the power of crispr/cas9: rewriting the code of life · 2019. 8. 5. · the power of crispr/cas9:...
TRANSCRIPT
![Page 1: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change](https://reader035.vdocuments.net/reader035/viewer/2022071408/6100c138251ac220c3073b94/html5/thumbnails/1.jpg)
The power of CRISPR/Cas9: Rewriting the code of life
„CRISPR in action“
BEST Course on Technology: Change me baby one more time
Dr. Duško Lainšček, DVM
National Institute of Chemistry Slovenia, Department of synthetic biology andimmunology
Ljubljana, 12.7.2019
![Page 2: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change](https://reader035.vdocuments.net/reader035/viewer/2022071408/6100c138251ac220c3073b94/html5/thumbnails/2.jpg)
![Page 3: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change](https://reader035.vdocuments.net/reader035/viewer/2022071408/6100c138251ac220c3073b94/html5/thumbnails/3.jpg)
Our work regarding CRSIPR/Cas
• Stable cell lines („knock out in knock in“ )
• Transcription regulation in varioius cell types
• Logic gates in mammalian cells
• Establishment of biosynthetic pathways in microbial cells
important way of introducing CRISPR/Cas system in the cell
(transfection, Cas9RNP, electroporation, nucleofection, transduction using adeno-, retro- and lentiviruses)
• Genetically modified animals (transgene animals)
![Page 4: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change](https://reader035.vdocuments.net/reader035/viewer/2022071408/6100c138251ac220c3073b94/html5/thumbnails/4.jpg)
1st step=Identiyfing the right target for designing sgRNA
http://crispr.mit.edu /
Different web tools: CRISPR Mit, CRISPreso, CHOP CHOP, Benchlinghttps://benchling.com/
![Page 5: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change](https://reader035.vdocuments.net/reader035/viewer/2022071408/6100c138251ac220c3073b94/html5/thumbnails/5.jpg)
![Page 6: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change](https://reader035.vdocuments.net/reader035/viewer/2022071408/6100c138251ac220c3073b94/html5/thumbnails/6.jpg)
• Construct preparation with appropriate selection markers (fluorescent proteins, ATB-kill curve!!!)-px330/458/459 vectors
• HDR template for „knock in“-ssODN (up to 200nt)-plasmids (homology
arms)
Addgene
![Page 7: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change](https://reader035.vdocuments.net/reader035/viewer/2022071408/6100c138251ac220c3073b94/html5/thumbnails/7.jpg)
![Page 8: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change](https://reader035.vdocuments.net/reader035/viewer/2022071408/6100c138251ac220c3073b94/html5/thumbnails/8.jpg)
TARČA ZA hD148E
sgRNA1
CGTCCAGCAGCCTGCCAGTG GGG (spodnja veriga)
Zaradi U6 promotorja restrikcijska mesta
Fw:
CACCGCACTGGCAGGCTGCTGGACG
Rw:
AAACCGTCCAGCAGCCTGCCAGTGC
ssODN hMyd88 D148E (GACv GAG)
wt sekvenca
CTGTCTCTTCCCCACAGAGGAGGATTGCCAAAAGTATATCTTGAAGCAGCAGCAGG
AGGAGGCTGAGAAGCCTTTACAGGTGGCCGCTGTAGACAGCAGTGTCCCACGGACA
GCAGAGCTGGCGGGCATCACCACACTTGATGACCCCCTGGGTAAGGGTCCAATACT
GTTCCCATGGGACAGGTGGA
Mutirana sekvenca (ssODN)
CTGTCTCTTCCCCACAGAGGAGGATTGCCAAAAGTATATCTTGAAGCAGCAGCAGG
AGGAGGCTGAGAAGCCTTTACAGGTCGCCGCTGTAGAGAGCAGTGTCCCACGGACA
GCAGAGCTGGCGGGCATCACCACACTTGATGACCCCCTGGGTAAGGGTCCAATACT
GTTCCCATGGGACAGGTGGA
PAM mutiran (valin; GTG v GTC)
Tarča
GAC v GAG
![Page 9: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change](https://reader035.vdocuments.net/reader035/viewer/2022071408/6100c138251ac220c3073b94/html5/thumbnails/9.jpg)
…. Delivery of CRISPR system (possible limitations of use in vivo)
Different mechanisms to increase Cas9 penetrance into cells/tissue:• Cas9RNP• CPP (cell penetrating proteins)• Changing the charge of the protein• Cas9 mRNA nanoparticles (liposomes)• iTOP method etc…
Wang et al. 2016.
![Page 10: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change](https://reader035.vdocuments.net/reader035/viewer/2022071408/6100c138251ac220c3073b94/html5/thumbnails/10.jpg)
![Page 11: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change](https://reader035.vdocuments.net/reader035/viewer/2022071408/6100c138251ac220c3073b94/html5/thumbnails/11.jpg)
https://www.abmgood.com/marketing/knowledge_base/CRISPR_Cas9_Tools_Methods.php
![Page 12: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change](https://reader035.vdocuments.net/reader035/viewer/2022071408/6100c138251ac220c3073b94/html5/thumbnails/12.jpg)
Workflow• Construct preparation (sgRNA, Cas9, selection markers)
• HDR template for „knock in“ mutations (ssODN, plasmid)
• Introducing the constructs into cells (transfection, electropration, Cas9RNP, viral transduction)
• Cell sorting based on selection marker
Addgene
![Page 13: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change](https://reader035.vdocuments.net/reader035/viewer/2022071408/6100c138251ac220c3073b94/html5/thumbnails/13.jpg)
• Mutation presence
-SSA or T7E1 assay (heterodulex detection); mix wt and mut DNA
wt wt+mut homoduplexi
NCVS
Surveyor test (SSA)2ul nukleaze; 42°C/1h
Fcut=b+c/a+b+c
![Page 14: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change](https://reader035.vdocuments.net/reader035/viewer/2022071408/6100c138251ac220c3073b94/html5/thumbnails/14.jpg)
• HRMA
• sequencing
![Page 15: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change](https://reader035.vdocuments.net/reader035/viewer/2022071408/6100c138251ac220c3073b94/html5/thumbnails/15.jpg)
![Page 16: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change](https://reader035.vdocuments.net/reader035/viewer/2022071408/6100c138251ac220c3073b94/html5/thumbnails/16.jpg)
CASP1
21%
MYD88 D135E
12%
CASP3
500500
500
17%
-GFP+ sorting on FACS (D135E, CASP1 KO, CASP3 KO, CASP1/3 DKO)-cell cloning by serial dilution
Agarose gel electrophoresis/PAGE electrophoresis-Sybr gold staining
![Page 17: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change](https://reader035.vdocuments.net/reader035/viewer/2022071408/6100c138251ac220c3073b94/html5/thumbnails/17.jpg)
600bp around target in pEGxxFP vector; GFP+ cells when appropriate sgRNA is present and efficient
blank pEGxxFP+pcDNA3 pEGxxFP+sgRNA1 pEGxxFP+sgRNA2
pEGxxFP+sgRNA3 pEGxxFP+sgRNA4 pEGxxFP+sgRNA5
• SNP present-use another method
![Page 18: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change](https://reader035.vdocuments.net/reader035/viewer/2022071408/6100c138251ac220c3073b94/html5/thumbnails/18.jpg)
• Cas9 protein production; Cas9RNP formationpCas9 in Rosetta E.coli; induction 0.1 in 0.25 mM IPTG, 30°C, 7h (inoculation at OD600 1.4)
-Lysis (20 mM TrisHCl, pH8, 200 mM NaCl, 1 mg/ml lizocim, benzoaza, 1 mM MgCl2, CPI, 10% glicerol)
SN, 0.1 mM IPTG SN 0.25 mMIPTG IB 0.1 IB 0.25 SN, 0.1 mM IPTG SN 0.25 mMIPTG IB 0.1 IB 0.25 100mm
imidazol
50mm
imidazol
Before the column purification After the column purification
RNA: in vitro transcription/order (Synthego)
![Page 19: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change](https://reader035.vdocuments.net/reader035/viewer/2022071408/6100c138251ac220c3073b94/html5/thumbnails/19.jpg)
Extracellular vesicles (EV); CRISPR/Cas9 delivery by extracellular vesicles for genome editing and therapeutic transcriptional regulation
Function:• Immunomodulation• Gene expression• Tissue regeneration• Inflammation• Tumorigenesis etc.
![Page 20: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change](https://reader035.vdocuments.net/reader035/viewer/2022071408/6100c138251ac220c3073b94/html5/thumbnails/20.jpg)
EV
Origin
Budding of membrane
Membrane blebbing/
apoptosis
Endolysosomal
pathway (MVB)
Size
50-1000 nm
500-2000 nm
40-200 nm
MV
MV
Apoptotic bodies
Apoptotic bodies
Exosomes
Exosomes
Also siRNA can be deliverd via EV… idea for our work
![Page 21: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change](https://reader035.vdocuments.net/reader035/viewer/2022071408/6100c138251ac220c3073b94/html5/thumbnails/21.jpg)
HEK293 cells transfection for desired packaging and production of EVs(CRISPR/Cas9 system)
Complex Cas9:sgRNA synthesis and packaginjg into EVs Collecting the Evs
enriched supernatant from HEK293 cells
EV isolation-ultracentrifugation
Genome modification
Characterization of EVs
![Page 22: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change](https://reader035.vdocuments.net/reader035/viewer/2022071408/6100c138251ac220c3073b94/html5/thumbnails/22.jpg)
CRISPR/Cas9 delivery by extracellular vesicles for genome editing and therapeutic transcriptional regulation
GEDEX: Genome Editing with Designed Extracellualr vesicles
Extracellular vesicles characterization
![Page 23: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change](https://reader035.vdocuments.net/reader035/viewer/2022071408/6100c138251ac220c3073b94/html5/thumbnails/23.jpg)
![Page 24: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change](https://reader035.vdocuments.net/reader035/viewer/2022071408/6100c138251ac220c3073b94/html5/thumbnails/24.jpg)
sgRNA target=eGFPgene in 293/GFP
Works in cells
Testing the functionality of the delivered CRISPR via EVs
![Page 25: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change](https://reader035.vdocuments.net/reader035/viewer/2022071408/6100c138251ac220c3073b94/html5/thumbnails/25.jpg)
CRISPR/Cas9 delivery via EVs works also in animals
sgRNA target=eGFPgene in B6/EGFP mice
i/p injection Do EVs have systemic effect?
Hydrodynamic delivery
No change in liver profile parameters
![Page 26: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change](https://reader035.vdocuments.net/reader035/viewer/2022071408/6100c138251ac220c3073b94/html5/thumbnails/26.jpg)
![Page 27: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change](https://reader035.vdocuments.net/reader035/viewer/2022071408/6100c138251ac220c3073b94/html5/thumbnails/27.jpg)
![Page 28: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change](https://reader035.vdocuments.net/reader035/viewer/2022071408/6100c138251ac220c3073b94/html5/thumbnails/28.jpg)
Validating the therapeuthic effect
• mouse model of hepatotoxicity (ANIT induced); approved : U34401-3/2017/8
![Page 29: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change](https://reader035.vdocuments.net/reader035/viewer/2022071408/6100c138251ac220c3073b94/html5/thumbnails/29.jpg)
CRISPR/Cas transgenesis: new disease animal models production
https://www.youtube.com/watch?v=xHvyICRM6FQ
![Page 30: The power of CRISPR/Cas9: Rewriting the code of life · 2019. 8. 5. · The power of CRISPR/Cas9: Rewriting the code of life „CRISPR in action“ BEST Course on Technology: Change](https://reader035.vdocuments.net/reader035/viewer/2022071408/6100c138251ac220c3073b94/html5/thumbnails/30.jpg)
…. any questions?
Thank you for your attention!!!