the power of crispr/cas9: rewriting the code of life · 2019. 8. 5. · the power of crispr/cas9:...

30
The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change me baby one more time Dr. Duško Lainšček, DVM National Institute of Chemistry Slovenia, Department of synthetic biology and immunology Ljubljana, 12.7.2019

Upload: others

Post on 01-Mar-2021

1 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change

The power of CRISPR/Cas9: Rewriting the code of life

„CRISPR in action“

BEST Course on Technology: Change me baby one more time

Dr. Duško Lainšček, DVM

National Institute of Chemistry Slovenia, Department of synthetic biology andimmunology

Ljubljana, 12.7.2019

Page 2: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change
Page 3: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change

Our work regarding CRSIPR/Cas

• Stable cell lines („knock out in knock in“ )

• Transcription regulation in varioius cell types

• Logic gates in mammalian cells

• Establishment of biosynthetic pathways in microbial cells

important way of introducing CRISPR/Cas system in the cell

(transfection, Cas9RNP, electroporation, nucleofection, transduction using adeno-, retro- and lentiviruses)

• Genetically modified animals (transgene animals)

Page 4: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change

1st step=Identiyfing the right target for designing sgRNA

http://crispr.mit.edu /

Different web tools: CRISPR Mit, CRISPreso, CHOP CHOP, Benchlinghttps://benchling.com/

Page 5: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change
Page 6: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change

• Construct preparation with appropriate selection markers (fluorescent proteins, ATB-kill curve!!!)-px330/458/459 vectors

• HDR template for „knock in“-ssODN (up to 200nt)-plasmids (homology

arms)

Addgene

Page 7: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change
Page 8: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change

TARČA ZA hD148E

sgRNA1

CGTCCAGCAGCCTGCCAGTG GGG (spodnja veriga)

Zaradi U6 promotorja restrikcijska mesta

Fw:

CACCGCACTGGCAGGCTGCTGGACG

Rw:

AAACCGTCCAGCAGCCTGCCAGTGC

ssODN hMyd88 D148E (GACv GAG)

wt sekvenca

CTGTCTCTTCCCCACAGAGGAGGATTGCCAAAAGTATATCTTGAAGCAGCAGCAGG

AGGAGGCTGAGAAGCCTTTACAGGTGGCCGCTGTAGACAGCAGTGTCCCACGGACA

GCAGAGCTGGCGGGCATCACCACACTTGATGACCCCCTGGGTAAGGGTCCAATACT

GTTCCCATGGGACAGGTGGA

Mutirana sekvenca (ssODN)

CTGTCTCTTCCCCACAGAGGAGGATTGCCAAAAGTATATCTTGAAGCAGCAGCAGG

AGGAGGCTGAGAAGCCTTTACAGGTCGCCGCTGTAGAGAGCAGTGTCCCACGGACA

GCAGAGCTGGCGGGCATCACCACACTTGATGACCCCCTGGGTAAGGGTCCAATACT

GTTCCCATGGGACAGGTGGA

PAM mutiran (valin; GTG v GTC)

Tarča

GAC v GAG

Page 9: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change

…. Delivery of CRISPR system (possible limitations of use in vivo)

Different mechanisms to increase Cas9 penetrance into cells/tissue:• Cas9RNP• CPP (cell penetrating proteins)• Changing the charge of the protein• Cas9 mRNA nanoparticles (liposomes)• iTOP method etc…

Wang et al. 2016.

Page 10: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change
Page 11: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change

https://www.abmgood.com/marketing/knowledge_base/CRISPR_Cas9_Tools_Methods.php

Page 12: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change

Workflow• Construct preparation (sgRNA, Cas9, selection markers)

• HDR template for „knock in“ mutations (ssODN, plasmid)

• Introducing the constructs into cells (transfection, electropration, Cas9RNP, viral transduction)

• Cell sorting based on selection marker

Addgene

Page 13: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change

• Mutation presence

-SSA or T7E1 assay (heterodulex detection); mix wt and mut DNA

wt wt+mut homoduplexi

NCVS

Surveyor test (SSA)2ul nukleaze; 42°C/1h

Fcut=b+c/a+b+c

Page 14: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change

• HRMA

• sequencing

Page 15: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change
Page 16: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change

CASP1

21%

MYD88 D135E

12%

CASP3

500500

500

17%

-GFP+ sorting on FACS (D135E, CASP1 KO, CASP3 KO, CASP1/3 DKO)-cell cloning by serial dilution

Agarose gel electrophoresis/PAGE electrophoresis-Sybr gold staining

Page 17: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change

600bp around target in pEGxxFP vector; GFP+ cells when appropriate sgRNA is present and efficient

blank pEGxxFP+pcDNA3 pEGxxFP+sgRNA1 pEGxxFP+sgRNA2

pEGxxFP+sgRNA3 pEGxxFP+sgRNA4 pEGxxFP+sgRNA5

• SNP present-use another method

Page 18: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change

• Cas9 protein production; Cas9RNP formationpCas9 in Rosetta E.coli; induction 0.1 in 0.25 mM IPTG, 30°C, 7h (inoculation at OD600 1.4)

-Lysis (20 mM TrisHCl, pH8, 200 mM NaCl, 1 mg/ml lizocim, benzoaza, 1 mM MgCl2, CPI, 10% glicerol)

SN, 0.1 mM IPTG SN 0.25 mMIPTG IB 0.1 IB 0.25 SN, 0.1 mM IPTG SN 0.25 mMIPTG IB 0.1 IB 0.25 100mm

imidazol

50mm

imidazol

Before the column purification After the column purification

RNA: in vitro transcription/order (Synthego)

Page 19: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change

Extracellular vesicles (EV); CRISPR/Cas9 delivery by extracellular vesicles for genome editing and therapeutic transcriptional regulation

Function:• Immunomodulation• Gene expression• Tissue regeneration• Inflammation• Tumorigenesis etc.

Page 20: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change

EV

Origin

Budding of membrane

Membrane blebbing/

apoptosis

Endolysosomal

pathway (MVB)

Size

50-1000 nm

500-2000 nm

40-200 nm

MV

MV

Apoptotic bodies

Apoptotic bodies

Exosomes

Exosomes

Also siRNA can be deliverd via EV… idea for our work

Page 21: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change

HEK293 cells transfection for desired packaging and production of EVs(CRISPR/Cas9 system)

Complex Cas9:sgRNA synthesis and packaginjg into EVs Collecting the Evs

enriched supernatant from HEK293 cells

EV isolation-ultracentrifugation

Genome modification

Characterization of EVs

Page 22: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change

CRISPR/Cas9 delivery by extracellular vesicles for genome editing and therapeutic transcriptional regulation

GEDEX: Genome Editing with Designed Extracellualr vesicles

Extracellular vesicles characterization

Page 23: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change
Page 24: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change

sgRNA target=eGFPgene in 293/GFP

Works in cells

Testing the functionality of the delivered CRISPR via EVs

Page 25: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change

CRISPR/Cas9 delivery via EVs works also in animals

sgRNA target=eGFPgene in B6/EGFP mice

i/p injection Do EVs have systemic effect?

Hydrodynamic delivery

No change in liver profile parameters

Page 26: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change
Page 27: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change
Page 28: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change

Validating the therapeuthic effect

• mouse model of hepatotoxicity (ANIT induced); approved : U34401-3/2017/8

Page 29: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change

CRISPR/Cas transgenesis: new disease animal models production

https://www.youtube.com/watch?v=xHvyICRM6FQ

Page 30: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change

…. any questions?

Thank you for your attention!!!