals, providing conclusive evidence of increased
contractility (Figure 3-6D). Moreover, there was no pressure gradient across the aortic valves of
L613V/+ mice (Table 3-2), ruling out aortic valve stenosis as a cause of their cardiac
hypertrophy. Taken together, our finding of eccentric cardiac hypertrophy in the absence of
pressure overload is consistent with the conclusion that L613V/+ mice have pathological
hypertrophy.
Mice (and humans) with pathological hypertrophy often reactivate specific fetal genes
(431, 437). There are two isoforms of cardiac myosin: alpha-myosin heavy chain (alpha-MHC,
faster kinetics) and beta-myosin heavy chain (beta-MHC, slower kinetics). In rodents, the Myh7
(beta-Mhc) gene is expressed mainly in late fetal life, whereas Myh6 (alpha-Mhc) is expressed
predominantly in the adult. Re-expression of Myh7 and a shift from alpha-Mhc to beta-Mhc is a
marker for phenotypic reprogramming and HCM (437). Indeed, Myh6 mRNA levels were
decreased significantly in L613V/+ hearts, and there was a trend (p=0.09, 1-tailed Student’s t-
test) towards increased Myh7 expression (Figure 3-7A). Consequently, the Myh7/Myh6 ratio
increased significantly. Expression of Nppa (atrial natriuretic peptide, Anp) and Nppb (brain
natriuretic peptide, Bnp), two other fetal genes often associated with cardiac hypertrophy (437,
450), was unaffected in L613V/+ hearts (Figure 3-7B).
3.3.4 Enhanced hypertrophic response and functional decompensation in
L613V/+ hearts following pressure overload
Although L613V/+ mice show cardiac hypertrophy, they displayed enhanced cardiac
function without signs of heart failure for at least a year of life. To gain further insight into the
nature of the hypertrophy in L613V/+ mice, we assessed their response (compared with controls)
to biomechanical stress by transverse aortic constriction (TAC). L613V/+ mice had an unusually
high acute death rate after this procedure (Figure 3-8A). Furthermore, the hearts of surviving
L613V/+ mice showed dramatic ventricular, as well as left atrial, enlargement compared with
WT mice (Figure 3-8B). Although WT mice had an ~45% increase in heart weight to body
weight ratio following TAC, L613V/+ mice had an ~ 72% increase. L613V/+ mice also
82
WT (n=12) L613V/+ (n=12)
Heart rate (bpm) 516±17 521±17
LVP (mmHg) 121±3 113±2*
EDP (mmHg) 4.1±0.7 3.9±0.5
Systolic P (mmHg) 117±3 109±2
Diastolic P (mmHg) 83±3 77±2
-dP/dt (mmHg/s) -11,010±332 -11,190±327
-dP/dt/MAP (1/s) -118±4 -127±3
Table 3-2. Additional hemodynamic parameters of hearts from 4 month-old mice.
Cardiac catherizations were performed and analyzed as described in Methods. LVP, left
ventricular systolic pressure; EDP, end diastolic pressure; MAP, mean arterial pressure. *
p<0.05, 2-tailed Student’s t-test.
83
Figure 3-7. L613V/+ mice show a shift from alpha-Mhc to beta-Mhc expression in hearts.
Alpha- and beta-Mhc gene expression (A) and Anp and Bnp gene expression (B) in 4-month-old
WT (n=6) and L613V/+ (n=9) hearts, assessed by quantitative real-time PCR. * p<0.05; **
p<0.005, 2-tailed Student’s t-test. WT heart sample after 8-week transverse aortic constriction
(TAC) (WT-TAC) (n=1) was served as positive control.
84
Figure 3-8. Abnormal response of L613V/+ mice to pressure overload.
(A) Survival curves of WT (n=25) and L613V/+ (n=24) mice following transverse aortic
constriction (TAC). ** p<0.005, Log-rank test. (B) Gross appearance of hearts (left) and heart
weight/body weight (mg/g) ratio (right) at 8 weeks post-TAC. Black dashed lines show markedly
enlarged left atrium in L613V/+, compared with WT, mice. ** p<0.005; *** p<0.0001
(Bonferroni post-test when ANOVA is significant); ## p<0.005 (1-tailed Student’s t-test). (C)
Severe interstitial fibrosis in L613V/+ hearts (Pico Sirius Red-PSR staining; original
magnification, 100X) at 8 weeks post-TAC. Percentage of pixels staining positive with PSR for
interstitial fibrosis was quantified by using ImageJ (n=14 for WT; n=13 for L613V/+). ***
p<0.0001, 2-tailed Student’s t-test. (D) Perivascular fibrosis in hearts (PSR staining; original
magnification, 200X) at 8 weeks post-TAC. Similar results were obtained when Masson’s
Trichrome stain was used to assess fibrosis.
85
developed more severe interstitial fibrosis (Figure 3-8C) and perivascular fibrosis (Figure 3-8D
and Figure 3-9A) post-TAC. Two L613V/+ mice were excluded from analysis as by 8 weeks of
TAC these mice had sustained a large (~30% of free ventricular wall) spontaneous transmural
infarct; extensive fibrosis with impaired systolic and diastolic function was evident (Figure
3-9B).
These morphologic and histological findings established that L613V/+ mice have an
altered response to pressure overload. Consistent with this, TAC provoked increases in left
ventricular diastolic posterior wall thickness (LVPWd) in WT and L613V/+ mice, which was
more pronounced in the L613V/+ mice (Figure 3-10A). Left ventricular internal end-diastolic
dimension (LVIDd) did not change after TAC in WT or L613V/+ mice, but remained elevated in
the latter (Figure 3-10B). Most importantly, several parameters of cardiac function, including SV
and FS, deteriorated in L613V/+ mice, whereas these were unaffected in WT mice (Figure 3-
10C). There also was a trend towards decreased cardiac output in L613V/+ mice subjected to
TAC, although this did not reach statistical significance because these mice increased their heart
rate sufficiently to compensate for decreased ventricular function (Figure 3-10D). In addition,
cardiac contractility (measured as either dP/dt Max or dP/dt@LVP40) decreased in L613V/+, but
not in WT mice (Figure 3-11A). Cardiac relaxation assessed by –dP/dt, normalized to mean
arterial pressure (afterload), was reduced comparably, while end-diastolic pressure was increased
to similar extents in WT and L613V/+ mice (Figure 3-11B). Thus, while WT mice could adapt
appropriately to pressure overload, L613V/+ mice exhibited substantial, occasionally fatal,
functional decompensation with reductions in SV, FS and dP/dt Max and @LVP40, consistent
with early stages of heart failure by 8 weeks of TAC.
3.3.5 The Raf1L613V mutant increases Mek and Erk activation in response to
multiple stimuli
Compared with WT RAF1, RAF1L613V has increased kinase activity in vitro and an
enhanced ability to activate MEK/ERK in transfection studies (148, 149). We assessed the effect
of Raf1L613V, expressed at endogenous levels, on the RAS-RAF-MEK-ERK MAPK pathway.
Consistent with the earlier over-expression experiments, Mek and Erk activation (as inferred
from immunoblots with activation-specific antibodies) was enhanced in multiple cell types
86
Figure 3-9. Severe perivascular fibrosis and infarct in L613V/+ mice after TAC.
(A) Severe perivascular fibrosis in L613V/+ heart after TAC (PSR staining; original
magnification, 200X). (B) Gross appearance of an LV/+ heart (left) with a severe infarct after
TAC, and severe fibrosis (right) in the infarcted region (PSR staining; original magnification,
100X).
87
Figure 3-10. Echocardiographic parameters in WT and L613V/+ mice following pressure
overload.
Left ventricular diastolic posterior wall thickness (LVPWd) (A) and left ventricular internal end-
diastolic dimension (LVIDd) (B) at 8 weeks after TAC. (C) Decreased stroke volume (SV) and
fractional shortening (FS) in L613V/+ mice after TAC. (D) Cardiac output (CO) and heart rate at
8 weeks after TAC. *** p<0.0001 (Bonferroni post-test when ANOVA is significant); # p<0.05;
## p<0.005; ### p<0.0001 (1-tailed Student’s t-test); ns=not significant. n=12 for WT Sham;
n=11 for L613V/+ Sham; n=22 for WT TAC; n=13 for L613V/+ TAC.
88
Figure 3-11. Hemodynamic parameters in WT and L613V/+ mice following pressure
overload.
(A) Decreased cardiac contractility in L613V/+ mice after TAC. Because left ventricular
pressures (LVP) are not identical in WT and L613V/+ mice, both dP/dt Max and dP/dt@LVP40
are shown. (B) Additional invasive hemodynamic parameters of hearts after TAC. EDP, end-
diastolic pressure; MAP, mean arterial pressure. * p<0.05; ** p<0.005; *** p<0.0001
(Bonferroni post-test when ANOVA is significant); ## p<0.005; ### p<0.0001 (1-tailed
Student’s t-test); ns=not significant.
89
expressing Raf1L613V, in response to a variety of stimuli, including LIF-stimulated ES cells
(Figure 3-12A), and EGF or PDGF-stimulated embryonic fibroblasts (MEFs) (Figure 3-12B and
Figure 3-12C). Of direct relevance to the L613V/+ cardiac phenotype, Mek and Erk activation
also were higher in L613V/+ (compared with WT) neonatal cardiomyocytes stimulated with
RTK (heregulin-β1), cytokine receptor (IL-6) or GPCR (AngII) agonists (Figure 3-13). Recently,
cardiac fibroblasts were implicated in the genesis of cardiac hypertrophy (451, 452); notably,
L613V/+ cardiac fibroblasts also showed enhanced agonist-stimulated Mek/Erk activation
(Figure 3-14). The effects (quantitative and qualitative) of the mutant Raf1 allele on Mek and
Erk activation differed in detail in cardiomyocytes versus cardiac fibroblasts (or MEFs) and in
response to different stimuli. In some cases, mutant Raf1 affected only the peak level
(magnitude) of activation, in others, solely the duration of activation, and for still others, both
magnitude and duration. Such differences might reflect distinct feedback responses to the
agonists in various cell types.
Although it was difficult to detect Erk activation in the adult heart under basal conditions
(data not shown), basal Mek activity was significantly higher in adult L613V/+, compared with
WT, hearts (Figure 3-15A). To compare Mek and Erk activation in vivo, we monitored the
response of WT and L613V/+ mice to pressure overload evoked by TAC for up to 45 minutes.
Mek activation remained significantly higher in L613V/+ hearts throughout the period of acute
TAC (Figure 3-15A). Erk activation was significantly higher in L613V/+ hearts after 30 min
TAC (compared with WT hearts), but was similar to WT at other time points (Figure 3-15B).
We also assayed several signaling pathways implicated in other models of cardiac
hypetrophy/HCM by immunoblotting with appropriate p-specific antibodies. Activation of the
MAPK family members c-jun NH2-terminal kinase (JNK) and p38 was comparable in AngII-
stimulated neonatal cardiomyocytes (Figure 3-16A) and EGF-stimulated cardiac fibroblasts
(Figure 3-16B). Likewise, Akt, GSK3β and p70S6K activation (in response to the agonists
tested) were unaffected by Raf1L613V expression in either cell type. Importantly, in the same
experiments, Mek and Erk activation were enhanced in L613V/+ cardiomyocytes and cardiac
fibroblasts (Figure 3-16).
90
Figure 3-12. Raf1L613V mutant causes increased Mek and Erk activation in multiple cell
types.
(A) WT and L613V/+ ES cells were removed from feeders, starved for 6 hr, and then stimulated
with LIF (103U/ml) or left unstimulated (0’). Cell lysates (20µg protein) were resolved by SDS-
PAGE, and analyzed by immunoblotting with the indicated antibodies. One of two experiments
with comparable results is shown. (B, C) Primary mouse embryo fibroblasts (MEFs) from WT
and L613V/+ mice were starved for 16 hr, and then either stimulated with 10 ng/ml EGF (n=4;
two independent experiments in two different MEF strains) or 50 ng/ml PDGF (n=2; one
experiment in each of two different MEF strains). Quantification of blots from all experiments is
shown at right.
91
Figure 3-13. Raf1L613V mutant increases Mek and Erk activation in cardiomyocytes.
Cardiomyocytes prepared from neonatal WT and L613V/+ mice were starved for 24 hr, and then
either left unstimulated (0’), or stimulated for the indicated times with 1µg/ml Angiotensin II
(AngII) (A), 10ng/ml IL-6 (B) or 100ng/ml heregulin-β1 (C). Cell lysates (15µg protein) were
immunoblotted with the indicated antibodies. Quantification of blots is shown at right. One of
two experiments with comparable results is shown.
92
Figure 3-14. Raf1L613V mutant increases Mek and Erk activation in cardiac fibroblasts.
Cardiac fibroblasts prepared from neonatal WT and L613V/+ mice were starved for 16 hr, and
then either left unstimulated (0’) or stimulated for the indicated times with 50ng/ml EGF (A),
100ng/ml IGF-I (B), 100ng/ml PDGF (C) or 50ng/ml FGF2 (D). Cell lysates (20µg protein) were
immunoblotted with the indicated antibodies. Quantification of blots is shown at right. One of
two experiments with comparable results is shown.
93
Figure 3-15. Enhanced Mek and Erk activation in L613V/+ hearts after pressure overload.
Hearts from WT and L613V/+ mice were subjected to TAC for the indicated times (n=5 for each
group at each time point), then lysed and analyzed by immunoblotting with the indicated
antibodies. Each lane represents an individual animal. (A) Mek activation, with all samples from
a single time point analyzed on the same gel. Quantification is shown at right. (B) Representative
samples of Erk activation from each time point analyzed on the same gel. Quantification of all
samples is shown at right. In both cases, Erk2 levels are shown as a loading control. * p<0.05, 2-
tailed Student’s t-test.
94
Figure 3-16. Other signaling pathways are unaffected in neonatal cardiac myocytes and
fibroblasts.
(A) Cardiomyocytes from neonatal WT and L613V/+ mice were starved for 24 hr, and then
either left unstimulated (0’) or stimulated with AngII (1µg/ml). (B) Cardiac fibroblasts from
neonatal WT and L613V/+ mice were starved for 16 hr, and then either left unstimulated (0’) or
stimulated with EGF (10ng/ml). Cell lysates (15-20µg protein) were analyzed by
immunoblotting with the indicated phospho-specific antibodies for other pathways implicated in
cardiac hypertrophy.
95
3.3.6 MEK inhibitor treatment normalizes NS phenotypes in L613V/+ mice
The genetics of NS (and other RASopathies), and the ability of Raf1L613V to selectively
enhance Mek and Erk activation by multiple agonists in cardiomyocytes and cardiac fibroblasts,
strongly implicate enhanced Mek/Erk activation in the pathogenesis of NS phenotypes, including
HCM. We asked whether any of these phenotypes might be reversible if Mek/Erk activation
were normalized by treatment of L613V/+ mice with a MEK inhibitor. In initial experiments,
the ATP-uncompetitive inhibitor PD0325901 (453) or empty vehicle was injected
intraperitoneally (IP) daily to WT and L613V/+ mice (5mg/kg body weight), beginning at 4
weeks and continuing for the succeeding 6 weeks. Importantly, at the start of the treatment
period, L613V/+ mice already show significant growth defects, facial dysmorphia and cardiac
hypertrophy.
Remarkably, the body length of L613V/+ mice began to catch up with WT mice after 1
week of treatment, and by 2 weeks, L613V/+ mice were the same length as untreated WT mice
(Figure 3-17A). MEK inhibitor-treated WT mice also increased their body length, such that by
the last two weeks of treatment, they were significantly longer than control, untreated WT mice.
Notably, however, MEK inhibitor-treated L613V/+ mice achieved the same final body length as
treated WT mice, arguing that increased Mek/Erk activity is the primary cause of the growth
defect in L613V/+ mice (see Discussion). Inhibitor treatment also increased the body weight of
L613V/+ mice, but surprisingly, they, as well as inhibitor-treated WT mice, gained substantially
more weight than untreated WT mice (Figure 3-17B). Increased body weight in MEK-inhibitor-
treated mice was accompanied (and presumably in large part caused) by an obvious increase in
body fat; thus, increased adiposity/body mass is an unanticipated, and previously unreported,
side-effect of PD0325901 (and possibly, MEK inhibitor) treatment (see Discussion).
MEK inhibitor treatment also affected the L613V/+ cardiac phenotype. The heart weight
to body weight ratio (Figure 3-17C) in L613V/+ mice was restored to normal range (WT control)
after treatment, whereas there was no significant change in WT mice. Echocardiography (Figure
3-17D and Figure 3-17E) and invasive hemodynamic (Figure 3-19) studies showed significant
improvement in multiple parameters of cardiac morphology and function. Furthermore,
histological assessment of cross-sectional area of cardiomyocytes confirmed the normalization of
96
97
Figure 3-17. MEK inhibitor treatment rescues growth defect and cardiac hypertrophy in
L613V/+ mice.
Mice were injected intraperitoneally (IP) daily with PD0325901 (5mg/kg body weight) or
vehicle, starting at 4 weeks of age and for the succeeding 6 weeks. Body length (A) and body
weight (B) were measured weekly. Note the rapid normalization of body length, as well as the
increase in body weight caused by inhibitor treatment. # p<0.05; ## p<0.005; ### p<0.0001
(two-way repeated measure ANOVA); * p<0.05; ** p<0.005; *** p<0.0001 (Bonferroni post-
test when ANOVA is significant; black asterisk for WT treatment vs. WT control; red asterisk
for L613V/+ treatment vs. L613V/+ control). (C) Heart weight/body weight (mg/g) ratio and (D)
Left ventricular diastolic posterior wall thickness (LVPWd) are restored to within normal limits
in inhibitor-treated mice. ** p<0.005; *** p<0.0001 (Bonferroni post-test when ANOVA is
significant); # p<0.05 (1-tailed Student’s t-test); ns=not significant. (E) Left ventricular end-
diastolic dimension (LVIDd). **p<0.005 (Bonferroni post-test when ANOVA is significant); #
p<0.05; ## p<0.005 (1-tailed Student’s t-test); ns=not significant. n=14 for WT control; n=10 for
L613V/+ control; n=6 for WT treatment (WT PD); n=14 for L613V/+ treatment (L613V/+ PD).
(F) Cross-sectional area of cardiomyocytes (original magnification, 400X; white bar, 100µm),
measured in WGA-strained heart sections (n=2 samples for each group, with 200 cells counted
for each sample using ImageJ). *** p<0.0001 (Bonferroni post-test when ANOVA is
significant); ns=not significant.
98
Figure 3-18. Normalized cardiac morphology and function after MEK inhibitor treatment.
(A) Left ventricular diastolic posterior wall thickness (LVPWd) normalized by BW1/3. (B) Left
ventricular internal end-diastolic dimension (LVIDd) normalized by BW1/3. (C) Normalized
stroke volume (SV). End-diastolic volume (EDV) = (4.5 x normalized LVIDd2); End-systolic
volume (ESV) = (3.72 x normalized LVIDd2); SV=EDV-ESV. (D) Normalized cardiac output
(CO). CO=Normalized SV X Heart rate. ** p<0.005; *** p<0.0001 (Bonferroni post-test when
ANOVA is significant); # p<0.05; ## p<0.005 (1-tailed Student’s t-test); ns=not significant.
n=14 for WT control; n=10 for LV/+ control; n=6 for WT treatment (WT PD); n=14 for
L613V/+ treatment (L613V/+ PD).
99
Figure 3-19. MEK inhibitor treatment normalizes cardiac function in L613V/+ mice.
(A) Echocardiographic parameters of hearts after MEK inhibitor treatment as described in Figure
3-17. Note normalization of stroke volume (SV) and fractional shortening (FS), with a trend
towards normalization of cardiac output (CO). * p<0.05; ** p<0.005; *** p<0.0001 (Bonferroni
post-test when ANOVA is significant); # p<0.05 (1-tailed Student’s t-test); ns=not significant.
(B) Hemodynamic parameters, assessed by cardiac catheterization, after MEK inhibitor
treatment. For calculating statistical significance, significant outliers (circled data points), as
accessed by Grubbs' test, were removed. *: p<0.05 (Bonferroni post-test when ANOVA is
significant); p=0.09 when outliers are not removed. # p<0.05 (1-tailed Student’s t-test); p=0.12
when outliers are not removed. ns, not significant. n=14 for WT control; n=10 for L613V/+
control; n=6 for WT treatment (WT PD); n=14 for L613V/+ treatment (L613V/+ PD).
100
cardiomyocyte size in L613V/+ mice after treatment (Figure 3-17F). The significant increase in
body size and body mass caused by inhibitor treatment potentially complicates echocardiography
and invasive hemodynamic comparisons of pre- and post-treatment WT and L613V/+ mice,
respectively. Therefore, we compared all parameters using both nominal values and values
normalized by BW1/3 (Figure 3-18); overall, the two analysis regimes lead to similar conclusions.
First, there was a significant reduction (towards normal) in left ventricular posterior wall
thickness in L613V/+ mice after treatment (Figure 3-17D); this difference was even more
significant when normalized by BW1/3 (Figure 3-18). Nominal left ventricular end-diastolic
dimension was unchanged in inhibitor-treated L613V/+ mice (Figure 3-17E), although when this
value is normalized, chamber dilatation was improved significantly, becoming comparable to
WT controls (Figure 3-18B). Inhibitor treatment clearly reduced the abnormal SV and FS in
L613V/+ mice towards normal (untreated or treated WT) values (Figure 3-19A and Figure
3-18C). There also was a strong trend towards decreased CO in L613V/+ mice after inhibitor
treatment (Figure 3-19A and Figure 3-18D). Finally, the excessive cardiac contractility (dP/dt
and dP/dt@LVP40) in L613V/+ mice was ameliorated by inhibitor treatment, while cardiac
relaxation remained unchanged (Figure 3-19B).
MEK inhibitor treatment did not improve the facial dysmorphia in L613V/+ mice in the
above study, most likely because skull development had already been completed by the onset of
drug administration. We tested whether earlier, but still post-natal, MEK inhibitor treatment
could prevent/ameliorate L613V/+ facial defects. Lactating female mice were injected IP with
PD0325901 (5mg/kg body weight) daily, beginning at postnatal day 0 (P0) until weaning (P21).
Weaned mice were then injected individually with same dose of inhibitor for another 5 weeks.
As expected from our initial treatment regimen (Figure 3-17A), the growth defect in L613V/+
mice was again prevented in this new study. Remarkably, however, earlier MEK inhibitor
treatment had a dramatic effect on the appearance of L613V/+ mice: they no longer had
“triangular” faces and instead, appeared indistinguishable from control (treated or untreated) WT
mice (Figure 3-20A). MicroCT morphometry confirmed that inner canthal distance was reduced
significantly, while skull length was increased and skull width and width/length ratio were
decreased in inhibitor-treated L613V/+ mice; all of these values were indistinguishable from WT
(treated or untreated) mice by the end of the treatment period (Figure 3-20B).
101
Figure 3-20. Early post-natal MEK inhibitor treatment rescues facial dysmorphia in
L613V/+ mice.
Lactating female mice were injected IP daily with PD0325901 (5mg/kg body weight) or vehicle,
starting at postnatal day 0 (P0) until weaning (P21). Weaned mice were then injected IP
individually with PD0325901 (5mg/kg body weight) or vehicle daily for another 5 weeks. (A)
Gross facial appearances for mice treated with PD0325901 (PD) or vehicle. (B) Morphometric
measurements of skulls from microCT scans. ** p<0.005; *** p<0.0001 (Bonferroni post-test
when ANOVA is significant). n=11 for WT control; n=10 for L613V/+ control; n=6 for WT
treatment (WT PD); n=7 for L613V/+ treatment (L613V/+ PD).
102
3.4 Discussion
We describe here a knock-in mouse model for Noonan syndrome (NS) caused by a Raf1
gain-of-function mutation. Similar to mouse models of Ptpn11 mutation-associated NS,
Raf1L613V heterozygosity causes proportional short stature, facial dysmorphia, and hematological
defects. Unlike phosphatase-activating Ptpn11 alleles, which cause valvuloseptal abnormalities
(204, 207, 210), L613V/+ mice have normal valvuloseptal development and instead exhibit
eccentric cardiac hypertrophy that decompensates upon pressure overload. Agonist-evoked
Mek/Erk activation is enhanced in multiple cell types without changes in several other signaling
pathways implicated in cardiac hypertrophy/HCM. Remarkably, post-natal MEK inhibition
normalizes the growth, facial and cardiac defects in L613V/+ mice, demonstrating that continued
MEK/ERK activity is critical for causing HCM and other NS phenotypes and identifying MEK
inhibitors as potential therapeutic agents for the treatment of NS.
RASopathies are a class of human genetic syndromes caused by germ line mutations in
genes that encode components of the RAS/ERK pathway (32, 439). Not surprisingly, these
disorders share several features (albeit with varying degrees of penetrance), yet each also
exhibits unique and characteristic phenotypes. Conceivably, the specific mutant gene, possibly as
a consequence of its position in the pathway and susceptibility to feedback regulation, could
direct the phenotype. Alternatively, genetic modifiers in the highly outbred human population
could be determinative.
Previous mouse models suggest that both the gene and the genetic background are
important to the ultimate RASopathy phenotype. Clearly, different mutations in the same
RASopathy gene can result in distinguishable phenotypes: gain-of-function Ptpn11 mutations,
depending on the degree of their phosphatase activity, cause a variable spectrum of NS
phenotypes (204, 207, 210). The current study, along with a parallel analysis of knock-in mice
expressing a NS-associated Sos1E846K mutant (211), shows that mutations in different genes that
cause the same RASopathy syndrome yield different phenotypes: mice with phosphatase-
activating Ptpn11 mutations have valvuloseptal defects, but not HCM (204, 207); Sos1E846K/+
mice develop left ventricular hypertrophy with incompletely penetrant aortic stenosis; and
Raf1L613V/+ mice exhibit HCM with normal valvuloseptal development.
103
On the other hand, mutations associated with different RASopathies also have distinct
effects in mice. In contrast to the NS mice discussed above, an HRasG12V knock-in mouse model
of Costello Syndrome (CS) shows abnormal cranial dimensions, papillomas and angiosarcomas.
These mice have cardiac hypertrophy, but also aortic stenosis, making it unclear whether the
hypertrophy is primary or secondary (439, 443). As described in the accompanying manuscript
(444), a mouse model of LEOPARD syndrome (LS) caused by Ptpn11Y279C, indicates that, unlike
Ptpn11 alleles with increased catalytic activity, catalytically impaired mutants develop HCM and
skeletal abnormalities (as well as short stature and facial dysmorphia).
While the specific mutation plays a major role in determining RASopathy phenotype,
modifier loci also clearly contribute: just as there is considerable phenotypic variation between
family members carrying the same NS or LS allele (454), there are differences in disease
spectrum and severity of mice with Ptpn11 (204, 210) and Raf1 (data not shown) mutations on
different strain backgrounds. Ptpn11D61G/+ mice show incomplete penetrance of valvuloseptal
defects on mixed background and various penetrance of embryonic lethality on different strain
backgrounds (204, 210). Raf1L613V/+ mice were obtained at the expected Mendelian ratio on
mixed background, whereas on the C57BL/6 background this mutant allele almost always was
lethal (data not shown). All of these data suggest that incomplete penetrance reflects strain-
specific modifiers. Genomic scans using SNP panels should help to determine whether cloneable
modifiers exist or heterosis accounts for the variable penetrance.
The role of the RAS/ERK pathway in cardiac hypertrophy has been controversial. Over-
expression of MAPK phosphatase 1 (MKP-1) blocks both agonist-induced hypertrophy in vitro
and pressure overload-associated hypertrophy in vivo (455). However, MKP-1 inactivates all
three major MAPKs, so this study could not address the specific effects of Ras/Erk pathway
activation. Depletion of ERK1/2 with antisense oligonucleotides or pharmacological inhibition
of MEK1/2 attenuates the hypertrophic response to agonist stimulation of cultured
cardiomyocytes (414, 415), consistent with a requirement for MEK/ERK activation in the
hypertrophic response. Transgenic mice with cardiac-specific expression of HRasG12V display
HCM associated with interstitial fibrosis and sudden death (411-413). Cardiac-specific Nf1-
deleted mice develop marked cardiac hypertrophy, progressive cardiomyopathy, and fibrosis as
adults (456).
104
Conversely, other studies suggest that MEK/ERK activity is dispensable for
cardiomyocyte hypertrophy. Transgenic mice with cardiac-restricted expression of activated
Mek1 exhibit concentric hypertrophy without signs of cardiomyopathy (418). Although
hypertrophy in this model was interpreted as physiological, these mice also have impaired
diastolic function and reactivated cardiac fetal gene expression, which is more consistent with
pathologic hypertrophy. A recent study showed that Erk1-/-Erk2+/- mice, or transgenic mice with
cardiac-specific expression of dual specificity phosphatase 6 (Dusp6), an Erk1/2-specific
phosphatase, showed a normal hypertrophic response to pressure overload and exercise (420). In
both of these lines of mice, however, residual Erk activity cannot be excluded. Also, it is possible
that Dusp6 has other targets besides Erk1/2, which could complicate interpretation of these
results. Moreover, most of these earlier studies involved cardiomyocyte-specific expression or
deletion of potential hypertrophy-related genes, which excludes the potential contribution of
other cell types in the heart to the hypertrophic response. Recent studies show that cardiac
fibroblasts play key roles in myocardial development and function (457, 458). Embryonic
cardiac fibroblasts induce myocyte proliferation, whereas adult cardiac fibroblasts promote
myocyte hypertrophy (457), and evoke pathological hypertrophy and fibrosis in response to
disease stimuli (451, 452). Of particular note, enhanced Ras/Erk activation in cardiac fibroblasts
is implicated in pathological hypertrophy and fibrosis caused by over-expression of the beta-
adrenergic receptor in cardiomyocytes (452).
Our mouse model, in which a NS-associated Raf1 mutant is expressed globally under
normal promoter control, supports the conclusion that excessive Ras/Erk pathway activity causes
HCM. Several lines of evidence indicate that L613V/+ mice have pathologic cardiac
hypertrophy. Hypertrophy is eccentric in these mice, and they show the characteristic shift from
alpha-Mhc to beta-Mhc expression seen in pathological hypertrophy. In response to pressure
overload (TAC), they have an unusually high death rate, presumably due to inability to adapt to
this stress or arrythmia, while surviving mice show clear evidence of functional decompensation.
Importantly, in our model, unlike many previous studies (see above), the mutant allele is
expressed in both cardiomyocytes and cardiac fibroblasts (as well as multiple other cell types).
Moreover, Mek/Erk activation is enhanced in response to multiple agonists in these cells. It will
be important to determine whether mutant expression in cardiomyocytes, cardiac fibroblasts, or
both is important for HCM in L613V/+ mice; our inducible Raf1 allele should facilitate such
105
analyses. Most importantly, post-natal MEK inhibitor treatment substantially normalizes the
cardiac defects in L613V/+ mice, providing strong evidence for the critical role of the RAS/ERK
pathway in initiating and maintaining the cardiac hypertrophic response.
Post-natal MEK inhibitor treatment also normalizes the growth defects and, if
administered early enough, the facial dysmorphia in L613V/+ mice. Notably, MEK inhibitor
treatment also increases the body length of WT mice, but there is no difference in the final body
length (after treatment) between the WT and mutant-treated groups. Likewise, MEK inhibitor
treatment (at doses that effectively normalized L613V/+ cardiac anatomy and function) had little
effect on cardiac function in WT mice. These results strongly suggest that all of these NS
phenotypes are due to excessive MEK/ERK activity (as opposed to the MEK inhibitor acting on
a parallel pathway to mitigate syndromic features).
Unexpectedly, we found that PD0325901 treatment caused a significant increase in body
weight with an obvious increase in body fat. Although we cannot exclude the possibility that this
is an idiosyncratic (i.e., off-target) effect of this specific MEK inhibitor, other evidence points to
a potential obesity-promoting effect of MEK/ERK inhibition. For example, leptin activates Erk
via an Shp2-dependent pathway (459, 460) and deletion of Shp2 in post-mitotic forebrain
neurons causes early-onset obesity with decreased ERK activation and evidence of leptin
resistance (461). We suspect that MEK inhibition may act in analogous ways to promote obesity
in our mice.
In summary, our data demonstrate a critical role of the RAS/ERK pathway in the genesis
of HCM in NS, and show that NS phenotypes can be rescued by pharmacological inhibition of
MEK1/2. Previous studies showed that genetic ablation of Erk1/2 (207, 210) or pre-natal
treatment with a MEK inhibitor (209, 211) can prevent some NS phenotypes. While these studies
provide evidence for the key role of Mek/Erk hyperactivity in NS pathogenesis, they did not
resolve whether MEK inhibition can reverse these phenotypes. By contrast, our results suggest
that MEK inhibition may be useful for the specific treatment of Raf1 mutant NS, and possibly for
other RASopathies associated with increased MEK/ERK pathway activity. Interestingly, a
parallel study show that LS-associated HCM is associated with hyper-activation of PI3K/Akt
pathway, and can be rescued by Rapamycin treatment (444). Taken together, these studies argue
for a mutation-specific, “personalized” approach to RASopathy therapy.
106
Chapter 4
Increased BRAF heterodimerization is the common pathogenic
mechanism for Noonan Syndrome-associated RAF1 mutants
This Chapter is a modified version of a paper published in Molecular and Cellular Biology (2012
Oct;32(19):3872-90).
107
4.1 Abstract
Noonan syndrome (NS) is a relatively common autosomal dominant disorder,
characterized by congenital heart defects, short stature and facial dysmorphia. NS is caused by
germ-line mutations in several components of the RAS-RAF-MEK-ERK MAPK pathway,
including both kinase-activating and kinase-impaired alleles of RAF1 (~3-5%), which encodes a
serine-threonine kinase for MEK1/2. To investigate how kinase-impaired RAF1 mutants cause
NS, we generated knock-in mice expressing Raf1D486N. Raf1D486N/+ (hereafter D486N/+) female
mice exhibited a mild growth defect. Male and female D486N/D486N mice developed
concentric cardiac hypertrophy and incompletely penetrant, but severe, growth defects.
Remarkably, Mek/Erk activation was enhanced in Raf1D486N-expressing cells compared with
controls. RAF1D486N, as well as other kinase-impaired RAF1 mutants, showed increased
heterodimerization with BRAF, which was necessary and sufficient to promote increased
MEK/ERK activation. Furthermore, kinase-activating RAF1 mutants also required
heterodimerization to enhance MEK/ERK activation. Our results suggest that increased
heterodimerization ability is the common pathogenic mechanism for NS-associated RAF1
mutations.
4.2 Background
Noonan syndrome (NS) is a relatively common (1 in 1,000–2,500 live births) autosomal
dominant disorder (127, 462, 463), characterized by short stature, craniofacial dysmorphia, a
wide spectrum of congenital cardiac anomalies, and an increased risk of hematopoietic
malignancy. Although NS is genetically heterogeneous (31, 32, 144), all known cases are caused
by germ-line mutations in conserved components of the canonical RAS-RAF-MEK-ERK MAPK
(hereafter, RAS/ERK) cascade, a key regulator of cell proliferation, differentiation and survival
(26, 27). Mutations in PTPN11, which encodes the protein-tyrosine phosphatase SHP2, account
for approximately half of NS cases (145). Other known NS genes include SOS1 (~10%) (146,
147), RAF1 (3-5%) (148, 149), KRAS (<2%) (150, 151), NRAS (152) and SHOC2 (183) (<1-2%).
Mutations in some of these genes, as well as in genes encoding other RAS/ERK pathway
components, also cause phenotypically related disorders, such as neurofibromatosis type 1
(NF1), Costello syndrome, cardio-facio-cutaneous (CFC) syndrome, and LEOPARD syndrome;
together with NS, these syndromes are now termed “RASopathies” (32). How mutations in the
108
same signaling pathway cause similar, yet clearly distinct, phenotypes remains unclear.
Consequently, detailed understanding of RASopathy pathogenesis should yield new insights into
RAS/ERK pathway regulation.
RAF family serine-threonine kinases (250-252) function as key RAS effectors,
phosphorylating and activating the dual specificity kinases MEK1 and MEK2, which in turn
promote the activation of the MAPKs, ERK1 and ERK2. The three mammalian RAF family
members (RAF1, BRAF and ARAF) differ in their expression profiles and regulatory
mechanisms, and have distinct roles during development. RAF1 (also known as CRAF) is the
most intensively studied isoform. Nevertheless, controversy and disagreement surround the
precise molecular events required for RAF1 activation, which include RAS-dependent
membrane recruitment, conformational changes, dimerization or oligomerization, scaffold
protein binding, and distinct phosphorylation/dephosphorylation events. RAF1 also has
important kinase-independent functions. For example, it interacts with and inhibits apoptosis
signal-regulating kinase 1 (ASK1) (227, 338), Mammalian STE20-like kinase 2 (MST2) (228,
339) and Rok-α (229).
Two groups (148, 149) identified multiple missense mutations of RAF1 in NS, which
cluster in three regions. Approximately 70% of NS-associated RAF1 alleles alter the motif
flanking S259 within the so-called CR2 domain, which binds to 14-3-3 proteins and is critical for
auto-inhibition (163, 164). The second group of mutations (~15%) affects residues within the
activation segment of the kinase domain (D486 and T491). The remaining alleles (~15%)
involve two adjacent residues (S612 and L613) located C-terminal to the kinase domain.
Transient transfection studies indicate that mutations affecting the 14-3-3 binding motif or the C-
terminus of the protein enhance RAF1 kinase activity and increase MEK/ERK activation in cells.
By contrast, mutations that cluster in the activation segment are kinase-impaired and reportedly
act as dominant negative or null alleles (148, 149). Previous work suggested that the increased
kinase activity of NS-associated CR2 domain mutants results from decreased S259
phosphorylation and consequent dissociation from 14-3-3 (149, 165, 166), but the mechanism
underlying increased kinase activity of the RAF1 C-terminal mutants remains unclear. Likewise,
how kinase-defective RAF1 alleles cause NS has remained obscure, if not paradoxical. Studies
of kinase-defective BRAF alleles strongly implicate enhanced MEK/ERK activation and
heterodimerization with RAF1 in human melanoma pathogenesis (167, 168). The paradoxical
109
activation of the MEK/ERK pathway in wild type cells treated with selective small molecule
BRAF inhibitors also has been attributed to the ability of these inhibitors to induce BRAF/RAF1
heterodimer formation (169, 170). The relevance of these observations for RAF1 alleles
expressed at physiological expression levels remains to be determined.
Kinase-activating and kinase-impaired RAF1 alleles also are associated with different
syndromic phenotypes. NS patients with RAF1 mutations have a much higher incidence (~75%)
of hypertrophic cardiomyopathy (HCM) than is found in the overall NS population (~20%).
However, only RAF1 alleles encoding kinase-activated mutants are highly associated (~95%)
with HCM. Recently, we reported that knock-in mice expressing the kinase-activated allele
Raf1L613V develop typical NS features (short stature, facial dysmorphia, haematological
abnormalities), as well as HCM (464). As expected, agonist-evoked MEK/ERK activation was
enhanced in multiple cell types expressing Raf1L613V. Moreover, postnatal MEK inhibition
normalized the growth, facial, and cardiac defects in L613V/+ mice, showing that enhanced
MEK/ERK activation is critical for evoking RAF1-mutant NS phenotypes.
Whether kinase-defective Raf1 alleles also faithfully model human NS, and if so, how
kinase-activating and kinase-defective mutants can cause similar phenotypes, remains to be
resolved. To investigate this paradox, we generated and analyzed knock-in mice expressing the
kinase-impaired NS mutant Raf1D486N, and also re-examined the effects of various other NS
mutants expressed at more physiological levels than in previous transient transfection studies.
Our results strongly implicate increased heterodimerization ability as the common pathogenic
mechanism for NS-associated RAF1 mutations.
4.3 Results
4.3.1 Generation of Raf1D486N mice
To avoid the possibility that expression of kinase-impaired Raf1 might cause embryonic
lethality, we designed an inducible Raf1D486N “knock-in” allele (D486Nfl; Figure 4-1A). The
targeting vector included a cassette containing a splice acceptor sequence, a Raf1 cDNA
fragment encoding WT exons 13-16, and a pGK-Neo gene. The fusion cDNA/Neo cassette was
flanked by LoxP sites and was positioned between Raf1 exons 12 and 13, with the D486N
110
111
Figure 4-1. Generation of Raf1D486N knock-in mice.
(A) Targeting strategy. Structures of the Raf1 locus, targeting vector, mutant allele and location
of probes for Southern blotting are shown. (B) Selection of targeted ES cells. To assay for
inclusion of the 5’ loxP site, a PCR product, obtained by using primers within exon 11 and the
Raf1 cDNA, was digested with NotI. To ensure inclusion of the D486N mutation, a PCR
product, obtained by using primers around exon 13, was digested with ApoI. To assay for
inclusion of the Neo cassette, a PCR product was obtained by using primers within the PGK Neo
gene. (C) ES cells are targeted correctly. Genomic DNA from WT ES cells and PCR-positive
D486Nfl/+ ES clones was digested with XbaI (5’ and Neo probe) or BamHI (3’ probe) and
subjected to Southern blotting with 5’, 3’ or Neo probes, respectively. (D) Inducible expression
of the Raf1D486N allele. RNA was isolated from WT and D486Nfl/+ ES cells with or without
prior transfection of pMSCV-Cre-GFP plasmid and reverse transcribed. A PCR product,
obtained by using primers within exon 11 and at the end of exon 16 of the Raf1 cDNA, was
digested with ApoI. Note that the mutant allele is silent until Cre is introduced, and then is
expressed efficiently. (E) Progeny from D486N/+ matings with the indicated littermates.
112
mutation introduced into exon 13 and an HSV-TK cassette for negative selection. In the absence
of Cre recombinase (Cre), Raf1 exon 12 should be spliced to the cDNA (exons 13-16), resulting
in the expression of WT Raf1. When Cre is present, the floxed cassette is excised, leading to the
transcription of the mutant Raf1 allele (D486N).
The targeting construct was electroporated into G4 ES cells, and correctly targeted clones
(D486Nfl/+) were identified by PCR (Figure 4-1B) and confirmed by Southern blotting (Figure
4-1C). To test whether the mutant Raf1 allele could be induced in D486Nfl/+ ES cells, a Cre
expression vector (pMSCV-GFP-Cre) was introduced; as expected, this resulted in efficient
transcription of the mutant allele (Figure 4-1D). Chimeras were generated by outbred morula
aggregation, and germ-line transmission was obtained. D486Nfl/+ progeny were crossed to EIIa-
Cre mice, which express Cre ubiquitously, and then to WT mice, thereby generating mice with
global Raf1D486N expression (referred to as D486N/+ mice) on a 129Sv × C57BL/6 mixed
background. D486N/+ littermates were intercrossed to generate mice homozygous for Raf1D486N
(referred to as D486N/D486N mice). D486N/+ and D486N/D486N mice were obtained at the
expected Mendelian ratios at weaning (Figure 4-1E), indicating that Raf1D486N expression is
compatible with embryonic development.
4.3.2 Phenotypes of D486N/+ and D486N/D486N mice
Major features of NS include short stature, facial dysmorphia, cardiovascular
abnormalities and often, some form of myeloproliferative disease (MPD) (438). D486N/+ female
mice exhibited a mild, but reproducible growth defect compared with WT littermates, although
male heterozygotes had normal body size (Figure 4-2A). Male and female D486N/D486N mice
showed two distinct patterns of growth: about two thirds of these animals had a normal growth
pattern but in the remaining one third, body length and weight were markedly decreased (~50%
smaller than littermate controls). Hereafter, we refer to the normal sized mice as n-
D486N/D486N, and the smaller ones as s-D486N/D486N. The majority of s-D486N/D486N
mice died shortly after weaning, while those that survived continued to have reduced body size, a
hunched appearance with ruffled fur and frequent tremors, and ultimately, died between 4-8
months of age. Consistent with their decreased body size, the skulls of s-D486N/D486N mice
were significantly shorter than those of WT mice. However, skull width was decreased only
slightly, resulting in a significant increase in width/length ratio and a “triangular” facial
113
appearance (Figure 4-2B). By contrast, n-D486N/D486N mice had normal lifespan, body size
and facial morphology (Figure 4-2B). Because D486N/D486N mice were maintained on a mixed
strain background, genetic modifiers presumably account for the variable phenotype.
Similar to RAF1D486N/+ NS patients, D486N/+ mice had normal heart size. By contrast, n-
D486N/D486N mice showed cardiac enlargement, manifested by a significantly increased heart
weight to body weight ratio compared with WT and D486N/+ littermates (Figure 4-2C).
Neonatal cardiomyocytes prepared from D486N/D486N mice showed significant increased
surface area compared with WT cardiomyocytes, indicating that cardiac enlargement was due to
hypertrophy (Figure 4-2D). Echocardiography performed on 4 month-old n-D486N/D486N mice
showed increased left ventricular diastolic posterior wall thickness (LVPWd) as expected, while
D486N/+ mice had normal LVPWd (Figure 4-2E). In contrast to Raf1L613V/+ mice, which develop
cardiac dilatation (464), left ventricular internal end-diastolic dimension (LVIDd) remained
normal in D486N/+ and n-D486N/D486N mice, while left ventricular internal end-systolic
dimension (LVIDs) tended to be reduced in D486N/+ hearts and was decreased significantly in
n-D486N/D486N hearts (Figure 4-2F). Stroke volume (SV), fractional shortening (FS), cardiac
output (CO), and ejection fraction (EF) also were increased in n-D486N/D486N mice (Figure
4-2G). Cardiac parameters could not be assessed in s-D486N/D486N mice because of their size
and general ill health. Overall, these findings indicate that D486N/D486N mice have concentric
cardiac hypertrophy with enhanced cardiac function.
Unlike other mouse models of NS (204, 210, 464, 465), D486N/+ and D486N/D486N
mice did not develop splenomegaly (Figure 4-3A), nor they show overt hematological defects
(Figure 4-3B and Figure 4-3C).
4.3.3 Raf1D486N expression increases Mek/Erk activation in response to
multiple stimuli
NS-associated RAF1 mutations include kinase-activating mutations (e.g., S257L and
L613V) and mutations with impaired kinase activity (e.g., D486N and T491I/R) (148, 149). To
begin to investigate why kinase-impaired and -activated RAF1 mutants cause similar
phenotypes, we assessed Mek and Erk activation in mouse embryonic fibroblasts (MEFs)
prepared from heterozygous and homozygous Raf1D486N embryos and stimulated with various
114
115
Figure 4-2. Phenotypes of D486N/+ and D486N/D486N mice.
(A) D486N/+ females have mild growth defect. Growth curves of male (top) and female
(bottom; p<0.0001, two-way repeated measure ANOVA) WT (n=25) and D486N/+ (n=25) mice.
(B) D486N/D486N mice with severe growth defect (s-D486N/D486N) have facial dysmorphia.
Morphometric measurements from microCT scans of a cohort of 2-month-old WT (n=12),
normal size D486N/D486N (n-D486N/D486N) (n=10) and s-D486N/D486N (n=3) male mice.
(C) Representative gross appearance and heart weight/body weight (mg/g) ratios of WT (n=15),
D486N/+ (n=20) and D486N/D486N (n=15) male mice at 4 months. (D) Surface area of isolated
neonatal cardiomyocytes from WT and D486N/D486N mice. For each genotype, 350 cells were
analyzed using ImageJ. ### p<0.001, 2-tailed Student’s t-test. (E) Left ventricular diastolic
posterior wall thickness (LVPWd) at 4 months, measured by echocardiography (n=12 for WT;
n=20 for D486N/+; n=12 for D486N/D486N). (F) Left ventricular chamber dimensions of 4
month-old WT (n=12), D486N/+ (n=20) and D486N/D486N (n=12) hearts. LVIDs, left
ventricular internal end-systolic dimension; LVIDd, left ventricular internal end-diastolic
dimension. (G) Echocardiographic parameters of 4 month-old WT (n=12), D486N/+ (n=20) and
D486N/D486N (n=12) hearts. SV, stroke volume; FS, fractional shortening; CO, cardiac output;
EF, ejection fraction. * p<0.05; ** p<0.01; *** p<0.001 (Bonferroni post-test when ANOVA is
significant). ns, not significant.
116
Figure 4-3. Additional phenotyping of D486N/+ and D486N/D486N mice.
(A) Spleen weight to body weight ratios in WT, D486N/+ and D486N/D486N male mice at 5
month (n=15 for each genotype). (B) White blood counts (WBC) in WT, D486N/+ and
D486N/D486N male mice at 1 year (n=6 for each genotype). (C) Myeloid colony formation in
the absence of cytokines of bone marrow cells from WT, D486N/+, and D486N/D486N mice.
Bulk bone marrow cells were extracted at 1 year (n=3 for each genotype). Colonies were
enumerated 7 days after plating. Bone marrow from an induced Mx-Cre:KrasG12D mouse (n=1),
serves as a positive control for cytokine-independent colony formation. ns, not significant.
117
agonists. As reported previously (464), Raf1L613V expressing cells show enhanced Mek/Erk
activation in response to agonists for receptor tyrosine kinases (RTKs), cytokine receptors and G
protein-coupled receptors (GPCRs). Notably, in D486N/+ MEFs, Raf1 protein levels were only
~60% of WT levels, a finding consistent with previous work showing that Raf1 kinase activity is
required to prevent ubiquitin-mediated proteolysis of Raf1 (297). Nevertheless, D486N/+ MEFs
showed sustained Mek and Erk activation in response to EGF (Figure 4-4A) stimulation.
D486N/D486N MEFs had only ~30% of WT Raf1 levels, but showed enhanced and sustained
Mek and Erk activation (Figure 4-4A). Mek and Erk activation also were enhanced in
D486N/D486N neonatal cardiomyocytes stimulated with cytokine receptor (IL-6), GPCR (Ang-
II), or RTK (IGF-I, EGF and NRG) ligands (Figure 4-4B and Figure 4-5), providing a potential
explanation for cardiac hypertrophy in D486N/D486N mice (Figure 4-2). Cardiac fibroblasts
also are implicated in hypertrophy pathogenesis (452, 466), and compared with their WT
counterparts, neonatal D486N/D486N cardiac fibroblasts showed enhanced Mek/Erk activation
in response to multiple agonists (Figure 4-4C and Figure 4-6).
4.3.4 Quantitative differences in effects of NS-associated Raf1 D486N and
L613V mutants on Mek/Erk activation
Kinase-activating (e.g., L613V) and kinase-impaired (e.g., D486N) RAF1 mutants cause
NS, but HCM is only highly associated with the former (148, 149, 467). Remarkably, our
Raf1L613V (L613V/+) (464) and Raf1D486N mouse models showed analogous genotype-dependent
phenotypic differences (Table 4-1). L613V/+ mice exhibit HCM that progresses to chamber
dilatation (464). By contrast, D486N/+ mice had no obvious cardiac phenotype, but doubling the
dosage of this kinase-defective Raf1 allele (e.g., in D486N/D486N mice) resulted in concentric
cardiac hypertrophy with decreased left ventricular end-systolic dimension and normal end-
diastolic dimension (Figure 4-2).
We asked whether these phenotypic differences correlated with differential effects on
Mek/Erk activation. Indeed, Raf1L613V caused a dramatic increase of the magnitude of EGF-
evoked Mek/Erk activation in primary MEFs, whereas Raf1D486N resulted mainly in sustained
Mek/Erk activation (Figure 4-7A). More importantly, Mek activation was enhanced only slightly
in hearts from D486N/D486N mice, whereas L613V/+ hearts showed a more profound increase
118
119
Figure 4-4. Raf1D486N mutant increases Mek and Erk activation.
(A) Primary mouse embryo fibroblasts (MEFs) from WT, D486N/+ and D486N/D486N mice
were serum-starved for 16 hr, and then stimulated with EGF for the indicated times. Cell lysates
were immunoblotted with the indicated antibodies. A representative blot and quantification of
blots from all experiments are shown (n=6; two independent experiments using three different
MEF strains). * p<0.05; ** p<0.01; *** p<0.001 (left bottom). * p<0.05; ** p<0.01; ***
p<0.001 (right; D486N/D486N vs. WT). # p<0.05; ## p<0.01 (right; D486N/+ vs. WT);
Bonferroni post-test, when ANOVA is significant. (B) Neonatal cardiomyocytes from WT and
D486N/D486N mice were starved for 24 hr, and then stimulated for the indicated times with the
indicated agonists. AngII, Angiotensin II. NRG, heregulin-β1. Cell lysates were immunoblotted,
as indicated. (C) Cardiac fibroblasts from WT and D486N/D486N neonates were starved for 16
hr, and then stimulated for the indicated times with various agonists. Cell lysates were
immunoblotted with the indicated antibodies.
120
Figure 4-5. Mek/Erk activation in WT and D486N/D486N neonatal cardiomyocytes.
Cardiomyocytes prepared from neonatal WT and D486N/D486N mice were starved for 24 hr,
and then stimulated for the indicated times with different agonists, as indicated. Mek/Erk
activation (n=2) was analyzed by immunobloting with specific antibodies and quantified using
Odyssey software.
121
Figure 4-6. Mek/Erk activation in WT and D486N/D486N neonatal cardiac fibroblasts.
Cardiac fibroblasts prepared from neonatal WT and D486N/D486N mice were starved for 24 hr,
and then stimulated for the indicated times with different agonists, as indicated. Mek/Erk
activation (n=2) was analyzed by immunobloting with specific antibodies and quantified using
Odyssey software.
122
WT (n=20) D486N/D486N (n=12)
L613V/+ (n=11)
LVPWd (mm) 0.73±0.01 0.87±0.03*** 0.81±0.02 *
LVIDd (mm) 4.08±0.04 4.03±0.08## 4.47±0.14**
LVIDs (mm) 2.87±0.06 2.59±0.09** # 2.96±0.12
SV (µl) 41.4±0.9 47.9±3.4** # 57.5±3.3***
CO (ml/min) 20.3±0.5 23.8±1.2** # 27.8±2.1***
FS% 29.6±0.9 35.3±1.6** 34.0±1.0*
EF% 56.8±1.4 64.3±2.2* 62.9±1.5*
dP/dt Max (mmHg/s)
10390±347 10707±690# 12486±414**
Table 4-1. Comparison of cardiac phenotypes in D486N/D486N and L613V/+ mice.
Echocardiographic and invasive hemodynamic parameters of 4 month-old WT (n=12),
D486N/D486N (n=12) and L613V/+ (n=11) hearts. LVPWD, left ventricular diastolic posterior
wall thickness; LVIDs, left ventricular internal end-systolic dimension; LVIDd, left ventricular
internal end-diastolic dimension; SV, stroke volume; FS, fractional shortening; CO, cardiac
output; EF, ejection fraction. Phenotypic data for L613V/+ mice are derived from our previous
publication (464). * p<0.05; ** p<0.01; *** p<0.001 (WT vs. L613V/+ or WT vs.
D486N/D486N). # p<0.05; ## p<0.01 (D486N/D486N vs. L613V/+); Bonferroni post-test when
ANOVA is significant.
123
Figure 4-7. NS-associated Raf1 mutants differentially activate Mek/Erk.
(A) Primary WT, D486N/D486N and L613V/+ MEFs were starved for 16 hr, and then
stimulated with EGF, as indicated. Cell lysates were immunoblotted with the indicated
antibodies. The top panel shows a representative blot; quantification of blots from all
experiments (n=4) is shown below. ** p<0.01; *** p<0.001 (D486N/D486N vs. WT); ##
p<0.01; ### p<0.001 (L613V/+ vs. WT); Bonferroni post-test when ANOVA is significant. (B)
Mek activation in heart tissues. Lysates from WT (n=7), L613V/+ (n=4) and D486N/D486N
(n=4) hearts were analyzed by immunoblotting with anti-pMek antibodies with Erk2 as a loading
control. Representative samples for each genotype are shown on the left. Each lane represents an
individual animal. Quantification of all samples is shown on the right. *p<0.05 (2-tailed
Student’s t-test).
124
in Mek activation (Figure 4-7B). Although Raf1L613V and Raf1D486N enhanced Mek/Erk
activation in neonatal cardiomyocytes and cardiac fibroblasts, their effects on the response to
various stimuli differed (Figure 4-8). In some cases (e.g., IL-6 and FGF2), Raf1L613V and
Raf1D486N had similar effects on pathway activation, but in many others (e.g., AngII, NRG, EGF,
PDGF), Raf1L613V had a much stronger effect. Both the magnitude and the duration of Mek/Erk
activation were affected differentially by Raf1L613V and Raf1D486N. Such differences likely reflect
important, if sometimes subtle, differences in the regulation of the RAS/ERK pathway in
response to distinct agonists and in different cell types. However, given that Mek inhibitor
treatment reverses HCM in L613V/+ mice (464), these data are consistent with the idea that the
ability of kinase-activating Raf1 mutants to more profoundly enhance Mek/Erk pathway
activation underlies their distinct phenotypic effects (see Discussion).
4.3.5 Kinase-impaired Raf1 mutants enhance Mek/Erk activation by promoting
heterodimerization with Braf
To study the biochemical properties of RAF1 mutants in a more biochemically tractable
cell system, while avoiding the marked over-expression seen in transient transfection
experiments, we generated stable mammalian Flp-In T-REx 293 (T-REx 293) cell lines. Such
cells allow tetracycline-inducible expression of Flag-tagged WT and mutant RAF1 from the
same genomic locus at levels comparable to endogenous RAF1. As in primary MEFs,
cardiomyocytes and cardiac fibroblasts, expression of RAF1D486N in T-REx 293 cells resulted in
increased MEK/ERK activation, compared with the effects of RAF1WT expression (Figure 4-9A).
Transient transfection studies have shown that RAF1 can form heterodimers with BRAF, that
RAF1/BRAF heterodimers have increased kinase activity compared with the respective
homodimers or monomers, and that a single kinase-competent RAF isoform can confer high
catalytic activity to the heterodimer (168, 298, 302, 303). These findings suggested that
RAF1D486N might enhance MEK/ERK activation by promoting heterodimer formation. To test
this possibility, we immunoprecipitated Flag-tagged RAF1 from induced T-REx 293 cell lysates,
and subjected the immunoprecipitates to immunoblotting with anti-BRAF antibodies. Following
EGF stimulation, low levels of RAF1/BRAF heterodimers were found in WT RAF1-expressing
T- REx 293 cell lysates. By contrast, heterodimerization was enhanced dramatically in
RAF1D486N-expressing cells, even though, as in MEFs, RAF1D486N accumulated to levels
considerably lower than WT RAF1 (Figure 4-9A). Increased heterodimerization was not due to
125
126
Figure 4-8. Severity of cardiac phenotype in D486N/D486N and L613V/+ mice correlates
with Mek/Erk activation.
Quantification of Mek/Erk activation from immunoblots (n=2) of cardiomyocytes (A) and
cardiac fibroblasts (B). Lysates from neonatal WT and D486N/D486N or WT and L613V/+
cells, starved for 24 hr and then stimulated as indicated. Values indicate fold change in Mek/Erk
activity (assessed by immunoblotting with phospho-specific antibodies) in D486N/D486N or
L613V/+ cells, compared with the corresponding WT control at 5 min post-stimulation.
127
defective negative feedback (244), as heterodimerization was increased even when ERK
activation was blocked by MEK inhibitor treatment (Figure 4-9B). These results were confirmed
using primary D486N/+ and D486N/D486N MEFs, despite their markedly lower expression of
Raf1D486N (Figure 4-9C). Furthermore, enhanced ability to form RAF1/BRAF heterodimers was a
common feature of kinase-impaired, NS-associated RAF1 mutants: the T491I and T491R kinase
domain mutants also showed enhanced heterodimerization, and increased and sustained
MEK/ERK activation in EGF-stimualted T-REx 293 cells (Figure 4-10).
4.3.6 Heterodimerization with BRAF is required for RAF1D486N to enhance
MEK/ERK activation
We next asked whether heterodimerization with BRAF is required for enhanced
MEK/ERK activation in these cells. Indeed, infection of T-REx 293 cells expressing RAF1D486N
with a lentivirus expressing BRAF shRNA abolished MEK/ERK hyperactivation in these cells
(Figure 4-11A). Similar experiments were performed on primary D486N/D486N MEFs. Again,
Mek activation and Raf1/Braf heterodimer levels were reduced significantly in Braf knock-down
cells (Figure 4-11B and Figure 4-11C). Surprisingly, Erk activation was not affected, although
this could reflect significant up-regulation of Erk1 protein levels in Braf knock-down MEFs
(Figure 4-11B).
Mammals express three RAF family members, RAF1, BRAF and ARAF (252), all of
which share MEK1/2 as substrates. Co-immunoprecipitation experiments using lysates from
D486N/D486N MEFs showed that Araf also was present in Raf1 immunoprecipitates (Figure 4-
11D). However, Araf knockdown did not reduce Mek activation significantly in these cells,
compared with the marked effects of Braf depletion. Braf knockdown did cause enhanced
Araf/Raf1 heterodimerization, which led us to test whether heterodimerization with Araf helps to
explain persistent Mek/Erk activation in Braf knockdown cells. As expected, combined depletion
of Araf and Braf in these cells further impaired Mek/Erk activation. Taken together, these results
suggest that at least in MEFs, Raf1D486N enhances Mek/Erk activation primarily by promoting
heterodimerization with Braf, but raise the possibility that Araf/Raf1 heterodimers might
contribute to the effects of Raf1D486N in other cell types.
128
129
Figure 4-9. RAF1D486N forms more heterodimers with BRAF.
(A) T-REx 293 cell lines expressing Flag-tagged human RAF1 WT or D486N were incubated
with 1µg/ml Tetracycline for 20 hours in serum-free medium, and then stimulated with EGF for
the indicated times. Heterodimers were detected by immunoprecipitation with anti-Flag
antibody, followed by blotting for endogenous BRAF. MEK and ERK activation in the same
lysates were assessed by immunoblotting. (B) T-REx 293 cell lines expressing Flag-tagged
human RAF1 WT or D486N were incubated with 1µg/ml Tetracycline for 20 hours in serum-
free medium, and then treated with 10µM PD0325901 for 1 hr before stimulation with EGF for
the indicated times. Heterodimers were detected by immunoprecipitation with anti-Flag
antibody, followed by blotting for BRAF. Total cell lysates from the same experiment were
immunoblotted with the indicated antibodies. (C) Primary MEFs from WT, D486N/+ and
D486N/D486N mice were starved for 16 hr, and then stimulated with EGF, as indicated.
Endogenous heterodimers were detected by immunoprecipitation with RAF1 antibody, followed
by blotting for Braf. Mek and Erk activation in the same lysates were assessed by
immunoblotting.
130
Figure 4-10. Kinase-impaired RAF1 mutants associated with NS enhance MEK/ERK
activation and form more RAF1/BRAF heterodimers.
(A) T-REx 293 cell lines expressing Flag-tagged human RAF1 WT, D486N, T491I or T491R
were incubated with 1µg/ml Tetracycline for 20 hours in serum-free medium, and then
stimulated with EGF. Cell lysates from a representative experiment were subjected to
immunoblotting with the indicated antibodies. Quantification of blots from all experiments (n=4)
is shown on the right. *** p<0.001 (WT vs. D486N in blue; WT vs. T491I in red; WT vs. T491R
in green); Bonferroni post-test when ANOVA is significant. (B) T-REx 293 cell lines expressing
Flag-tagged human RAF1 WT or the indicated mutants were incubated with 1µg/ml Tetracycline
for 20 hours in serum-free medium, and then stimulated with EGF. Heterodimers were detected
by immunoprecipitation with anti-Flag antibody, followed by immunoblotting for BRAF. The
same lysates were immunoblotted with the indicated antibodies.
131
132
Figure 4-11. BRAF is required for RAF1D486N to enhance MEK/ERK activation.
(A) T-REx 293 cell lines expressing Flag-tagged human WT or D486N mutant RAF1 were
infected with a lentivirus expressing BRAF shRNA (BRAF-KD) or a control (Luciferase) shRNA
(shluc). At 48 hours post-puromycin selection, cells were incubated with 1µg/ml Tetracycline for
20 hours in serum-free medium, and then stimulated with EGF. Cell lysates were immunoblotted
with the indicated antibodies. A representative experiment is shown at the left, and blots from all
experiments (n=3) are quantified on the right. * p<0.05; ** p<0.01; *** p<0.001 (WT-shluc vs.
D486N-shluc); ### p<0.001 (D486N-shluc vs. D486N-BRAF-KD); Bonferroni post-test when
ANOVA is significant. (B) Primary MEFs from D486N/D486N mice were infected with a
lentivirus expressing Braf shRNA (Braf-KD) or a control shRNA (shluc). Cell lysates were
immunoblotted with the indicated antibodies. A representative blot is shown on the top (arrow
indicates position of Erk1). Quantification of blots from all experiments (n=4) for Mek activation
is shown at the bottom. *** p<0.001; Bonferroni post-test when ANOVA is significant. (C)
Primary WT and D486N/D486N MEFs were infected with a lentivirus expressing Braf shRNA
(Braf-KD) or a control shRNA (shluc). Heterodimers were detected by immunoprecipitation with
RAF1 antibody, followed by immunoblotting for BRaf. Total cell lysates were immunoblotted
with the indicated antibodies. (D) Primary D486N/D486N MEFs were infected with lentiviruses
expressing shRNAs against Braf (Braf-KD) and/or Araf (Araf-KD) or a control shRNA (shluc).
Heterodimers were detected by immunoprecipitations with RAF1 antibody, followed by blotting
for Braf or Araf. Total cell lysates also were immunoblotted with the indicated antibodies.
133
Although these experiments showed that Braf, and to a lesser extent, Araf, is necessary
for the effects of Raf1D486N, and that these effects correlate with the ability of this mutant to
increase heterodimerization, they did not establish a causal relationship between
heterodimerization and Mek/Erk hyperactivation. Structural studies of Drosophila Raf (299)
showed that Arg 481 (Arg401 in RAF1 and Arg509 in BRAF) is at the center of a side-to-side
RAF dimer interface, and directly participates in these interactions (Figure 4-12A). As in
Drosophila Raf, introduction of the R401H mutation into WT RAF1 or RAF1D486N abolished
RAF1/BRAF heterodimerization (Figure 4-12B). Moreover, the compound R401H/D486N
mutant no longer enhanced EGF-evoked MEK/ERK activation (Figure 4-12C). Similar results
were obtained when we tested another mutation (F408A) within the dimer interface (Figure 4-
12A and Figure 4-12D). Furthermore, re-expression of Myc-tagged WT Braf in Braf knock-
down D486N/D486N MEFs restored Mek and Erk activation, whereas BrafR509H could not
rescue (Figure 4-12E).
Finally, to test unambiguously the effects of dimerization per se (as opposed to other,
unanticipated structural consequences of dimer-interface mutants), we asked if forced
heterodimerization could restore the ability of RAF1R401H/D486N to promote MEK/ERK
activation. We fused Flag-RAF1R401H/D486N, which cannot form heterodimers with BRAF, to
FKBP, while FRB was fused to BRAF (Figure 4-13A). Upon co-transfection, these two proteins
can heterodimerize only upon addition of a rapamycin analog (A/C heterodimerizer).
Remarkably, MEK and ERK activation were restored upon A/C heterodimerizer addition (Figure
4-13B); importantly, the heterodimerizer itself had no effect (Figure 4-13C). Taken together,
these results show that heterodimerization with BRAF is necessary and sufficient for the NS-
associated RAF1D486N mutant to enhance MEK/ERK activation.
Surprisingly, we also noticed that the kinase-activating mutant RAF1L613V also formed
more RAF1/BRAF heterodimers in response to growth factor stimulation (Figure 4-12B and
Figure 4-14A) and, as for the kinase-defective Raf1 alleles, knock-down of Braf in primary
MEFs expressing Raf1L613V significantly reduced Mek activation in these cells (data not
shown). Moreover, the compound L613V and dimer mutant (R401H) abolished RAF1/BRAF
heterodimerization and no longer caused enhanced MEK/ERK activation (Figure 4-12B and
134
135
Figure 4-12. Heterodimerization with BRAF is required for RAF1D486N mutant to enhance
MEK/ERK activation.
(A) Side-to-side dimer interface in Drosophila Raf (299). One protomer is displayed as a surface
representation in orange, while the other is shown as a ribbon representation in violet. The inset
shows a close-up of hydrogen bonding interactions involving R481 and F488 (R401 and F408 in
human RAF1). (B) T-REx 293 cell lines expressing Flag-tagged human RAF1 WT or the
indicated mutants were incubated with 1µg/ml Tetracycline for 20 hours in serum-free medium,
and then either left unstimulated (-) or stimulated with EGF for 5 min (+). Heterodimers were
detected by immunoprecipitation with anti-Flag antibody, followed by immunoblotting with
BRAF antibodies. Total cell lysates also were immunoblotted with the indicated antibodies. (C)
T-REx 293 cell lines expressing Flag-tagged human RAF1 WT or the indicated mutants were
incubated with 1µg/ml Tetracycline for 20 hours in serum-free medium, and then stimulated with
EGF for the times indicated. Cell lysates were immunoblotted with the indicated antibodies. A
representative immunoblot is shown, and quantification of the blots from all experiments (n=4) is
shown at the bottom. * p<0.05; ** p<0.01; *** p<0.001 (WT vs. D486N). ### p<0.001
(R401H/D486N vs. WT); Bonferroni post-test when ANOVA is significant. (D) T-REx 293 cell
lines expressing Flag-tagged human RAF1 WT, D486N and/or F408A were incubated with
1µg/ml Tetracycline for 20 hours in serum-free medium, and then stimulated with EGF for the
times indicated. Cell lysates were immunoblotted with the indicated antibodies. (E) Immortalized
D486N/D486N MEFs were infected with a lentivirus expressing Braf shRNA. At 72 hours post-
puromycin selection, cells were infected with MCSV-based retroviruses expressing GFP alone or
GFP plus myc-BRAFWT or myc-BRAFR509H. GFP+ cells, obtained by FACS, were serum-starved
for 16 hours, and then stimulated with EGF. Cell lysates were immunoblotted with the indicated
antibodies.
136
Figure 4-13. Induced RAF1/BRAF heterodimerization restores activity of RAF1R401H/D486N
mutant to enhance MEK/ERK activation.
(A) RAF1R401H/D486N and BRAF coding sequences were sub-cloned into FKBP or PRB expression
vectors, respectively, as shown. (B) T-REx 293 cells were co-transfected with Flag-
RAF1R401H/D486N-FKBP and BRAF-FRB-HA expression plasmids for 24 hours, and then left
untreated (0h), or treated with A/C heterodimerizer (500nM) for the indicated times. Cell lysates
were immunoblotted with the indicated antibodies. (C) T-REx 293 host cells were co-transfected
with Flag-RAF1D486N or Flag-RAF1R401H/D486N and Myc-BRAF expression plasmids, and 24 hours
later were left untreated (-), or treated with A/C heterodimerizer (500nM) (+) for 30 min. Cell
lysates were immunoblotted with the indicated antibodies.
137
Figure 4-14. RAF1L613V mutant enhances MEK/ERK activation via RAF1/BRAF
heterodimer formation.
(A) Primary WT, L613V/+ and L613V/L613V MEFs were starved for 16 hr, and then stimulated
with EGF for the indicated times. Endogenous heterodimers were detected by
immunoprecipitation with RAF1 antibody, followed by blotting for Braf. Total cell lysates from
the same experiments were immunoblotted with the indicated antibodies. (B) T-REx 293 cell
lines expressing Flag-RAF1 WT, L613V or R401H/L613V were incubated with 1µg/ml
Tetracycline for 20 hours in serum-free medium, and then stimulated with EGF for the times
indicated. MEK and ERK activation were assessed by immunoblotting with the indicated
antibodies. A representative immunoblot is shown, and quantification of the blots from all
experiments (n=3) is shown on the right. * p<0.05; *** p<0.001 (WT vs. L613V). ## p<0.01;
### p<0.001 (R401H/L613V vs. WT); Bonferroni post-test when ANOVA is significant.
138
Figure 4-14B). These data provide an explanation for the ability of this class of kinase-activated
alleles to promote MEK/ERK hyper-activation.
4.4 Discussion
We generated and analyzed a knock-in mouse model for the NS-associated, kinase-
impaired Raf1D486N mutation. Unlike the kinase-activating mutation Raf1L613V (464), which
causes most major features of NS, including proportional short stature, facial dysmorphia,
hematological defects and HCM, Raf1D486N heterozygosity results only in a mild growth defect in
female mice. Raf1D486N homozygous mice (on a 129Sv × C57BL/6 mixed background) exhibit
concentric cardiac hypertrophy (but not HCM) and an incompletely penetrant severe growth
defect that is accompanied by facial dysmorphia, failure to thrive and early death. Detailed
analysis of the mechanism underlying the effects of this Raf1 allele, as well as other kinase-
defective RAF1 mutants, indicate that they paradoxically hyper-activate the RAS/ERK pathway
by promoting heterodimerization with BRAF and, to a lesser extent, ARAF. Finally, we
unexpectedly found that Raf1L613V, whose activation mechanism had remained unclear, also
promotes increased heterodimer formation. Taken together, these data identify increased
heterodimerization capacity as the common theme in the pathogenesis of RAF1 mutant-
associated NS.
The incompletely penetrant growth/facial dysmorphia/viability phenotype of
D486N/D486N mice suggests the existence of modifier gene(s) that vary between the 129Sv and
C57BL/6 strains. Indeed, preliminary mapping studies have identified a 129Sv locus on mouse
chromosome 8 that is strongly linked (LOD score ~15) to the s-D486N/D486N phenotype (see
5.2 Future directions). Like s-D486N/D486N mice, Araf-deficient mice have severe growth
defects, neurological abnormalities and post-natal lethality (234); notably, these phenotypes also
are sensitive to genetic background. The identification of loci that modify Raf1 function could
provide important insights into the regulation of Raf-dependent signaling, and it will be
interesting to see if the same modifier(s) affect the Raf1D486N and Araf mutant phenotypes.
Primary lung fibroblasts prepared from s- and n- D486N/D486N mice show comparable
Mek/Erk activation (data not shown), suggesting that the putative modifier(s) likely acts
downstream of Erk or parallel to the RAS/ERK pathway. Our previous NS mouse models,
Shp2D61G (204) and Raf1L613V (464), also show strain-specific differences in phenotype.
139
However, different modifiers are likely to be involved, because increasing C57BL/6 content
causes lethality in these two mouse models. Given the marked genetic heterogeneity of the
human population, and the differences in penetrance of RASopathy phenotypes within a single
affected family, not to mention between unrelated patients with the same mutant allele, our
mouse models provide excellent opportunities to investigate the relative effects of RASopathy
mutations and genetic background.
Kinase-activating RAF1 mutants are strongly associated with HCM in human NS
patients, a phenotype reproduced by our Raf1L613V mouse model (464). Similarly, D486N/+ mice,
like NS patients with kinase-impaired RAF1 mutations, do not exhibit HCM. Notably, Raf1D486N
homozygosity (which is not seen in humans) results in concentric cardiac hypertrophy that does
not progress to heart failure within one year of observation (Figure 4-2), unlike the eccentric
cardiac hypertrophy seen in L613V/+ mice (464). Biochemical analysis revealed that, in contrast
to initial reports based on transient transfection experiments (149), expression of kinase-impaired
Raf1D486N at normal (endogenous) levels causes sustained and/or enhanced Mek/Erk activation in
multiple cell types in response to a variety of stimuli. In order to transmit signals downstream,
RAF proteins must assemble into multi-protein complexes (252). Presumably, the substantial
over-expression that occurs in transiently transfected cells results in artifactual dominant
negative effects of kinase-deficient RAF1 mutants that are not seen when these proteins are
expressed at appropriate, endogenous levels. Importantly, however, Raf1D486N is less potent than
Raf1L613V in enhancing Mek/Erk activation in response to most stimuli, both in cardiomyocytes
and in cardiac fibroblasts (Figure 4-8). Furthermore, Raf1L613V generally increases the magnitude
of Mek/Erk activation, whereas Raf1D486N most often prolongs signal duration. Given our
previous finding that HCM can be prevented or reversed by MEK inhibitor treatment of
Raf1L613V/+ mice, these data strongly suggest that differences in the ability of the D486N and
L613V mutants (and by inference, between kinase-impaired and kinase-activated RAF1 in
general) to promote Mek/Erk activation in the heart explains their distinct cardiac phenotypes. If
so, then agonists that show differential effects on Mek/Erk pathway activation in Raf1L613V/+ and
Raf1D486N/D486N cardiomyocytes (e.g., AngII, NRG, but not IL6) and/or cardiac fibroblasts (e.g.,
EGF, IGF, PDGF, but not FGF2) might be particularly important for cardiac hypertrophy in NS.
Raf1D486N accumulates to much lower levels than Raf1L613V, consistent with a previous report
that kinase activity is required to prevent Raf1 degradation (297). Consequently, we cannot
140
ascertain whether lower levels of the Raf1D486N protein or its lower kinase activity accounts for
the decreased Mek/Erk hyperactivation seen in D486N/D486N, compared with L613V/+, mice
(also, see below).
The carboxyl oxygen of the highly conserved aspartic acid 486 (the “D” of the DFG
motif) plays a critical role in chelating Mg2+ and stabilizing ATP binding in the active site of
protein kinases (468). Mutation of this residue to alanine creates a kinase-inactive protein (297),
whereas mutation to asparagine severely impairs (but does not eliminate) activity (149). All RAF
family members require phosphorylation of key activation loop residues for maximal kinase
activation (244, 469), and T491 is one of these residues. As expected, NS-associated mutants
affecting T491 also show impaired kinase activity (149).
Our results clearly establish how all such mutants (D486N, T491I and T491R) enhance
downstream MEK/ERK activation. Previous studies showed that RAF1/BRAF
heterodimerization occurs during normal growth factor signaling, and indicated that
heterodimers have increased catalytic activity compared with homodimers or monomers (298).
Although some have argued that RAF1 inhibits BRAF activation in a kinase domain-dependent
fashion (470), other studies reported that human cancer-associated BRAF mutants with impaired
kinase activity promote MEK activation by binding to and trans-activating RAF1 (167, 168). Of
note, these kinase-impaired mutations alter the activation segment of BRAF, and some (D594G
and T599I) are analogous to NS-associated RAF1 mutants (471, 472). Marais and colleagues
recently reported that mice with a conditional kinase-dead Braf (BrafLSL-D594A) allele, when
combined with oncogenic Ras (KrasG12D), induced melanomas in mice. In tumor cells from these
mice, BrafD594A was bound to Raf1 constitutively (303). By analogy, we suspected that kinase-
impaired, NS-associated RAF1 mutants hyperactivated MEK/ERK by promoting
heterodimerization with BRAF. Indeed, we found that all of the kinase-impaired RAF1 mutants
form more heterodimers with BRAF upon growth factor stimulation (Figure 4-9 and Figure
4-10). Furthermore, the level of MEK/ERK hyperactivation depends on the level of RAF1/BRAF
heterodimerization, as RAF1T491I and RAF1T491R formed more heterodimers and caused more
MEK/ERK activation than did RAF1D486N (Figure 4-10).
Several subsequent lines of evidence establish a causal relationship between
heterodimerization and MEK/ERK activation. First, knockdown of BRAF in T-REx293 cells
141
expressing Flag-RAF1D486N reduces MEK/ERK activation. Braf knockdown in primary
D486N/D486N MEFs also impairs Mek activation, although Erk activation is unaffected (Figure
4-11B). This difference might be more apparent than real, however, as total Erk1 levels are
increased in Braf-knockdown MEFs, suggesting potential compensation during the selection of
stable knockdown clones. Such feedback regulation presumably is impaired (or less effective) in
T-REx 293 cells. Second, mutation of either of two key residues (R401H, F408A) in the dimer
interface of the RAF1 kinase domain, as revealed by the crystal structures of BRAF (167) and
Drosophila Raf (299), abolishes the ability of RAF1D486N to enhance EGF-evoked MEK/ERK
activation (Figure 4-12). Most compellingly, forced heterodimerization of Raf1D486N/R401H and
BRAF by means of an inducible FKBP-FRB interaction system restored the ability of
Raf1D486N/R401H to enhance EGF-evoked MEK/ERK hyperactivation (Figure 4-13). The latter
result shows unambiguously that Raf1D486N/R401H cannot hyperactivate MEK/ERK
hyperactivation solely because it has lost its ability to promote RAF1/BRAF heterodimerization,
as opposed to some unanticipated effect of the second site R401H mutation on the conformation
of the D486N mutant. Taken together, our results demonstrate that heterodimerization with
BRAF is necessary and sufficient for such mutants to enhance MEK/ERK activation. Although
our knockdown studies show that RAF1D486N enhances MEK/ERK activation (at least in MEFs
and T-REx 293 cells) mainly through heterodimerization and transactivation of BRAF, we also
find that kinase-defective RAF1 mutants can heterodimerize with ARAF. Consequently, we do
not exclude the possibility that RAF1/ARAF heterodimers play an important role in the
pathogenesis of NS caused by kinase-defective RAF1 alleles in tissues where ARAF is a major
isoform (e.g., the brain).
Another cluster of NS-associated RAF1 mutations maps to the C-terminus (S612 and
L613) of RAF1. Like NS-associated CR2 domain mutants, these mutants have increased kinase
activity (149), even though S612 and L613 lie distal to the RAF1 kinase domain. Previous
studies have not implicated these residues in RAF1 regulation, so it has been unclear how such
mutations enhance kinase activity. Moreover, phosphorylation of Ser259 (an inhibitory binding
site for 14-3-3), and Ser 621 (149), a 14-3-3 binding site that promotes RAF1 activation (297),
are unaffected in RAF1L613V. We found that, compared with WT RAF1, RAF1L613V also forms
more heterodimers with BRAF upon growth factor stimulation. Moreover, superimposing the
142
dimer interface mutant (R401H) on L613V blocked its ability to enhance MEK/ERK activation
(Figure 4-14).
These data strongly suggest that RAF1L613V also promotes MEK/ERK hyper-activation
via enhanced BRAF heterodimerization ability. As the kinase domain of RAF1L613V is not
altered, and this mutant is expressed at normal levels unlike kinase-deficient RAF1 alleles,
heterodimerization with BRAF presumably results in a greater increase in MEK/ERK activation,
compared with that evoked by kinase-impaired RAF1 alleles. The NS-associated CR2 domain
mutant RAF1S257L and RAF1P261T (98) (data not shown) also forms more heterodimers with
BRAF. Taken together, these results argue that increased ability to heterodimerize with BRAF
(and possibly ARAF) represents a general pathogenic mechanism for NS-associated RAF1
mutations, and suggest that agents that interfere with dimerization might have general utility for
the treatment of RAF1 mutant NS.
143
Chapter 5
Summary and future directions
144
5.1 Summary and Key Findings
NS is one of several autosomal dominant “RASopathies” caused by mutations in
components of the RAS/ERK pathway. Germ line mutations in RAF1 account for ~3-5% of NS,
and unlike other NS alleles, RAF1 mutations that confer increased kinase activity are highly
associated with hypertrophic cardiomyopathy (HCM). Surprisingly, some NS-associated RAF1
mutations show normal or decreased kinase activity. These observations raised the question of
why both kinase-activating and kinase-impaired RAF1 mutants can cause similar diseases, and
how NS-associated RAF1 mutations cause HCM. In this thesis, these issues were addressed by
generating and analyzing two lines of “knock-in” mice that express kinase-activating (L613V)
and impaired (D486N) RAF1 mutants, respectively.
In Chapter 3, I described a knock-in mouse model for NS caused by the kinase-
activating Raf1L613V mutation. Similar to mouse models of Ptpn11 mutation-associated NS,
Raf1L613V heterozygosity (L613V/+) causes proportional short stature, facial dysmorphia, and
hematological defects. Unlike phosphatase-activating Ptpn11 alleles, which cause valvuloseptal
abnormalities, L613V/+ mice have normal valvuloseptal development and instead exhibit
eccentric cardiac hypertrophy that decompensates upon pressure overload. Agonist-evoked
Mek/Erk activation is enhanced in multiple cell types without changes in several other signaling
pathways implicated in cardiac hypertrophy/HCM. Remarkably, post-natal MEK inhibition
normalizes the growth, facial and cardiac defects in L613V/+ mice, demonstrating that elevated
MEK/ERK activity is critical for causing HCM and other NS phenotypes and identifying MEK
inhibitors as potential therapeutic agents for the treatment of NS.
Whether kinase-defective Raf1 alleles also faithfully model human NS, and if so, how
kinase-activating and kinase-defective mutants can cause similar phenotypes, remained to be
resolved. In Chapter 4, I generated and analyzed knock-in mice expressing the kinase-impaired
NS mutant Raf1D486N, and also re-examined the effects of various other NS mutants expressed at
more physiological levels than in previous transient transfection studies. Unlike the kinase-
activating mutation Raf1L613V, which causes most major features of NS, Raf1D486N heterozygosity
results in only a mild growth defect in female mice. Raf1D486N homozygous mice (on a 129Sv ×
C57BL/6 mixed background) exhibit concentric cardiac hypertrophy (but not HCM) and an
145
incompletely penetrant severe growth defect that is accompanied by facial dysmorphia, failure to
thrive and early death. Detailed analysis of the mechanism underlying the effects of this Raf1
allele, as well as other kinase-defective RAF1 mutants, indicate that they paradoxically hyper-
activate the RAS/ERK pathway by promoting heterodimerization with BRAF and, to a lesser
extent, ARAF. Finally, I unexpectedly found that Raf1L613V also promotes increased heterodimer
formation. Taken together, these data identify increased heterodimerization capacity as the
common theme in the pathogenesis of RAF1 mutant-associated NS.
5.2 Future Directions
5.2.1 Optimizing therapy for NS-associated HCM
RASopathies are rare, “orphan diseases”, so extensive pre-clinical evaluations are needed
to prioritize potential therapeutic approaches for these patients. Post-natal therapy for 6 weeks
with the MEK inhibitor PD0325901 (PD) rescues all NS phenotypes, including HCM, in
L613V/+ mice (Figure 3-17, Figure 3-19 and Figure 3-20; (464)). Whether the dose used for our
initial experiments (5mg/kg BW/day) is optimal is uncertain, nor is it clear whether HCM recurs
upon drug withdrawal. Furthermore, obesity was an unanticipated side effect of PD treatment.
Therefore, it is worthy to perform more extensive pre-clinical studies with PD treatment on our
NS mouse models, to ask whether its body mass effects are on- or off-target by testing a
structurally unrelated MEK inhibitor, and to test whether other agents can be used for L613V/+
HCM.
Our initial MEK inhibitor treatment studies were done with PD at 5mg/kg BW/day, a
dose below that used in most mouse xenograft tumor models of this agent for cancer therapy
(453). In humans, PD has side effects such as skin rash, diarrhea, fatigue, nausea, and visual
disturbances (473, 474) that may be tolerable for treatment of patients with advanced cancers,
but not for a developmental disorder such as NS, particularly if long term, continuous treatment
is required. Although we did not observe severe side effects except weight gain in our original
study, we would nevertheless like to use the lowest effective dose in patients. Therefore, I
performed a lower dose MEK inhibitor treatment (3mg/kg BW/day PD) in our L613V/+ NS
mouse model, beginning at 4 weeks of age and continuing for 6 weeks, as in our original study
(464). Mice were weighed and measured weekly. At the end of the treatment period, the hearts of
146
these mice were analyzed by echocardiography. The results showed that the lower dose of MEK
inhibitor could still rescue the growth defect in L613V/+ mice (Figure 5-1A), although it takes
longer for L613V/+ mice to catch up with the WT controls (Figure 3-17). The increased body
mass effect also was reduced by decreasing the dose of PD (Figure 5-1B). However, at this dose,
MEK inhibitor treatment could not rescue the cardiac hypertrophy, nor the chamber dilatation of
the hearts (Figure 5-1C, D and E). Interestingly, MEK inhibitor treatment did caused a mild but
significant increase in LVIDs (Figure 5-1F), which is consistent with a decrease in FS and EF in
L613V/+ mice after treatment (Figure 5-2). However, other parameters of cardiac function (SV
and CO) did not change upon lower dose MEK inhibitor treatment (Figure 5-2). These data
suggest that there may be a different threshold of the level of Mek/Erk activation for causing the
growth defects and HCM in NS, and/or that an off-target effect of PD might contribute to the
rescue of HCM. Either way, we cannot lower the dose of PD in order to fully rescue the HCM in
our L613V/+ NS mouse model.
Future work should investigate whether growth retardation or HCM recur after drug
cessation. In order to test this, the same general design can be used as in our original study (464),
except that body size would be measured continuously post-treatment, and echocardiography
will be performed both at the end of the treatment period and at different time points post-
withdrawal. Another interesting question is whether we can rescue NS phenotypes in adult mice
(e.g., starting treatment at 10 weeks of age or later) instead of treating the mice at puberty as in
our original study (464) by MEK inhibitor treatment. All of these findings would provide
important guidelines for potential clinical treatment of NS patients with MEK inhibitors.
Finally, PD treatment causes a rapid and significant increase in body mass/body fat, an
obviously undesirable side effect. This could be an on-target effect of Mek-inhibition; notably,
deletion of Ptpn11 in the forebrain causes marked obesity (461), and Shp2, of course, is a major
regulator of Erk activation. Alternatively, it could be an idiosyncratic effect of PD. To
distinguish between these possibilities, we can perform similar studies to those described above
using the structurally unrelated MEK inhibitors, such as the compound ARRY162, which is
available commercially.
147
148
Figure 5-1. Lower dose MEK inhibitor treatment rescues growth defect, but not cardiac
hypertrophy and chamber dilatation in L613V/+ mice.
Mice were injected IP daily with PD0325901 (PD; 3mg/kg) or vehicle, starting at 4 weeks of age
and for the succeeding 6 weeks. Body length (A) and body weight (B) were measured weekly. #
p<0.05, ### p<0.0001, two-way repeated-measures ANOVA; * p<0.05, Bonferroni post-test
when ANOVA was significant (black symbols, WT PD vs. WT control; red symbols, L613V/+
PD vs. L613V/+ control). (C) Heart weight/body weight (HW/BW) ratio, (D) LVPWd and (E)
LVIDd were not restored to within normal limits in lower dose MEK inhibitor-treated mice. (F)
LVIDs increased after MEK inhibitor treatment. LVPWd, LVIDd and LVIDs were also
normalized by BW1/3. ns, not significant. # p<0.05, ## p<0.005 1-tailed Student’s t test; *
p<0.05, ** p<0.005, *** p<0.0001, Bonferroni post-test when ANOVA was significant. n= 9
(WT); 10 (WT PD); 10 (L613V/+); 11 (L613V/+ PD).
149
Figure 5-2. Lower dose MEK inhibitor treatment partially normalizes cardiac function in
L613V/+ mice.
Echocardiographic parameters at 4 month of age. ns, not significant. * p<0.05, ** p<0.005, ***
p<0.0001, Bonferroni post-test when ANOVA was significant. n= 9 (WT); 10 (WT PD); 10
(L613V/+); 11 (L613V/+ PD).
150
Although PD treatment reverses all of the phenotypes in Raf1 mutant NS, no MEK
inhibitor is approved for use in children (or adults); therefore, it would be difficult to bring MEK
inhibitor therapy to the clinic quickly. Besides increased Mek/Erk activation, S6 phosphorylation
also is enhanced in Raf1 mutant NS (Figure 5-3). S6 can be a downstream target of the Erk target
Rsk (107); although p70S6K activation (and presumably mTorc1 activity) is normal in these
mice (Figure 3-16), reducing mTorc1 activity with Rapamycin might be effective for Raf1
mutant HCM. Rapamycin is approved for the pediatric population, and could be tested in NS
patients with HCM more rapidly than a MEK inhibitor. In order to test this hypothesis, the same
general design was used as in our original MEK inhibitor treatment study (464), and Rapamycin
(2 mg/kg BW/day), a dose that reverses HCM in LS mice (404), was used to treat L613V/+ mice.
Our preliminary data showed that, at this dose, rapamycin treatment caused significant growth
retardation and weight loss in both L613V/+ and WT control mice (Figure 5-4A and B), which
forced us to terminate the treatment. It could not rescue the cardiac hypertrophy after 4 weeks of
treatment (Figure 5-4C). These data suggest that excess S6 phosphorylation is not a major part of
HCM pathogenesis in NS. Alternatively, many Erk-dependent pathways might have to be
reversed to ameliorate Raf1 mutant HCM.
5.2.2 Downstream target(s) of the RAS/ERK signaling in NS and HCM
Many pathways are implicated in HCM pathogenesis (Figure 1-14), in addtition to the
RAS/ERK pathway demonstrated by our studies, yet the key targets of excessive Erk activation
in HCM pathogenesis remain to be determined. Specific transcription factors can mediate cardiac
hypertrophy. For example, Gata4 activates hypertrophy-associated genes and causes
cardiomyopathy, in part via Nfat family members, themselves key transducers of the
hypertrophic response (392). Gata4 interacts with Nfat2 and Nfat3 to strengthen DNA binding,
thereby synergistically activating endothelin-1 (475) and BNP (476) transcription. Notably,
Gata4 is an Erk1/2 target (419, 477). Therefore, these transcription factors are attractive
candidates for mediating the hypertrophic effects of NS-associated Raf1. To test the possible
involvement of Gata4 in Raf1 mutant HCM, we can assess phosphorylation at its Erk site, S105,
by immunoblotting. We also can cross L613V/+ mice to knock-in mice expressing Gata4S105A,
which lack the Erk-dependent phosphorylation site, and assess whether HCM can be attenuated
in these mice.
151
Figure 5-3. Increased pS6 (S235/236) in cardiomyocytes and cardiac fibroblasts from
L613V/+ mice.
(A) Neonatal cardiomyocytes were starved for 24 hr, and then stimulated as indicated with AngII
or IL-6. (B) Neonatal cardiac fibroblasts were starved for 16 hr, and then stimulated as indicated
with EGF or IGF-I. ERK2 serves as a loading control.
152
Figure 5-4. Rapamycin treatment does not rescue growth defect and cardiac hypertrophy
in L613V/+ mice.
Mice were injected IP daily with Rapamycin (Rapa; 2mg/kg) or vehicle, starting at 4 weeks of
age and for the succeeding 4 weeks. Body length (A) and body weight (B) were measured
weekly. # p<0.05, ### p<0.0001, two-way repeated-measures ANOVA; * p<0.05, ** p<0.005,
*** p<0.0001, Bonferroni post-test when ANOVA was significant (black symbols, WT Rapa vs.
WT control; red symbols, L613V/+ Rapa vs. L613V/+ control). (C) Heart weight/body weight
(HW/BW) ratio was measured by the end of treatment. ns, not significant. *** p<0.0001,
Bonferroni post-test when ANOVA was significant. n= 11 (WT); 10 (WT Rapa); 13 (L613V/+);
12 (L613V/+ Rapa).
153
5.2.3 Cell(s)-of-origin for Raf1 mutant-induced HCM
Global Raf1L613V expression causes eccentric cardiac hypertrophy with enhanced cardiac
contractility and cardiac fetal gene re-expression (464). Under basal conditions, fibrosis is
minimal, but TAC causes massive fibrosis in L613V/+ hearts and functional decompensation.
Recent Langendorf preparations (data not shown) reveal increased contractility in the L613V/+
heart, indicating a cardiac-intrinsic process, but the detailed physiological effects of mutant Raf1
at the single cell level are unclear. Furthermore, both cardiomyocytes (CM) and cardiac
fibroblasts (CF) from L613V/+ mice show increased Mek/Erk activation in response to multiple
agonists, including growth factors, cytokines, and GPCR agonists (464), so either cell type might
contribute to HCM pathogenesis in NS. Indeed, CF are found throughout the heart and account
for up to two-thirds of the cells in adult hearts (478). Moreover, recent studies indicate that CF
play key roles in myocardial development and function (457, 458). Embryonic CF induce
myocyte proliferation (457), whereas adult CF promote myocyte hypertrophy (457) and evoke
pathological hypertrophy and fibrosis in response to disease stimuli (451, 452). Notably,
enhanced Ras/Erk activation in CF is critical for pathological hypertrophy and fibrosis caused by
overexpression of the adrenergic receptor in CM (452). In a neonatal rat cell co-culture model
(479), Ang II stimulates cardiac myocyte hypertrophy via paracrine release of TGF-β1 and
endothelin-1 from CF. Studying the cell(s)-of-origin for RAF1 mutant-induced HCM would
advance our knowledge on the pathogenesis of HCM, and also provide important information for
therapeutic investigations (e.g., drug screening on the relevant cell type).
In order to ask whether CM and/or CF expression of mutant Raf1 is/are important for the
cardiac phenotype in L613V/+ mice, I have begun to induce Raf1L613V expression selectively in
CM or CF by crossing inducible L613Vfl/+ mice with tissue-specific Cre lines, and monitor
effects on basal and pressure overload-induced cardiac hypertrophy. For CM-specific expression,
L613Vfl/+ mice were first crossed to Mlc2v-Cre mice, in which Cre is expressed beginning at
~E9.5 (480, 481), to generate L613Vfl/+:Mlc2vCre/+ mice. The morphology of the
L613Vfl/+:Mlc2vCre/+ and control hearts was analyzed by echocardiography at 10 weeks of age,
at what time L613V/+ mice already have a significant cardiac hypertrophy and chamber
dilatation. However, L613Vfl/+:Mlc2vCre/+ mice did not show the same cardiac phenotypes as
L613V/+ mice. Instead, they exhibited a trend towards, but not a significant, increase in LVPWd
154
Figure 5-5. Cardiomycyte-specific expression of Raf1L613V does not cause significant
cardiac hypertrophy.
LVPWd (A) and LV chamber dimension (B), as measured by echocardiography at 10 weeks of
age. ns, not significant. * p<0.05, Bonferroni post-test when ANOVA was significant. n= 9
(WT); 11 (L613Vfl/+); 9 (Mlc2vCre/+); 11 (L613Vfl/+:Mlc2vCre/+).
155
at 10 weeks of age (Figure 5-5A). There was no chamber dilatation in these mice, although they
showed a significant decrease in LVIDs (Figure 5-5B), which was consistent with a mild
increase in cardiac function (Figure 5-6) and contractility (Figure 5-7). In total,
L613Vfl/+:Mlc2vCre/+ mice showed a mild concentric cardiac hypertrophy instead of the
eccentric cardiac hypertrophy observed in L613V/+ mice. However, we cannot conclude that
CMs are not the only cell-of-origin for the HCM phenotype because our preliminary data showed
that expression of Mlc2v-Cre was not universal in all ventricular CMs at E12.5, although studies
from other groups demonstrate that Mlc2v-Cre efficiently targets the ventricular myocardium
(481, 482). The big variation in the LVPWd measurement (Figure 5-5A) could reflect
differential Mlc2v-Cre expression and Raf1L613V induction within the ventricle. The cardiac
phenotype of these L613Vfl/+:Mlc2vCre/+ mice should be monitored at a later stage (e.g., 4
months of age) to see whether they would progress to more severe cardiac hypertrophy or even
chamber dilatation. Alternatively, another CM-specific Cre line (e.g., α-MHC-MerCreMer (483))
might be needed to determine the contribution of CM in Raf1 mutant-induced HCM.
To date, there is no Cre line for specifically targeting cardiac fibroblasts. However,
several Cre lines targeting the general fibroblast population have been used to study the function
of CF. Considering that studies have shown that CF are heterogeneous (45-49), different CF-
specific Cre lines, such as Cre expressed under the control of fibroblast-specific protein 1
promoter (Fsp1-Cre) (484-486) and the Col1a2 promoter (Col12a-Cre) (487, 488), should be
used to monitor the effects of CF-specific Raf1L613V expression.
There are several potential outcomes to these experiments. HCM might be mediated
entirely via CM or CF; alternatively, both might contribute. In the latter case, CM or CF might
be particularly important for different aspects of the HCM phenotype (e.g., effects on wall
thickness vs. contractility). Our preliminary data above for CM-specific expression of NS-
associated Raf1 mutant suggests that CM might not be the only cell-of-origin for RAF1 mutant-
induced HCM. We strongly suspect that CF will be important (if not required) for the severe
fibrosis post-TAC found in L613V/+ mice, but also expect effects on basal function. If CF-
specific expression of the Raf1 mutant does not cause detectable HCM, it would imply a
complex interaction between CM and CF in HCM pathogenesis. We would then evaluate mice
expressing mutant Raf1 in both cell types by generating compound CF/CM-Cre:L613Vfl/+
156
Figure 5-6. Cardiomycyte-specific expression of Raf1L613V causes mild increase in cardiac
function.
Echocardiographic parameters at 10 weeks of age. ns, not significant. * p<0.05, ** p<0.005,
Bonferroni post-test when ANOVA was significant. n= 9 (WT); 11 (L613Vfl/+); 9
(Mlc2vCre/+); 11 (L613Vfl/+:Mlc2vCre/+).
157
Figure 5-7. Cardiomycyte-specific expression of Raf1L613V causes mild increase in cardiac
contractility.
Cardiac contractility (A) and relaxation (B) of 4-month-old hearts as measured by invasive
hemodynamic analysis. ns, not significant. * p<0.05, Bonferroni post-test when ANOVA was
significant. n= 3 (WT); 3 (L613Vfl/+); 5 (Mlc2vCre/+); 6 (L613Vfl/+:Mlc2vCre/+).
158
mice. In the unlikely event that even the latter does not result in HCM, we would explore the
possibility that other cell types contribute to the HCM phenotype, such as endothelial cells (Tie2-
Cre) (93). Surprisingly, recent preliminary data indicate that L613Vfl/+:Tie2-Cre/+ mice showed
a significant cardiac hypertrophy (data not shown), although whether it was primary or
secondary to valve defects needs to be further investigated.
5.2.4 The roles of specific Erk isoforms in Raf1-induced HCM
I found that post-natal MEK inhibition normalizes the growth, facial and cardiac defects
in L613V/+ mice, indicating that elevated MEK/ERK activity is critical for causing HCM and
other NS phenotypes. To further investigate the role of specific Erks in HCM pathogenesis, I
took a genetic approach by knocking-out Erk1 and/or Erk2 in L613V/+ mice and monitoring
their cardiac phenotypes.
In initial experiments, I analyzed L613V/+:Erk1+/- and L613V/+:Erk1-/- mice (Figure
5-8, Figure 5-9, and Figure 5-10). Remarkably, Erk1 deficiency normalized the increased
contractility in L613V/+ mice, but did not rescue the cardiac hypertrophy. On the other hand,
preliminary data showed that knocking-out one allele of Erk2 in L613V/+ mice could not rescue
the cardiac hypertrophy, and might even cause more severe hypertrophy (Figure 5-11). The
contractility of L613V/+:Erk2+/- hearts needs to be analyzed further.
There are several potential outcomes of these experiments. If reducing Erk2 levels can
rescue cardiac contractility as does Erk1 deficiency, the total Erk activity likely is critical for
inducing cardiac phenotypes in NS, and there may be a different threshold of the level of Erk
activation for regulating cardiac contractility vs. hypertrophy. If knocking-out one allele of Erk2
does not alter the contractility in L613V/+ mice, there is likely to be a specific role for Erk1 in
regulating cardiac contractility, considering that Erk2 levels are higher than Erk1 in both CM and
CF (464, 489). To further investigate the specific roles of Erk1/2 in cardiac contractility vs.
hypertrophy conclusively, complete deletion of Erk2 needs to be carried out. Due to the
embryonic lethality caused by full Erk2 depletion, cardiac-specific depletion of Erk2 by Nkx2.5-
Cre line (490), or knocking-out of Erk2 in the relevant cell type(s), which are the cell(s)-of-
origin for Raf1 mutant-induced HCM, needs to be done. These mouse models with specific
depletion of Erk1 or Erk2, or both, also will help us to investigate the downstream target(s) of
159
Figure 5-8. Reducing Erk1 levels in L613V/+ mice does not rescue the cardiac hypertrophy
and chamber dilatation.
HW/BW ratio (A), LVPWd (B) and LV chamber dimension (C and D) at 4 month of age. ns, not
significant. * p<0.05, ** p<0.005, Bonferroni post-test when ANOVA was significant. n= 12
(WT); 15 (Erk1+/-); 11 (Erk1-/-); 12 (L613V/+); 15 (L613V/+:Erk1+/-); 8 (L613V/+:Erk1-/-).
160
Figure 5-9. Reducing Erk1 levels in L613V/+ mice does not rescue the cardiac function.
Echocardiographic parameters at 4 month of age. ns, not significant. # p<0.05, 1-tailed Student’s
t test; ** p<0.005, *** p<0.0001, Bonferroni post-test when ANOVA was significant. n= 12
(WT); 15 (Erk1+/-); 11 (Erk1-/-); 12 (L613V/+); 15 (L613V/+:Erk1+/-); 8 (L613V/+:Erk1-/-).
161
Figure 5-10. Reducing Erk1 levels in L613V/+ mice rescues the cardiac contractility.
Cardiac contractility (A) and relaxation (B) of 4-month-old hearts as measured by invasive
hemodynamic analysis. ns, not significant. # p<0.05, ## p<0.005, 1-tailed Student’s t test; *
p<0.05, ** p<0.005, *** p<0.0001, Bonferroni post-test when ANOVA was significant. n= 14
(WT); 18 (Erk1+/-); 8 (Erk1-/-); 14 (L613V/+); 13 (L613V/+:Erk1+/-); 6 (L613V/+:Erk1-/-).
162
Figure 5-11. Reducing Erk2 levels in L613V/+ mice does not rescue the cardiac
hypertrophy.
HW/BW ratio at 4 month of age. * p<0.05, *** p<0.0001, Bonferroni post-test when ANOVA
was significant. n= 4 for each genotype.
163
RAS/ERK signaling in the pathogenesis of NS and HCM, and in the regulation of cardiac
contractility vs. hypertrophy.
5.2.5 Genetic modifiers in D486N/D486N mice
The incompletely penetrant growth/facial dysmorphia/viability phenotype of
D486N/D486N mice on a 129Sv × C57BL/6 mixed background suggests the existence of a
modifier gene(s) that vary between the 129Sv and C57BL/6 strains. To screen genetic loci linked
to the s-D486N/D486N phenotypes, genomic DNA from s-D486N/D486N and n-D486N/D486N
mice was collected (Figure 5-12) and subjected to linkage analysis using the Illumina Mouse
Medium Density linkage panel. This panel contains 1449 SNP markers, among which 877 are
informative (different) between 129Sv and C57BL/6 mice. LOD (logarithm of odds) scores were
calculated by R/qtl (491) for mapping quantitative trait loci (QTLs) in experimental populations
derived from inbred lines (Figure 5-13). The trait was also binarized using a cutoff of body
weight at 10g (Figure 5-14 and Figure 5-15).
These preliminary mapping studies identified a 129Sv locus on mouse chromosome 8
that is strongly linked (LOD score ~15 for quantitative trait; LOD score ~9 for binary trait) to the
s-D486N/D486N phenotype (Figure 5-14, Figure 5-15 and Figure 5-16). However, this region
covers more than 30 megabase pairs (Mbps), and contains numerous genes. The Mouse SNP
Query from Mouse Genome Informatics (MGI) reveals that there are hundreds of SNPs, varying
between 129Sv and C57BL/6 strains, within this region, the majority of which are coding-
synonymous or located within introns or non-coding sequences. Most likely, the modifier(s) are
differentially regulated transcriptionally or translationally between 129Sv and C57BL/6 mice.
Further studies need to be performed in order to find the critical genetic modifier(s)
linked to the s-D486N/D486N phenotypes. More genomic DNA samples from s-D486N/D486N
and n-D486N/D486N mice could be collected and thereby increase the sample size of the
screening in order to narrow the region. Alternatively, this can be achieved by genotype
imputation without including more samples. The number of SNPs assessed in Illumina Mouse
Medium Density genotyping panels provides very low genomic coverage. Statistically, it is
therefore more likely for phenotype-associated SNPs to be in linkage disequilibrium (LD) with
164
Figure 5-12. Distributions of the body weight data for all the 56 samples.
165
0
5
10
15
Chromosome
LOD
Sco
re
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 1819 X
Figure 5-13. Genome-wide LOD score plot of the quantitative trait.
Produced by Pingzhao Hu
166
0
2
4
6
8
Chromosome
LOD
Sco
re
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 1819 X
Figure 5-14. Genome-wide LOD score plot of the binary trait.
The trait is binarized using a cutoff of body weight: 10g. Produced by Pingzhao Hu
167
Figure 5-15. LOD score plot of the binary trait on Chromosome 8.
The trait is binarized using a cutoff of body weight: 10g. Black dots indicate the individual SNPs
tested in the analysis.
168
Figure 5-16. Boxplots of body weight for mice with different genotypes.
rs6237645 and rs3662808 are the two SNPs with highest LOD score from the array.
169
causal variants than to be causal themselves (492). Therefore, a list of all SNPs that are in strong
LD with each SNP strongly linked to the s-D486N/D486N phenotype could be generated using
data from the laboratory mouse haplotype map (493). Through this imputation approach, we
could extend the coverage of phenotype-associated SNPs to include a more comprehensive list of
putative functional SNPs. On the other hand, gene expression profiles for the genes coded within
this region could be compared in available databases or be analyzed by qPCR in the relevant
tissues (e.g., pituitary, hypothalamus and liver for growth retardation) between the two mouse
strains. The gene(s) that is(are) strongly down-regulated on the 129/Sv background, could be the
critical genetic modifier(s) linked to the s-D486N/D486N phenotypes.
5.3 Concluding Remarks
In this thesis, I have carried out detailed studies leading to a better understanding of the
molecular pathogenesis of NS-associated RAF1 mutations. Using knock-in mouse models and a
variety of biochemical and molecular biology approaches, I have demonstrated that elevated
MEK/ERK activation is critical for causing HCM and other NS phenotypes. My work also
indicates that increased BRAF heterodimerization is the common theme in the pathogenesis of
NS-associated RAF1 mutations. The role of RAS/ERK signaling in regulating pathological
cardiac hypertrophy revealed in this study resolves a prior controversy in the field. I further
identified MEK inhibitors as potential therapeutic agents for the treatment of RAF1 mutant-
associated NS. In comparison with other RASopathy mouse models, I propose that different
RASopathies lead to distinct alterations in signaling, and a personalized, mutant gene-specific
strategy may be needed for treating the RASopathies. Further studies are required to clarify the
cell(s)-of-origin underlying HCM in NS, the role of specific Erk family members and modifier
gene(s) in Raf1 mutant NS.
170
References
1. Dhillon, A.S., Hagan, S., Rath, O., and Kolch, W. 2007. MAP kinase signalling pathways in cancer. Oncogene 26:3279-3290.
2. Schaeffer, H.J., and Weber, M.J. 1999. Mitogen-activated protein kinases: specific messages from ubiquitous messengers. Mol Cell Biol 19:2435-2444.
3. Chen, Z., Gibson, T.B., Robinson, F., Silvestro, L., Pearson, G., Xu, B., Wright, A., Vanderbilt, C., and Cobb, M.H. 2001. MAP kinases. Chem Rev 101:2449-2476.
4. Krens, S.F., Spaink, H.P., and Snaar-Jagalska, B.E. 2006. Functions of the MAPK family in vertebrate-development. FEBS Lett 580:4984-4990.
5. Kyriakis, J.M., and Avruch, J. 2001. Mammalian mitogen-activated protein kinase signal transduction pathways activated by stress and inflammation. Physiol Rev 81:807-869.
6. Kant, S., Schumacher, S., Singh, M.K., Kispert, A., Kotlyarov, A., and Gaestel, M. 2006. Characterization of the atypical MAPK ERK4 and its activation of the MAPK-activated protein kinase MK5. J Biol Chem 281:35511-35519.
7. Kasler, H.G., Victoria, J., Duramad, O., and Winoto, A. 2000. ERK5 is a novel type of mitogen-activated protein kinase containing a transcriptional activation domain. Mol Cell Biol 20:8382-8389.
8. Kuo, W.L., Duke, C.J., Abe, M.K., Kaplan, E.L., Gomes, S., and Rosner, M.R. 2004. ERK7 expression and kinase activity is regulated by the ubiquitin-proteosome pathway. J Biol Chem 279:23073-23081.
9. Abe, M.K., Saelzler, M.P., Espinosa, R., 3rd, Kahle, K.T., Hershenson, M.B., Le Beau, M.M., and Rosner, M.R. 2002. ERK8, a new member of the mitogen-activated protein kinase family. J Biol Chem 277:16733-16743.
10. Abe, M.K., Kuo, W.L., Hershenson, M.B., and Rosner, M.R. 1999. Extracellular signal-regulated kinase 7 (ERK7), a novel ERK with a C-terminal domain that regulates its activity, its cellular localization, and cell growth. Mol Cell Biol 19:1301-1312.
11. Abe, M.K., Kahle, K.T., Saelzler, M.P., Orth, K., Dixon, J.E., and Rosner, M.R. 2001. ERK7 is an autoactivated member of the MAPK family. J Biol Chem 276:21272-21279.
12. Cobb, M.H., and Goldsmith, E.J. 1995. How MAP kinases are regulated. J Biol Chem 270:14843-14846.
13. Roux, P.P., and Blenis, J. 2004. ERK and p38 MAPK-activated protein kinases: a family of protein kinases with diverse biological functions. Microbiol Mol Biol Rev 68:320-344.
171
14. Kyriakis, J.M., Banerjee, P., Nikolakaki, E., Dai, T., Rubie, E.A., Ahmad, M.F., Avruch, J., and Woodgett, J.R. 1994. The stress-activated protein kinase subfamily of c-Jun kinases. Nature 369:156-160.
15. Das, S., Cho, J., Lambertz, I., Kelliher, M.A., Eliopoulos, A.G., Du, K., and Tsichlis, P.N. 2005. Tpl2/cot signals activate ERK, JNK, and NF-kappaB in a cell-type and stimulus-specific manner. J Biol Chem 280:23748-23757.
16. Yujiri, T., Sather, S., Fanger, G.R., and Johnson, G.L. 1998. Role of MEKK1 in cell survival and activation of JNK and ERK pathways defined by targeted gene disruption. Science 282:1911-1914.
17. Dupre, A., Haccard, O., and Jessus, C. 2011. Mos in the oocyte: how to use MAPK independently of growth factors and transcription to control meiotic divisions. J Signal Transduct 2011:350412.
18. Drew, B.A., Burow, M.E., and Beckman, B.S. 2012. MEK5/ERK5 pathway: the first fifteen years. Biochim Biophys Acta 1825:37-48.
19. Weston, C.R., and Davis, R.J. 2002. The JNK signal transduction pathway. Curr Opin Genet Dev 12:14-21.
20. Ip, Y.T., and Davis, R.J. 1998. Signal transduction by the c-Jun N-terminal kinase (JNK)--from inflammation to development. Curr Opin Cell Biol 10:205-219.
21. Raingeaud, J., Gupta, S., Rogers, J.S., Dickens, M., Han, J., Ulevitch, R.J., and Davis, R.J. 1995. Pro-inflammatory cytokines and environmental stress cause p38 mitogen-activated protein kinase activation by dual phosphorylation on tyrosine and threonine. J Biol Chem 270:7420-7426.
22. Zarubin, T., and Han, J. 2005. Activation and signaling of the p38 MAP kinase pathway. Cell Res 15:11-18.
23. Derijard, B., Raingeaud, J., Barrett, T., Wu, I.H., Han, J., Ulevitch, R.J., and Davis, R.J. 1995. Independent human MAP-kinase signal transduction pathways defined by MEK and MKK isoforms. Science 267:682-685.
24. Roskoski, R., Jr. 2012. ERK1/2 MAP kinases: structure, function, and regulation. Pharmacol Res 66:105-143.
25. Rogge, R.D., Karlovich, C.A., and Banerjee, U. 1991. Genetic dissection of a neurodevelopmental pathway: Son of sevenless functions downstream of the sevenless and EGF receptor tyrosine kinases. Cell 64:39-48.
26. Malumbres, M., and Barbacid, M. 2003. RAS oncogenes: the first 30 years. Nat Rev Cancer 3:459-465.
27. Giehl, K. 2005. Oncogenic Ras in tumour progression and metastasis. Biol Chem 386:193-205.
172
28. McCubrey, J.A., Steelman, L.S., Chappell, W.H., Abrams, S.L., Wong, E.W., Chang, F., Lehmann, B., Terrian, D.M., Milella, M., Tafuri, A., et al. 2007. Roles of the Raf/MEK/ERK pathway in cell growth, malignant transformation and drug resistance. Biochim Biophys Acta 1773:1263-1284.
29. Downward, J. 2003. Targeting RAS signalling pathways in cancer therapy. Nat Rev Cancer 3:11-22.
30. Kohno, M., and Pouyssegur, J. 2006. Targeting the ERK signaling pathway in cancer therapy. Ann Med 38:200-211.
31. Bentires-Alj, M., Kontaridis, M.I., and Neel, B.G. 2006. Stops along the RAS pathway in human genetic disease. Nat Med 12:283-285.
32. Tidyman, W.E., and Rauen, K.A. 2009. The RASopathies: developmental syndromes of Ras/MAPK pathway dysregulation. Curr Opin Genet Dev 19:230-236.
33. Vakiani, E., and Solit, D.B. KRAS and BRAF: drug targets and predictive biomarkers. J Pathol 223:219-229.
34. Bos, J.L. 1989. ras oncogenes in human cancer: a review. Cancer Res 49:4682-4689.
35. Davies, H., Bignell, G.R., Cox, C., Stephens, P., Edkins, S., Clegg, S., Teague, J., Woffendin, H., Garnett, M.J., Bottomley, W., et al. 2002. Mutations of the BRAF gene in human cancer. Nature 417:949-954.
36. Garnett, M.J., and Marais, R. 2004. Guilty as charged: B-RAF is a human oncogene. Cancer Cell 6:313-319.
37. Lemmon, M.A., and Schlessinger, J. 2010. Cell signaling by receptor tyrosine kinases. Cell 141:1117-1134.
38. Hubbard, S.R. 2004. Juxtamembrane autoinhibition in receptor tyrosine kinases. Nat Rev Mol Cell Biol 5:464-471.
39. Mol, C.D., Dougan, D.R., Schneider, T.R., Skene, R.J., Kraus, M.L., Scheibe, D.N., Snell, G.P., Zou, H., Sang, B.C., and Wilson, K.P. 2004. Structural basis for the autoinhibition and STI-571 inhibition of c-Kit tyrosine kinase. J Biol Chem 279:31655-31663.
40. Niu, X.L., Peters, K.G., and Kontos, C.D. 2002. Deletion of the carboxyl terminus of Tie2 enhances kinase activity, signaling, and function. Evidence for an autoinhibitory mechanism. J Biol Chem 277:31768-31773.
41. Knowles, P.P., Murray-Rust, J., Kjaer, S., Scott, R.P., Hanrahan, S., Santoro, M., Ibanez, C.F., and McDonald, N.Q. 2006. Structure and chemical inhibition of the RET tyrosine kinase domain. J Biol Chem 281:33577-33587.
173
42. Zhang, X., Gureasko, J., Shen, K., Cole, P.A., and Kuriyan, J. 2006. An allosteric mechanism for activation of the kinase domain of epidermal growth factor receptor. Cell 125:1137-1149.
43. Pawson, T., Gish, G.D., and Nash, P. 2001. SH2 domains, interaction modules and cellular wiring. Trends Cell Biol 11:504-511.
44. Margolis, B., Borg, J.P., Straight, S., and Meyer, D. 1999. The function of PTB domain proteins. Kidney Int 56:1230-1237.
45. Li, N., Batzer, A., Daly, R., Yajnik, V., Skolnik, E., Chardin, P., Bar-Sagi, D., Margolis, B., and Schlessinger, J. 1993. Guanine-nucleotide-releasing factor hSos1 binds to Grb2 and links receptor tyrosine kinases to Ras signalling. Nature 363:85-88.
46. Rojas, M., Yao, S., and Lin, Y.Z. 1996. Controlling epidermal growth factor (EGF)-stimulated Ras activation in intact cells by a cell-permeable peptide mimicking phosphorylated EGF receptor. J Biol Chem 271:27456-27461.
47. Pelicci, G., Lanfrancone, L., Grignani, F., McGlade, J., Cavallo, F., Forni, G., Nicoletti, I., Grignani, F., Pawson, T., and Pelicci, P.G. 1992. A novel transforming protein (SHC) with an SH2 domain is implicated in mitogenic signal transduction. Cell 70:93-104.
48. Suenaga, A., Hatakeyama, M., Kiyatkin, A.B., Radhakrishnan, R., Taiji, M., and Kholodenko, B.N. 2009. Molecular dynamics simulations reveal that Tyr-317 phosphorylation reduces Shc binding affinity for phosphotyrosyl residues of epidermal growth factor receptor. Biophys J 96:2278-2288.
49. Dance, M., Montagner, A., Salles, J.P., Yart, A., and Raynal, P. 2008. The molecular functions of Shp2 in the Ras/Mitogen-activated protein kinase (ERK1/2) pathway. Cell Signal 20:453-459.
50. Vogel, W., and Ullrich, A. 1996. Multiple in vivo phosphorylated tyrosine phosphatase SHP-2 engages binding to Grb2 via tyrosine 584. Cell Growth Differ 7:1589-1597.
51. Li, W., Nishimura, R., Kashishian, A., Batzer, A.G., Kim, W.J., Cooper, J.A., and Schlessinger, J. 1994. A new function for a phosphotyrosine phosphatase: linking GRB2-Sos to a receptor tyrosine kinase. Mol Cell Biol 14:509-517.
52. Bennett, A.M., Tang, T.L., Sugimoto, S., Walsh, C.T., and Neel, B.G. 1994. Protein-tyrosine-phosphatase SHPTP2 couples platelet-derived growth factor receptor beta to Ras. Proc Natl Acad Sci U S A 91:7335-7339.
53. Araki, T., Nawa, H., and Neel, B.G. 2003. Tyrosyl phosphorylation of Shp2 is required for normal ERK activation in response to some, but not all, growth factors. J Biol Chem 278:41677-41684.
54. Tefft, D., Lee, M., Smith, S., Crowe, D.L., Bellusci, S., and Warburton, D. 2002. mSprouty2 inhibits FGF10-activated MAP kinase by differentially binding to upstream target proteins. Am J Physiol Lung Cell Mol Physiol 283:L700-706.
174
55. Hanafusa, H., Torii, S., Yasunaga, T., Matsumoto, K., and Nishida, E. 2004. Shp2, an SH2-containing protein-tyrosine phosphatase, positively regulates receptor tyrosine kinase signaling by dephosphorylating and inactivating the inhibitor Sprouty. J Biol Chem 279:22992-22995.
56. Tefft, D., De Langhe, S.P., Del Moral, P.M., Sala, F., Shi, W., Bellusci, S., and Warburton, D. 2005. A novel function for the protein tyrosine phosphatase Shp2 during lung branching morphogenesis. Dev Biol 282:422-431.
57. Agazie, Y.M., and Hayman, M.J. 2003. Molecular mechanism for a role of SHP2 in epidermal growth factor receptor signaling. Mol Cell Biol 23:7875-7886.
58. Montagner, A., Yart, A., Dance, M., Perret, B., Salles, J.P., and Raynal, P. 2005. A novel role for Gab1 and SHP2 in epidermal growth factor-induced Ras activation. J Biol Chem 280:5350-5360.
59. Ren, Y., Meng, S., Mei, L., Zhao, Z.J., Jove, R., and Wu, J. 2004. Roles of Gab1 and SHP2 in paxillin tyrosine dephosphorylation and Src activation in response to epidermal growth factor. J Biol Chem 279:8497-8505.
60. Zhang, S.Q., Yang, W., Kontaridis, M.I., Bivona, T.G., Wen, G., Araki, T., Luo, J., Thompson, J.A., Schraven, B.L., Philips, M.R., et al. 2004. Shp2 regulates SRC family kinase activity and Ras/Erk activation by controlling Csk recruitment. Mol Cell 13:341-355.
61. Yang, W., Klaman, L.D., Chen, B., Araki, T., Harada, H., Thomas, S.M., George, E.L., and Neel, B.G. 2006. An Shp2/SFK/Ras/Erk signaling pathway controls trophoblast stem cell survival. Dev Cell 10:317-327.
62. Della Rocca, G.J., van Biesen, T., Daaka, Y., Luttrell, D.K., Luttrell, L.M., and Lefkowitz, R.J. 1997. Ras-dependent mitogen-activated protein kinase activation by G protein-coupled receptors. Convergence of Gi- and Gq-mediated pathways on calcium/calmodulin, Pyk2, and Src kinase. J Biol Chem 272:19125-19132.
63. Goldsmith, Z.G., and Dhanasekaran, D.N. 2007. G protein regulation of MAPK networks. Oncogene 26:3122-3142.
64. Kumar, C.C. 1998. Signaling by integrin receptors. Oncogene 17:1365-1373.
65. Shimizu, K., Goldfarb, M., Suard, Y., Perucho, M., Li, Y., Kamata, T., Feramisco, J., Stavnezer, E., Fogh, J., and Wigler, M.H. 1983. Three human transforming genes are related to the viral ras oncogenes. Proc Natl Acad Sci U S A 80:2112-2116.
66. Gorfe, A.A. 2010. Mechanisms of allostery and membrane attachment in Ras GTPases: implications for anti-cancer drug discovery. Curr Med Chem 17:1-9.
67. Rocks, O., Peyker, A., Kahms, M., Verveer, P.J., Koerner, C., Lumbierres, M., Kuhlmann, J., Waldmann, H., Wittinghofer, A., and Bastiaens, P.I. 2005. An acylation
175
cycle regulates localization and activity of palmitoylated Ras isoforms. Science 307:1746-1752.
68. Avruch, J., Zhang, X.F., and Kyriakis, J.M. 1994. Raf meets Ras: completing the framework of a signal transduction pathway. Trends Biochem Sci 19:279-283.
69. Vigil, D., Cherfils, J., Rossman, K.L., and Der, C.J. 2010. Ras superfamily GEFs and GAPs: validated and tractable targets for cancer therapy? Nat Rev Cancer 10:842-857.
70. Alessi, D.R., Saito, Y., Campbell, D.G., Cohen, P., Sithanandam, G., Rapp, U., Ashworth, A., Marshall, C.J., and Cowley, S. 1994. Identification of the sites in MAP kinase kinase-1 phosphorylated by p74raf-1. Embo J 13:1610-1619.
71. Pritchard, C.A., Samuels, M.L., Bosch, E., and McMahon, M. 1995. Conditionally oncogenic forms of the A-Raf and B-Raf protein kinases display different biological and biochemical properties in NIH 3T3 cells. Mol Cell Biol 15:6430-6442.
72. Papin, C., Denouel, A., Calothy, G., and Eychene, A. 1996. Identification of signalling proteins interacting with B-Raf in the yeast two-hybrid system. Oncogene 12:2213-2221.
73. Marais, R., Light, Y., Paterson, H.F., Mason, C.S., and Marshall, C.J. 1997. Differential regulation of Raf-1, A-Raf, and B-Raf by oncogenic ras and tyrosine kinases. J Biol Chem 272:4378-4383.
74. Papin, C., Denouel-Galy, A., Laugier, D., Calothy, G., and Eychene, A. 1998. Modulation of kinase activity and oncogenic properties by alternative splicing reveals a novel regulatory mechanism for B-Raf. J Biol Chem 273:24939-24947.
75. Roskoski, R., Jr. 2012. MEK1/2 dual-specificity protein kinases: structure and regulation. Biochem Biophys Res Commun 417:5-10.
76. Park, E.R., Eblen, S.T., and Catling, A.D. 2007. MEK1 activation by PAK: a novel mechanism. Cell Signal 19:1488-1496.
77. Eblen, S.T., Slack-Davis, J.K., Tarcsafalvi, A., Parsons, J.T., Weber, M.J., and Catling, A.D. 2004. Mitogen-activated protein kinase feedback phosphorylation regulates MEK1 complex formation and activation during cellular adhesion. Mol Cell Biol 24:2308-2317.
78. Gopalbhai, K., Jansen, G., Beauregard, G., Whiteway, M., Dumas, F., Wu, C., and Meloche, S. 2003. Negative regulation of MAPKK by phosphorylation of a conserved serine residue equivalent to Ser212 of MEK1. J Biol Chem 278:8118-8125.
79. Catalanotti, F., Reyes, G., Jesenberger, V., Galabova-Kovacs, G., de Matos Simoes, R., Carugo, O., and Baccarini, M. 2009. A Mek1-Mek2 heterodimer determines the strength and duration of the Erk signal. Nat Struct Mol Biol 16:294-303.
80. Lloyd, A.C. 2006. Distinct functions for ERKs? J Biol 5:13.
176
81. Boulton, T.G., Yancopoulos, G.D., Gregory, J.S., Slaughter, C., Moomaw, C., Hsu, J., and Cobb, M.H. 1990. An insulin-stimulated protein kinase similar to yeast kinases involved in cell cycle control. Science 249:64-67.
82. Boulton, T.G., Nye, S.H., Robbins, D.J., Ip, N.Y., Radziejewska, E., Morgenbesser, S.D., DePinho, R.A., Panayotatos, N., Cobb, M.H., and Yancopoulos, G.D. 1991. ERKs: a family of protein-serine/threonine kinases that are activated and tyrosine phosphorylated in response to insulin and NGF. Cell 65:663-675.
83. Lefloch, R., Pouyssegur, J., and Lenormand, P. 2008. Single and combined silencing of ERK1 and ERK2 reveals their positive contribution to growth signaling depending on their expression levels. Mol Cell Biol 28:511-527.
84. Lefloch, R., Pouyssegur, J., and Lenormand, P. 2009. Total ERK1/2 activity regulates cell proliferation. Cell Cycle 8:705-711.
85. Pages, G., Guerin, S., Grall, D., Bonino, F., Smith, A., Anjuere, F., Auberger, P., and Pouyssegur, J. 1999. Defective thymocyte maturation in p44 MAP kinase (Erk 1) knockout mice. Science 286:1374-1377.
86. Yao, Y., Li, W., Wu, J., Germann, U.A., Su, M.S., Kuida, K., and Boucher, D.M. 2003. Extracellular signal-regulated kinase 2 is necessary for mesoderm differentiation. Proc Natl Acad Sci U S A 100:12759-12764.
87. Hatano, N., Mori, Y., Oh-hora, M., Kosugi, A., Fujikawa, T., Nakai, N., Niwa, H., Miyazaki, J., Hamaoka, T., and Ogata, M. 2003. Essential role for ERK2 mitogen-activated protein kinase in placental development. Genes Cells 8:847-856.
88. Saba-El-Leil, M.K., Vella, F.D., Vernay, B., Voisin, L., Chen, L., Labrecque, N., Ang, S.L., and Meloche, S. 2003. An essential function of the mitogen-activated protein kinase Erk2 in mouse trophoblast development. EMBO Rep 4:964-968.
89. Bost, F., Aouadi, M., Caron, L., Even, P., Belmonte, N., Prot, M., Dani, C., Hofman, P., Pages, G., Pouyssegur, J., et al. 2005. The extracellular signal-regulated kinase isoform ERK1 is specifically required for in vitro and in vivo adipogenesis. Diabetes 54:402-411.
90. Ferrell, J.E., Jr., and Bhatt, R.R. 1997. Mechanistic studies of the dual phosphorylation of mitogen-activated protein kinase. J Biol Chem 272:19008-19016.
91. Tanoue, T., Adachi, M., Moriguchi, T., and Nishida, E. 2000. A conserved docking motif in MAP kinases common to substrates, activators and regulators. Nat Cell Biol 2:110-116.
92. Yoon, S., and Seger, R. 2006. The extracellular signal-regulated kinase: multiple substrates regulate diverse cellular functions. Growth Factors 24:21-44.
93. Northwood, I.C., Gonzalez, F.A., Wartmann, M., Raden, D.L., and Davis, R.J. 1991. Isolation and characterization of two growth factor-stimulated protein kinases that
177
phosphorylate the epidermal growth factor receptor at threonine 669. J Biol Chem 266:15266-15276.
94. Li, X., Huang, Y., Jiang, J., and Frank, S.J. 2008. ERK-dependent threonine phosphorylation of EGF receptor modulates receptor downregulation and signaling. Cell Signal 20:2145-2155.
95. Dong, C., Waters, S.B., Holt, K.H., and Pessin, J.E. 1996. SOS phosphorylation and disassociation of the Grb2-SOS complex by the ERK and JNK signaling pathways. J Biol Chem 271:6328-6332.
96. Kamioka, Y., Yasuda, S., Fujita, Y., Aoki, K., and Matsuda, M. 2010. Multiple decisive phosphorylation sites for the negative feedback regulation of SOS1 via ERK. J Biol Chem 285:33540-33548.
97. Dougherty, M.K., Muller, J., Ritt, D.A., Zhou, M., Zhou, X.Z., Copeland, T.D., Conrads, T.P., Veenstra, T.D., Lu, K.P., and Morrison, D.K. 2005. Regulation of Raf-1 by direct feedback phosphorylation. Mol Cell 17:215-224.
98. Ritt, D.A., Monson, D.M., Specht, S.I., and Morrison, D.K. 2010. Impact of feedback phosphorylation and Raf heterodimerization on normal and mutant B-Raf signaling. Mol Cell Biol 30:806-819.
99. Brondello, J.M., Pouyssegur, J., and McKenzie, F.R. 1999. Reduced MAP kinase phosphatase-1 degradation after p42/p44MAPK-dependent phosphorylation. Science 286:2514-2517.
100. Peng, D.J., Zhou, J.Y., and Wu, G.S. 2010. Post-translational regulation of mitogen-activated protein kinase phosphatase-2 (MKP-2) by ERK. Cell Cycle 9:4650-4655.
101. Waskiewicz, A.J., Flynn, A., Proud, C.G., and Cooper, J.A. 1997. Mitogen-activated protein kinases activate the serine/threonine kinases Mnk1 and Mnk2. Embo J 16:1909-1920.
102. Wendel, H.G., Silva, R.L., Malina, A., Mills, J.R., Zhu, H., Ueda, T., Watanabe-Fukunaga, R., Fukunaga, R., Teruya-Feldstein, J., Pelletier, J., et al. 2007. Dissecting eIF4E action in tumorigenesis. Genes Dev 21:3232-3237.
103. Chen, R.H., Chung, J., and Blenis, J. 1991. Regulation of pp90rsk phosphorylation and S6 phosphotransferase activity in Swiss 3T3 cells by growth factor-, phorbol ester-, and cyclic AMP-mediated signal transduction. Mol Cell Biol 11:1861-1867.
104. Anjum, R., and Blenis, J. 2008. The RSK family of kinases: emerging roles in cellular signalling. Nat Rev Mol Cell Biol 9:747-758.
105. Gavin, A.C., and Nebreda, A.R. 1999. A MAP kinase docking site is required for phosphorylation and activation of p90(rsk)/MAPKAP kinase-1. Curr Biol 9:281-284.
178
106. Carriere, A., Ray, H., Blenis, J., and Roux, P.P. 2008. The RSK factors of activating the Ras/MAPK signaling cascade. Front Biosci 13:4258-4275.
107. Roux, P.P., Shahbazian, D., Vu, H., Holz, M.K., Cohen, M.S., Taunton, J., Sonenberg, N., and Blenis, J. 2007. RAS/ERK signaling promotes site-specific ribosomal protein S6 phosphorylation via RSK and stimulates cap-dependent translation. J Biol Chem 282:14056-14064.
108. Roux, P.P., Ballif, B.A., Anjum, R., Gygi, S.P., and Blenis, J. 2004. Tumor-promoting phorbol esters and activated Ras inactivate the tuberous sclerosis tumor suppressor complex via p90 ribosomal S6 kinase. Proc Natl Acad Sci U S A 101:13489-13494.
109. Carriere, A., Cargnello, M., Julien, L.A., Gao, H., Bonneil, E., Thibault, P., and Roux, P.P. 2008. Oncogenic MAPK signaling stimulates mTORC1 activity by promoting RSK-mediated raptor phosphorylation. Curr Biol 18:1269-1277.
110. Shahbazian, D., Roux, P.P., Mieulet, V., Cohen, M.S., Raught, B., Taunton, J., Hershey, J.W., Blenis, J., Pende, M., and Sonenberg, N. 2006. The mTOR/PI3K and MAPK pathways converge on eIF4B to control its phosphorylation and activity. Embo J 25:2781-2791.
111. Fujita, N., Sato, S., and Tsuruo, T. 2003. Phosphorylation of p27Kip1 at threonine 198 by p90 ribosomal protein S6 kinases promotes its binding to 14-3-3 and cytoplasmic localization. J Biol Chem 278:49254-49260.
112. Frodin, M., and Gammeltoft, S. 1999. Role and regulation of 90 kDa ribosomal S6 kinase (RSK) in signal transduction. Mol Cell Endocrinol 151:65-77.
113. Brunet, A., Roux, D., Lenormand, P., Dowd, S., Keyse, S., and Pouyssegur, J. 1999. Nuclear translocation of p42/p44 mitogen-activated protein kinase is required for growth factor-induced gene expression and cell cycle entry. Embo J 18:664-674.
114. Deak, M., Clifton, A.D., Lucocq, L.M., and Alessi, D.R. 1998. Mitogen- and stress-activated protein kinase-1 (MSK1) is directly activated by MAPK and SAPK2/p38, and may mediate activation of CREB. Embo J 17:4426-4441.
115. Gupta, P., and Prywes, R. 2002. ATF1 phosphorylation by the ERK MAPK pathway is required for epidermal growth factor-induced c-jun expression. J Biol Chem 277:50550-50556.
116. Wiggin, G.R., Soloaga, A., Foster, J.M., Murray-Tait, V., Cohen, P., and Arthur, J.S. 2002. MSK1 and MSK2 are required for the mitogen- and stress-induced phosphorylation of CREB and ATF1 in fibroblasts. Mol Cell Biol 22:2871-2881.
117. Soloaga, A., Thomson, S., Wiggin, G.R., Rampersaud, N., Dyson, M.H., Hazzalin, C.A., Mahadevan, L.C., and Arthur, J.S. 2003. MSK2 and MSK1 mediate the mitogen- and stress-induced phosphorylation of histone H3 and HMG-14. Embo J 22:2788-2797.
179
118. Marais, R., Wynne, J., and Treisman, R. 1993. The SRF accessory protein Elk-1 contains a growth factor-regulated transcriptional activation domain. Cell 73:381-393.
119. Price, M.A., Rogers, A.E., and Treisman, R. 1995. Comparative analysis of the ternary complex factors Elk-1, SAP-1a and SAP-2 (ERP/NET). Embo J 14:2589-2601.
120. Gille, H., Kortenjann, M., Thomae, O., Moomaw, C., Slaughter, C., Cobb, M.H., and Shaw, P.E. 1995. ERK phosphorylation potentiates Elk-1-mediated ternary complex formation and transactivation. Embo J 14:951-962.
121. Pelengaris, S., Khan, M., and Evan, G. 2002. c-MYC: more than just a matter of life and death. Nat Rev Cancer 2:764-776.
122. Sears, R., Nuckolls, F., Haura, E., Taya, Y., Tamai, K., and Nevins, J.R. 2000. Multiple Ras-dependent phosphorylation pathways regulate Myc protein stability. Genes Dev 14:2501-2514.
123. Monje, P., Hernandez-Losa, J., Lyons, R.J., Castellone, M.D., and Gutkind, J.S. 2005. Regulation of the transcriptional activity of c-Fos by ERK. A novel role for the prolyl isomerase PIN1. J Biol Chem 280:35081-35084.
124. Felton-Edkins, Z.A., Fairley, J.A., Graham, E.L., Johnston, I.M., White, R.J., and Scott, P.H. 2003. The mitogen-activated protein (MAP) kinase ERK induces tRNA synthesis by phosphorylating TFIIIB. Embo J 22:2422-2432.
125. Stefanovsky, V.Y., Pelletier, G., Hannan, R., Gagnon-Kugler, T., Rothblum, L.I., and Moss, T. 2001. An immediate response of ribosomal transcription to growth factor stimulation in mammals is mediated by ERK phosphorylation of UBF. Mol Cell 8:1063-1073.
126. Noonan, J.A. 1968. Hypertelorism with Turner phenotype. A new syndrome with associated congenital heart disease. Am J Dis Child 116:373-380.
127. Nora, J.J., Nora, A.H., Sinha, A.K., Spangler, R.D., and Lubs, H.A. 1974. The Ullrich-Noonan syndrome (Turner phenotype). Am J Dis Child 127:48-55.
128. Noonan, J.A. 1994. Noonan syndrome. An update and review for the primary pediatrician. Clin Pediatr (Phila) 33:548-555.
129. Allanson, J.E. 2007. Noonan syndrome. Am J Med Genet C Semin Med Genet 145C:274-279.
130. van der Burgt, I. 2007. Noonan syndrome. Orphanet J Rare Dis 2:4.
131. Romano, A.A., Blethen, S.L., Dana, K., and Noto, R.A. 1996. Growth hormone treatment in Noonan syndrome: the National Cooperative Growth Study experience. J Pediatr 128:S18-21.
180
132. Noordam, C., Van der Burgt, I., Sengers, R.C., Delemarre-van de Waal, H.A., and Otten, B.J. 2001. Growth hormone treatment in children with Noonan's syndrome: four year results of a partly controlled trial. Acta Paediatr 90:889-894.
133. Binder, G., Neuer, K., Ranke, M.B., and Wittekindt, N.E. 2005. PTPN11 mutations are associated with mild growth hormone resistance in individuals with Noonan syndrome. J Clin Endocrinol Metab 90:5377-5381.
134. De Rocca Serra-Nedelec, A., Edouard, T., Treguer, K., Tajan, M., Araki, T., Dance, M., Mus, M., Montagner, A., Tauber, M., Salles, J.P., et al. 2012. Noonan syndrome-causing SHP2 mutants inhibit insulin-like growth factor 1 release via growth hormone-induced ERK hyperactivation, which contributes to short stature. Proc Natl Acad Sci U S A 109:4257-4262.
135. Burch, M., Sharland, M., Shinebourne, E., Smith, G., Patton, M., and McKenna, W. 1993. Cardiologic abnormalities in Noonan syndrome: phenotypic diagnosis and echocardiographic assessment of 118 patients. J Am Coll Cardiol 22:1189-1192.
136. Marino, B., Digilio, M.C., Toscano, A., Giannotti, A., and Dallapiccola, B. 1999. Congenital heart diseases in children with Noonan syndrome: An expanded cardiac spectrum with high prevalence of atrioventricular canal. J Pediatr 135:703-706.
137. Shah, N., Rodriguez, M., Louis, D.S., Lindley, K., and Milla, P.J. 1999. Feeding difficulties and foregut dysmotility in Noonan's syndrome. Arch Dis Child 81:28-31.
138. Cesarini, L., Alfieri, P., Pantaleoni, F., Vasta, I., Cerutti, M., Petrangeli, V., Mariotti, P., Leoni, C., Ricci, D., Vicari, S., et al. 2009. Cognitive profile of disorders associated with dysregulation of the RAS/MAPK signaling cascade. Am J Med Genet A 149A:140-146.
139. Pierpont, E.I., Pierpont, M.E., Mendelsohn, N.J., Roberts, A.E., Tworog-Dube, E., and Seidenberg, M.S. 2009. Genotype differences in cognitive functioning in Noonan syndrome. Genes Brain Behav 8:275-282.
140. Bastida, P., Garcia-Minaur, S., Ezquieta, B., Dapena, J.L., and Sanchez de Toledo, J. 2011. Myeloproliferative disorder in Noonan syndrome. J Pediatr Hematol Oncol 33:e43-45.
141. Niemeyer, C.M., and Kratz, C.P. 2008. Paediatric myelodysplastic syndromes and juvenile myelomonocytic leukaemia: molecular classification and treatment options. Br J Haematol 140:610-624.
142. Kratz, C.P., Niemeyer, C.M., Castleberry, R.P., Cetin, M., Bergstrasser, E., Emanuel, P.D., Hasle, H., Kardos, G., Klein, C., Kojima, S., et al. 2005. The mutational spectrum of PTPN11 in juvenile myelomonocytic leukemia and Noonan syndrome/myeloproliferative disease. Blood 106:2183-2185.
143. Allanson, J.E., Hall, J.G., Hughes, H.E., Preus, M., and Witt, R.D. 1985. Noonan syndrome: the changing phenotype. Am J Med Genet 21:507-514.
181
144. Aoki, Y., Niihori, T., Narumi, Y., Kure, S., and Matsubara, Y. 2008. The RAS/MAPK syndromes: novel roles of the RAS pathway in human genetic disorders. Hum Mutat 29:992-1006.
145. Tartaglia, M., Mehler, E.L., Goldberg, R., Zampino, G., Brunner, H.G., Kremer, H., van der Burgt, I., Crosby, A.H., Ion, A., Jeffery, S., et al. 2001. Mutations in PTPN11, encoding the protein tyrosine phosphatase SHP-2, cause Noonan syndrome. Nat Genet 29:465-468.
146. Roberts, A.E., Araki, T., Swanson, K.D., Montgomery, K.T., Schiripo, T.A., Joshi, V.A., Li, L., Yassin, Y., Tamburino, A.M., Neel, B.G., et al. 2007. Germline gain-of-function mutations in SOS1 cause Noonan syndrome. Nat Genet 39:70-74.
147. Tartaglia, M., Pennacchio, L.A., Zhao, C., Yadav, K.K., Fodale, V., Sarkozy, A., Pandit, B., Oishi, K., Martinelli, S., Schackwitz, W., et al. 2007. Gain-of-function SOS1 mutations cause a distinctive form of Noonan syndrome. Nat Genet 39:75-79.
148. Razzaque, M.A., Nishizawa, T., Komoike, Y., Yagi, H., Furutani, M., Amo, R., Kamisago, M., Momma, K., Katayama, H., Nakagawa, M., et al. 2007. Germline gain-of-function mutations in RAF1 cause Noonan syndrome. Nat Genet 39:1013-1017.
149. Pandit, B., Sarkozy, A., Pennacchio, L.A., Carta, C., Oishi, K., Martinelli, S., Pogna, E.A., Schackwitz, W., Ustaszewska, A., Landstrom, A., et al. 2007. Gain-of-function RAF1 mutations cause Noonan and LEOPARD syndromes with hypertrophic cardiomyopathy. Nat Genet 39:1007-1012.
150. Schubbert, S., Zenker, M., Rowe, S.L., Boll, S., Klein, C., Bollag, G., van der Burgt, I., Musante, L., Kalscheuer, V., Wehner, L.E., et al. 2006. Germline KRAS mutations cause Noonan syndrome. Nat Genet 38:331-336.
151. Zenker, M., Lehmann, K., Schulz, A.L., Barth, H., Hansmann, D., Koenig, R., Korinthenberg, R., Kreiss-Nachtsheim, M., Meinecke, P., Morlot, S., et al. 2007. Expansion of the genotypic and phenotypic spectrum in patients with KRAS germline mutations. J Med Genet 44:131-135.
152. Cirstea, I.C., Kutsche, K., Dvorsky, R., Gremer, L., Carta, C., Horn, D., Roberts, A.E., Lepri, F., Merbitz-Zahradnik, T., Konig, R., et al. 2010. A restricted spectrum of NRAS mutations causes Noonan syndrome. Nat Genet 42:27-29.
153. Sarkozy, A., Carta, C., Moretti, S., Zampino, G., Digilio, M.C., Pantaleoni, F., Scioletti, A.P., Esposito, G., Cordeddu, V., Lepri, F., et al. 2009. Germline BRAF mutations in Noonan, LEOPARD, and cardiofaciocutaneous syndromes: molecular diversity and associated phenotypic spectrum. Hum Mutat 30:695-702.
154. Neel, B.G., Gu, H., and Pao, L. 2003. The 'Shp'ing news: SH2 domain-containing tyrosine phosphatases in cell signaling. Trends Biochem Sci 28:284-293.
155. Mohi, M.G., and Neel, B.G. 2007. The role of Shp2 (PTPN11) in cancer. Curr Opin Genet Dev 17:23-30.
182
156. Hof, P., Pluskey, S., Dhe-Paganon, S., Eck, M.J., and Shoelson, S.E. 1998. Crystal structure of the tyrosine phosphatase SHP-2. Cell 92:441-450.
157. Keilhack, H., David, F.S., McGregor, M., Cantley, L.C., and Neel, B.G. 2005. Diverse biochemical properties of Shp2 mutants. Implications for disease phenotypes. J Biol Chem 280:30984-30993.
158. Tartaglia, M., Martinelli, S., Stella, L., Bocchinfuso, G., Flex, E., Cordeddu, V., Zampino, G., Burgt, I., Palleschi, A., Petrucci, T.C., et al. 2006. Diversity and functional consequences of germline and somatic PTPN11 mutations in human disease. Am J Hum Genet 78:279-290.
159. Martinelli, S., Torreri, P., Tinti, M., Stella, L., Bocchinfuso, G., Flex, E., Grottesi, A., Ceccarini, M., Palleschi, A., Cesareni, G., et al. 2008. Diverse driving forces underlie the invariant occurrence of the T42A, E139D, I282V and T468M SHP2 amino acid substitutions causing Noonan and LEOPARD syndromes. Hum Mol Genet 17:2018-2029.
160. Zenker, M., Horn, D., Wieczorek, D., Allanson, J., Pauli, S., van der Burgt, I., Doerr, H.G., Gaspar, H., Hofbeck, M., Gillessen-Kaesbach, G., et al. 2007. SOS1 is the second most common Noonan gene but plays no major role in cardio-facio-cutaneous syndrome. J Med Genet 44:651-656.
161. Kratz, C.P., Zampino, G., Kriek, M., Kant, S.G., Leoni, C., Pantaleoni, F., Oudesluys-Murphy, A.M., Di Rocco, C., Kloska, S.P., Tartaglia, M., et al. 2009. Craniosynostosis in patients with Noonan syndrome caused by germline KRAS mutations. Am J Med Genet A 149A:1036-1040.
162. Schubbert, S., Bollag, G., Lyubynska, N., Nguyen, H., Kratz, C.P., Zenker, M., Niemeyer, C.M., Molven, A., and Shannon, K. 2007. Biochemical and functional characterization of germ line KRAS mutations. Mol Cell Biol 27:7765-7770.
163. Light, Y., Paterson, H., and Marais, R. 2002. 14-3-3 antagonizes Ras-mediated Raf-1 recruitment to the plasma membrane to maintain signaling fidelity. Mol Cell Biol 22:4984-4996.
164. Kubicek, M., Pacher, M., Abraham, D., Podar, K., Eulitz, M., and Baccarini, M. 2002. Dephosphorylation of Ser-259 regulates Raf-1 membrane association. J Biol Chem 277:7913-7919.
165. Kobayashi, T., Aoki, Y., Niihori, T., Cave, H., Verloes, A., Okamoto, N., Kawame, H., Fujiwara, I., Takada, F., Ohata, T., et al. 2010. Molecular and clinical analysis of RAF1 in Noonan syndrome and related disorders: dephosphorylation of serine 259 as the essential mechanism for mutant activation. Hum Mutat 31:284-294.
166. Molzan, M., Schumacher, B., Ottmann, C., Baljuls, A., Polzien, L., Weyand, M., Thiel, P., Rose, R., Rose, M., Kuhenne, P., et al. 2010. Impaired binding of 14-3-3 to C-RAF in Noonan syndrome suggests new approaches in diseases with increased Ras signaling. Mol Cell Biol 30:4698-4711.
183
167. Wan, P.T., Garnett, M.J., Roe, S.M., Lee, S., Niculescu-Duvaz, D., Good, V.M., Jones, C.M., Marshall, C.J., Springer, C.J., Barford, D., et al. 2004. Mechanism of activation of the RAF-ERK signaling pathway by oncogenic mutations of B-RAF. Cell 116:855-867.
168. Garnett, M.J., Rana, S., Paterson, H., Barford, D., and Marais, R. 2005. Wild-type and mutant B-RAF activate C-RAF through distinct mechanisms involving heterodimerization. Mol Cell 20:963-969.
169. Poulikakos, P.I., Zhang, C., Bollag, G., Shokat, K.M., and Rosen, N. 2010. RAF inhibitors transactivate RAF dimers and ERK signalling in cells with wild-type BRAF. Nature 464:427-430.
170. Hatzivassiliou, G., Song, K., Yen, I., Brandhuber, B.J., Anderson, D.J., Alvarado, R., Ludlam, M.J., Stokoe, D., Gloor, S.L., Vigers, G., et al. 2010. RAF inhibitors prime wild-type RAF to activate the MAPK pathway and enhance growth. Nature 464:431-435.
171. Niihori, T., Aoki, Y., Narumi, Y., Neri, G., Cave, H., Verloes, A., Okamoto, N., Hennekam, R.C., Gillessen-Kaesbach, G., Wieczorek, D., et al. 2006. Germline KRAS and BRAF mutations in cardio-facio-cutaneous syndrome. Nat Genet 38:294-296.
172. Rodriguez-Viciana, P., Tetsu, O., Tidyman, W.E., Estep, A.L., Conger, B.A., Cruz, M.S., McCormick, F., and Rauen, K.A. 2006. Germline mutations in genes within the MAPK pathway cause cardio-facio-cutaneous syndrome. Science 311:1287-1290.
173. Tartaglia, M., Kalidas, K., Shaw, A., Song, X., Musat, D.L., van der Burgt, I., Brunner, H.G., Bertola, D.R., Crosby, A., Ion, A., et al. 2002. PTPN11 mutations in Noonan syndrome: molecular spectrum, genotype-phenotype correlation, and phenotypic heterogeneity. Am J Hum Genet 70:1555-1563.
174. Zenker, M., Buheitel, G., Rauch, R., Koenig, R., Bosse, K., Kress, W., Tietze, H.U., Doerr, H.G., Hofbeck, M., Singer, H., et al. 2004. Genotype-phenotype correlations in Noonan syndrome. J Pediatr 144:368-374.
175. Tartaglia, M., Niemeyer, C.M., Fragale, A., Song, X., Buechner, J., Jung, A., Hahlen, K., Hasle, H., Licht, J.D., and Gelb, B.D. 2003. Somatic mutations in PTPN11 in juvenile myelomonocytic leukemia, myelodysplastic syndromes and acute myeloid leukemia. Nat Genet 34:148-150.
176. Digilio, M.C., Sarkozy, A., de Zorzi, A., Pacileo, G., Limongelli, G., Mingarelli, R., Calabro, R., Marino, B., and Dallapiccola, B. 2006. LEOPARD syndrome: clinical diagnosis in the first year of life. Am J Med Genet A 140:740-746.
177. Digilio, M.C., Conti, E., Sarkozy, A., Mingarelli, R., Dottorini, T., Marino, B., Pizzuti, A., and Dallapiccola, B. 2002. Grouping of multiple-lentigines/LEOPARD and Noonan syndromes on the PTPN11 gene. Am J Hum Genet 71:389-394.
178. Legius, E., Schrander-Stumpel, C., Schollen, E., Pulles-Heintzberger, C., Gewillig, M., and Fryns, J.P. 2002. PTPN11 mutations in LEOPARD syndrome. J Med Genet 39:571-574.
184
179. Hanna, N., Montagner, A., Lee, W.H., Miteva, M., Vidal, M., Vidaud, M., Parfait, B., and Raynal, P. 2006. Reduced phosphatase activity of SHP-2 in LEOPARD syndrome: consequences for PI3K binding on Gab1. FEBS Lett 580:2477-2482.
180. Kontaridis, M.I., Swanson, K.D., David, F.S., Barford, D., and Neel, B.G. 2006. PTPN11 (Shp2) mutations in LEOPARD syndrome have dominant negative, not activating, effects. J Biol Chem 281:6785-6792.
181. Koudova, M., Seemanova, E., and Zenker, M. 2009. Novel BRAF mutation in a patient with LEOPARD syndrome and normal intelligence. Eur J Med Genet 52:337-340.
182. Mazzanti, L., Cacciari, E., Cicognani, A., Bergamaschi, R., Scarano, E., and Forabosco, A. 2003. Noonan-like syndrome with loose anagen hair: a new syndrome? Am J Med Genet A 118A:279-286.
183. Cordeddu, V., Di Schiavi, E., Pennacchio, L.A., Ma'ayan, A., Sarkozy, A., Fodale, V., Cecchetti, S., Cardinale, A., Martin, J., Schackwitz, W., et al. 2009. Mutation of SHOC2 promotes aberrant protein N-myristoylation and causes Noonan-like syndrome with loose anagen hair. Nat Genet 41:1022-1026.
184. Capalbo, D., Melis, D., De Martino, L., Palamaro, L., Riccomagno, S., Bona, G., Cordeddu, V., Pignata, C., and Salerno, M. 2012. Noonan-like syndrome with loose anagen hair associated with growth hormone insensitivity and atypical neurological manifestations. Am J Med Genet A 158A:856-860.
185. Cantatore-Francis, J.L., and Orlow, S.J. 2009. Practical guidelines for evaluation of loose anagen hair syndrome. Arch Dermatol 145:1123-1128.
186. Matsunaga-Udagawa, R., Fujita, Y., Yoshiki, S., Terai, K., Kamioka, Y., Kiyokawa, E., Yugi, K., Aoki, K., and Matsuda, M. 2010. The scaffold protein Shoc2/SUR-8 accelerates the interaction of Ras and Raf. J Biol Chem 285:7818-7826.
187. Martinelli, S., De Luca, A., Stellacci, E., Rossi, C., Checquolo, S., Lepri, F., Caputo, V., Silvano, M., Buscherini, F., Consoli, F., et al. 2010. Heterozygous germline mutations in the CBL tumor-suppressor gene cause a Noonan syndrome-like phenotype. Am J Hum Genet 87:250-257.
188. Perez, B., Mechinaud, F., Galambrun, C., Ben Romdhane, N., Isidor, B., Philip, N., Derain-Court, J., Cassinat, B., Lachenaud, J., Kaltenbach, S., et al. 2010. Germline mutations of the CBL gene define a new genetic syndrome with predisposition to juvenile myelomonocytic leukaemia. J Med Genet 47:686-691.
189. Niemeyer, C.M., Kang, M.W., Shin, D.H., Furlan, I., Erlacher, M., Bunin, N.J., Bunda, S., Finklestein, J.Z., Sakamoto, K.M., Gorr, T.A., et al. 2010. Germline CBL mutations cause developmental abnormalities and predispose to juvenile myelomonocytic leukemia. Nat Genet 42:794-800.
190. Friedman, J.M., and Birch, P.H. 1997. Type 1 neurofibromatosis: a descriptive analysis of the disorder in 1,728 patients. Am J Med Genet 70:138-143.
185
191. Williams, V.C., Lucas, J., Babcock, M.A., Gutmann, D.H., Korf, B., and Maria, B.L. 2009. Neurofibromatosis type 1 revisited. Pediatrics 123:124-133.
192. Thomson, S.A., Fishbein, L., and Wallace, M.R. 2002. NF1 mutations and molecular testing. J Child Neurol 17:555-561; discussion 571-552, 646-551.
193. Brems, H., Chmara, M., Sahbatou, M., Denayer, E., Taniguchi, K., Kato, R., Somers, R., Messiaen, L., De Schepper, S., Fryns, J.P., et al. 2007. Germline loss-of-function mutations in SPRED1 cause a neurofibromatosis 1-like phenotype. Nat Genet 39:1120-1126.
194. Messiaen, L., Yao, S., Brems, H., Callens, T., Sathienkijkanchai, A., Denayer, E., Spencer, E., Arn, P., Babovic-Vuksanovic, D., Bay, C., et al. 2009. Clinical and mutational spectrum of neurofibromatosis type 1-like syndrome. Jama 302:2111-2118.
195. Pasmant, E., Sabbagh, A., Hanna, N., Masliah-Planchon, J., Jolly, E., Goussard, P., Ballerini, P., Cartault, F., Barbarot, S., Landman-Parker, J., et al. 2009. SPRED1 germline mutations caused a neurofibromatosis type 1 overlapping phenotype. J Med Genet 46:425-430.
196. Wakioka, T., Sasaki, A., Kato, R., Shouda, T., Matsumoto, A., Miyoshi, K., Tsuneoka, M., Komiya, S., Baron, R., and Yoshimura, A. 2001. Spred is a Sprouty-related suppressor of Ras signalling. Nature 412:647-651.
197. Reynolds, J.F., Neri, G., Herrmann, J.P., Blumberg, B., Coldwell, J.G., Miles, P.V., and Opitz, J.M. 1986. New multiple congenital anomalies/mental retardation syndrome with cardio-facio-cutaneous involvement--the CFC syndrome. Am J Med Genet 25:413-427.
198. Roberts, A., Allanson, J., Jadico, S.K., Kavamura, M.I., Noonan, J., Opitz, J.M., Young, T., and Neri, G. 2006. The cardiofaciocutaneous syndrome. J Med Genet 43:833-842.
199. Costello, J.M. 1977. A new syndrome: mental subnormality and nasal papillomata. Aust Paediatr J 13:114-118.
200. Hennekam, R.C. 2003. Costello syndrome: an overview. Am J Med Genet C Semin Med Genet 117C:42-48.
201. Gripp, K.W. 2005. Tumor predisposition in Costello syndrome. Am J Med Genet C Semin Med Genet 137C:72-77.
202. Aoki, Y., Niihori, T., Kawame, H., Kurosawa, K., Ohashi, H., Tanaka, Y., Filocamo, M., Kato, K., Suzuki, Y., Kure, S., et al. 2005. Germline mutations in HRAS proto-oncogene cause Costello syndrome. Nat Genet 37:1038-1040.
203. Pylayeva-Gupta, Y., Grabocka, E., and Bar-Sagi, D. 2011. RAS oncogenes: weaving a tumorigenic web. Nat Rev Cancer 11:761-774.
204. Araki, T., Mohi, M.G., Ismat, F.A., Bronson, R.T., Williams, I.R., Kutok, J.L., Yang, W., Pao, L.I., Gilliland, D.G., Epstein, J.A., et al. 2004. Mouse model of Noonan syndrome
186
reveals cell type- and gene dosage-dependent effects of Ptpn11 mutation. Nat Med 10:849-857.
205. Brannan, C.I., Perkins, A.S., Vogel, K.S., Ratner, N., Nordlund, M.L., Reid, S.W., Buchberg, A.M., Jenkins, N.A., Parada, L.F., and Copeland, N.G. 1994. Targeted disruption of the neurofibromatosis type-1 gene leads to developmental abnormalities in heart and various neural crest-derived tissues. Genes Dev 8:1019-1029.
206. Lakkis, M.M., and Epstein, J.A. 1998. Neurofibromin modulation of ras activity is required for normal endocardial-mesenchymal transformation in the developing heart. Development 125:4359-4367.
207. Krenz, M., Gulick, J., Osinska, H.E., Colbert, M.C., Molkentin, J.D., and Robbins, J. 2008. Role of ERK1/2 signaling in congenital valve malformations in Noonan syndrome. Proc Natl Acad Sci U S A 105:18930-18935.
208. Nakamura, T., Colbert, M., Krenz, M., Molkentin, J.D., Hahn, H.S., Dorn, G.W., 2nd, and Robbins, J. 2007. Mediating ERK 1/2 signaling rescues congenital heart defects in a mouse model of Noonan syndrome. J Clin Invest 117:2123-2132.
209. Nakamura, T., Gulick, J., Pratt, R., and Robbins, J. 2009. Noonan syndrome is associated with enhanced pERK activity, the repression of which can prevent craniofacial malformations. Proc Natl Acad Sci U S A 106:15436-15441.
210. Araki, T., Chan, G., Newbigging, S., Morikawa, L., Bronson, R.T., and Neel, B.G. 2009. Noonan syndrome cardiac defects are caused by PTPN11 acting in endocardium to enhance endocardial-mesenchymal transformation. Proc Natl Acad Sci U S A 106:4736-4741.
211. Chen, P.C., Wakimoto, H., Conner, D., Araki, T., Yuan, T., Roberts, A., Seidman, C.E., Bronson, R., Neel, B.G., Seidman, J.G., et al. 2010 Nov1. Activation of multiple signaling pathways causes developmental defects in mice with a Noonan syndrome-associated Sos1 mutation. J Clin Invest Epub ahead of print.
212. Rapp, U.R., Goldsborough, M.D., Mark, G.E., Bonner, T.I., Groffen, J., Reynolds, F.H., Jr., and Stephenson, J.R. 1983. Structure and biological activity of v-raf, a unique oncogene transduced by a retrovirus. Proc Natl Acad Sci U S A 80:4218-4222.
213. Sutrave, P., Bonner, T.I., Rapp, U.R., Jansen, H.W., Patschinsky, T., and Bister, K. 1984. Nucleotide sequence of avian retroviral oncogene v-mil: homologue of murine retroviral oncogene v-raf. Nature 309:85-88.
214. Moelling, K., Heimann, B., Beimling, P., Rapp, U.R., and Sander, T. 1984. Serine- and threonine-specific protein kinase activities of purified gag-mil and gag-raf proteins. Nature 312:558-561.
215. Bonner, T.I., Kerby, S.B., Sutrave, P., Gunnell, M.A., Mark, G., and Rapp, U.R. 1985. Structure and biological activity of human homologs of the raf/mil oncogene. Mol Cell Biol 5:1400-1407.
187
216. Jansen, H.W., and Bister, K. 1985. Nucleotide sequence analysis of the chicken gene c-mil, the progenitor of the retroviral oncogene v-mil. Virology 143:359-367.
217. Wasylyk, C., Wasylyk, B., Heidecker, G., Huleihel, M., and Rapp, U.R. 1989. Expression of raf oncogenes activates the PEA1 transcription factor motif. Mol Cell Biol 9:2247-2250.
218. Kolch, W., Heidecker, G., Lloyd, P., and Rapp, U.R. 1991. Raf-1 protein kinase is required for growth of induced NIH/3T3 cells. Nature 349:426-428.
219. Jamal, S., and Ziff, E. 1990. Transactivation of c-fos and beta-actin genes by raf as a step in early response to transmembrane signals. Nature 344:463-466.
220. Kyriakis, J.M., App, H., Zhang, X.F., Banerjee, P., Brautigan, D.L., Rapp, U.R., and Avruch, J. 1992. Raf-1 activates MAP kinase-kinase. Nature 358:417-421.
221. Dent, P., Haser, W., Haystead, T.A., Vincent, L.A., Roberts, T.M., and Sturgill, T.W. 1992. Activation of mitogen-activated protein kinase kinase by v-Raf in NIH 3T3 cells and in vitro. Science 257:1404-1407.
222. Zhang, X.F., Settleman, J., Kyriakis, J.M., Takeuchi-Suzuki, E., Elledge, S.J., Marshall, M.S., Bruder, J.T., Rapp, U.R., and Avruch, J. 1993. Normal and oncogenic p21ras proteins bind to the amino-terminal regulatory domain of c-Raf-1. Nature 364:308-313.
223. Warne, P.H., Viciana, P.R., and Downward, J. 1993. Direct interaction of Ras and the amino-terminal region of Raf-1 in vitro. Nature 364:352-355.
224. Vojtek, A.B., Hollenberg, S.M., and Cooper, J.A. 1993. Mammalian Ras interacts directly with the serine/threonine kinase Raf. Cell 74:205-214.
225. Van Aelst, L., Barr, M., Marcus, S., Polverino, A., and Wigler, M. 1993. Complex formation between RAS and RAF and other protein kinases. Proc Natl Acad Sci U S A 90:6213-6217.
226. Moodie, S.A., Willumsen, B.M., Weber, M.J., and Wolfman, A. 1993. Complexes of Ras.GTP with Raf-1 and mitogen-activated protein kinase kinase. Science 260:1658-1661.
227. Chen, J., Fujii, K., Zhang, L., Roberts, T., and Fu, H. 2001. Raf-1 promotes cell survival by antagonizing apoptosis signal-regulating kinase 1 through a MEK-ERK independent mechanism. Proc Natl Acad Sci U S A 98:7783-7788.
228. O'Neill, E., Rushworth, L., Baccarini, M., and Kolch, W. 2004. Role of the kinase MST2 in suppression of apoptosis by the proto-oncogene product Raf-1. Science 306:2267-2270.
229. Piazzolla, D., Meissl, K., Kucerova, L., Rubiolo, C., and Baccarini, M. 2005. Raf-1 sets the threshold of Fas sensitivity by modulating Rok-alpha signaling. J Cell Biol 171:1013-1022.
188
230. Ehrenreiter, K., Piazzolla, D., Velamoor, V., Sobczak, I., Small, J.V., Takeda, J., Leung, T., and Baccarini, M. 2005. Raf-1 regulates Rho signaling and cell migration. J Cell Biol 168:955-964.
231. Storm, S.M., Cleveland, J.L., and Rapp, U.R. 1990. Expression of raf family proto-oncogenes in normal mouse tissues. Oncogene 5:345-351.
232. Barnier, J.V., Papin, C., Eychene, A., Lecoq, O., and Calothy, G. 1995. The mouse B-raf gene encodes multiple protein isoforms with tissue-specific expression. J Biol Chem 270:23381-23389.
233. Luckett, J.C., Huser, M.B., Giagtzoglou, N., Brown, J.E., and Pritchard, C.A. 2000. Expression of the A-raf proto-oncogene in the normal adult and embryonic mouse. Cell Growth Differ 11:163-171.
234. Pritchard, C.A., Bolin, L., Slattery, R., Murray, R., and McMahon, M. 1996. Post-natal lethality and neurological and gastrointestinal defects in mice with targeted disruption of the A-Raf protein kinase gene. Curr Biol 6:614-617.
235. Wojnowski, L., Zimmer, A.M., Beck, T.W., Hahn, H., Bernal, R., Rapp, U.R., and Zimmer, A. 1997. Endothelial apoptosis in Braf-deficient mice. Nat Genet 16:293-297.
236. Wojnowski, L., Stancato, L.F., Zimmer, A.M., Hahn, H., Beck, T.W., Larner, A.C., Rapp, U.R., and Zimmer, A. 1998. Craf-1 protein kinase is essential for mouse development. Mech Dev 76:141-149.
237. Mikula, M., Schreiber, M., Husak, Z., Kucerova, L., Ruth, J., Wieser, R., Zatloukal, K., Beug, H., Wagner, E.F., and Baccarini, M. 2001. Embryonic lethality and fetal liver apoptosis in mice lacking the c-raf-1 gene. Embo J 20:1952-1962.
238. Huser, M., Luckett, J., Chiloeches, A., Mercer, K., Iwobi, M., Giblett, S., Sun, X.M., Brown, J., Marais, R., and Pritchard, C. 2001. MEK kinase activity is not necessary for Raf-1 function. Embo J 20:1940-1951.
239. Avruch, J., Khokhlatchev, A., Kyriakis, J.M., Luo, Z., Tzivion, G., Vavvas, D., and Zhang, X.F. 2001. Ras activation of the Raf kinase: tyrosine kinase recruitment of the MAP kinase cascade. Recent Prog Horm Res 56:127-155.
240. Tran, N.H., Wu, X., and Frost, J.A. 2005. B-Raf and Raf-1 are regulated by distinct autoregulatory mechanisms. J Biol Chem 280:16244-16253.
241. Brtva, T.R., Drugan, J.K., Ghosh, S., Terrell, R.S., Campbell-Burk, S., Bell, R.M., and Der, C.J. 1995. Two distinct Raf domains mediate interaction with Ras. J Biol Chem 270:9809-9812.
242. Daub, M., Jockel, J., Quack, T., Weber, C.K., Schmitz, F., Rapp, U.R., Wittinghofer, A., and Block, C. 1998. The RafC1 cysteine-rich domain contains multiple distinct regulatory epitopes which control Ras-dependent Raf activation. Mol Cell Biol 18:6698-6710.
189
243. Dhillon, A.S., Meikle, S., Yazici, Z., Eulitz, M., and Kolch, W. 2002. Regulation of Raf-1 activation and signalling by dephosphorylation. Embo J 21:64-71.
244. Chong, H., Lee, J., and Guan, K.L. 2001. Positive and negative regulation of Raf kinase activity and function by phosphorylation. Embo J 20:3716-3727.
245. Mason, C.S., Springer, C.J., Cooper, R.G., Superti-Furga, G., Marshall, C.J., and Marais, R. 1999. Serine and tyrosine phosphorylations cooperate in Raf-1, but not B-Raf activation. Embo J 18:2137-2148.
246. Cutler, R.E., Jr., Stephens, R.M., Saracino, M.R., and Morrison, D.K. 1998. Autoregulation of the Raf-1 serine/threonine kinase. Proc Natl Acad Sci U S A 95:9214-9219.
247. Chong, H., and Guan, K.L. 2003. Regulation of Raf through phosphorylation and N terminus-C terminus interaction. J Biol Chem 278:36269-36276.
248. Heidecker, G., Huleihel, M., Cleveland, J.L., Kolch, W., Beck, T.W., Lloyd, P., Pawson, T., and Rapp, U.R. 1990. Mutational activation of c-raf-1 and definition of the minimal transforming sequence. Mol Cell Biol 10:2503-2512.
249. Yip-Schneider, M.T., Miao, W., Lin, A., Barnard, D.S., Tzivion, G., and Marshall, M.S. 2000. Regulation of the Raf-1 kinase domain by phosphorylation and 14-3-3 association. Biochem J 351:151-159.
250. Wellbrock, C., Karasarides, M., and Marais, R. 2004. The RAF proteins take centre stage. Nat Rev Mol Cell Biol 5:875-885.
251. Leicht, D.T., Balan, V., Kaplun, A., Singh-Gupta, V., Kaplun, L., Dobson, M., and Tzivion, G. 2007. Raf kinases: function, regulation and role in human cancer. Biochim Biophys Acta 1773:1196-1212.
252. Matallanas, D., Birtwistle, M., Romano, D., Zebisch, A., Rauch, J., von Kriegsheim, A., and Kolch, W. 2011. Raf family kinases: old dogs have learned new tricks. Genes Cancer 2:232-260.
253. Tran, N.H., and Frost, J.A. 2003. Phosphorylation of Raf-1 by p21-activated kinase 1 and Src regulates Raf-1 autoinhibition. J Biol Chem 278:11221-11226.
254. Rommel, C., Radziwill, G., Lovric, J., Noeldeke, J., Heinicke, T., Jones, D., Aitken, A., and Moelling, K. 1996. Activated Ras displaces 14-3-3 protein from the amino terminus of c-Raf-1. Oncogene 12:609-619.
255. Jaumot, M., and Hancock, J.F. 2001. Protein phosphatases 1 and 2A promote Raf-1 activation by regulating 14-3-3 interactions. Oncogene 20:3949-3958.
256. Terai, K., and Matsuda, M. 2005. Ras binding opens c-Raf to expose the docking site for mitogen-activated protein kinase kinase. EMBO Rep 6:251-255.
190
257. Raabe, T., and Rapp, U.R. 2003. Ras signaling: PP2A puts Ksr and Raf in the right place. Curr Biol 13:R635-637.
258. Ory, S., Zhou, M., Conrads, T.P., Veenstra, T.D., and Morrison, D.K. 2003. Protein phosphatase 2A positively regulates Ras signaling by dephosphorylating KSR1 and Raf-1 on critical 14-3-3 binding sites. Curr Biol 13:1356-1364.
259. Buday, L., Warne, P.H., and Downward, J. 1995. Downregulation of the Ras activation pathway by MAP kinase phosphorylation of Sos. Oncogene 11:1327-1331.
260. Roy, S., Lane, A., Yan, J., McPherson, R., and Hancock, J.F. 1997. Activity of plasma membrane-recruited Raf-1 is regulated by Ras via the Raf zinc finger. J Biol Chem 272:20139-20145.
261. Bondeva, T., Balla, A., Varnai, P., and Balla, T. 2002. Structural determinants of Ras-Raf interaction analyzed in live cells. Mol Biol Cell 13:2323-2333.
262. Andresen, B.T., Rizzo, M.A., Shome, K., and Romero, G. 2002. The role of phosphatidic acid in the regulation of the Ras/MEK/Erk signaling cascade. FEBS Lett 531:65-68.
263. Kraft, C.A., Garrido, J.L., Fluharty, E., Leiva-Vega, L., and Romero, G. 2008. Role of phosphatidic acid in the coupling of the ERK cascade. J Biol Chem 283:36636-36645.
264. Williams, J.G., Drugan, J.K., Yi, G.S., Clark, G.J., Der, C.J., and Campbell, S.L. 2000. Elucidation of binding determinants and functional consequences of Ras/Raf-cysteine-rich domain interactions. J Biol Chem 275:22172-22179.
265. Inder, K., Harding, A., Plowman, S.J., Philips, M.R., Parton, R.G., and Hancock, J.F. 2008. Activation of the MAPK module from different spatial locations generates distinct system outputs. Mol Biol Cell 19:4776-4784.
266. Diaz, B., Barnard, D., Filson, A., MacDonald, S., King, A., and Marshall, M. 1997. Phosphorylation of Raf-1 serine 338-serine 339 is an essential regulatory event for Ras-dependent activation and biological signaling. Mol Cell Biol 17:4509-4516.
267. Xiang, X., Zang, M., Waelde, C.A., Wen, R., and Luo, Z. 2002. Phosphorylation of 338SSYY341 regulates specific interaction between Raf-1 and MEK1. J Biol Chem 277:44996-45003.
268. Edin, M.L., and Juliano, R.L. 2005. Raf-1 serine 338 phosphorylation plays a key role in adhesion-dependent activation of extracellular signal-regulated kinase by epidermal growth factor. Mol Cell Biol 25:4466-4475.
269. King, A.J., Sun, H., Diaz, B., Barnard, D., Miao, W., Bagrodia, S., and Marshall, M.S. 1998. The protein kinase Pak3 positively regulates Raf-1 activity through phosphorylation of serine 338. Nature 396:180-183.
191
270. Sun, H., King, A.J., Diaz, H.B., and Marshall, M.S. 2000. Regulation of the protein kinase Raf-1 by oncogenic Ras through phosphatidylinositol 3-kinase, Cdc42/Rac and Pak. Curr Biol 10:281-284.
271. Fabian, J.R., Daar, I.O., and Morrison, D.K. 1993. Critical tyrosine residues regulate the enzymatic and biological activity of Raf-1 kinase. Mol Cell Biol 13:7170-7179.
272. Marais, R., Light, Y., Paterson, H.F., and Marshall, C.J. 1995. Ras recruits Raf-1 to the plasma membrane for activation by tyrosine phosphorylation. Embo J 14:3136-3145.
273. Zang, M., Gong, J., Luo, L., Zhou, J., Xiang, X., Huang, W., Huang, Q., Luo, X., Olbrot, M., Peng, Y., et al. 2008. Characterization of Ser338 phosphorylation for Raf-1 activation. J Biol Chem 283:31429-31437.
274. Ritt, D.A., Zhou, M., Conrads, T.P., Veenstra, T.D., Copeland, T.D., and Morrison, D.K. 2007. CK2 Is a component of the KSR1 scaffold complex that contributes to Raf kinase activation. Curr Biol 17:179-184.
275. Zhu, J., Balan, V., Bronisz, A., Balan, K., Sun, H., Leicht, D.T., Luo, Z., Qin, J., Avruch, J., and Tzivion, G. 2005. Identification of Raf-1 S471 as a novel phosphorylation site critical for Raf-1 and B-Raf kinase activities and for MEK binding. Mol Biol Cell 16:4733-4744.
276. Zhang, B.H., and Guan, K.L. 2000. Activation of B-Raf kinase requires phosphorylation of the conserved residues Thr598 and Ser601. Embo J 19:5429-5439.
277. Morrison, D.K., Heidecker, G., Rapp, U.R., and Copeland, T.D. 1993. Identification of the major phosphorylation sites of the Raf-1 kinase. J Biol Chem 268:17309-17316.
278. Zhang, Y., Yao, B., Delikat, S., Bayoumy, S., Lin, X.H., Basu, S., McGinley, M., Chan-Hui, P.Y., Lichenstein, H., and Kolesnick, R. 1997. Kinase suppressor of Ras is ceramide-activated protein kinase. Cell 89:63-72.
279. Kolch, W., Heidecker, G., Kochs, G., Hummel, R., Vahidi, H., Mischak, H., Finkenzeller, G., Marme, D., and Rapp, U.R. 1993. Protein kinase C alpha activates RAF-1 by direct phosphorylation. Nature 364:249-252.
280. von Kriegsheim, A., Pitt, A., Grindlay, G.J., Kolch, W., and Dhillon, A.S. 2006. Regulation of the Raf-MEK-ERK pathway by protein phosphatase 5. Nat Cell Biol 8:1011-1016.
281. Park, S., Rath, O., Beach, S., Xiang, X., Kelly, S.M., Luo, Z., Kolch, W., and Yeung, K.C. 2006. Regulation of RKIP binding to the N-region of the Raf-1 kinase. FEBS Lett 580:6405-6412.
282. Rath, O., Park, S., Tang, H.H., Banfield, M.J., Brady, R.L., Lee, Y.C., Dignam, J.D., Sedivy, J.M., Kolch, W., and Yeung, K.C. 2008. The RKIP (Raf-1 Kinase Inhibitor Protein) conserved pocket binds to the phosphorylated N-region of Raf-1 and inhibits the Raf-1-mediated activated phosphorylation of MEK. Cell Signal 20:935-941.
192
283. Yeung, K., Seitz, T., Li, S., Janosch, P., McFerran, B., Kaiser, C., Fee, F., Katsanakis, K.D., Rose, D.W., Mischak, H., et al. 1999. Suppression of Raf-1 kinase activity and MAP kinase signalling by RKIP. Nature 401:173-177.
284. Yeung, K., Janosch, P., McFerran, B., Rose, D.W., Mischak, H., Sedivy, J.M., and Kolch, W. 2000. Mechanism of suppression of the Raf/MEK/extracellular signal-regulated kinase pathway by the raf kinase inhibitor protein. Mol Cell Biol 20:3079-3085.
285. Cirit, M., Wang, C.C., and Haugh, J.M. 2010. Systematic quantification of negative feedback mechanisms in the extracellular signal-regulated kinase (ERK) signaling network. J Biol Chem 285:36736-36744.
286. Balan, V., Leicht, D.T., Zhu, J., Balan, K., Kaplun, A., Singh-Gupta, V., Qin, J., Ruan, H., Comb, M.J., and Tzivion, G. 2006. Identification of novel in vivo Raf-1 phosphorylation sites mediating positive feedback Raf-1 regulation by extracellular signal-regulated kinase. Mol Biol Cell 17:1141-1153.
287. Wu, J., Dent, P., Jelinek, T., Wolfman, A., Weber, M.J., and Sturgill, T.W. 1993. Inhibition of the EGF-activated MAP kinase signaling pathway by adenosine 3',5'-monophosphate. Science 262:1065-1069.
288. Hafner, S., Adler, H.S., Mischak, H., Janosch, P., Heidecker, G., Wolfman, A., Pippig, S., Lohse, M., Ueffing, M., and Kolch, W. 1994. Mechanism of inhibition of Raf-1 by protein kinase A. Mol Cell Biol 14:6696-6703.
289. Dhillon, A.S., Pollock, C., Steen, H., Shaw, P.E., Mischak, H., and Kolch, W. 2002. Cyclic AMP-dependent kinase regulates Raf-1 kinase mainly by phosphorylation of serine 259. Mol Cell Biol 22:3237-3246.
290. Dumaz, N., and Marais, R. 2003. Protein kinase A blocks Raf-1 activity by stimulating 14-3-3 binding and blocking Raf-1 interaction with Ras. J Biol Chem 278:29819-29823.
291. Zimmermann, S., and Moelling, K. 1999. Phosphorylation and regulation of Raf by Akt (protein kinase B). Science 286:1741-1744.
292. Guan, K.L., Figueroa, C., Brtva, T.R., Zhu, T., Taylor, J., Barber, T.D., and Vojtek, A.B. 2000. Negative regulation of the serine/threonine kinase B-Raf by Akt. J Biol Chem 275:27354-27359.
293. Rommel, C., Clarke, B.A., Zimmermann, S., Nunez, L., Rossman, R., Reid, K., Moelling, K., Yancopoulos, G.D., and Glass, D.J. 1999. Differentiation stage-specific inhibition of the Raf-MEK-ERK pathway by Akt. Science 286:1738-1741.
294. Tzivion, G., Luo, Z., and Avruch, J. 1998. A dimeric 14-3-3 protein is an essential cofactor for Raf kinase activity. Nature 394:88-92.
295. Mischak, H., Seitz, T., Janosch, P., Eulitz, M., Steen, H., Schellerer, M., Philipp, A., and Kolch, W. 1996. Negative regulation of Raf-1 by phosphorylation of serine 621. Mol Cell Biol 16:5409-5418.
193
296. Dhillon, A.S., Yip, Y.Y., Grindlay, G.J., Pakay, J.L., Dangers, M., Hillmann, M., Clark, W., Pitt, A., Mischak, H., and Kolch, W. 2009. The C-terminus of Raf-1 acts as a 14-3-3-dependent activation switch. Cell Signal 21:1645-1651.
297. Noble, C., Mercer, K., Hussain, J., Carragher, L., Giblett, S., Hayward, R., Patterson, C., Marais, R., and Pritchard, C.A. 2008. CRAF autophosphorylation of serine 621 is required to prevent its proteasome-mediated degradation. Mol Cell 31:862-872.
298. Rushworth, L.K., Hindley, A.D., O'Neill, E., and Kolch, W. 2006. Regulation and role of Raf-1/B-Raf heterodimerization. Mol Cell Biol 26:2262-2272.
299. Rajakulendran, T., Sahmi, M., Lefrancois, M., Sicheri, F., and Therrien, M. 2009. A dimerization-dependent mechanism drives RAF catalytic activation. Nature 461:542-545.
300. Farrar, M.A., Alberol-Ila, J., and Perlmutter, R.M. 1996. Activation of the Raf-1 kinase cascade by coumermycin-induced dimerization. Nature 383:178-181.
301. Luo, Z., Tzivion, G., Belshaw, P.J., Vavvas, D., Marshall, M., and Avruch, J. 1996. Oligomerization activates c-Raf-1 through a Ras-dependent mechanism. Nature 383:181-185.
302. Weber, C.K., Slupsky, J.R., Kalmes, H.A., and Rapp, U.R. 2001. Active Ras induces heterodimerization of cRaf and BRaf. Cancer Res 61:3595-3598.
303. Heidorn, S.J., Milagre, C., Whittaker, S., Nourry, A., Niculescu-Duvas, I., Dhomen, N., Hussain, J., Reis-Filho, J.S., Springer, C.J., Pritchard, C., et al. 2010. Kinase-dead BRAF and oncogenic RAS cooperate to drive tumor progression through CRAF. Cell 140:209-221.
304. Matheny, S.A., and White, M.A. 2009. Signaling threshold regulation by the Ras effector IMP. J Biol Chem 284:11007-11011.
305. Chadee, D.N., Xu, D., Hung, G., Andalibi, A., Lim, D.J., Luo, Z., Gutmann, D.H., and Kyriakis, J.M. 2006. Mixed-lineage kinase 3 regulates B-Raf through maintenance of the B-Raf/Raf-1 complex and inhibition by the NF2 tumor suppressor protein. Proc Natl Acad Sci U S A 103:4463-4468.
306. McKay, M.M., Ritt, D.A., and Morrison, D.K. 2011. RAF inhibitor-induced KSR1/B-RAF binding and its effects on ERK cascade signaling. Curr Biol 21:563-568.
307. Omerovic, J., and Prior, I.A. 2009. Compartmentalized signalling: Ras proteins and signalling nanoclusters. Febs J 276:1817-1825.
308. Kholodenko, B.N., Hancock, J.F., and Kolch, W. 2010. Signalling ballet in space and time. Nat Rev Mol Cell Biol 11:414-426.
309. Kolch, W. 2005. Coordinating ERK/MAPK signalling through scaffolds and inhibitors. Nat Rev Mol Cell Biol 6:827-837.
194
310. Muller, J., Ory, S., Copeland, T., Piwnica-Worms, H., and Morrison, D.K. 2001. C-TAK1 regulates Ras signaling by phosphorylating the MAPK scaffold, KSR1. Mol Cell 8:983-993.
311. Therrien, M., Michaud, N.R., Rubin, G.M., and Morrison, D.K. 1996. KSR modulates signal propagation within the MAPK cascade. Genes Dev 10:2684-2695.
312. McKay, M.M., Ritt, D.A., and Morrison, D.K. 2009. Signaling dynamics of the KSR1 scaffold complex. Proc Natl Acad Sci U S A 106:11022-11027.
313. Joneson, T., Fulton, J.A., Volle, D.J., Chaika, O.V., Bar-Sagi, D., and Lewis, R.E. 1998. Kinase suppressor of Ras inhibits the activation of extracellular ligand-regulated (ERK) mitogen-activated protein (MAP) kinase by growth factors, activated Ras, and Ras effectors. J Biol Chem 273:7743-7748.
314. Nguyen, A., Burack, W.R., Stock, J.L., Kortum, R., Chaika, O.V., Afkarian, M., Muller, W.J., Murphy, K.M., Morrison, D.K., Lewis, R.E., et al. 2002. Kinase suppressor of Ras (KSR) is a scaffold which facilitates mitogen-activated protein kinase activation in vivo. Mol Cell Biol 22:3035-3045.
315. Brennan, D.F., Dar, A.C., Hertz, N.T., Chao, W.C., Burlingame, A.L., Shokat, K.M., and Barford, D. 2011. A Raf-induced allosteric transition of KSR stimulates phosphorylation of MEK. Nature 472:366-369.
316. Hu, J., Yu, H., Kornev, A.P., Zhao, J., Filbert, E.L., Taylor, S.S., and Shaw, A.S. 2011. Mutation that blocks ATP binding creates a pseudokinase stabilizing the scaffolding function of kinase suppressor of Ras, CRAF and BRAF. Proc Natl Acad Sci U S A 108:6067-6072.
317. Claperon, A., and Therrien, M. 2007. KSR and CNK: two scaffolds regulating RAS-mediated RAF activation. Oncogene 26:3143-3158.
318. Ziogas, A., Moelling, K., and Radziwill, G. 2005. CNK1 is a scaffold protein that regulates Src-mediated Raf-1 activation. J Biol Chem 280:24205-24211.
319. Rabizadeh, S., Xavier, R.J., Ishiguro, K., Bernabeortiz, J., Lopez-Ilasaca, M., Khokhlatchev, A., Mollahan, P., Pfeifer, G.P., Avruch, J., and Seed, B. 2004. The scaffold protein CNK1 interacts with the tumor suppressor RASSF1A and augments RASSF1A-induced cell death. J Biol Chem 279:29247-29254.
320. Roy, M., Li, Z., and Sacks, D.B. 2004. IQGAP1 binds ERK2 and modulates its activity. J Biol Chem 279:17329-17337.
321. Roy, M., Li, Z., and Sacks, D.B. 2005. IQGAP1 is a scaffold for mitogen-activated protein kinase signaling. Mol Cell Biol 25:7940-7952.
322. Rajalingam, K., and Rudel, T. 2005. Ras-Raf signaling needs prohibitin. Cell Cycle 4:1503-1505.
195
323. Rajalingam, K., Wunder, C., Brinkmann, V., Churin, Y., Hekman, M., Sievers, C., Rapp, U.R., and Rudel, T. 2005. Prohibitin is required for Ras-induced Raf-MEK-ERK activation and epithelial cell migration. Nat Cell Biol 7:837-843.
324. Torii, S., Kusakabe, M., Yamamoto, T., Maekawa, M., and Nishida, E. 2004. Sef is a spatial regulator for Ras/MAP kinase signaling. Dev Cell 7:33-44.
325. DeFea, K.A., Zalevsky, J., Thoma, M.S., Dery, O., Mullins, R.D., and Bunnett, N.W. 2000. beta-arrestin-dependent endocytosis of proteinase-activated receptor 2 is required for intracellular targeting of activated ERK1/2. J Cell Biol 148:1267-1281.
326. Teis, D., Wunderlich, W., and Huber, L.A. 2002. Localization of the MP1-MAPK scaffold complex to endosomes is mediated by p14 and required for signal transduction. Dev Cell 3:803-814.
327. Teis, D., Taub, N., Kurzbauer, R., Hilber, D., de Araujo, M.E., Erlacher, M., Offterdinger, M., Villunger, A., Geley, S., Bohn, G., et al. 2006. p14-MP1-MEK1 signaling regulates endosomal traffic and cellular proliferation during tissue homeostasis. J Cell Biol 175:861-868.
328. Sharma, C., Vomastek, T., Tarcsafalvi, A., Catling, A.D., Schaeffer, H.J., Eblen, S.T., and Weber, M.J. 2005. MEK partner 1 (MP1): regulation of oligomerization in MAP kinase signaling. J Cell Biochem 94:708-719.
329. Vomastek, T., Schaeffer, H.J., Tarcsafalvi, A., Smolkin, M.E., Bissonette, E.A., and Weber, M.J. 2004. Modular construction of a signaling scaffold: MORG1 interacts with components of the ERK cascade and links ERK signaling to specific agonists. Proc Natl Acad Sci U S A 101:6981-6986.
330. Sancak, Y., Bar-Peled, L., Zoncu, R., Markhard, A.L., Nada, S., and Sabatini, D.M. 2010. Ragulator-Rag complex targets mTORC1 to the lysosomal surface and is necessary for its activation by amino acids. Cell 141:290-303.
331. Deakin, N.O., and Turner, C.E. 2008. Paxillin comes of age. J Cell Sci 121:2435-2444.
332. Ishibe, S., Joly, D., Zhu, X., and Cantley, L.G. 2003. Phosphorylation-dependent paxillin-ERK association mediates hepatocyte growth factor-stimulated epithelial morphogenesis. Mol Cell 12:1275-1285.
333. Galabova-Kovacs, G., Kolbus, A., Matzen, D., Meissl, K., Piazzolla, D., Rubiolo, C., Steinitz, K., and Baccarini, M. 2006. ERK and beyond: insights from B-Raf and Raf-1 conditional knockouts. Cell Cycle 5:1514-1518.
334. Wang, H.G., Rapp, U.R., and Reed, J.C. 1996. Bcl-2 targets the protein kinase Raf-1 to mitochondria. Cell 87:629-638.
335. Jin, S., Zhuo, Y., Guo, W., and Field, J. 2005. p21-activated Kinase 1 (Pak1)-dependent phosphorylation of Raf-1 regulates its mitochondrial localization, phosphorylation of BAD, and Bcl-2 association. J Biol Chem 280:24698-24705.
196
336. Hindley, A., and Kolch, W. 2007. Raf-1 and B-Raf promote protein kinase C theta interaction with BAD. Cell Signal 19:547-555.
337. Le Mellay, V., Troppmair, J., Benz, R., and Rapp, U.R. 2002. Negative regulation of mitochondrial VDAC channels by C-Raf kinase. BMC Cell Biol 3:14.
338. Yamaguchi, O., Watanabe, T., Nishida, K., Kashiwase, K., Higuchi, Y., Takeda, T., Hikoso, S., Hirotani, S., Asahi, M., Taniike, M., et al. 2004. Cardiac-specific disruption of the c-raf-1 gene induces cardiac dysfunction and apoptosis. J Clin Invest 114:937-943.
339. Romano, D., Matallanas, D., Weitsman, G., Preisinger, C., Ng, T., and Kolch, W. 2010. Proapoptotic kinase MST2 coordinates signaling crosstalk between RASSF1A, Raf-1, and Akt. Cancer Res 70:1195-1203.
340. Tobiume, K., Matsuzawa, A., Takahashi, T., Nishitoh, H., Morita, K., Takeda, K., Minowa, O., Miyazono, K., Noda, T., and Ichijo, H. 2001. ASK1 is required for sustained activations of JNK/p38 MAP kinases and apoptosis. EMBO Rep 2:222-228.
341. Matallanas, D., Romano, D., Yee, K., Meissl, K., Kucerova, L., Piazzolla, D., Baccarini, M., Vass, J.K., Kolch, W., and O'Neill, E. 2007. RASSF1A elicits apoptosis through an MST2 pathway directing proapoptotic transcription by the p73 tumor suppressor protein. Mol Cell 27:962-975.
342. O'Neill, E., and Kolch, W. 2005. Taming the Hippo: Raf-1 controls apoptosis by suppressing MST2/Hippo. Cell Cycle 4:365-367.
343. Niault, T., Sobczak, I., Meissl, K., Weitsman, G., Piazzolla, D., Maurer, G., Kern, F., Ehrenreiter, K., Hamerl, M., Moarefi, I., et al. 2009. From autoinhibition to inhibition in trans: the Raf-1 regulatory domain inhibits Rok-alpha kinase activity. J Cell Biol 187:335-342.
344. Ehrenreiter, K., Kern, F., Velamoor, V., Meissl, K., Galabova-Kovacs, G., Sibilia, M., and Baccarini, M. 2009. Raf-1 addiction in Ras-induced skin carcinogenesis. Cancer Cell 16:149-160.
345. Zak, R. 1984. Growth of the heart in health and disease: Raven Press, New York.
346. Banerjee, I., Fuseler, J.W., Price, R.L., Borg, T.K., and Baudino, T.A. 2007. Determination of cell types and numbers during cardiac development in the neonatal and adult rat and mouse. Am J Physiol Heart Circ Physiol 293:H1883-1891.
347. Gregorio, C.C., and Antin, P.B. 2000. To the heart of myofibril assembly. Trends Cell Biol 10:355-362.
348. Soonpaa, M.H., Kim, K.K., Pajak, L., Franklin, M., and Field, L.J. 1996. Cardiomyocyte DNA synthesis and binucleation during murine development. Am J Physiol 271:H2183-2189.
197
349. Dorn, G.W., 2nd, and Force, T. 2005. Protein kinase cascades in the regulation of cardiac hypertrophy. J Clin Invest 115:527-537.
350. Heineke, J., and Molkentin, J.D. 2006. Regulation of cardiac hypertrophy by intracellular signalling pathways. Nat Rev Mol Cell Biol 7:589-600.
351. Fagard, R.H. 1997. Impact of different sports and training on cardiac structure and function. Cardiol Clin 15:397-412.
352. Eghbali, M., Deva, R., Alioua, A., Minosyan, T.Y., Ruan, H., Wang, Y., Toro, L., and Stefani, E. 2005. Molecular and functional signature of heart hypertrophy during pregnancy. Circ Res 96:1208-1216.
353. Seidman, J.G., and Seidman, C. 2001. The genetic basis for cardiomyopathy: from mutation identification to mechanistic paradigms. Cell 104:557-567.
354. Sala, V., Gallo, S., Leo, C., Gatti, S., Gelb, B.D., and Crepaldi, T. 2012. Signaling to Cardiac Hypertrophy: Insights from Human and Mouse RASopathies. Mol Med 18:938-947.
355. Drazner, M.H. 2011. The progression of hypertensive heart disease. Circulation 123:327-334.
356. Haider, A.W., Larson, M.G., Benjamin, E.J., and Levy, D. 1998. Increased left ventricular mass and hypertrophy are associated with increased risk for sudden death. J Am Coll Cardiol 32:1454-1459.
357. Berenji, K., Drazner, M.H., Rothermel, B.A., and Hill, J.A. 2005. Does load-induced ventricular hypertrophy progress to systolic heart failure? Am J Physiol Heart Circ Physiol 289:H8-H16.
358. Pluim, B.M., Zwinderman, A.H., van der Laarse, A., and van der Wall, E.E. 2000. The athlete's heart. A meta-analysis of cardiac structure and function. Circulation 101:336-344.
359. Grossman, W., Jones, D., and McLaurin, L.P. 1975. Wall stress and patterns of hypertrophy in the human left ventricle. J Clin Invest 56:56-64.
360. McMullen, J.R., and Jennings, G.L. 2007. Differences between pathological and physiological cardiac hypertrophy: novel therapeutic strategies to treat heart failure. Clin Exp Pharmacol Physiol 34:255-262.
361. Kehat, I., and Molkentin, J.D. 2010. Molecular pathways underlying cardiac remodeling during pathophysiological stimulation. Circulation 122:2727-2735.
362. Kaplan, M.L., Cheslow, Y., Vikstrom, K., Malhotra, A., Geenen, D.L., Nakouzi, A., Leinwand, L.A., and Buttrick, P.M. 1994. Cardiac adaptations to chronic exercise in mice. Am J Physiol 267:H1167-1173.
198
363. Iemitsu, M., Miyauchi, T., Maeda, S., Sakai, S., Kobayashi, T., Fujii, N., Miyazaki, H., Matsuda, M., and Yamaguchi, I. 2001. Physiological and pathological cardiac hypertrophy induce different molecular phenotypes in the rat. Am J Physiol Regul Integr Comp Physiol 281:R2029-2036.
364. McMullen, J.R., Shioi, T., Zhang, L., Tarnavski, O., Sherwood, M.C., Kang, P.M., and Izumo, S. 2003. Phosphoinositide 3-kinase(p110alpha) plays a critical role for the induction of physiological, but not pathological, cardiac hypertrophy. Proc Natl Acad Sci U S A 100:12355-12360.
365. Rockman, H.A., Ross, R.S., Harris, A.N., Knowlton, K.U., Steinhelper, M.E., Field, L.J., Ross, J., Jr., and Chien, K.R. 1991. Segregation of atrial-specific and inducible expression of an atrial natriuretic factor transgene in an in vivo murine model of cardiac hypertrophy. Proc Natl Acad Sci U S A 88:8277-8281.
366. deAlmeida, A.C., van Oort, R.J., and Wehrens, X.H. 2010. Transverse aortic constriction in mice. J Vis Exp.
367. Lips, D.J., deWindt, L.J., van Kraaij, D.J., and Doevendans, P.A. 2003. Molecular determinants of myocardial hypertrophy and failure: alternative pathways for beneficial and maladaptive hypertrophy. Eur Heart J 24:883-896.
368. Brower, G.L., Gardner, J.D., Forman, M.F., Murray, D.B., Voloshenyuk, T., Levick, S.P., and Janicki, J.S. 2006. The relationship between myocardial extracellular matrix remodeling and ventricular function. Eur J Cardiothorac Surg 30:604-610.
369. McMullen, J.R., Sadoshima, J., and Izumo, S. 2005. Physiological versus pathological cardiac hypertrophy. In Molecular Mechanisms of Cardiac Hypertrophy and Failure. R.A. Walsh, editor. London: Taylor & Francis. 117-136.
370. Evangelista, F.S., Brum, P.C., and Krieger, J.E. 2003. Duration-controlled swimming exercise training induces cardiac hypertrophy in mice. Braz J Med Biol Res 36:1751-1759.
371. Wang, Y., Wisloff, U., and Kemi, O.J. 2010. Animal models in the study of exercise-induced cardiac hypertrophy. Physiol Res 59:633-644.
372. Maron, B.J. 2002. Hypertrophic cardiomyopathy: a systematic review. Jama 287:1308-1320.
373. Poliac, L.C., Barron, M.E., and Maron, B.J. 2006. Hypertrophic cardiomyopathy. Anesthesiology 104:183-192.
374. Hina, K., Kusachi, S., Iwasaki, K., Nogami, K., Moritani, H., Kita, T., Taniguchi, G., and Tsuji, T. 1993. Progression of left ventricular enlargement in patients with hypertrophic cardiomyopathy: incidence and prognostic value. Clin Cardiol 16:403-407.
375. Anan, R., Greve, G., Thierfelder, L., Watkins, H., McKenna, W.J., Solomon, S., Vecchio, C., Shono, H., Nakao, S., Tanaka, H., et al. 1994. Prognostic implications of novel beta
199
cardiac myosin heavy chain gene mutations that cause familial hypertrophic cardiomyopathy. J Clin Invest 93:280-285.
376. Marian, A.J., and Roberts, R. 1995. Recent advances in the molecular genetics of hypertrophic cardiomyopathy. Circulation 92:1336-1347.
377. Schwartz, K., Carrier, L., Guicheney, P., and Komajda, M. 1995. Molecular basis of familial cardiomyopathies. Circulation 91:532-540.
378. Niimura, H., Bachinski, L.L., Sangwatanaroj, S., Watkins, H., Chudley, A.E., McKenna, W., Kristinsson, A., Roberts, R., Sole, M., Maron, B.J., et al. 1998. Mutations in the gene for cardiac myosin-binding protein C and late-onset familial hypertrophic cardiomyopathy. N Engl J Med 338:1248-1257.
379. Arad, M., Maron, B.J., Gorham, J.M., Johnson, W.H., Jr., Saul, J.P., Perez-Atayde, A.R., Spirito, P., Wright, G.B., Kanter, R.J., Seidman, C.E., et al. 2005. Glycogen storage diseases presenting as hypertrophic cardiomyopathy. N Engl J Med 352:362-372.
380. Blair, E., Redwood, C., Ashrafian, H., Oliveira, M., Broxholme, J., Kerr, B., Salmon, A., Ostman-Smith, I., and Watkins, H. 2001. Mutations in the gamma(2) subunit of AMP-activated protein kinase cause familial hypertrophic cardiomyopathy: evidence for the central role of energy compromise in disease pathogenesis. Hum Mol Genet 10:1215-1220.
381. Oliveira, S.M., Ehtisham, J., Redwood, C.S., Ostman-Smith, I., Blair, E.M., and Watkins, H. 2003. Mutation analysis of AMP-activated protein kinase subunits in inherited cardiomyopathies: implications for kinase function and disease pathogenesis. J Mol Cell Cardiol 35:1251-1255.
382. Murphy, R.T., Mogensen, J., McGarry, K., Bahl, A., Evans, A., Osman, E., Syrris, P., Gorman, G., Farrell, M., Holton, J.L., et al. 2005. Adenosine monophosphate-activated protein kinase disease mimicks hypertrophic cardiomyopathy and Wolff-Parkinson-White syndrome: natural history. J Am Coll Cardiol 45:922-930.
383. Gripp, K.W., Lin, A.E., Stabley, D.L., Nicholson, L., Scott, C.I., Jr., Doyle, D., Aoki, Y., Matsubara, Y., Zackai, E.H., Lapunzina, P., et al. 2006. HRAS mutation analysis in Costello syndrome: genotype and phenotype correlation. Am J Med Genet A 140:1-7.
384. Porciello, R., Divona, L., Strano, S., Carbone, A., Calvieri, C., and Giustini, S. 2008. Leopard syndrome. Dermatol Online J 14:7.
385. Gripp, K.W., Lin, A.E., Nicholson, L., Allen, W., Cramer, A., Jones, K.L., Kutz, W., Peck, D., Rebolledo, M.A., Wheeler, P.G., et al. 2007. Further delineation of the phenotype resulting from BRAF or MEK1 germline mutations helps differentiate cardio-facio-cutaneous syndrome from Costello syndrome. Am J Med Genet A 143A:1472-1480.
386. Rohini, A., Agrawal, N., Koyani, C.N., and Singh, R. Molecular targets and regulators of cardiac hypertrophy. Pharmacol Res 61:269-280.
200
387. D'Angelo, D.D., Sakata, Y., Lorenz, J.N., Boivin, G.P., Walsh, R.A., Liggett, S.B., and Dorn, G.W., 2nd. 1997. Transgenic Galphaq overexpression induces cardiac contractile failure in mice. Proc Natl Acad Sci U S A 94:8121-8126.
388. Mende, U., Kagen, A., Cohen, A., Aramburu, J., Schoen, F.J., and Neer, E.J. 1998. Transient cardiac expression of constitutively active Galphaq leads to hypertrophy and dilated cardiomyopathy by calcineurin-dependent and independent pathways. Proc Natl Acad Sci U S A 95:13893-13898.
389. Akhter, S.A., Luttrell, L.M., Rockman, H.A., Iaccarino, G., Lefkowitz, R.J., and Koch, W.J. 1998. Targeting the receptor-Gq interface to inhibit in vivo pressure overload myocardial hypertrophy. Science 280:574-577.
390. Wettschureck, N., Rutten, H., Zywietz, A., Gehring, D., Wilkie, T.M., Chen, J., Chien, K.R., and Offermanns, S. 2001. Absence of pressure overload induced myocardial hypertrophy after conditional inactivation of Galphaq/Galpha11 in cardiomyocytes. Nat Med 7:1236-1240.
391. Rockman, H.A., Koch, W.J., and Lefkowitz, R.J. 2002. Seven-transmembrane-spanning receptors and heart function. Nature 415:206-212.
392. Wilkins, B.J., and Molkentin, J.D. 2004. Calcium-calcineurin signaling in the regulation of cardiac hypertrophy. Biochem Biophys Res Commun 322:1178-1191.
393. Wilkins, B.J., Dai, Y.S., Bueno, O.F., Parsons, S.A., Xu, J., Plank, D.M., Jones, F., Kimball, T.R., and Molkentin, J.D. 2004. Calcineurin/NFAT coupling participates in pathological, but not physiological, cardiac hypertrophy. Circ Res 94:110-118.
394. Wu, X., Zhang, T., Bossuyt, J., Li, X., McKinsey, T.A., Dedman, J.R., Olson, E.N., Chen, J., Brown, J.H., and Bers, D.M. 2006. Local InsP3-dependent perinuclear Ca2+ signaling in cardiac myocyte excitation-transcription coupling. J Clin Invest 116:675-682.
395. Clerk, A., and Sugden, P.H. 1999. Activation of protein kinase cascades in the heart by hypertrophic G protein-coupled receptor agonists. Am J Cardiol 83:64H-69H.
396. Conlon, I., and Raff, M. 1999. Size control in animal development. Cell 96:235-244.
397. Neri Serneri, G.G., Boddi, M., Modesti, P.A., Cecioni, I., Coppo, M., Padeletti, L., Michelucci, A., Colella, A., and Galanti, G. 2001. Increased cardiac sympathetic activity and insulin-like growth factor-I formation are associated with physiological hypertrophy in athletes. Circ Res 89:977-982.
398. Shioi, T., Kang, P.M., Douglas, P.S., Hampe, J., Yballe, C.M., Lawitts, J., Cantley, L.C., and Izumo, S. 2000. The conserved phosphoinositide 3-kinase pathway determines heart size in mice. Embo J 19:2537-2548.
399. McMullen, J.R., Shioi, T., Huang, W.Y., Zhang, L., Tarnavski, O., Bisping, E., Schinke, M., Kong, S., Sherwood, M.C., Brown, J., et al. 2004. The insulin-like growth factor 1
201
receptor induces physiological heart growth via the phosphoinositide 3-kinase(p110alpha) pathway. J Biol Chem 279:4782-4793.
400. Luo, J., McMullen, J.R., Sobkiw, C.L., Zhang, L., Dorfman, A.L., Sherwood, M.C., Logsdon, M.N., Horner, J.W., DePinho, R.A., Izumo, S., et al. 2005. Class IA phosphoinositide 3-kinase regulates heart size and physiological cardiac hypertrophy. Mol Cell Biol 25:9491-9502.
401. Cantley, L.C. 2002. The phosphoinositide 3-kinase pathway. Science 296:1655-1657.
402. Proud, C.G. 2004. Ras, PI3-kinase and mTOR signaling in cardiac hypertrophy. Cardiovasc Res 63:403-413.
403. Shiojima, I., Sato, K., Izumiya, Y., Schiekofer, S., Ito, M., Liao, R., Colucci, W.S., and Walsh, K. 2005. Disruption of coordinated cardiac hypertrophy and angiogenesis contributes to the transition to heart failure. J Clin Invest 115:2108-2118.
404. Marin, T.M., Keith, K., Davies, B., Conner, D.A., Guha, P., Kalaitzidis, D., Wu, X., Lauriol, J., Wang, B., Bauer, M., et al. 2011. Rapamycin reverses hypertrophic cardiomyopathy in a mouse model of LEOPARD syndrome-associated PTPN11 mutation. J Clin Invest 121:1026-1043.
405. Rose, B.A., Force, T., and Wang, Y. 2010. Mitogen-activated protein kinase signaling in the heart: angels versus demons in a heart-breaking tale. Physiol Rev 90:1507-1546.
406. Matsumoto-Ida, M., Takimoto, Y., Aoyama, T., Akao, M., Takeda, T., and Kita, T. 2006. Activation of TGF-beta1-TAK1-p38 MAPK pathway in spared cardiomyocytes is involved in left ventricular remodeling after myocardial infarction in rats. Am J Physiol Heart Circ Physiol 290:H709-715.
407. Fischer, P., and Hilfiker-Kleiner, D. 2008. Role of gp130-mediated signalling pathways in the heart and its impact on potential therapeutic aspects. Br J Pharmacol 153 Suppl 1:S414-427.
408. Sugden, P.H., and Clerk, A. 1998. "Stress-responsive" mitogen-activated protein kinases (c-Jun N-terminal kinases and p38 mitogen-activated protein kinases) in the myocardium. Circ Res 83:345-352.
409. Bueno, O.F., and Molkentin, J.D. 2002. Involvement of extracellular signal-regulated kinases 1/2 in cardiac hypertrophy and cell death. Circ Res 91:776-781.
410. Lorenz, K., Schmitt, J.P., Vidal, M., and Lohse, M.J. 2009. Cardiac hypertrophy: targeting Raf/MEK/ERK1/2-signaling. Int J Biochem Cell Biol 41:2351-2355.
411. Hunter, J.J., Tanaka, N., Rockman, H.A., Ross, J., Jr., and Chien, K.R. 1995. Ventricular expression of a MLC-2v-ras fusion gene induces cardiac hypertrophy and selective diastolic dysfunction in transgenic mice. J Biol Chem 270:23173-23178.
202
412. Zheng, M., Dilly, K., Dos Santos Cruz, J., Li, M., Gu, Y., Ursitti, J.A., Chen, J., Ross, J., Jr., Chien, K.R., Lederer, J.W., et al. 2004. Sarcoplasmic reticulum calcium defect in Ras-induced hypertrophic cardiomyopathy heart. Am J Physiol Heart Circ Physiol 286:H424-433.
413. Mitchell, S., Ota, A., Foster, W., Zhang, B., Fang, Z., Patel, S., Nelson, S.F., Horvath, S., and Wang, Y. 2006. Distinct gene expression profiles in adult mouse heart following targeted MAP kinase activation. Physiol Genomics 25:50-59.
414. Glennon, P.E., Kaddoura, S., Sale, E.M., Sale, G.J., Fuller, S.J., and Sugden, P.H. 1996. Depletion of mitogen-activated protein kinase using an antisense oligodeoxynucleotide approach downregulates the phenylephrine-induced hypertrophic response in rat cardiac myocytes. Circ Res 78:954-961.
415. Clerk, A., Michael, A., and Sugden, P.H. 1998. Stimulation of the p38 mitogen-activated protein kinase pathway in neonatal rat ventricular myocytes by the G protein-coupled receptor agonists, endothelin-1 and phenylephrine: a role in cardiac myocyte hypertrophy? J Cell Biol 142:523-535.
416. Harris, I.S., Zhang, S., Treskov, I., Kovacs, A., Weinheimer, C., and Muslin, A.J. 2004. Raf-1 kinase is required for cardiac hypertrophy and cardiomyocyte survival in response to pressure overload. Circulation 110:718-723.
417. Olson, E.N., and Schneider, M.D. 2003. Sizing up the heart: development redux in disease. Genes Dev 17:1937-1956.
418. Bueno, O.F., De Windt, L.J., Tymitz, K.M., Witt, S.A., Kimball, T.R., Klevitsky, R., Hewett, T.E., Jones, S.P., Lefer, D.J., Peng, C.F., et al. 2000. The MEK1-ERK1/2 signaling pathway promotes compensated cardiac hypertrophy in transgenic mice. Embo J 19:6341-6350.
419. Sanna, B., Bueno, O.F., Dai, Y.S., Wilkins, B.J., and Molkentin, J.D. 2005. Direct and indirect interactions between calcineurin-NFAT and MEK1-extracellular signal-regulated kinase 1/2 signaling pathways regulate cardiac gene expression and cellular growth. Mol Cell Biol 25:865-878.
420. Purcell, N.H., Wilkins, B.J., York, A., Saba-El-Leil, M.K., Meloche, S., Robbins, J., and Molkentin, J.D. 2007. Genetic inhibition of cardiac ERK1/2 promotes stress-induced apoptosis and heart failure but has no effect on hypertrophy in vivo. Proc Natl Acad Sci U S A 104:14074-14079.
421. Kehat, I., Davis, J., Tiburcy, M., Accornero, F., Saba-El-Leil, M.K., Maillet, M., York, A.J., Lorenz, J.N., Zimmermann, W.H., Meloche, S., et al. 2011. Extracellular signal-regulated kinases 1 and 2 regulate the balance between eccentric and concentric cardiac growth. Circ Res 108:176-183.
422. Nicol, R.L., Frey, N., Pearson, G., Cobb, M., Richardson, J., and Olson, E.N. 2001. Activated MEK5 induces serial assembly of sarcomeres and eccentric cardiac hypertrophy. Embo J 20:2757-2767.
203
423. Kimura, T.E., Jin, J., Zi, M., Prehar, S., Liu, W., Oceandy, D., Abe, J., Neyses, L., Weston, A.H., Cartwright, E.J., et al. 2010. Targeted deletion of the extracellular signal-regulated protein kinase 5 attenuates hypertrophic response and promotes pressure overload-induced apoptosis in the heart. Circ Res 106:961-970.
424. Liao, P., Georgakopoulos, D., Kovacs, A., Zheng, M., Lerner, D., Pu, H., Saffitz, J., Chien, K., Xiao, R.P., Kass, D.A., et al. 2001. The in vivo role of p38 MAP kinases in cardiac remodeling and restrictive cardiomyopathy. Proc Natl Acad Sci U S A 98:12283-12288.
425. Petrich, B.G., Gong, X., Lerner, D.L., Wang, X., Brown, J.H., Saffitz, J.E., and Wang, Y. 2002. c-Jun N-terminal kinase activation mediates downregulation of connexin43 in cardiomyocytes. Circ Res 91:640-647.
426. Petrich, B.G., Molkentin, J.D., and Wang, Y. 2003. Temporal activation of c-Jun N-terminal kinase in adult transgenic heart via cre-loxP-mediated DNA recombination. Faseb J 17:749-751.
427. Knoll, R., Hoshijima, M., Hoffman, H.M., Person, V., Lorenzen-Schmidt, I., Bang, M.L., Hayashi, T., Shiga, N., Yasukawa, H., Schaper, W., et al. 2002. The cardiac mechanical stretch sensor machinery involves a Z disc complex that is defective in a subset of human dilated cardiomyopathy. Cell 111:943-955.
428. Brancaccio, M., Fratta, L., Notte, A., Hirsch, E., Poulet, R., Guazzone, S., De Acetis, M., Vecchione, C., Marino, G., Altruda, F., et al. 2003. Melusin, a muscle-specific integrin beta1-interacting protein, is required to prevent cardiac failure in response to chronic pressure overload. Nat Med 9:68-75.
429. Heineke, J., Ruetten, H., Willenbockel, C., Gross, S.C., Naguib, M., Schaefer, A., Kempf, T., Hilfiker-Kleiner, D., Caroni, P., Kraft, T., et al. 2005. Attenuation of cardiac remodeling after myocardial infarction by muscle LIM protein-calcineurin signaling at the sarcomeric Z-disc. Proc Natl Acad Sci U S A 102:1655-1660.
430. Maron, B.J., Gardin, J.M., Flack, J.M., Gidding, S.S., Kurosaki, T.T., and Bild, D.E. 1995. Prevalence of hypertrophic cardiomyopathy in a general population of young adults. Echocardiographic analysis of 4111 subjects in the CARDIA Study. Coronary Artery Risk Development in (Young) Adults. Circulation 92:785-789.
431. Soor, G.S., Luk, A., Ahn, E., Abraham, J.R., Woo, A., Ralph-Edwards, A., and Butany, J. 2009. Hypertrophic cardiomyopathy: current understanding and treatment objectives. J Clin Pathol 62:226-235.
432. Su, I.H., Basavaraj, A., Krutchinsky, A.N., Hobert, O., Ullrich, A., Chait, B.T., and Tarakhovsky, A. 2003. Ezh2 controls B cell development through histone H3 methylation and Igh rearrangement. Nat Immunol 4:124-131.
433. Haj, F.G., Markova, B., Klaman, L.D., Bohmer, F.D., and Neel, B.G. 2003. Regulation of receptor tyrosine kinase signaling by protein tyrosine phosphatase-1B. J Biol Chem 278:739-744.
204
434. Todaro, G.J., and Green, H. 1963. Quantitative studies of the growth of mouse embryo cells in culture and their development into established lines. J Cell Biol 17:299-313.
435. Zobel, C., Kassiri, Z., Nguyen, T.T., Meng, Y., and Backx, P.H. 2002. Prevention of hypertrophy by overexpression of Kv4.2 in cultured neonatal cardiomyocytes. Circulation 106:2385-2391.
436. Chan, G., Kalaitzidis, D., Usenko, T., Kutok, J.L., Yang, W., Mohi, M.G., and Neel, B.G. 2009. Leukemogenic Ptpn11 causes fatal myeloproliferative disorder via cell-autonomous effects on multiple stages of hematopoiesis. Blood 113:4414-4424.
437. Schoenfeld, J.R., Vasser, M., Jhurani, P., Ng, P., Hunter, J.J., Ross, J., Jr., Chien, K.R., and Lowe, D.G. 1998. Distinct molecular phenotypes in murine cardiac muscle development, growth, and hypertrophy. J Mol Cell Cardiol 30:2269-2280.
438. Tartaglia, M., and Gelb, B.D. 2005. Noonan syndrome and related disorders: genetics and pathogenesis. Annu Rev Genomics Hum Genet 6:45-68.
439. Rauen, K.A., Schoyer, L., McCormick, F., Lin, A.E., Allanson, J.E., Stevenson, D.A., Gripp, K.W., Neri, G., Carey, J.C., Legius, E., et al. Proceedings from the 2009 genetic syndromes of the Ras/MAPK pathway: From bedside to bench and back. Am J Med Genet A 152A:4-24.
440. Chan, G., Kalaitzidis, D., and Neel, B.G. 2008. The tyrosine phosphatase Shp2 (PTPN11) in cancer. Cancer Metastasis Rev 27:179-192.
441. Nishikawa, T., Ishiyama, S., Shimojo, T., Takeda, K., Kasajima, T., and Momma, K. 1996. Hypertrophic cardiomyopathy in Noonan syndrome. Acta Paediatr Jpn 38:91-98.
442. Sznajer, Y., Keren, B., Baumann, C., Pereira, S., Alberti, C., Elion, J., Cave, H., and Verloes, A. 2007. The spectrum of cardiac anomalies in Noonan syndrome as a result of mutations in the PTPN11 gene. Pediatrics 119:e1325-1331.
443. Chen, X., Mitsutake, N., LaPerle, K., Akeno, N., Zanzonico, P., Longo, V.A., Mitsutake, S., Kimura, E.T., Geiger, H., Santos, E., et al. 2009. Endogenous expression of Hras(G12V) induces developmental defects and neoplasms with copy number imbalances of the oncogene. Proc Natl Acad Sci U S A 106:7979-7984.
444. Marin, T.M., Keith, K., Davies, B., Conner, D.A., Guha, P., Kalaitzidis, D., Wu, X., Bauer, M., Bronson, R., Franchini, K.G., et al. 2010. Rapamycin normalizes hypertrophic cardiomyopathy in a mouse model of LEOPARD Syndrome-associated PTPN11 mutation. J Clin Invest. In revision.
445. Martinelli, S., De Luca, A., Stellacci, E., Rossi, C., Checquolo, S., Lepri, F., Caputo, V., Silvano, M., Buscherini, F., Consoli, F., et al. 2011. Heterozygous germline mutations in the CBL tumor-suppressor gene cause a Noonan syndrome-like phenotype. Am J Hum Genet 87:250-257.
205
446. Allanson, J.E., Bohring, A., Dorr, H.G., Dufke, A., Gillessen-Kaesbach, G., Horn, D., Konig, R., Kratz, C.P., Kutsche, K., Pauli, S., et al. The face of Noonan syndrome: Does phenotype predict genotype. Am J Med Genet A 152A:1960-1966.
447. Hasle, H. 2009. Malignant diseases in Noonan syndrome and related disorders. Horm Res 72 Suppl 2:8-14.
448. Maron, B.J., Roberts, W.C., Arad, M., Haas, T.S., Spirito, P., Wright, G.B., Almquist, A.K., Baffa, J.M., Saul, J.P., Ho, C.Y., et al. 2009. Clinical outcome and phenotypic expression in LAMP2 cardiomyopathy. Jama 301:1253-1259.
449. Ross, J., Jr., and Sobel, B.E. 1972. Regulation of cardiac contraction. Annu Rev Physiol 34:47-90.
450. Nakagawa, O., Ogawa, Y., Itoh, H., Suga, S., Komatsu, Y., Kishimoto, I., Nishino, K., Yoshimasa, T., and Nakao, K. 1995. Rapid transcriptional activation and early mRNA turnover of brain natriuretic peptide in cardiocyte hypertrophy. Evidence for brain natriuretic peptide as an "emergency" cardiac hormone against ventricular overload. J Clin Invest 96:1280-1287.
451. Takeda, N., Manabe, I., Uchino, Y., Eguchi, K., Matsumoto, S., Nishimura, S., Shindo, T., Sano, M., Otsu, K., Snider, P., et al. Cardiac fibroblasts are essential for the adaptive response of the murine heart to pressure overload. J Clin Invest 120:254-265.
452. Thum, T., Gross, C., Fiedler, J., Fischer, T., Kissler, S., Bussen, M., Galuppo, P., Just, S., Rottbauer, W., Frantz, S., et al. 2008. MicroRNA-21 contributes to myocardial disease by stimulating MAP kinase signalling in fibroblasts. Nature 456:980-984.
453. Barrett, S.D., Bridges, A.J., Dudley, D.T., Saltiel, A.R., Fergus, J.H., Flamme, C.M., Delaney, A.M., Kaufman, M., LePage, S., Leopold, W.R., et al. 2008. The discovery of the benzhydroxamate MEK inhibitors CI-1040 and PD 0325901. Bioorg Med Chem Lett 18:6501-6504.
454. Bertola, D.R., Pereira, A.C., de Oliveira, P.S., Kim, C.A., and Krieger, J.E. 2004. Clinical variability in a Noonan syndrome family with a new PTPN11 gene mutation. Am J Med Genet A 130A:378-383.
455. Bueno, O.F., De Windt, L.J., Lim, H.W., Tymitz, K.M., Witt, S.A., Kimball, T.R., and Molkentin, J.D. 2001. The dual-specificity phosphatase MKP-1 limits the cardiac hypertrophic response in vitro and in vivo. Circ Res 88:88-96.
456. Xu, J., Ismat, F.A., Wang, T., Lu, M.M., Antonucci, N., and Epstein, J.A. 2009. Cardiomyocyte-specific loss of neurofibromin promotes cardiac hypertrophy and dysfunction. Circ Res 105:304-311.
457. Ieda, M., Tsuchihashi, T., Ivey, K.N., Ross, R.S., Hong, T.T., Shaw, R.M., and Srivastava, D. 2009. Cardiac fibroblasts regulate myocardial proliferation through beta1 integrin signaling. Dev Cell 16:233-244.
206
458. Miragoli, M., Gaudesius, G., and Rohr, S. 2006. Electrotonic modulation of cardiac impulse conduction by myofibroblasts. Circ Res 98:801-810.
459. Margetic, S., Gazzola, C., Pegg, G.G., and Hill, R.A. 2002. Leptin: a review of its peripheral actions and interactions. Int J Obes Relat Metab Disord 26:1407-1433.
460. Bjorbaek, C., Buchholz, R.M., Davis, S.M., Bates, S.H., Pierroz, D.D., Gu, H., Neel, B.G., Myers, M.G., Jr., and Flier, J.S. 2001. Divergent roles of SHP-2 in ERK activation by leptin receptors. J Biol Chem 276:4747-4755.
461. Zhang, E.E., Chapeau, E., Hagihara, K., and Feng, G.S. 2004. Neuronal Shp2 tyrosine phosphatase controls energy balance and metabolism. Proc Natl Acad Sci U S A 101:16064-16069.
462. Opitz, J.M. 1985. The Noonan syndrome. Am J Med Genet 21:515-518.
463. Tartaglia, M., Gelb, B.D., and Zenker, M. 2011. Noonan syndrome and clinically related disorders. Best Pract Res Clin Endocrinol Metab 25:161-179.
464. Wu, X., Simpson, J., Hong, J.H., Kim, K.H., Thavarajah, N.K., Backx, P.H., Neel, B.G., and Araki, T. 2011. MEK-ERK pathway modulation ameliorates disease phenotypes in a mouse model of Noonan syndrome associated with the Raf1(L613V) mutation. J Clin Invest 121:1009-1025.
465. Chen, P.C., Wakimoto, H., Conner, D., Araki, T., Yuan, T., Roberts, A., Seidman, C.E., Bronson, R., Neel, B.G., Seidman, J.G., et al. 2010. Activation of multiple signaling pathways causes developmental defects in mice with a Noonan syndrome-associated Sos1 mutation. J Clin Invest 120:4353-4365.
466. Takeda, N., Manabe, I., Uchino, Y., Eguchi, K., Matsumoto, S., Nishimura, S., Shindo, T., Sano, M., Otsu, K., Snider, P., et al. 2010. Cardiac fibroblasts are essential for the adaptive response of the murine heart to pressure overload. J Clin Invest 120:254-265.
467. Dhandapany, P.S., Fabris, F., Tonk, R., Illaste, A., Karakikes, I., Sorourian, M., Sheng, J., Hajjar, R.J., Tartaglia, M., Sobie, E.A., et al. 2011. Cyclosporine attenuates cardiomyocyte hypertrophy induced by RAF1 mutants in Noonan and LEOPARD syndromes. J Mol Cell Cardiol 51:4-15.
468. Johnson, L.N., Lowe, E.D., Noble, M.E., and Owen, D.J. 1998. The Eleventh Datta Lecture. The structural basis for substrate recognition and control by protein kinases. FEBS Lett 430:1-11.
469. Chong, H., Vikis, H.G., and Guan, K.L. 2003. Mechanisms of regulating the Raf kinase family. Cell Signal 15:463-469.
470. Karreth, F.A., DeNicola, G.M., Winter, S.P., and Tuveson, D.A. 2009. C-Raf inhibits MAPK activation and transformation by B-Raf(V600E). Mol Cell 36:477-486.
207
471. Hinselwood, D.C., Abrahamsen, T.W., and Ekstrom, P.O. 2005. BRAF mutation detection and identification by cycling temperature capillary electrophoresis. Electrophoresis 26:2553-2561.
472. Jung, C.K., Im, S.Y., Kang, Y.J., Lee, H., Jung, E.S., Kang, C.S., Bae, J.S., and Choi, Y.J. 2012. Mutational patterns and novel mutations of BRAF gene in a large cohort of Korean patients with papillary thyroid carcinoma. Thyroid.
473. LoRusso, P.M., Krishnamurthi, S.S., Rinehart, J.J., Nabell, L.M., Malburg, L., Chapman, P.B., DePrimo, S.E., Bentivegna, S., Wilner, K.D., Tan, W., et al. 2010. Phase I pharmacokinetic and pharmacodynamic study of the oral MAPK/ERK kinase inhibitor PD-0325901 in patients with advanced cancers. Clin Cancer Res 16:1924-1937.
474. Haura, E.B., Ricart, A.D., Larson, T.G., Stella, P.J., Bazhenova, L., Miller, V.A., Cohen, R.B., Eisenberg, P.D., Selaru, P., Wilner, K.D., et al. 2010. A phase II study of PD-0325901, an oral MEK inhibitor, in previously treated patients with advanced non-small cell lung cancer. Clin Cancer Res 16:2450-2457.
475. Morimoto, T., Hasegawa, K., Wada, H., Kakita, T., Kaburagi, S., Yanazume, T., and Sasayama, S. 2001. Calcineurin-GATA4 pathway is involved in beta-adrenergic agonist-responsive endothelin-1 transcription in cardiac myocytes. J Biol Chem 276:34983-34989.
476. Molkentin, J.D., Lu, J.R., Antos, C.L., Markham, B., Richardson, J., Robbins, J., Grant, S.R., and Olson, E.N. 1998. A calcineurin-dependent transcriptional pathway for cardiac hypertrophy. Cell 93:215-228.
477. Liang, Q., Wiese, R.J., Bueno, O.F., Dai, Y.S., Markham, B.E., and Molkentin, J.D. 2001. The transcription factor GATA4 is activated by extracellular signal-regulated kinase 1- and 2-mediated phosphorylation of serine 105 in cardiomyocytes. Mol Cell Biol 21:7460-7469.
478. Camelliti, P., Borg, T.K., and Kohl, P. 2005. Structural and functional characterisation of cardiac fibroblasts. Cardiovasc Res 65:40-51.
479. Gray, M.O., Long, C.S., Kalinyak, J.E., Li, H.T., and Karliner, J.S. 1998. Angiotensin II stimulates cardiac myocyte hypertrophy via paracrine release of TGF-beta 1 and endothelin-1 from fibroblasts. Cardiovasc Res 40:352-363.
480. Chen, J., Kubalak, S.W., Minamisawa, S., Price, R.L., Becker, K.D., Hickey, R., Ross, J., Jr., and Chien, K.R. 1998. Selective requirement of myosin light chain 2v in embryonic heart function. J Biol Chem 273:1252-1256.
481. Robson, A., Allinson, K.R., Anderson, R.H., Henderson, D.J., and Arthur, H.M. 2010. The TGFbeta type II receptor plays a critical role in the endothelial cells during cardiac development. Dev Dyn 239:2435-2442.
208
482. Lavine, K.J., Long, F., Choi, K., Smith, C., and Ornitz, D.M. 2008. Hedgehog signaling to distinct cell types differentially regulates coronary artery and vein development. Development 135:3161-3171.
483. Sohal, D.S., Nghiem, M., Crackower, M.A., Witt, S.A., Kimball, T.R., Tymitz, K.M., Penninger, J.M., and Molkentin, J.D. 2001. Temporally regulated and tissue-specific gene manipulations in the adult and embryonic heart using a tamoxifen-inducible Cre protein. Circ Res 89:20-25.
484. Bhowmick, N.A., Chytil, A., Plieth, D., Gorska, A.E., Dumont, N., Shappell, S., Washington, M.K., Neilson, E.G., and Moses, H.L. 2004. TGF-beta signaling in fibroblasts modulates the oncogenic potential of adjacent epithelia. Science 303:848-851.
485. Zeisberg, E.M., Tarnavski, O., Zeisberg, M., Dorfman, A.L., McMullen, J.R., Gustafsson, E., Chandraker, A., Yuan, X., Pu, W.T., Roberts, A.B., et al. 2007. Endothelial-to-mesenchymal transition contributes to cardiac fibrosis. Nat Med 13:952-961.
486. Loffredo, F.S., Steinhauser, M.L., Gannon, J., and Lee, R.T. 2011. Bone marrow-derived cell therapy stimulates endogenous cardiomyocyte progenitors and promotes cardiac repair. Cell Stem Cell 8:389-398.
487. Zheng, B., Zhang, Z., Black, C.M., de Crombrugghe, B., and Denton, C.P. 2002. Ligand-dependent genetic recombination in fibroblasts : a potentially powerful technique for investigating gene function in fibrosis. Am J Pathol 160:1609-1617.
488. Cai, C.L., Martin, J.C., Sun, Y., Cui, L., Wang, L., Ouyang, K., Yang, L., Bu, L., Liang, X., Zhang, X., et al. 2008. A myocardial lineage derives from Tbx18 epicardial cells. Nature 454:104-108.
489. Wu, X., Yin, J., Simpson, J., Kim, K.H., Gu, S., Hong, J.H., Bayliss, P., Backx, P.H., Neel, B.G., and Araki, T. 2012. Increased BRAF Heterodimerization Is the Common Pathogenic Mechanism for Noonan Syndrome-Associated RAF1 Mutants. Mol Cell Biol 32:3872-3890.
490. Moses, K.A., DeMayo, F., Braun, R.M., Reecy, J.L., and Schwartz, R.J. 2001. Embryonic expression of an Nkx2-5/Cre gene using ROSA26 reporter mice. Genesis 31:176-180.
491. Broman, K.W., Wu, H., Sen, S., and Churchill, G.A. 2003. R/qtl: QTL mapping in experimental crosses. Bioinformatics 19:889-890.
492. McClellan, J., and King, M.C. 2010. Genetic heterogeneity in human disease. Cell 141:210-217.
493. Mott, R. 2007. A haplotype map for the laboratory mouse. Nat Genet 39:1054-1056.