the monomer-binding orphan receptor rev-erb represses transcription as a dimer on a novel

MOLECULAR AND CELLULAR BIOLOGY, Sept. 1995, p. 4791–4802 Vol. 15, No. 90270-7306/95/$04.0010Copyright q 1995, American Society for Microbiology

The Monomer-Binding Orphan Receptor Rev-Erb RepressesTranscription as a Dimer on a Novel Direct Repeat

HEATHER P. HARDING AND MITCHELL A. LAZAR*

Departments of Medicine and Genetics, University of Pennsylvania School of Medicine,Philadelphia, Pennsylvania 19104

Received 7 March 1995/Returned for modification 13 April 1995/Accepted 31 May 1995

Rev-Erb is an orphan nuclear receptor which binds as a monomer to the thyroid/retinoic acid receptorhalf-site AGGTCA flanked 5* by an A/T-rich sequence, referred to here as a Rev monomer site. Fusion ofRev-Erb to the DNA binding domain of yeast GAL4 strongly repressed basal transcription of a GAL4-luciferasereporter gene as a result of the presence of a C-terminal domain containing both the hinge and heptad repeatregions. Nevertheless, wild-type Rev-Erb did not repress basal transcription from the Rev monomer bindingsite. Therefore, a DNA binding site selection strategy was devised to test the hypothesis that Rev-Erb mayfunction on a different site as a dimer. This approach identified sequences containing two Rev monomer sitesarranged as direct repeats with the AGGTCAmotifs separated by 2 bp (Rev-DR2). Remarkably, Rev-Erb boundas a homodimer to Rev-DR2 but not to other direct repeats or to a standard DR2 sequence. The DNA bindingdomain contained all of the determinants for Rev-DR2-specific homodimerization. Rev-Erb bound coopera-tively as a homodimer to Rev-DR2, and this interaction was 5 to 10 times more stable than Rev-Erb monomerbinding to the Rev monomer site. Functionally, Rev-Erb markedly repressed the basal activity of a variety ofpromoters with a strong Rev-DR2 specificity. The C terminus was required for this repression, consistent withthe GAL4 results. However, the Rev-DR2 specificity did not require the C terminus in vivo, since fusion ofC-terminally truncated Rev-Erb to a heterologous transactivation domain created a transcriptional activatorspecific for Rev-DR2. In addition to idealized Rev-DR2 sites, Rev-Erb also repressed basal as well as retinoicacid-induced transcription from a naturally occurring Rev-DR2 in the CRBPI gene. Thus, although Rev-Erbis distinguished from other thyroid/steroid receptor superfamily members by its ability to bind DNA as amonomer, it functions as a homodimer to repress transcription of genes containing a novel DR2 element.

The nuclear hormone receptor superfamily of transcriptionfactors includes an expanding group of ‘‘orphan’’ receptors inaddition to receptors for classical hormones such as retinoids,vitamin D, thyroid hormone (T3), and steroid hormones (25,36). Orphan nuclear receptors play fundamental roles ingrowth and differentiation of mammals as well as lower spe-cies, although it is not known which ligands, if any, regulatetheir transcriptional activity (65). The nuclear receptors bindto DNA through two zinc-coordinated modules (26, 32). Theprimary determinant of nuclear receptor DNA binding speci-ficity is the so-called P box, which for most orphan receptors isidentical to that of retinoid receptors, T3 receptor (TR), andvitamin D receptor (VDR). As a result, these receptors recog-nize the hexamer AGGTCA rather than AGAACA, which isthe target of steroid hormone receptors (21, 37, 79). However,the affinity of receptor monomers for these simple hexamers isinsufficient for transcriptional regulation in vivo, and the re-ceptors have additional properties which enable them to bindto response elements with higher affinity. Steroid hormonereceptors, for example, bind with high affinity as homodimersto two inverted AGAACA half-sites separated by 3 bp. Thehomodimeric interaction primarily occurs through the D-boxregion within the C domain (60). The AGGTCA-binding nu-clear receptors are even more complicated, and at least threedifferent mechanisms for high-affinity binding have evolved,defining subgroups which bind DNA as (i) heterodimers with

retinoid X receptor (RXR), (ii) homodimers, or (iii) mono-mers (reviewed in reference 35).The retinoid receptors, TR, and VDR bind with highest

affinity as heterodimers with RXR to direct repeats (DRs) ofthe AGGTCA motif (9, 11, 48, 57, 61, 87). The heterodimericinteraction is mediated by at least two domains. The strongestinteraction is demonstrable in the absence of DNA and in-volves the so-called ninth heptad of the C-terminal ligandbinding domain (2). A second, weaker heterodimerization do-main involves regions within the DNA binding domain (DBD)and also serves to dictate the spacing between the half sites insuch a way that VDR prefers a spacing of 3 bp (DR3), whereasTR prefers DR4 and retinoic acid (RA) receptor (RAR) bindswith highest affinity to DR1, DR2, and DR5 (68, 85). Certainorphan receptors, including MB67, RLD-1, ubiquitous recep-tor, and LXR, also bind with highest affinity to DRs as het-erodimers with RXR (1, 4, 75, 81). RXR also binds to DR1 asa homodimer, utilizing regions within the DBD together withan adjacent (C-terminal side) extended a helix known as theT/A box (56, 84). A number of orphan receptors, most notablyCOUP-TF and its relatives, bind with highest affinity as ho-modimers to direct and inverted repeats with minimal spacingrequirements (20). A third group of receptors binds to DNAwith high affinity as a monomer, utilizing the C-terminal ex-tension of the DBD to interact with specific sequences in theminor groove 59 to the AGGTCA half-site. This subgroup canbe further subdivided by the specific 59 sequences recognized.Most are orphan receptors, although TR also interacts withDNA as a monomer (22, 27, 52), preferring the sequenceTAAGGTCA (46, 47, 72). The orphan receptor NGFI-B (alsoknown as nur77) and the related receptors RNR and NURR1prefer AAAGGTCA (51, 71, 82), SF-1 and related receptor

* Corresponding author. Mailing address: University of Pennsylva-nia School of Medicine, 611 CRB, 415 Curie Blvd., Philadelphia, PA19104-6149. Phone: (215) 898-0198. Fax: (215) 898-5408. Electronicmail address: [email protected].

4791

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 21

Nov

embe

r 20

21 b

y 21

6.15

5.68

.194

.

FTZ-F1 bind TCAAGGTCA (78, 83), and Rev-Erb (alsoknown as ear-1 [41]) and related receptors ROR (also knownas RZR [13, 34]) and BD73 (also known as RVR and Rev-Erbb [23, 28, 70]) bind strongly to WAWNTAGGTCA (whereW 5 A or T).DNA binding by nuclear receptors has numerous transcrip-

tional outcomes. A highly conserved ligand-inducible activa-tion function (AF-2) in the ligand binding domain allows hor-mone receptors to stimulate transcription in the presence oftheir cognate ligands (7, 8, 24, 58), probably by exposing anautonomous activation domain to transcriptional coactivatorproteins (15, 38, 55). RAR and TR also repress transcription inthe absence of ligand via a silencing function of the ligandbinding domain (6). Some orphan receptors such as MB67,RLD-1, RORa1, and SF1 activate transcription without addi-tion of a known ligand, which may reflect either true constitu-tive activity or the presence of an intracellular ligand (1, 4, 34,83). Other orphan receptors such as COUP-TF and TRa2 donot greatly affect transcription on their own but may functionto repress transcription by competing for DNA binding siteswith activating nuclear receptors (19, 45, 50, 77).Rev-Erb is an interesting orphan nuclear receptor which is

encoded on the noncoding strand of the TRa gene in multiplemammalian species (53, 63). Rev-Erb is induced during adi-pocyte differentiation, but its biological function is unknown(16). The most distinctive feature of Rev-Erb is its unique andunusually long hinge region, whose function is unknown. Rev-Erb and RORa1 are nearly identical in the T-box regions (34,41), which are likely to specify the extended half-site recog-nized by monomer-binding receptors (84). Whereas RORa1can activate transcription as a monomer, Rev-Erb lacks theautonomous activation domain which is preserved in the Ctermini of the majority of transcription-stimulating nuclearreceptors, and although we initially found that Rev-Erb hadthe ability to function as an activator, we and others have morerecently concluded that monomeric Rev-Erb is not transcrip-tionally active (23, 28). Here we report that the Rev-Erb Cterminus contains a strong repression domain which can betransferred to the DBD of GAL4. Since Rev-Erb did notrepress basal transcription from the monomeric binding sitewhich we originally identified with the sequence amplificationand binding method, we modified the technique to search fordimeric, potentially higher-affinity binding sites. Remarkably,Rev-Erb was found to bind cooperatively as a homodimer to adirect repeat of its monomer binding site with the AGGTCAhexamers separated by 2 bp and greatly repressed transcriptionfrom this site but not from other DRs. Sequence-specific ho-modimerization required only the Rev-Erb DBD, whereas re-pression required both the DBD and the COOH-terminal re-pression domain. Thus, Rev-Erb has the novel property ofrepressing transcription directly from novel high-affinity sitesto which it binds as a homodimer.

MATERIALS AND METHODSMammalian expression vectors. GAL4(1–147), GAL4-VP16, and Rev-Erb

CDM expression vectors have been previously described (41, 45). GAL4-Rev-Erb fusions were created by insertion of fragments of human Rev-Erb cDNA(54) into polylinker sites of the GAL4 expression vector in order to createin-frame fusion genes as follows: for GAL4-Rev 200-614, XhoI (bp 798)-XhoI(polylinker) filled in with Klenow enzyme and subcloned into the SmaI site ofGAL4; for GAL4-Rev 289-614, EcoRV (bp 1058)-XbaI (polylinker), and forGAL4-Rev 376-614, PvuII (bp 1332)-XbaI (polylinker), into the SmaI and XbaIsites of GAL4; for GAL4-Rev 432-614, a PCR product with BamHI (bp 1499)-XhoI ends into the BamHI and SalI sites of GAL4. Each of these chimerascontains the natural translational termination codon from the Rev-Erb cDNA.GAL4-Rev 200-288 and GAL4-Rev 200-471 were created by inserting an oligo-nucleotide containing a stop codon at the EcoRV (bp 1058) and EcoNI (bp 1616)sites of GAL4-human Rev 200-614, respectively. RevDC288 was created by

insertion of a stop codon into the EcoRV site of the Rev-Erb expression vector.The RORa1 expression vector was kindly supplied by V. Giguere (34).Rev-Erb-K was created by inserting the HindIII-XhoI fragment from a PCR

product with primer-derived HindIII and ClaI sites followed by a consensustranslational start site and Rev-Erb cDNA bp 205 to 798 (amino acids 2 to 199)and the natural XhoI site into the HindIII (59 polylinker)-XhoI (bp 798) sites ofthe Rev-Erb expression vector. VP16-Rev-Erb was created by insertion of a PCRproduct containing a primer-derived HindIII site, an ATG, and then the codingregion for VP16 amino acids 412 to 490 followed by a ClaI site into the HindIIIand ClaI sites of Rev-Erb-K. VP16-RevDC288 was created by insertion of anoligonucleotide containing a stop codon into the EcoRV site of VP16-Rev-Erb.pSG5-RARg was generously provided by P. Chambon. All PCR products andligation junctions were sequenced.Reporter plasmids.Double-stranded oligonucleotides containing a single copy

of each binding site were inserted into the BglII site of pTK-luciferase (gift of D.Moore) or into the BamHI site of pGL2-promoter (Promega) for thymidinekinase (TK) and simian virus 40-driven luciferase reporters. The oligonucleotidesfor Rev-DR1 through Rev-DR5 and the Rev monomer site contained the se-quences shown in Fig. 4A with the addition of BamHI ends. The inserts forDR2-All C and CRBPI reporters are CCCCCAGGTCACCAGGTCAAA andAGTCTTTAGTAGGTCAAAAGGTCAAGACAC, respectively (43, 74). TheGAL4 simian virus 40-luciferase reporter contained five copies of the GAL417-mer binding site (CGGAGTACTGTCCTCG) inserted into the SmaI-BglIIsites of pGL2-promoter. All constructs were sequenced to verify the correctbases and number of copies of the inserts.Cell culture and transfection. JEG3 cells were maintained and transfected in

low glucose Dulbecco modified Eagle medium (DMEM) containing 10% calfserum. HepG2 cells were maintained in RPMI–10% fetal calf serum butswitched to high-glucose DMEM–10% fetal calf serum for transfection. NIH3T3, CV-1, and 293T cells were maintained and transfected in high-glucoseDMEM–10% fetal calf serum. For the experiment shown in Fig. 10, JEG3 cellswere switched to low-glucose DMEM with 10% charcoal-stripped fetal calfserum 1 h prior to transfection. One micromolar all-trans RA in ethanol orethanol alone was added 16 h after transfection, and cells were harvested 24 hlater. For transcription assays, 60-mm-diameter dishes were transfected by thecalcium phosphate precipitation method, using 5 to 10 mg of receptor expressionvector or as indicated in figure legends, 1 mg of luciferase reporter, and 0.5 mg ofb-galactosidase (b-Gal) expression vector. Cells were lysed in Triton X-100buffer, and b-Gal and luciferase assays were carried out by using standardprotocols (3). Results were expressed either as relative light units or as activityrelative to the control level, normalized to b-Gal activity, which served as internalcontrol for transfection efficiency. Fold repression was calculated as the activityof a given reporter after transfection with a control expression vector divided byactivity of the same reporter in the presence of the Rev-Erb expression vector.Figures show the results of representative experiments in which individual datumpoints were assayed in duplicate or triplicate, and the range or standard error ofthe mean, respectively, is shown. Each experiment was repeated two to five times.Although there was a modest variation in the basal activities of individual TK-luciferase reporters from experiment to experiment, basal expression from Rev-DR2 was intermediate, and the degree of repression from a given site was highlyconsistent from experiment to experiment.Western blot (immunoblot) analysis. Western blotting of cell extracts was

done as previously described (45), using a rabbit anti-GAL4 DBD antibody (kindgift of F. Rauscher) at a dilution of 1/5,000.EMSA. Extracts of 293T or JEG3 cells were prepared as described by Ume-

sono et al. (80) after cotransfection with 10 mg of expression plasmid, 2 mg ofreporter gene, and 0.5 mg of b-Gal expression vector. Other proteins wereprepared in vitro with the TNT T7 kit (Promega) from plasmids containing theappropriate cDNAs under the control of the T7 promoter. Electrophoreticmobility shift assays (EMSAs) were was performed as previously described (23)except that for Fig. 1C (GAL4 binding site), the gel contained 1% glycerol andthe reaction mixture contained 40 mM N-2-hydroxyethylpiperazine-N9-2-ethane-sulfonic acid (HEPES; pH 7.9), 50 mM KCl, 5 mM MgCl2, 0.2 mg of bovineserum albumin per ml, 1 mM ZnCl2, and 6% glycerol (final concentrations)instead of the usual reaction buffer. For half-life experiments, 5% gels wereprerun for at least 2 h prior to loading. Proteins were preincubated with labeledprobe for 1 h at room temperature, and then the first lane was loaded into therunning gel, a 500-fold molar excess of unlabeled DNA competitor was added tothe remaining reaction mix, and equal aliquots were loaded onto the remaininglanes at the times indicated in the relevant figure.In vitro translation vectors. The BBV-Rev-Erb in vitro expression vector has

been previously described (23). RevDN103 was created by inserting the NaeI-XhoI fragment from a PCR product with a primer-derived NaeI site followed bythe Rev-Erb cDNA encoding amino acids 103 to 199 (bp 505 to 798) along withthe Rev-Erb cDNA XhoI (bp 798)-XbaI (polylinker) fragment into the BBVparent vector. Rev-DBD (amino acids 103 to 225) and RevDC288 were createdby insertion of an oligonucleotide containing a stop codon into the BstEII andEcoRV sites of RevDN103 and BBV-Rev-Erb, respectively. RevDN220 was con-structed by insertion of the XhoI (bp 798)-HindIII fragment of Rev-Erb cDNAinto the HindIII sites of pCMX, using a HindIII-Xho linker. The size of theprotein was consistent with translational initiation at the next natural methioninecodon (amino acid 220). All PCR products were sequenced after cloning, and all

4792 HARDING AND LAZAR MOL. CELL. BIOL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 21

Nov

embe

r 20

21 b

y 21

6.15

5.68

.194

.

ligation products were confirmed by restriction enzyme mapping and sequencingof ligation junctions. HA (hemagglutinin)-Rev-Erb was created by insertion of aBamHI fragment of rat Rev-Erb into the BglII site of a T7 promoter-drivenexpression vector encoding the HA epitope (66), creating an in-frame fusion ofthe HA epitope with amino acid 22 of Rev-Erb.Coimmunoprecipitation. Cotranslated proteins were incubated in 75 ml of

buffer H (20 mM HEPES, 50 mM KCl, 2 mM EDTA, 0.1% Nonidet P-40, 10%glycerol, 0.5% nonfat dry milk, 5 mM dithiothreitol) with an excess of theindicated DNA (2.5 pmol of probe to ;45 fmol of protein) or with no DNA.Samples were incubated 20 min at room temperature (RT) and then preclearedtwice with 50 ml of protein A-Sepharose in buffer H for 15 min at RT on arotator. Precleared supernatants were incubated on a rotator for 1 h at RT with50 ml of protein-Sepharose prebound with 2 ml of HA antibody or with beadsalone and then centrifuged for 10 s. The beads were then washed four times with1 ml of ice-cold buffer H, boiled in 13 sodium dodecyl sulfate loading buffer, andseparated by electrophoresis on a 15% polyacrylamide gel. Gels were fixed,treated with En3Hance, dried, and autoradiographed. Results of two indepen-dent experiments were quantitated with a Molecular Dynamics densitometer.Binding site selection. The sequence amplification and binding method was

modified from our previous protocol (41), which was based on the method ofBlackwell et al. (10). The N4AGGTCAN12 random oligonucleotide pool andprimers A and B were previously described (41). One hundred fifty picomoles ofthe unlabeled double-stranded pool of oligonucleotides was incubated with 10 mlof reticulocyte lysate-synthesized Rev-Erb (;45 fmol) in a standard EMSAreaction for the first round of selection. In one experiment, Rev-Erb and BD73were used together for selection. Salmon sperm DNA (2 mg) was added toreactions in subsequent rounds to reduce background. Control reactions toidentify the migration of Rev-Erb monomers contained Rev-Erb with labeledRev-Erb monomer probe. DNA complexes which migrated more slowly than themonomer complex were isolated from dried gels. This EMSA selection wasrepeated seven times. In some experiments, additional selection was achieved byimmunoprecipitation rather than EMSA, using the Rev-Erb monoclonal anti-body (39) in the protocol described above. At each step, the selected DNA wasPCR amplified under previously described conditions (41); in later rounds, theselected pool was labeled by a single round of PCR, using [32P]dCTP in place ofunlabeled CTP. Monomer and dimer bands were observed in early rounds, butafter five rounds, primarily dimer complexes were seen. The selected pool wassubcloned into pGemT vector (Promega). Inserts were amplified and labeled byusing PCR and then tested in EMSA, whereby three fragments were observed toreproducibly result in potentially dimeric complexes with Rev-Erb, as judged bytheir migration distances. We presume that the small number of distinct oligo-nucleotide sequences obtained was due to some combination of inefficiency ofcloning the PCR products, preferential amplification of certain sequences,and/or the low abundance of 12-fold-degenerate sequences in the starting ran-dom oligonucleotides (especially relative to the 4-fold degeneracy of monomerbinding sites). The relevant sequences of the fragments bound as dimers were:AACTAGGTCACTAGGTCA, ATCTAGGTCAGTGGGACG, and AAGTAGGTCAGTAGGCCA.

RESULTS

Rev-Erb contains a transferable repression domain in the Cterminus. To study the potential transcriptional regulatoryfunctions of Rev-Erb, chimeric proteins containing the GAL4DBD followed by portions of Rev-Erb were constructed (Fig.1A). Western blot analysis of extracts from transfected 293Tcells by using an antibody to the GAL4 portion of the proteinconfirmed that all chimeras were expressed (Fig. 1B). In addi-tion, a gel mobility shift assay with transfected cell extractsconfirmed that all chimeras not only were produced but alsobound to the GAL4 binding site (Fig. 1C). The chimeras werethen tested for transcriptional activity on a luciferase reportergene containing five copies of the GAL4 binding site or noinsert 59 to a simian virus 40 minimal promoter. No change inactivity was observed with the insertless reporter in any of thechimeras (data not shown). Remarkably, a chimeric proteincontaining the entire region C terminal to the DBD of Rev-Erb (GAL4-Rev 200-614) potently repressed the basal tran-scriptional activity of the GAL4 binding site reporter gene in293T, JEG3, HepG2, and NIH 3T3 cells (Fig. 1D). GAL4-Rev376-614 also repressed transcription, indicating that this regionof Rev-Erb was sufficient for transfer of repression function tothe GAL4 DBD, but note that a significant contribution torepression was made by amino acids 200 to 289. Expression ofa reporter containing two GAL4 binding sites was also re-

pressed, although to a lesser extent (40). In contrast, aminoacids 432 to 614 were insufficient for repression, indicating thatsome portion of the unique hinge region of Rev-Erb was re-quired for this function. At least part of the heptad repeatregion was also required, since a chimera containing aminoacids 200 to 471, which did not contain the heptad repeats, alsofailed to repress. Although the levels of expression of thechimeric proteins were not identical (Fig. 1B and C), normal-ization to the protein levels did not change the conclusionsfrom these experiments (for example, GAL4-Rev 432-614 wasinactive despite higher-level expression than GAL4-Rev 200-614). Furthermore, similar results were obtained in multiplecell types, suggesting that cofactors involved in repression byRev-Erb were not absolutely cell specific. Thus, Rev-Erb con-tains a potent transcriptional repression domain within theC-terminal portion of the molecule which functioned in severalcell types after transfer to a heterologous DBD.These results were surprising since we had not previously

seen significant repression of basal activity by Rev-Erb in tran-sient transfections of a chloramphenicol acetyltransferase re-porter gene containing a high-affinity monomer binding site forRev-Erb (23). To rule out the possibility that the low basalactivity of the chloramphenicol acetyltransferase construct im-paired detection of repression, a luciferase reporter gene con-taining a single copy of the Rev-Erb monomer binding site infront of the minimal TK promoter was constructed. In tran-sient transfections, Rev-Erb did not reproducibly reduce basaltranscription from this reporter (Fig. 2). However, as previ-ously described by other groups (28, 70), Rev-Erb was able torepress RORa1-activated transcription when fivefold-excessRev-Erb expression vector was cotransfected (Fig. 2). Repres-sion of RORa1-mediated transcription did not require therepression domain identified by the GAL4 fusion experiments,since C-terminally truncated (at amino acid 288) Rev-Erb alsorepressed RORa1 activation. These results suggest that Rev-Erb inhibited RORa1-mediated transcription from this mono-mer binding site by a mechanism independent of that involvedin the active repression of basal transcription by the GAL4-Rev-Erb fusion proteins.Several explanations for the lack of repression by full-length

Rev-Erb on the monomer site were considered. First, the do-main might not be exposed in the full-length protein, or anactivation domain in the N terminus might overcome the re-pression activity. However, an N-terminally truncated form ofRev-Erb did not repress basal transcription on the monomerbinding site although it did repress RORa1 activation, suggest-ing that the N terminus was not preventing basal repression(40). An alternate explanation was that Rev-Erb DNA bindingto the monomer site was not stable in vivo. Both the findingthat inhibition of RORa1-induced transcription required afivefold excess of Rev-Erb expression vector and the knowl-edge that the GAL4 DBD and therefore the GAL4-Rev-Erbchimera would bind DNA as dimers suggested that transcrip-tional repression by Rev-Erb may require the formation ofdimers.Rev-Erb binds to a DR2 element flanked by the Rev-Erb/

RORa-specific 5* flank as a homodimer. Our previous unbi-ased approach to identifying Rev-Erb binding sites revealedthat Rev-Erb bound DNA as a monomer (41). Because of theconsiderations noted above, this binding site selection strategywas modified to favor the selection of dimeric binding sites. Asdetailed in Materials and Methods, three fragments whichreproducibly resulted in a Rev-Erb-bound complex that mi-grated more slowly than Rev-Erb bound to the monomer sitewere obtained. Sequence analysis revealed the presence ineach case of a second AGGTCA half-site (perfect or imper-

VOL. 15, 1995 TRANSCRIPTION REPRESSION BY Rev-Erb DIMERS 4793

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 21

Nov

embe

r 20

21 b

y 21

6.15

5.68

.194

.

FIG. 1. Identification of a transferable repression domain in the C terminus of Rev-Erb. (A) Expression vectors for GAL4-DBD-Rev-Erb chimeras. The positionsof conserved domains (E/F is defined as beginning at the ti domain [31, 64]) are indicated. The reporter is shown below. SV40, simian virus 40. (B) Expression of GAL4chimeras in transfected cells. Proteins prepared from whole cell extracts of 293T cells transfected with 5 mg of the indicated protein expression vector, 0.5 mg of b-Galexpression vector, and 2 mg of GAL4-luciferase reporter were detected with an antibody to the GAL4 DBD. Gel loading was equalized to b-Gal units. (C) DNA bindingby GAL4 chimeras. An EMSA in which equal b-Gal units (;10 mg of protein) of transfected 293T cell extracts were incubated with labeled GAL4 DBD probe priorto gel loading was performed. (D) Transcriptional repression by chimeras on a GAL4-luciferase reporter in transfected 293T, JEG3, HepG2, and JEG3 cells. Foldrepression relative to the GAL4 DBD level is indicated. The range of activity is indicated by error bars. GAL4-VP16 activated .100-fold (fold repression is !1). ND,not determined.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 21

Nov

embe

r 20

21 b

y 21

6.15

5.68

.194

.

fect) 2 bp downstream from the half-site present in the startingoligonucleotide pool. Moreover, in each case, the four nucle-otides flanking the upstream half-site were a perfect consensusfor the Rev-Erb monomer site. Also, a T was found in thespacer immediately upstream of the second half-site, suggest-ing that the spacer sequence was important as well. The con-sensus site, referred to as Rev-DR2, is shown in Fig. 3A incomparison with the consensus Rev-Erb monomer bindingsite. Binding of Rev-Erb to Rev-DR2 is shown in Fig. 3B; inthis assay, the dimeric nature of the complex was confirmed bymixing full-length Rev-Erb with the truncated forms whosestructures are shown in Fig. 3C. Both a C-terminally truncatedRev-Erb (RevDC288) and a smaller version lacking both N-and C-terminal sequences (Rev-DBD) bound to Rev-DR2 and,when mixed with full-length Rev-Erb, formed complexes of

intermediate migration indicative of heterodimer formationbetween the wild-type and truncated proteins (42). These re-sults clearly showed that all three Rev-Erb proteins werebound to the Rev-DR2 as homodimers. Further, these datasuggest that the N and C termini of Rev-Erb were not requiredfor homodimerization (see below).The specificity of the Rev-Erb homodimer for a 2-bp spacer

between the half-sites was tested by examining Rev-Erb bind-ing to a series of DNA elements based on Rev-DR2 in whichthe spacer varied from one to five bases (DR1 through DR5)or in which there was only one extended half-site (Fig. 4A).Note that the spacer in each case was based on the optimal Rev59 flanking sequence. As seen in Fig. 4B, Rev-Erb formedhomodimers exclusively on the Rev-DR2 element, confirmingthe preference for a two-base spacer. In contrast, Rev-Erbbound as a monomer on the Rev half-site as well as the DR1,DR3, DR4, and DR5 elements, which also contain half-sitespreceded by the Rev-Erb/ROR 59 flanking sequence. To deter-mine whether the N or C terminus of Rev-Erb was required forthis spacing specificity, Rev-DBD was incubated with the sameseries of DNA sequences. Like the full-length protein, Rev-DBD bound primarily as a monomer on Rev-DR1, -3, -4, and-5, suggesting that the primary determinants of 2-bp spacingspecificity were contained within the DBD (Fig. 4B). Interest-ingly, the spacing restriction appeared to be somewhat reducedbecause the smaller protein bound weakly as a homodimer toRev-DR3.Next we examined the importance of the 59 A/T-rich se-

quence as well as the spacer sequence of Rev-DR2. The basesof the 59 flank or the T of the spacer were mutated individuallyor together in another series of potential binding sites, and theabilities of increasing concentrations of Rev-Erb to bind tothese sites are shown in Fig. 5. At all concentrations examined,Rev-Erb primarily formed homodimers on the Rev-DR2 probe(first three lanes). Mutation of both the 59 flank and the spacerto all C residues completely eliminated Rev-Erb binding towhat was still a DR2 (final three lanes). More subtle mutationof the first and fourth bases without changing the spacer se-quence (CACT and AACC) did not greatly affect binding;however, mutation of the second base (AGCT) greatly reduced

FIG. 2. Rev-Erb blocks RORa1 activation but does not repress basal tran-scription from a monomer binding site. A fivefold excess of either the Rev-Erbor C-terminally truncated Rev-Erb (Rev-DC288) expression vector was cotrans-fected into JEG3 cells with or without RORa1 expression vector and a luciferase(Luc) reporter containing a single copy of the Rev-Erb monomer site as indi-cated below the bars. Data are adjusted to the activity seen with insertlessexpression vectors (solid black bars).

FIG. 3. Selection of a consensus binding site for Rev-Erb dimers. (A) Comparison of the Rev-DR2 sequence with the sequence of the previously determinedRev-Erb monomer site. (B) Demonstration of dimer formation on the Rev-DR2 site. Full-length Rev-Erb was incubated alone or with the indicated Rev-Erbtruncations and labeled Rev-DR2 probe. Intermediately migrating heterodimer (HD) complexes between Rev-Erb and Rev-DC288 and Rev-DBD are marked witharrows on the left and right, respectively. Homodimer complexes are marked by arrowheads. (C) Structures of Rev-Erb proteins used in experiment.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 21

Nov

embe

r 20

21 b

y 21

6.15

5.68

.194

.

overall binding. Interestingly, this base was also the most im-portant for Rev-Erb binding as a monomer (41). Mutation ofthe T in the spacer without changing the 59 flank also modestlyreduced binding. These results suggest that Rev-Erb formsdimers only on the subset of DR2 elements which are flankedby the Rev-Erb 59 A/T-rich region.Rev-Erb binding to Rev-DR2 is cooperative and stable. Rev-

Erb bound to Rev-DR2 primarily as a dimer even at the lowestconcentration of protein examined in Fig. 5B, strongly suggest-

ing that dimer formation is cooperative. To determine whetherthe 2-bp spacing between Rev monomer sites was importantfor this cooperativity, binding to Rev-DR2 was compared withbinding to DNA containing one monomer site or two copies ofthe monomer site separated by 15 bp (23monomer probe). Asseen in Fig. 6A, relatively low concentrations of Rev-Erbbound to both the single-monomer probe as well as the 23monomer probe as single rapidly migrating complex (first sixlanes). Formation of a more greatly retarded complex with the23 monomer probe was observed only at the highest proteinconcentration, presumably as a result of filling of the half-sitesby noninteracting protein monomers. Even at high Rev-Erbconcentrations, however, the amount of monomer bound wasquantitatively greatest. In contrast, Rev-Erb bound to the Rev-DR2 probe primarily as a dimer at all concentrations exam-ined. Similar results were obtained with the Rev-DBD (40),

FIG. 4. Specificity of Rev-Erb and Rev-DBD for a 2-bp spacer betweenhalf-sites. (A) Sequences of DNA elements used for EMSA with the Rev-Erb 59flank and spacer with spacing of one, two, three, four, and five bases betweenhalf-sites or no second half-site. The Rev-Erb 59 flank and spacer sequence isindicated in boldface, and half-sites are marked with arrows above the sequences.(B) EMSA of Rev-Erb and Rev-DBD on the indicated probes. The positions ofmonomer (M) and dimer (D) complexes are indicated.

FIG. 5. Role of the 59 flank and spacer sequences in Rev-DR2 for dimerformation. Increasing concentrations of Rev-Erb were incubated with a series ofDR2 probes containing the indicated 59 flank and spacer sequences. Mutationsin the 59 flank are underlined. Triangles above the lanes indicate the use of 1.5,3, or 6 ml of reticulocyte lysate-synthesized Rev-Erb.

FIG. 6. Rev-Erb cooperatively forms stable homodimers on Rev-DR2. (A)Formation of cooperative dimers on Rev-DR2 but not two adjacent monomersites. Increasing concentrations of Rev-Erb were incubated with probes contain-ing a single Rev-Erb monomer site (Mono), two monomer sites in a direct repeatspaced by 15 bp between half-sites [(Mono)32] or Rev-DR2. Triangles above thelanes indicate the use of 1.5, 3, or 6 ml of reticulocyte lysate-synthesized protein.Monomer (M) and dimer (D) complexes are indicated on the left. (B and C) TheRev-Erb-Rev-DR2 complex has a longer half-life than the Rev-Erb-Rev mono-mer site complex. Either Rev-Erb (B) or Rev-DBD (C) was preincubated for 1h with labeled Rev monomer site or Rev-DR2, and equal aliquots were loadedonto a prerun gel at the indicated times after a 500-fold excess of unlabeledcompetitor was added to the reaction. No competitor was added to the time 0lane. Monomer and dimer complexes are indicated.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 21

Nov

embe

r 20

21 b

y 21

6.15

5.68

.194

.

further indicating that this minimal region of Rev-Erb wassufficient for cooperative homodimerization and that this co-operativity was limited to DNA elements characterized by 2-bpspacing between AGGTCA half sites.The cooperativity of Rev-Erb homodimer binding led us to

ask whether Rev-Erb dimers are more stable than Rev-Erbmonomers. To address this issue, we measured the half-life ofRev-Erb complexes with the monomer and the Rev-DR2 sites.As shown in Fig. 6B, the half-life of the homodimer complexwith Rev-DR2 was 5 to 10 times longer than the half-life of theRev-Erb monomer on the monomer site (as well as the minor-ity of monomeric complexes with the Rev-DR2 site, seen in thesame lane as the homodimer). This result suggests that re-duced stability of the Rev-Erb DNA complex is likely to beresponsible for the lack of activity of Rev-Erb from a mono-meric binding site in transfection experiments. Figure 6Cshows that the half-life of Rev-DBD homodimer was similarlylonger on Rev-DR2 than the monomer bound to the Revmonomer site. The relative lack of importance of the Rev-ErbN and C termini in stabilizing DNA binding contrasts with theimportance of the C terminus of TR and RAR in stabilizingdimers (29) as well as the role of the N terminus in regulatingthe DNA binding affinity of the highly related RORa (62).Coimmunoprecipitation of Rev-Erb dimers is enhanced by

Rev-DR2. Coimmunoprecipitation experiments were performedto confirm Rev-Erb homodimerization in a different assay, aswell as to determine whether the N- or C-terminal region ofRev-Erb plays a role in dimer formation in solution. Full-length Rev-Erb was N-terminally HA tagged and translatedtogether with various untagged N- and C-terminal truncationsof Rev-Erb (Fig. 7A). These translation products were incu-bated with or without a molar excess of DNA, either theRev-DR2 sequence or a similar sequence (Rev-DR4) on whichhomodimerization was not observed in the EMSA, and thenimmunoprecipitated with a monoclonal HA antibody (Fig.7B). No background precipitation was observed in the absenceof HA antibody (lanes 2, 6, 10, 15) or when HA-Rev-Erb wasomitted (data not shown). As seen in lane 3, a small amount(;10% in two separate experiments) of the Rev-Erb DBDcoimmunoprecipitated with HA-Rev-Erb even in the absenceof DNA. Addition of Rev-DR2 (but not Rev-DR4; data notshown) nearly doubled the amount of coimmunoprecipitatedRev-DBD. Larger fragments of Rev-Erb which also contained

the DBD (RevDC288 and RevDN103) also coimmunoprecipi-tated with HA-Rev-Erb. Again, the coimmunoprecipitationwas enhanced by the inclusion of Rev-DR2 (compare lane 9with lanes 11 to 13), whereas inclusion of the Rev-DR4 site didnot promote dimerization in this assay (lane 12). Similarly, inthe experiment shown, the presence of Rev-DR2 seemed to berequired for coimmunoprecipitation of RevDN103 with HA-Rev-Erb (compare lane 14 with lanes 16 to 18). AlthoughRev-DR2 always enhanced coimmunoprecipitation of Rev-DN103, it should be noted that in some experiments there didnot seem to be an absolute requirement for the DNA in orderto detect dimerization in this assay; therefore, the possibilitythat a portion of the C terminus contributed to dimerizationcannot be ruled out. However, the isolated C terminus(RevDN220) did not dimerize with HA-Rev-Erb with or with-out DNA (compare lane 5 with lanes 7 and 8). Thus, takentogether with the results of gel shift experiments, these resultssuggest that the primary determinants of Rev-Erb homodimer-ization are found within the DBD and that DNA bindingstabilizes homodimer formation.Rev-Erb represses transcription from Rev-DR2 in vivo. The

foregoing experiments indicated that Rev-Erb contains a tran-scriptional repression domain, which may not be active onmonomer binding sites because of the reduced stability of themonomeric Rev-Erb DNA-binding complex. We thereforepredicted that Rev-Erb would negatively regulate transcriptionfrom the Rev-DR2 site to which it bound cooperatively andwith greater stability. Indeed, Fig. 8A shows that Rev-Erbstrongly repressed transcription from a luciferase reportergene containing the Rev-DR2 59 to the TK promoter. Muta-tion of the 59 flank and spacer sequences to C residues (DR2-All C) abolished the repression, and Rev-Erb also did notrepress transcription from reporters containing a monomersite or the minimal promoter. The ability of Rev-Erb to repressbasal transcription from the Rev-DR2 site was not specific tothe TK promoter, as the basal activity of the simian virus 40promoter was similarly repressed by Rev-Erb from the Rev-DR2 but not the DR2-All C element (40). In addition, Rev-Erb repressed transcription from Rev-DR2 in multiple celltypes, including JEG3, HepG2, 293T, NIH 3T3, and CV-1cells, although the magnitude of repression was less in the NIH3T3 and CV-1 cells (40). Transcriptional repression by Rev-Erb correlated with the ability of the transfected protein to

FIG. 7. Coimmunoprecipitation of Rev-Erb dimers. (A) Structures of proteins used in this experiment. (B) Coimmunoprecipitation of HA-Rev-Erb and Rev-Erbtruncations. N-terminally HA-tagged Rev-Erb was cotranslated with the indicated untagged protein truncation and incubated with an excess of labeled Rev-DR2 orRev-DR4 probe or with no DNA. The reaction mixtures were then immunoprecipitated with HA antibody prebound to protein A beads or with beads alone. The bandsseen at the bottom of lanes 13 and 18 correspond to labeled Rev-DR2 probe coprecipitated with the protein complexes (the coprecipitated probe ran off the gel in lane4 as a result of a ‘‘smiling’’ artifact). ‘‘Load’’ refers to amounts of the proteins prior to immunoprecipitation. Note that for Rev-DBD and RevDN220, one-fifth theamount of protein used for immunoprecipitation is loaded in lanes 1 and 5.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 21

Nov

embe

r 20

21 b

y 21

6.15

5.68

.194

.

form dimers. Thus, extracts from Rev-Erb-transfected cellsformed monomeric complexes with the monomer consensussite and dimeric complexes with the Rev-DR2 which weresimilar to those of in vitro-translated Rev-Erb (Fig. 8B). Theaddition of cell extracts or RXR did not alter the migration ofthe in vitro-translated Rev-Erb on these binding sites (40).Figure 8C shows that strong repression of basal transcription

was observed when Rev-Erb was cotransfected with the Rev-DR2-TK-luciferase reporter but not reporters containing Rev-DR1, DR3, DR4, or DR5. Thus, the ability of Rev-Erb tofunction as a transcriptional repressor correlated well with itsability to homodimerize on these sites. When expressed incells, Rev-Erb displayed the same preference for homodimer-ization on Rev-DR2 versus other Rev-DR sites as was shownearlier for the in vitro-translated protein (40). Figure 8C alsoshows that in contrast to dimeric DNA binding by Rev-Erb,which does not require the C terminus of the protein, transre-pression from Rev-DR2 required the C terminus (compareresults for full-length and C-terminally truncated Rev-Erb).

This effect was not due to lack of protein expression becausethe protein could be detected by Western analysis (data notshown) and the same protein interfered with activation byRORa1 (Fig. 2). Thus, the Rev-Erb C terminus, which func-tions as a repression domain in the context of a heterologouspromoter, can also function as a repression domain in thecontext of wild-type Rev-Erb when the protein is bound to asingle dimeric response element.The C terminus of Rev-Erb is not essential for the Rev-DR2

binding preference in vivo. The results shown above indicatethat the Rev-Erb C terminus is essential for repression in vivo.It seemed likely that the function of the C terminus was forrepression and not dimerization or stabilization of DNA bind-ing, given the presence of a transferable repression domainand the lack of requirement of the C terminus for the Rev-DR2 binding preference in vitro. However, it was possible thatthe C terminus was required for DR2 homodimerization spec-ificity in vivo. To test this possibility, we constructed a vectorwhich expressed the VP16 transactivation domain fused to theN terminus of RevDC288. Figure 9 shows that this fusionprotein activated transcription from Rev-DR2 but not from themonomer site, consistent with the in vitro binding and dimer-ization of RevDC288. Similar preference for Rev-DR2 amongdirect repeats was also observed (data not shown). Thus, the Cterminus of Rev-Erb is not essential for the Rev-DR2 bindingpreference in vivo. Since RevDC288 lacks the repression do-main, it was of interest to determine whether the powerfulVP16 transactivation domain could overcome this repressionby full-length Rev-Erb. Interestingly, as shown in Fig. 9, fusionto VP16 did convert Rev-Erb into a transcriptional activator,but the degree of activation was considerably less than thatobserved with RevDC288, suggesting that the repression do-main in the C terminus was still having a negative effect ontranscription in the context of the VP16 fusion protein.Rev-Erb represses basal transcription as well as RAR acti-

vation from the naturally occurring DR2 in the CRBPI gene.RARs can activate transcription from DR2 as well as DR5elements. The selective effects of Rev-Erb on Rev-DR2 sug-gested that one role of Rev-Erb might be to repress transcrip-tion of the subset of RAR-responsive genes in which the RAresponse element is a Rev-Erb dimer binding site. The CRBPIRA response element is a candidate for such a natural target,since its sequence, TTAGTAGGTCAAAAGGTCA (43, 74),

FIG. 8. Rev-Erb represses of basal transcription: Rev-DR2 specificity andrequirement for the C terminus. Rev-Erb represses transcription only from aRev-DR2-containing TK-luciferase (Luc) reporter. (A) Repression from Rev-DR2. Rev-Erb or a control expression vector was cotransfected into JEG3 cellswith reporters containing no insert, a monomer consensus site, Rev-DR2, andDR2 with C residues as flanking and gap sequences (All C) along with a b-Galexpression vector. (B) Transfected Rev-Erb binds as monomer (M) and dimer(D). Rev-Erb was transfected into 293T cells, and extracts were used in EMSAwith a monomer consensus site (Mono) or Rev-DR2. Reticulocyte-translatedRev-Erb is shown as a control for each binding site. (C) Basal repression byRev-Erb from the Rev-DR oligonucleotide series. Rev-Erb, Rev-DC288, or acontrol expression vector was cotransfected into JEG3 cells with TK-luciferasereporters containing the indicated elements (Rev-DR series or monomer con-sensus site) along with a b-Gal expression vector. Activities compared with thatobserved with control expression vector, normalized to b-Gal activity, are indi-cated as the range of duplicate samples.

FIG. 9. VP16-Rev-Erb fusions specifically activate from Rev-DR2 in vivo.VP16-Rev-Erb and VP16-Rev-DC288 expression vectors (1, 2.5, and 5 mg ofeach) were cotransfected into JEG3 cells with luciferase (Luc) reporters con-taining the Rev monomer or Rev-DR2 sites as indicated by triangles below thebars.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 21

Nov

embe

r 20

21 b

y 21

6.15

5.68

.194

.

is a DR2 with an ideal sequence flanking the upstream half-site, with an A rather than a T just preceding the downstreamhalfsite. Figure 10A shows that Rev-Erb bound to this elementas a homodimer. Although the cooperativity was somewhatless than that on a perfect Rev-DR2 (similar to the spacermutant shown in lanes 13 to 15 of Fig. 5), the half-life of thehomodimer complex was similar to that observed with the idealRev-DR2 and was significantly longer than that of the mono-meric complex. The magnitude of binding of the Rev-Erbhomodimer was comparable to that of the RAR-RXR het-erodimer which, as expected, also bound to this element (40).Figure 10B shows that indeed, Rev-Erb strongly repressedbasal activity of a luciferase reporter containing the CRBPIDR2 59 to the TK promoter (compare bar 1 with bars 3 and 7).Moreover, Rev-Erb blocked the transcriptional activation fromthis element mediated by RA-induced RARg (compare bars 6and 8). In contrast, Rev-Erb had little effect on basal transcrip-tion from Rev-DR5 (as shown earlier; compare bars 9 and 11)and had only a minor effect on the RA/RAR-induced activa-tion from this element. This 50% reduction in RA stimulation(bars 14 and 16) is likely to be analogous to Rev-Erb monomerrepression of RORa1-mediated induction, as Rev-Erb mono-mer certainly binds to the Rev-DR5 (see, for example, Fig. 4).

DISCUSSION

We have shown that the nuclear orphan receptor Rev-Erbcontains a potent transcriptional regulatory domain in its Cterminus which mediates repression of basal transcription bothin the context of the native protein and when fused to a het-erologous DBD. Deletion analysis indicated that amino acidsfrom both the D domain and the E/F domain were required fortranscriptional repression. For the purposes of this report, theD domain is defined as the distance from the conserved VGMat the end of the second zinc module in the DBD (26) to theconserved VEFAK motif which marks the ti region (31). TheD domain of Rev-Erb is of special interest because it longerthan that of any other known member of the nuclear hormonereceptor superfamily. For example, the Rev-Erb D domain iscomposed of 252 amino acids (amino acids 200 to 451); incontrast, the D domains of the RAR and TR are 86 and 82amino acids in length, respectively. Comparison of the Rev-Erb D domain with proteins in the Blast database was unre-

vealing, although the N-terminal portion of the D domain ishighly proline rich, a feature of previously characterized re-pression domains in other transcription factors. Indeed, dele-tion of amino acids 200 to 289, a region which encompasses astretch in which 17 of 43 amino acids are proline, reduced thefold repression by ;50% in most cell types. However, ourobservation that amino acids 376 to 614 were sufficient forrepression indicated that a second domain also contributes tomaximal repression.Despite their shorter D domains, TR and RAR also contain

transferable C-terminal repression domains which repressbasal transcription in the absence of hormone (6) but whichare overpowered by the AF-2 activation domain revealed inthe presence of hormone (7, 8, 25). This so-called silencingfunction has been studied most thoroughly in TRb, for which,as for Rev-Erb, portions of both the D domain and E/F do-mains are required for repression as a GAL4 DBD fusion (6).Furthermore, Baniahmad et al. have shown that the repressiondomain of TRb can be broken into two fragments, one fromthe D domain and one from the E/F domain, which represstranscription when coexpressed but not separately (5). Morerecently, evidence that the C terminus of TR interacts with anegative cellular factor or corepressor which is released or hasreduced activity in the presence of hormone has been pre-sented (7, 14). The putative corepressor appears to interactwith both TR and RAR but not RXR or COUP-TF, as deter-mined by the abilities of these proteins (or portions of the theirC termini) to inhibit basal repression by GAL4-TR (7). We arecurrently investigating whether a similar corepressor is in-volved in Rev-Erb function.The identification of a constitutive transcriptional repression

domain in Rev-Erb is interesting in light of the recent charac-terization of the activation domains of other nuclear receptors.In particular, both Rev-Erba and Rev-Erbb are missing theC-terminal activation domain (AF-2/t4) which has been func-tionally identified in TR, RAR, and RXR and which is con-served in many other members of the superfamily (7, 8, 24, 58),including RORa1, which is most closely related to Rev-Erb yetfunctions as an activator in the absence of exogenous ligand,most likely as a result of the presence of AF-2 at its C terminus(62). Interestingly, whereas both Rev-Erb and Rev-Erbb/RVR/BD73 lack AF-2 as a result of natural truncation, COUP-TF andARP I, which repress transcription through competition for

FIG. 10. Rev-Erb represses basal transcription and RAR activation from the naturally occurring imperfect Rev-DR2 in the CRBPI gene. (A) Binding of Rev-Erbto the CRBPI RA response element. Rev-Erb was preincubated for 1 h with labeled CRBPI site and then loaded onto a prerun gel at the indicated times after a 500-foldexcess of unlabeled competitor was added to the reaction. No competitor was added to the time 0 lane. Monomer (M) and dimer (D) complexes are indicated. (B)Transcriptional regulation from this site by Rev-Erb. JEG3 cells were transfected with 1 mg of RAR expression vector and 4 mg of Rev-Erb or control expression vector.RA was used at a concentration of 1 mM. The activity range of duplicate samples is indicated.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 21

Nov

embe

r 20

21 b

y 21

6.15

5.68

.194

.

DNA binding or active repression (20, 33, 50, 77), are alsomissing a functional AF-2 domain as a result of natural pointmutations within the critical amino acids of the domain (24).The naturally occurring lack of the conserved activation do-main AF-2 suggests that the natural function of Rev-Erb maybe to repress transcription but does not rule out the possibilitythat Rev-Erb contains undetected activation domains whichmay be revealed by interaction with an as yet undiscoveredligand or by posttranslational modification.Another important finding in this work has to do with the

complexity of DNA binding by Rev-Erb. We have previouslydetermined that Rev-Erb, unlike the majority of nuclear re-ceptors which interact with the AGGTCA half-site, boundstrongly to a Rev monomer site (41). The subgroup of mono-mer binding receptors includes not only very similar receptorssuch as RORa1, which actually binds to the Rev monomer site(34), but also more distantly related orphan receptors such asNGFI-B and SF1/FTZ-F1 (78, 83). The observation that Rev-Erb binds Rev-DR2 as a homodimer, together with the factthat TR binds DNA as monomer, homodimer, and RXR het-erodimer, raises the possibility that other monomer binderswill be found to homodimerize or heterodimerize on morecomplex elements. Indeed, while this work was being reviewed,it was reported that the monomer-binding orphan receptorNGFI-B has the ability to heterodimerize with RXR (30, 67).In contrast, we have not detected any association with RXReither on DNA or in solution, nor did nuclear extracts fromliver or JEG3 cells influence Rev-Erb binding to Rev-DR2(40). Moreover, unlike the case of NGFI-B, RXR-binding reti-noids such as 9-cis RA did not alter the effects of Rev-Erb ontranscription (40).Understanding of the molecular mechanism underlying Rev-

Erb dimerization provides further insight into the mechanismby which nuclear hormone receptors interact with differentDNA binding sites as monomers, homodimers, and het-erodimers (reviewed in reference 35). Steroid hormone recep-tors homodimerize on palindromic binding sites, whose inher-ent symmetry juxtaposes the identical region (D box) of eachof the partners (60, 73). In contrast, heterodimeric binding ofRXR together with other nuclear hormone receptors to inher-ently asymmetric DR sites involves distinct regions of the part-ners, the so-called D and DR boxes, and these interactions arefavored at specific half-site spacings (49, 68, 69). Much less isknown about homodimerization on DRs. The COUP-TF fam-ily of orphan receptors homodimerize on DR sites, but withlittle or no stringency in terms of half-site spacing or sequencesflanking the half-sites (20, 77). VDR homodimerizes on DR3sites (76), and RXR specifically binds to DR1 sites, althoughligand may be required to achieve the correct conformation ofthe full-length protein (86). Interestingly, the identity of the1-bp spacer in DR1 appears to regulate RXR homodimerbinding affinity (18). Rev-Erb is the first receptor found tohomodimerize specifically on a DR2 site. Rev-Erb homodimer-ization is remarkably selective as a result of the additionalrequirement that the 59 flank of the upstream half-site must beoptimal for Rev-Erb monomer binding. Homodimerization isfavored when the spacer, which is also the 59 flank of thedownstream half-site, is optimized for Rev-Erb monomer bind-ing. These results are consistent with methylation interferenceexperiments indicating that the Rev-Erb monomer makes di-rect contact with the base pairs 59 to the AGGTCA half-site(41). These are likely to be minor groove contacts mediated byamino acids C terminal to the second zinc module, which havebeen referred to as the T and A boxes (84). In the cases ofRXRa (56) and TRb (69), these amino acids form an a-helicalstructure. Crystallization of Rev-Erb bound to DNA will be

required to determine the role of this region of the protein inmaking minor groove contacts 59 to both the upstream anddownstream half-sites, as well as to determine the role of theseamino acids in restricting the spacing between the two half-sites and/or facilitating homodimerization.It is interesting to compare the DNA binding properties of

Rev-Erb and RORa1, since their DBDs are so similar. Thefinding that Rev-Erb dimer complexes are more stable thanmonomer complexes and that its repression function is detect-able on the dimer site but not a monomer site suggests thatRev-Erb normally functions as a dimer. In contrast, RORa1 istranscriptionally active on the Rev monomer binding site (34),probably because its monomeric binding is more stable thanthat of Rev-Erb (40). The increased stability of monomericRORa1 may reflect the recently described role of the N ter-minus in regulating DNA binding of RORa isoforms to themonomer site (62). This represents another distinction be-tween Rev-Erb and RORa, since the present results show thatthe cooperativity as well as the stability of Rev-Erb dimercomplexes are retained in amino acids 103 to 225. Neverthe-less, it is still possible that amino acids just N terminal to thefirst zinc module (residues 104 to 131) play a role in stabilizingDNA binding by Rev-Erb.The failure of Rev-Erb monomer to significantly repress

transcription was most likely due to its rapid dissociation rate,which may be too great to allow a productive interaction withcorepressors and/or basal factors when bound to DNA in vivo.Alternatively, two copies of the repression domain may berequired for function in vivo; this would also be consistent withour data, since GAL4 DBD binds as a dimer (12). The abilityof Rev-Erb to block activation of transcription by RORa1from a monomer site suggests that the binding by Rev-Erb tothis site may be strong enough to compete with RORa1 foroccupation of the site provided that Rev-Erb is present inexcess. It is also possible that RORa1 and Rev-Erb form in-active heterodimers. The ability of Rev-Erb to actively represstranscription specifically from the Rev-DR2 suggests that Rev-Erb and ROR may have overlapping yet distinct sets of targetgenes, since the Rev-DR2 site contains a Rev-Erb monomersite. The identification of natural target genes as well as adetermination of the relative ratios of Rev-Erb and RORa1naturally expressed will be required to resolve the question ofwhether Rev-Erb normally has a role as a monomer in vivo.Similarly, the selectivity of Rev-Erb homodimer for a subset ofDR2 elements may have important functional consequencesfor regulation of retinoid signaling, since RAR-RXR het-erodimers also bind and regulate transcription through DR2elements yet do not have an absolute requirement for a specific59 flank sequence. Thus, Rev-Erb is able to almost completelyantagonize RA-induced RAR activation of transcription fromthe CRBPI RA response element as a homodimer, weaklyantagonize RAR activation from Rev-DR5 (probably as amonomer), and have little or no effect on RAR function atDR2 or DR5 sites which are not Rev-Erb binding sites (40).Such regulation could have physiological significance, for ex-ample in adipogenesis, in which case Rev-Erb (16), retinoidreceptors (17, 44, 59), and CRBPI (88) are coexpressed andregulated during adipocyte differentiation and after RA treat-ment. More generally, this type of functional diversity may notbe limited to Rev-Erb; other orphan receptors whose DNAbinding is currently thought to be primarily monomeric maysubsequently be found to bind and function as dimers.

ACKNOWLEDGMENTS

We thank T. Berrodin for help in generating and characterizingRev-Erb monoclonal antibodies, P. Bernheim for help with DNA se-


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 21

Nov

embe

r 20

21 b

y 21

6.15

5.68

.194

.

quencing, G. Dreyfuss for providing HA antibody, M. Malim for 293Tcells, F. Rauscher for providing GAL4 antibody, and D. Moore, V.Giguere, and P. Chambon for plasmids. We also thank P. Traber andF. Rauscher for helpful discussions.This work was supported by NIH grant DK45586 (M.A.L.).

REFERENCES

1. Apfel, R., D. Benbrook, E. Lernhardt, M. A. Ortiz, G. Salbert, and M. Pfahl.1994. A novel orphan receptor specific for a subset of thyroid hormone-responsive elements and its interaction with the retinoid/thyroid hormonereceptor superfamily. Mol. Cell. Biol. 14:7025–7035.

2. Au-Fliegner, M., E. Helmer, J. Casanova, B. M. Raaka, and H. H. Samuels.1993. The conserved ninth C-terminal heptad in thyroid hormone and reti-noic acid receptors mediates diverse responses by affecting heterodimer butnot homodimer formation. Mol. Cell. Biol. 13:5725–5737.

3. Ausubel, F. M., R. Brent, R. Kingston, D. D. Moore, J. A. Smith, J. G.Seidman, and K. Struhl (ed.). 1987. Current protocols in molecular biology.Greene Publishing-Wiley Interscience, New York.

4. Baes, M., T. Gulick, H. S. Choi, M. G. Martinoli, D. Simha, and D. D. Moore.1994. A new orphan member of the nuclear hormone receptor superfamilythat interacts with a subset of retinoic acid response elements. Mol. Cell.Biol. 14:1544–1551.

5. Baniahmad, A., I. Ha, D. Reinberg, S. Tsai, M. J. Tsai, and B. W. O’Malley.1993. Interaction of human thyroid hormone receptor beta with transcriptionfactor TFIIB may mediate target gene derepression and activation by thyroidhormone. Proc. Natl. Acad. Sci. USA 90:8832–8836.

6. Baniahmad, A., A. C. Kohne, and R. Renkawitz. 1992. A transferable silenc-ing domain is present in the thyroid hormone receptor, in the v-erbA onco-gene product and in the retinoic acid receptor. EMBO J. 11:1015–1023.

7. Baniahmad, A., X. Leng, T. P. Burris, S. Y. Tsai, M.-J. Tsai, and B. W.O’Malley. 1995. The t4 activation domain of the thyroid hormone receptoris required for release of a putative corepressor(s) necessary for transcrip-tional silencing. Mol. Cell. Biol. 15:76–86.

8. Barettino, D., M. d. M. V. Ruz, and H. G. Stunnenberg. 1994. Characteriza-tion of the ligand-dependent transactivation domain of thyroid hormonereceptor. EMBO J. 13:3039–3049.

9. Berrodin, T. J., M. S. Marks, K. Ozato, E. Linney, and M. A. Lazar. 1992.Heterodimerization among thyroid hormone receptor, retinoic acid recep-tor, retinoid X receptor, chicken ovalbumin upstream promoter transcriptionfactor, and an endogenous nuclear protein. Mol. Endocrinol. 6:1468–1478.

10. Blackwell, T. K., L. Kretzner, E. M. Blackwood, R. N. Eisenman, and H.Weintraub. 1990. Sequence-specific DNA binding by the c-Myc protein.Science 250:1149–1151.

11. Bugge, T. H., J. Pohl, O. Lonnoy, and H. G. Stunnenberg. 1992. RXRa, apromiscuous partner of retinoic acid and thyroid hormone receptors. EMBOJ. 11:1409–1418.

12. Carey, M., H. Kakadani, J. Leatherwood, F. Mostashari, and M. Ptashne.1989. An amino-terminal fragment of GAL4 binds DNA as a dimer. J. Mol.Biol. 209:423–432.

13. Carlberg, C., R. H. van Huijsduijnen, J. K. Staple, J. F. DeLamarter, and M.Becker-Andre. 1994. RZRs, a new family of retinoid-related orphan recep-tors that function as both monomers and homodimers. Mol. Endocrinol.8:757–770.

14. Casanova, J., E. Helmer, S. Selmi-Ruby, J.-S. Qi, M. Au-Fliegner, V. Desai-Yajnik, N. Koudinova, F. Yarm, B. Raaka, and H. H. Samuels. 1994. Func-tional evidence for ligand-dependent dissociation of thyroid hormone andretinoic acid receptors from an inhibitory cellular factor. Mol. Cell. Biol.14:5756–5765.

15. Cavailles, V., S. Dauvois, P. S. Danielian, and M. G. Parker. 1994. Interac-tion of proteins with transcriptionally active estrogen receptors. Proc. Natl.Acad. Sci. USA 91:10009–10013.

16. Chawla, A., and M. A. Lazar. 1993. Induction of Rev-ErbAa, an orphannuclear receptor encoded on the opposite strand of the a-thyroid hormonereceptor gene, during adipocyte differentiation. J. Biol. Chem. 268:16265–16269.

17. Chawla, A., and M. A. Lazar. 1994. Peroxisome proliferator and retinoidsignalling pathways co-regulate preadipocyte phenotype and survival. Proc.Natl. Acad. Sci. USA 91:1786–1790.

18. Chen, H., and M. L. Privalsky. 1995. Cooperative formation of high-orderoligomers by retinoid X receptors: an unexpected mode of DNA recognition.Proc. Natl. Acad. Sci. USA 92:422–426.

19. Cooney, A. J., X. Leng, S. Y. Tsai, B. W. O’Malley, and M.-J. Tsai. 1993.Multiple mechanisms of chicken ovalbumin upstream promoter transcrip-tion factor-dependent repression of transactivation by the vitamin D, thyroidhormone, and retinoic acid receptors. J. Biol. Chem. 268:4152–4160.

20. Cooney, A. J., S. Y. Tsai, B. W. O’Malley, and M.-J. Tsai. 1992. Chickenovalbumin upstream promoter transcription factor (COUP-TF) dimers bindto different GGTCA response elements, allowing COUP-TF to repress hor-monal induction of the vitamin D3, thyroid hormone, and retinoic acidreceptors. Mol. Cell. Biol. 12:4153–4163.

21. Danielsen, M., L. Hinck, and G. Ringold. 1989. Two amino acids within the

knuckle of the first zinc finger specify DNA response element activation bythe glucorticoid receptor. Cell. 57:1131–1138.

22. Darling, D. S., J. S. Beebe, J. Burnside, E. R. Winslow, and W. W. Chin. 1991.3,5, 39-Triiodothyronine receptor auxiliary protein (TRAP) binds DNA andforms heterodimers with the T3 receptor. Mol. Endocrinol. 5:73–84.

23. Dumas, B., H. Harding, H.-S. Choi, K. Lehmann, M. Chung, M. A. Lazar,and D. D. Moore. 1994. A new orphan member of the nuclear hormonereceptor superfamily closely related to Rev-Erb. Mol. Endocrinol. 8:996–1005.

24. Durand, B., M. Saunders, C. Gaudon, B. Roy, R. Losson, and P. Chambon.1994. Activation function 2 (AF-2) of retinoic acid receptor and 9-cis retinoicacid receptor: presencer of a conserved autonomous constitutive activatingdomain and influence of the nature of the response element on AF-2 activity.EMBO J. 13:5370–5382.

25. Evans, R. M. 1988. The steroid and thyroid hormone receptor superfamily.Science 240:889–895.

26. Evans, R. M., and S. Hollenberg. 1988. Zinc fingers: gilt by association. Cell52:1–3.

27. Forman, B. M., J. Casanova, B. M. Raaka, J. Ghysdael, and H. H. Samuels.1992. Half-site spacing and orientation determines whether thyroid hormoneand retinoic acid receptors and related factors bind to DNA response elementsas monomers, homodimers, or heterodimers. Mol. Endocrinol. 6:429–442.

28. Forman, B. M., J. Chen, B. Blumberg, S. A. Kliewer, R. Henshaw, E. S. Ong,and R. M. Evans. 1994. Cross-talk among RORa1 and the Rev-erb family oforphan nuclear receptors. Mol. Endocrinol. 8:1253–1261.

29. Forman, B. M., and H. H. Samuels. 1990. Interactions among a subfamily ofnuclear hormone receptors: the regulatory zipper model. Mol. Endocrinol.4:1293–1301.

30. Forman, B. M., K. Umesono, J. Chen, and R. M. Evans. 1995. Uniqueresponse pathways are established by allosteric interactions among nuclearhormone receptors. Cell 81:541–550.

31. Forman, B. M., C. Yang, M. Au, J. Casanova, J. Ghysdael, and H. H.Samuels. 1989. A domain containing a leucine-zipper-like motif mediatesnovel in vivo interactions between the thyroid hormone and retinoic acidreceptors. Mol. Endocrinol. 3:1610–1626.

32. Freedman, L. P., B. F. Luisi, Z. R. Korszun, R. Basavappa, P. B. Sigler, andK. R. Yamamoto. 1988. The function and structure of the metal coordinationsites within the glucocorticoid receptor DNA binding domain. Nature (Lon-don) 334:543–546.

33. Ge, R., M. Rhee, S. Malik, and S. K. Karathanasis. 1994. Transcriptionalrepression of apolipoprotein AI gene expression by orphan receptor ARP-1.J. Biol. Chem. 269:13185–13192.

34. Giguere, V., M. Tini, G. Flock, E. Ong, R. M. Evans, and G. Otulakowski.1994. Isoform-specific amino-terminal domains dictate DNA-binding prop-erties of RORa, a novel family of orphan hormone nuclear receptors. GenesDev. 8:538–553.

35. Glass, C. K. 1994. Differential recognition of target genes by nuclear recep-tor monomers, dimers, and heterodimers. Endocrine Rev. 15:391–407.

36. Green, S., and P. Chambon. 1988. Nuclear receptors enhance our under-standing of transcription regulation. Trends Genet. 4:309–315.

37. Green, S., V. Kumar, I. Theulaz, W. Wahli, and P. Chambon. 1988. TheN-terminal DNA-binding ‘zinc finger’ of the oestrogen and glucocorticoidreceptors determines target gene specificity. EMBO J. 7:3037–3044.

38. Halachmi, S., E. Marden, G. Martin, H. MacKay, C. Abbondanza, and M.Brown. 1994. Estrogen receptor-associated proteins: possible mediators ofhormone-induced transcription. Science 264:1455–1458.

39. Harding, H. P., T. J. Berrodin, and M. A. Lazar. Unpublished observations.40. Harding, H. P., and M. A. Lazar. Unpublished observations.41. Harding, H. P., and M. A. Lazar. 1993. The orphan receptor Rev-ErbAa

activates transcription via a novel response element. Mol. Cell. Biol. 13:3113–3121.

42. Hope, I. A., and K. Struhl. 1987. GCN4, a eukaryotic transcriptional activa-tor protein, binds as a dimer to target DNA. EMBO J. 6:2781–2784.

43. Husmann, M., B. Hoffmann, D. G. Stump, and M. Pfahl. 1992. A retinoicacid response element from the rat CRBPI promoter is activated by anRAR/RXR heterodimer. Biochem. Biophys. Res. Commun. 187:1558–1564.

44. Kamei, Y., T. Kawada, R. Kazuki, and E. Sugimoto. 1993. Retinoic acidreceptor g2 gene expression is up-regulated by retinoic acid in 3T3-L1preadipoctyes. Biochem J. 293:807–812.

45. Katz, D., and M. A. Lazar. 1993. Dominant negative activity of an endoge-nous thyroid hormone receptor variant (a2) is due to competition for bind-ing sites on target genes. J. Biol. Chem. 268:20904–20910.

46. Katz, R. W., and R. J. Koenig. 1993. Nonbiased identification of DNAsequences that bind thyroid hormone receptor alpha 1 with high affinity. J.Biol. Chem. 268:19392–19397.

47. Katz, R. W., and R. J. Koenig. 1994. Nucleotide substitutions differentiallyaffect direct repeat and palindromic thyroid hormone response elements. J.Biol. Chem. 269:9500–9505.

48. Kliewer, S. A., K. Umesono, D. J. Mangelsdorf, and R. M. Evans. 1992.Retinoid X receptor interacts with nuclear receptors in retinoic acid, thyroidhormone, and vitamin D3 signalling. Nature (London) 355:446–449.

49. Kurokawa, R., V. C. Yu, A. Naar, S. Kyakumoto, Z. Han, S. Silverman, M. G.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 21

Nov

embe

r 20

21 b

y 21

6.15

5.68

.194

.

Rosenfeld, and C. K. Glass. 1993. Differential orientations of the DNA-binding domain and carboxy-terminal dimerization interface regulate bind-ing site selection by nuclear receptor heterodimers. Genes Dev. 7:1423–1435.

50. Ladias, J. 1994. Convergence of multiple nuclear receptor signaling path-ways onto the long terminal repeat of human immunodeficiency virus-1. J.Biol. Chem. 269:5944–5951.

51. Law, S. W., O. M. Conneely, F. J. DeMayo, and B. W. O’Malley. 1992.Identification of a new brain-specific transcription factor, NURR1. Mol.Endocrinol. 6:2129–2135.

52. Lazar, M. A., T. J. Berrodin, and H. P. Harding. 1991. Differential DNAbinding by monomeric, homodimeric, and potentially heteromeric forms ofthe thyroid hormone receptor. Mol. Cell. Biol. 11:5005–5015.

53. Lazar, M. A., R. A. Hodin, D. S. Darling, and W. W. Chin. 1989. A novelmember of the thyroid/steroid hormone receptor family is encoded by theopposite strand of the rat c-erbAa transcriptional unit. Mol. Cell. Biol.9:1128–1136.

54. Lazar, M. A., K. E. Jones, and W. W. Chin. 1990. Isolation of a cDNAencoding human Rev-ErbAa: transcription from the non-coding DNA standof a thyroid hormone receptor gene results in a related protein which doesnot bind thyroid hormone. DNA Cell. Biol. 9:77–83.

55. Le Douarin, B., C. Zechel, J.-M. Garnier, Y. Lutz, L. Tora, B. Pierrat, D.Heery, H. Gronemeyer, P. Chambon, and R. Losson. 1995. The N-terminalpart of TIF1, a putative mediator of the ligand-dependent activation function(AF-2) of nuclear receptors, is fused to B-raf in the oncogenic protein T18.EMBO J. 14:2020–2033.

56. Lee, M. S., S. A. Kliewer, J. Provencal, P. E. Wright, and R. M. Evans. 1993.Structure of the retinoid X receptor alpha DNA binding domain: a helixrequired for homodimeric DNA binding. Science 260:1117–1121.

57. Leid, M., P. Kastner, R. Lyons, H. Nakshatri, M. Saunders, T. Zacharewski,J. Chen, A. Staub, J.-M. Garnier, S. Mader, and P. Chambon. 1992. Purifi-cation, cloning, and RXR identity of the HeLa cell factor with which RARor TR heterodimerizes to bind target sequences efficiently. Cell 68:377–395.

58. Leng, X., J. Blanco, S. Y. Tsai, K. Ozato, B. W. O’Malley, and M. Tsai. 1995.Mouse retinoid X receptor contains a separable ligand-binding and transac-tivation domain in its E region. Mol. Cell. Biol. 15:255–263.

59. Lepar, G. J., and D. B. Jump. 1992. Retinoic acid and dexamethasoneinteract to regulate S14 gene transcription in 3T3-F442A adipocytes. Mol.Cell. Endocrinol. 84:65–72.

60. Luisi, B. F., W. X. Xu, Z. Otwinowski, L. P. Freedman, K. R. Yamamoto, andP. B. Sigler. 1991. Crystallographic analysis of the interaction of the glu-cocorticoid receptor with DNA. Nature (London) 352:497–505.

61. Marks, M. S., P. L. Hallenback, T. Nagata, J. H. Segars, E. Appella, V. M.Nikodem, and K. Ozato. 1992. H-2RIIBP (RXRb) dimerization provides amechanism for combinatorial diversity in the regulation of retinoic acid andthyroid hormone responsive genes. EMBO J. 11:1419–1435.

62. McBroom, L. D. B., G. Flock, and V. Giguere. 1995. The nonconserved hingeregion and distinct amino-terminal domains of the RORa orphan nuclearreceptor isoforms are required for proper DNA bending and RARa-DNAinteractions. Mol. Cell. Biol. 15:796–808.

63. Miyajima, N., R. Horiuchi, Y. Shibuya, S. Fukushige, K. Matsubara, K.Toyoshima, and T. Yamamoto. 1989. Two erbA homologs encoding proteinswith different T3 binding capacities are transcribed from opposite DNAstrands of the same genetic locus. Cell 57:31–39.

64. O’Donnell, A. L., and R. J. Koenig. 1990. Mutational analysis identifies a newfunctional domain of the thyroid hormone receptor. Mol. Endocrinol. 4:715–720.

65. O’Malley, B. W., and O. M. Conneely. 1992. Orphan receptors: in search ofa unifying hypothesis for activation. Mol. Endocrinol. 6:1359–1361.

66. Pati, U. K. 1992. Novel vectors for expression of cDNA encoding epitope-tagged proteins in mammalian cells. Gene 114:285–288.

67. Perlmann, T., and L. Jansson. 1995. A novel pathway for vitamin A signalingmediated by RXR heterodimerization with NGFI-B and NURR1. GenesDev. 9:769–782.

68. Perlmann, T., P. N. Rangarajan, K. Umesono, and R. M. Evans. 1993.Determinants for selective RAR and TR recognition of direct repeat HREs.

Genes Dev. 7:1411–1422.69. Rastinejad, F., T. Perlmann, R. M. Evans, and P. B. Sigler. 1995. Structural

determinants of nuclear receptor assembly on DNA direct repeats. Nature(London) 375:203–211.

70. Retnakaran, R., G. Flock, and V. Giguere. 1994. Identification of RVR, anovel orphan nuclear receptor that acts as a negative transcriptional regu-lator. Mol. Endocrinol. 8:1234–1244.

71. Scearce, L. M., T. M. Laz, T. G. Hazel, L. F. Lau, and R. Taub. 1993. RNR-1,a nuclear receptor in the NGFI-B/nur77 family that is rapidly induced inregenerating liver. J. Biol. Chem. 268:8855–8861.

72. Schrader, M., M. Becker-Andre, and C. Carlberg. 1994. Thyroid hormonereceptor functions as monomeric ligand-induced transcription factor on oc-tameric half-sites. J. Biol. Chem. 269:6444–6449.

73. Schwabe, J. W., L. Chapman, J. T. Finch, and D. Rhodes. 1993. The crystalstructure of the estrogen receptor DNA-binding domain bound to DNA:how receptors discriminate among their response elements. Cell 75:567–578.

74. Smith, W. C., H. Nakshatri, P. Leroy, J. Rees, and P. Chambon. 1991. Aretinoic acid response element is present in the mouse cellular retinol bind-ing protein I (mCRBPI) promoter. EMBO J. 10:2223–2230.

75. Song, C., J. M. Kokontis, R. A. Hiipakka, and S. Liao. 1994. Ubiquitousreceptor: a receptor that modulates gene activation by retinoic acid andthyroid hormone receptors. Proc. Natl. Acad. Sci. USA 91:10809–10913.

76. Towers, T. L., B. F. Luisi, A. Asianov, and L. P. Freedman. 1993. DNA targetselectivity by the vitamin D3 receptor: mechanism of dimer binding to anasymmetric repeat element. Proc. Natl. Acad. Sci. USA 90:6310–6314.

77. Tran, P., X.-K. Zhang, G. Salbert, T. Hermann, J. M. Lehmann, and M.Pfahl. 1992. COUP orphan receptors are negative regulators of retinoic acidresponse pathways. Mol. Cell. Biol. 12:4666–4676.

78. Ueda, H., G. C. Sun, T. Murata, and S. Hirose. 1992. A novel DNA-bindingmotif abuts the zinc finger domain of insect nuclear hormone receptorFTZ-F1 and mouse embryonal long terminal repeat-binding protein. Mol.Cell. Biol. 12:5667–5672.

79. Umesono, K., and R. M. Evans. 1989. Determinants of target gene specificityfor steroid/thyroid hormone receptors. Cell 57:1139–1146.

80. Umesono, K., K. K. Murakami, C. C. Thompson, and R. M. Evans. 1991.Direct repeats as selective response elements for the thyroid hormone,retinoic acid, and vitamin D3 receptors. Cell 65:1255–1266.

81. Willy, P. J., K. Umesono, E. S. Ong, R. M. Evans, R. A. Heyman, and D. J.Mangelsdorf. 1995. LXR, a nuclear receptor that defines a distinct retinoidresponse pathway. Genes Dev. 9:1033–1045.

82. Wilson, T. E., T. J. Fahrner, M. Johnston, and J. Milbrandt. 1991. Identi-fication of the DNA binding site for NGF-IB by genetic selection in yeast.Science 252:1296–1299.

83. Wilson, T. E., T. J. Fahrner, and J. Milbrandt. 1993. The orphan receptorsNGFI-B and steroidogenic factor 1 establish monomer binding as a thirdparadigm of nuclear receptor-DNA interaction. Mol. Cell. Biol. 13:5794–5804.

84. Wilson, T. E., R. E. Paulsen, K. A. Padgett, and J. Milbrandt. 1992. Partic-ipation of non-zinc finger residues in DNA binding by two nuclear orphanreceptors. Science 256:107–110.

85. Zechel, C., X. Q. Shen, P. Chambon, and H. Gronemeyer. 1994. Dimeriza-tion interfaces formed between the DNA binding domains determine thecooperative binding of RXR/RAR and RXR/TR heterodimers to DR5 andDR4 elements. EMBO J. 13:1414–1424.

86. Zhang, X., J. Lehmann, B. Hoffmann, M. I. Dawson, J. Cameron, G.Graupner, T. Hermann, P. Tran, and M. Pfahl. 1992. Homodimer formationof retinoid X receptor induced by 9-cis retinoic acid. Nature (London)358:587–591.

87. Zhang, X.-K., B. Hoffmann, P. B.-V. Tran, G. Graupner, and M. Pfahl. 1992.Retinoid X receptor is an auxilliary protein for thyroid and retinoic acidreceptors. Nature (London) 355:441–446.

88. Zovich, D. C., A. Orologa, M. Okuno, L. W. Y. Kong, D. A. Talmage, R.Piantedosi, D. S. Goodman, and W. S. Blaner. 1992. Differentiation-depen-dent expression of retinoid-binding proteins in BFC-1b adipocytes. J. Biol.Chem. 267:13884–13889.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 21

Nov

embe

r 20

21 b

y 21

6.15

5.68

.194

.

the monomer-binding orphan receptor rev-erb represses transcription as a dimer on a novel

Documents