the purified and recombinant legionella pneumophila … · audrey chong, 1† celia a. lima, david...

INFECTION AND IMMUNITY, Nov. 2009, p. 4724–4739 Vol. 77, No. 110019-9567/09/$12.00 doi:10.1128/IAI.00150-09Copyright © 2009, American Society for Microbiology. All Rights Reserved.

The Purified and Recombinant Legionella pneumophila ChaperoninAlters Mitochondrial Trafficking and Microfilament Organization�

Audrey Chong,1† Celia A. Lima,1 David S. Allan,1 Gheyath K. Nasrallah,1 and Rafael A. Garduno1,2*Department of Microbiology and Immunology1 and Department of Medicine–Division of Infectious Diseases,2 Faculty of Medicine,

Dalhousie University, Halifax, Nova Scotia B3H 1X5, Canada

Received 8 February 2009/Returned for modification 21 March 2009/Accepted 5 August 2009

A portion of the total cellular pool of the Legionella pneumophila chaperonin, HtpB, is found on the bacterialcell surface, where it can mediate invasion of nonphagocytic cells. HtpB continues to be abundantly producedand released by internalized L. pneumophila and may thus have postinvasion functions. We used here twofunctional models (protein-coated beads and expression of recombinant proteins in CHO cells) to investigatethe competence of HtpB in mimicking early intracellular trafficking events of L. pneumophila, including therecruitment of mitochondria, cytoskeletal alterations, the inhibition of phagosome-lysosome fusion, and as-sociation with the endoplasmic reticulum. Microscopy and flow cytometry studies indicated that HtpB-coatedbeads recruited mitochondria in CHO cells and U937-derived macrophages and induced transient changes inthe organization of actin microfilaments in CHO cells. Ectopic expression of HtpB in the cytoplasm oftransfected CHO cells also led to modifications in actin microfilaments similar to those produced by HtpB-coated beads but did not change the distribution of mitochondria. Association of phagosomes containingHtpB-coated beads with the endoplasmic reticulum was not consistently detected by either fluorescence orelectron microscopy studies, and only a modest delay in the fusion of TrOv-labeled lysosomes with phagosomescontaining HtpB-coated beads was observed. HtpB is the first Legionella protein and the first chaperonin shownto, by means of our functional models, induce mitochondrial recruitment and microfilament rearrangements,two postinternalization events that typify the early trafficking of virulent L. pneumophila.

The gram-negative bacterium Legionella pneumophila is anintracellular parasite of amoebae (67) that has emerged as anaccidental human pathogen capable of replicating in mononu-clear phagocytes (38), primarily alveolar macrophages. Lunginfection by L. pneumophila usually begins after the inhalationof contaminated water aerosol and manifests as an atypicalpneumonia known as Legionnaires’ disease (86).

The early events of L. pneumophila infection are well de-scribed at the cellular level. The first steps of infection arebacterial attachment to host cell receptors and subsequentinternalization by conventional phagocytosis (27, 61, 75), coil-ing phagocytosis (12, 35), or macropinocytosis (84). Once in-ternalized, L. pneumophila remains contained within a mem-brane-bound compartment, which is transformed into aspecialized vacuole referred to as the Legionella-containingvacuole (LCV). The major cellular events of LCV conditioninginclude recruitment of vesicles and mitochondria (26, 33, 60),avoidance of both acidification and fusion with lysosomes (34,37), and association with the endoplasmic reticulum (ER) (33,42, 79, 80). Less known (or predictable) are the early changesin F-actin organization induced by L. pneumophila, which seemto be unrelated to the F-actin rearrangements required for itsinternalization (16, 44, 60, 78).

At the molecular level, at least five bacterial gene products,RtxA, EnhC (13, 14), LpnE (58), LvhB2 (65), and HtpB (25)are involved in cell entry, confirming L. pneumophila’s flexibil-ity in the use of alternate entry pathways. Conditioning of theLCV requires the Dot/Icm type IV secretion system of L.pneumophila, suggesting that the translocation of type IV-se-creted effectors into host cells is essential for the recruitmentof organelles and avoidance of acidification and fusion withlysosomes (3, 15, 53). Although a number of specific Dot/Icmeffectors have been identified that mediate the sequestration ofER-derived vesicles to the LCV (19, 40, 48, 50, 63), no specificgene products have been linked to the recruitment of mito-chondria or the inhibition of LCV-lysosome fusion.

It has been hypothesized that the factors that mediate theinternalization of L. pneumophila are preformed and may alsoparticipate in the early conditioning of the LCV (see, for ex-ample, reference 41). This hypothesis is supported by the fol-lowing observations: (i) conditioning of the LCV begins withinminutes after L. pneumophila internalization (18, 42, 49, 68),and (ii) antibiotic-treated legionellae (incapable of de novoprotein synthesis) are not affected in their ability to attach to orenter host cells (26, 39) and resume intracellular growth im-mediately after removal of the antibiotic (39). It seems that L.pneumophila is prearmed to deploy a sequence of coordinatedevents (which follow a precise timing) immediately after mak-ing contact with a host cell, a notion also suggested by detailedmicroscopy studies conducted in the genetically tractableamoeba Dictyostelium discoideum (49). Moreover, some of theinfection steps clearly have a short duration (49), suggestingthat L. pneumophila may transiently alter a number of cellularprocesses. The transient nature of such effects sometimes de-pends on the host cell being infected. For instance, in human

* Corresponding author. Mailing address: Department of Microbi-ology and Immunology, 5850 College Street, Sir Charles Tupper Med-ical Building, 7th Floor, Dalhousie University, Halifax, Nova ScotiaB3H 1X5, Canada. Phone: (902) 494-6575. Fax: (902) 494-5125.E-mail: [email protected].

† Present address: Laboratory of Intracellular Parasites, NIAID, Na-tional Institutes of Health, Rocky Mountain Laboratories, 903 South 4thSt., Hamilton, MT 59840.

� Published ahead of print on 17 August 2009.

4724

on June 10, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

https://crossmark.crossref.org/dialog/?doi=10.1128/IAI.00150-09&domain=pdf&date_stamp=2009-11-01

http://iai.asm.org/

macrophages avoidance of both LCV acidification and fusionwith lysosomes persists throughout the intracellular growthcycle (70, 85), whereas in murine macrophages, LCVs acidifyand fuse with lysosomes toward the end of the L. pneumophilareplicative phase (76). In contrast, other LCV conditioningprocesses, such as the association with mitochondria and ER,are structurally maintained (regardless of the cellular host be-ing infected) until the replicative phase of the intracellulargrowth cycle has been completed (26, 33, 60).

L. pneumophila HtpB is a member of the group 1 chaper-onins, which includes the evolutionarily conserved and essen-tial chaperonins of bacteria, mitochondria and plastids, withwell-characterized roles in protein folding (28). The functionof bacterial chaperonins, however, is not limited to proteinfolding. Chaperonins of bacteria can mediate adherence tomammalian cells (22), stabilize membrane lipids (81), paralyzeinsects (87), and activate eukaryotic signaling cascades (51, 88).The expression of HtpB is upregulated in the presence of L929murine cells or human monocytes, and high levels of expres-sion are maintained during the course of intracellular infection(21), leading to its accumulation in the lumen of the LCV, asshown in infected HeLa cells (24). The increased production ofHtpB in L929 cells and monocytes correlates with virulencebecause spontaneous salt-tolerant, avirulent mutants of L.pneumophila are unable to upregulate the expression of HtpBupon contact with these host cells (21). In addition, HtpB isfound in association with the L. pneumophila cytoplasmicmembrane (5, 23), as well as on the bacterial cell surface (24),where it can mediate invasion of HeLa cells (25). As a L.pneumophila factor that mediates cell entry (25), and one thatcontinues to be abundantly produced and released into theLCV after L. pneumophila internalization (24, 32), HtpB mayparticipate in the early intracellular establishment of L. pneu-mophila. In the present study, we show that microbeads coatedwith purified HtpB (but not uncoated beads or beads coatedwith control proteins) are sufficient to attract mitochondriaand transiently modify the organization of actin microfilamentsin mammalian cells, two postinternalization events that typifythe early trafficking of virulent L. pneumophila.

MATERIALS AND METHODS

Bacterial strains and growth conditions. L. pneumophila strain Lp02 and theLp02dotA mutant JV309 (3, 83) were obtained from R. Isberg (Tufts UniversityMedical School, Boston, MA). The Lp02dotB mutant JV303 (83) was obtainedfrom J. Vogel (Washington University School of Medicine, St. Louis, MO). Lp02,Lp02dotA, and Lp02dotB were grown at 37°C on BCYE agar, or BYE broth,

containing thymidine and streptomycin (both at 100 �g/ml) (3). Escherichia colistrains DH5� (cloning host) and JM109 (used to over produce GroEL andHtpB) were grown at 37°C on LB agar with or without antibiotics, as required(69). Bacterial medium components were from Difco-BD (Sparks, MD), EMScience (Gibbstown, MD), and (or) Sigma-Aldrich (St. Louis, MO).

GFP and RFP expression in L. pneumophila. Plasmid pBH6119::htpAB, carryingthe gfp gene under the control of the htpAB promoter (4), was a gift from K.Brassinga (University of Manitoba, Winnipeg, Manitoba, Canada). Plasmid pSW001(52), encoding DsRed fluorescent protein (RFP), was a gift from H. Hilbi (ETHZurich). Lp02 and Lp02dotB were transformed with pBH6119::htpAB or pSW001 byelectroporation (4, 82), and green fluorescent protein (GFP)-expressing transfor-mants were selected at 37°C on BCYE agar with streptomycin (100 �g/ml), andRFP-expressing transformants on BCYE agar with streptomycin and thymidine (100�g/ml) and chloramphenicol (5 �g/ml).

Cell culture. Wild-type, proline-requiring Chinese hamster ovary (CHO-wt)cells (29) were obtained from R. Gupta (McMaster University, Hamilton, On-tario, Canada). CHO-wt cells were cultured in minimal essential medium(MEM) supplemented with 5% fetal bovine serum (FBS), 100 U of penicillin/ml,and 100 �g of streptomycin/ml (all from Gibco-Invitrogen [Grand Island, NY],except for the FBS [HyClone, Logan, UT]). We also used CHO-htpB cells tocompare the effects of HtpB-coated beads with the effects of cytoplasmic recom-binant HtpB in the same cells. CHO-htpB cells are the stably transfected line ofCHO-AA8 Tet-Off cells (Clontech-BD, Palo Alto, CA) containing the htpB genecloned into pTRE2hyg (see below). CHO-htpB cells were grown at 37°C and 5%CO2 in �MEM supplemented with 5% FBS, 100 U of penicillin/ml, 100 �g ofstreptomycin/ml, 300 �g of Geneticin/ml, and 200 �g of hygromycin B/ml (allfrom Gibco except the FBS) and 10 ng of doxycycline (Clontech)/ml. Geneticinand hygromycin assured maintenance of the integrated plasmid, and doxycyclinerepressed HtpB expression. In the presence of 10 ng of doxycycline/ml, CHO-htpB and CHO-AA8 Tet-Off cells were similar in relation to morphology andpermissiveness to L. pneumophila (10 ng of doxycycline/ml did not inhibit thegrowth of Lp02 or Lp02dotA). U937 cells were obtained from A. Issekutz (Dal-housie University) and grown in suspension in RPMI 1640 (Gibco) supple-mented with 10% FBS, 2 mM L-glutamine (Gibco), 100 U of penicillin/ml, and100 �g of streptomycin/ml at 37°C in 5% CO2. U937 cells differentiated intoadherent, macrophagelike cells with 60 ng of phorbol 12-myristate 13-acetate(PMA; Sigma)/ml and plated at a density of 3 � 106 cells/well in six-well cultureplates (Falcon-BD Biosciences Canada, Mississauga, Ontario, Canada). AfterPMA activation (24 h), the cells were washed once with RPMI 1640 supple-mented with 5% FBS and 2 mM L-glutamine. Adherent U937-derived macro-phages were further incubated for 24 to 48 h in the same medium prior to theaddition of beads or bacteria.

Constructs for expression of recombinant proteins in CHO-AA8 Tet-Off cells.Plasmid pTRE2hyg (PhCMV*-1, ColE1ori, Ampr Hygr; Clontech) was used for theexpression of HtpB, GroEL, and DsRed. (i) The primers CHOhtpB forward andCHOhtpB reverse (Table 1) were used to PCR amplify htpB from plasmidpSH16 (31). The amplification product was T/A cloned into the EcoRV site ofpBluescript KS (Stratagene, La Jolla, CA) to create pBS::htpB-1, from which aBamHI-ClaI fragment was subcloned into pTRE2hyg to generate pTRE2-htpBhyg. (ii) The primers groEL forward and groEL reverse (Table 1) were used toamplify groEL from E. coli DH5� chromosomal DNA. The PCR product wasT/A cloned into the EcoRV site of pBluescript to create pBS::groEL, from whicha NotI-SalI fragment was subcloned into pTRE2hyg to generate pTRE2-groELhyg. Insertion of a Kozak sequence (45) and modification of the first leucinecodon of the htpB sequence (Table 1) enhanced expression of the bacterial

TABLE 1. Sequences of PCR primers

Primer Sequence (5�–3�)a Restriction site

CHOhtpB forward AGTCTAGACAGCCGCCATGGCTAAAGAACTGCGTTTTGGTGATGA NoneCHOhtpB reverse ACCTCTAGAAACTTACATCATTCCGCC NonegroEL forward AGCGGCCGCCGCCATGGCAGCTAAAGACGTA NonegroEL reverse GTGTCGACCACTTACATCATGCCGCCCAT NonehtpABP1 CCCCGCGGCCGCTCAAGAGGTGTTGCTTCAGG NotIhtpABP2 CCCCGGATCCCCATACGACGAACAACAACG BamHIhtpABP3 CCCCGGATCCTGGGCGGAATGATGTAATTT BamHIhtpABP4 CCCCCTCGAGGGCACTGATTCCATATCAACTG XhoIhtpB-Forward GCCATTGCTCAAGTTGGAACTAT NonehtpB-Reverse GCGTTGAAACCGTAGTTGTCTTT None

a The boldfacing indicates a Kozak sequence, and the boldface italics indicates a modified leucine codon. The restriction sites are underlined.

VOL. 77, 2009 L. PNEUMOPHILA HtpB ALTERS MITOCHONDRIAL TRAFFICKING 4725


.org/D

ownloaded from

http://iai.asm.org/

chaperonins in CHO cells. (iii) A BamHI-NotI fragment from plasmid pDsRed2(pUCori, Plac, Ampr) encoding the RFP drFP583 from Discosoma sp. (Clontech)was subcloned into pTRE2hyg (using the same restriction sites) to generatepTRE2-Dsred2 hyg. Construct integrity was confirmed by DNA sequencing (Dal-Gen; Dalhousie University). CHO-AA8 Tet-Off cells were transiently trans-fected by using Lipofectamine 2000 (Invitrogen, Carlsbad, CA). Stably trans-fected CHO-htpB cells were isolated as single colonies of CHOAA8 Tet-Off cellscarrying pTRE2-htpB hyg after dilution-cloning in medium with hygromycin B(200 �g/ml).

Expression of recombinant proteins in CHOAA8 Tet-Off cells. Expressionfrom the pTRE2-hyg constructs (previous section) was induced in the absence ofdoxycycline and confirmed in cells grown on 22-by-22-mm coverslips placedinside six-well plates, by direct (DsRed2) or indirect (HtpB and GroEL) fluo-rescence microscopy using a BX61 Olympus microscope (Olympus Canada,Markham, Ontario, Canada). For indirect fluorescence microscopy, cells oncoverslips were fixed in 4% paraformaldehyde for 10 min, permeabilized in 0.1%Triton X-100 for 5 min, and blocked in 2% bovine serum albumin (BSA) for 30min, all prepared in phosphate-buffered saline (PBS; 137 mM NaCl, 2.7 mMKCl, 2 mM KH2PO4, 10 mM NaH2PO4 [pH 7.4]). Immunostaining was donewith our rHtpB-specific polyclonal antibody (see below) diluted 1:500 and AlexaFluor-546 secondary antibody (Molecular Probes-Invitrogen, Carlsbad, CA) di-luted 1:200. All washes were done by passing the coverslips 3� in fresh PBS for10 min. For stably transfected CHO-htpB cells, ectopic expression of HtpB(referred to as eHtpB) was assessed by fluorescence microscopy and immuno-blotting at different concentrations of doxycycline. CHO-htpB cells seeded at adensity of �5 � 105 cells/well into six-well plates (Falcon) were grown overnightwith 10 ng of doxycycline/ml. Cells were washed and further cultured for 48 h inmedium with different concentrations of doxycycline. Cells were then detachedwith 2 mg of trypsin (Sigma)/ml, harvested, and washed with PBS, before beingcounted in an improved Neubauer chamber (Hausser Scientific, Horsham, PA).5� Laemmli sample buffer (5 �l) containing 10% 2-mercaptoethanol was addedto �6 � 105 cells in 10 �l of PBS. Samples were boiled for 10 min and subjectedto sodium dodecyl sulfate-polyacrylamide gel electrophoresis and immunoblot-ting according to the procedures of Laemmli and Towbin et al. as reportedpreviously (24). Proteins transferred to a PALL nitrocellulose membrane (VWRCanada, Mississauga, Ontario, Canada) were stained with Ponceau-S, and areference TIFF image was obtained in an Epson ES 1200C scanner (EpsonCanada, Toronto, Ontario, Canada). Membranes were then immunostainedwith a hybridoma supernatant of HtpB-specific monoclonal antibodyGW2X4B8B2H6 (30) diluted 1:200, followed by alkaline phosphatase-conju-gated anti-mouse immunoglobulin G (IgG; Cedarlane Laboratories, Hornby,Ontario, Canada) diluted 1:5,000. Color was developed with 5-bromo-4-chloro-3-indolylphosphate (BCIP) and nitroblue tetrazolium (Sigma), and a TIFF imageof the stained membrane was produced using an Epson ES 1200C scanner.Stained bands were analyzed by densitometry (on the unprocessed TIFF images)using the single-band analysis tool of Gel-Pro Analyzer v.4.5 software (MediaCybernetics, Silver Spring, MD).

Purification of HtpB from L. pneumophila, recombinant HtpB from E. coli, andGroEL from E. coli. Lp02 harboring the htpAB operon in RSF1010 (1) or E. coliJM109 harboring plasmid pSH16 (pUC19 with the htpAB operon insert [31])were grown, respectively, at 30°C for 48 h, 150 rpm, in 2 liters of BYE broth withkanamycin (30 �g/ml) and at 30°C for 24 h and 150 rpm in 2 liters of LB brothwith ampicillin (100 �g/ml), followed by heat shock at 42°C for 2 h. Cultures werecentrifuged at 6,000 � g for 20 min, and pelleted bacterial cells were resuspendedin 40 ml of column buffer (50 mM Tris [pH 7.6], 35 mM KCl, 25 mM NH4Cl, 5mM EDTA, 1 mM phenylmethylsulfonyl fluoride, 5 mM dithiothreitol). Crudebacterial lysates were made by passing the bacterial suspensions four timesthrough a French press cell at 20,000 lb/in2. Sarkosyl (2% in water) was added(200 �l) to the lysate prior to sonication in three cycles, each for 1 min, plus 4 minof cooling on ice. Lysates were clarified by centrifugation at 8,800 � g for 10 min.HtpB was precipitated from the clarified lysate with (NH4)2SO4 (41% satura-tion), resolubilized in column buffer, and subjected to ion-exchange chromatog-raphy in a DE-52 (Whatman, Clifton, NJ) 50-ml column, eluting with 1 liter ofa 0 to 0.4 M KCl gradient. Fractions containing HtpB (detected by dot immu-noblot with monoclonal antibody GW2X4B8B2H6) were pooled and concen-trated by ultrafiltration in a positive pressure 400-ml chamber (Amicon, Beverly,MA) using a 10,000 molecular weight cutoff, 70-mm Spectrapor membrane(Spectrum, Rancho Dominguez, CA). The concentrated sample was then se-quentially run through a 0.6-liter G200 and a 0.4-liter G75 Sephadex column(Amersham-GE Healtcare Canada, Baie d’Urfe, Quebec, Canada). Fractionscontaining HtpB were pooled, dialyzed, and concentrated by ultrafiltration. Thefinal protein concentration was determined by using a protein assay (Bio-RadCanada, Mississauga, Ontario, Canada). Recombinant HtpB from E. coli con-

tains GroEL and is referred to as rHtpB, whereas the HtpB from L. pneumophilais simply referred to as HtpB. GroEL was purified from E. coli JM109 harboringplasmid pTrcGroE (obtained from P. B. Sigler, Molecular Biophysics and Bio-chemistry, Yale University), which is pTrc99a carrying the E. coli groELS operonunder the trc promoter. E. coli-pTrcGroE was grown at 37°C for �18 h at 150rpm, in 2 liters of LB containing ampicillin (100 �g/ml) and then incubated for1.5 h at 40°C with 5 mM IPTG (isopropyl-�-D-thiogalactopyranoside) to inducemaximal production of GroEL. Bacterial cells were harvested and lysed, andGroEL purified from the crude bacterial lysate as described above for HtpB andrHtpB. Detection of GroEL in the various chromatography fractions was done bydot immunoblot with the GroEL-specific monoclonal antibody SPA-870 (Stress-Gen-Assay Designs, Ann Arbor, MI). Our in-house GroEL should be distin-guished from the commercial one (StressGen), referred to as GroEL. Reagentsused in chaperonin purifications were all analytical grade from Sigma, FisherScientific (Fair Lawn, NJ), or BDH, Inc. (Toronto, Ontario, Canada).

Anti-rHtpB serum. Purified rHtpB (100 �g) was emulsified in a total of 300 �lof complete Freund adjuvant (Sigma), and subcutaneously injected into threedifferent sites (100 �l/site) on the back of a New Zealand White rabbit (CharlesRiver Canada, Saint-Constant, Quebec, Canada). The initial injection was fol-lowed by two boosters (3 weeks apart) of 100 �g of rHtpB in 300 �l of incompleteFreund adjuvant (Sigma), subcutaneously injected on the back in three differentsites (100 �l/site). The rabbit was euthanized 9 weeks after the initial injection (3weeks after the second booster). Hyperimmune serum was recovered and keptfrozen at �80°C for long-term storage or at 4°C for short-term storage. Rabbitwas cared for following guidelines outlined by the Canadian Council for AnimalCare, under a protocol approved by the Dalhousie University Committee onLaboratory Animals.

Protein-coated beads. Polystyrene carboxylated beads (�9 � 109), 1 �m indiameter, with blue (excitation, 365 nm/emission, 415 nm), yellow-green (505/515), or crimson red (625/645) fluorescence (Molecular Probes, Eugene, OR)were coated with 200 �g of BSA (Sigma), GroEL, in-house GroEL, rHtpB, orHtpB using a carbodiimide kit (Polysciences, Warrington, PA) in a total volumeof 1 ml. Levels of bound proteins were equivalent between beads (11 � 7 fg/bead,with GroEL [5 fg/bead] and in house GroEL [18.8 fg/bead] showing the lowestand highest average levels), as estimated by subtracting protein concentrationsbefore and after reaction with carbodiimide-activated beads (Bio-Rad assay).Bound chaperonins were confirmed by dot immunoblot: 3 �l of coated beads(�6 � 106 beads) was spotted onto nitrocellulose and stained with our rHtpB-specific polyclonal antibody at a 1:1,000 dilution, followed by goat anti-rabbit IgGconjugated to alkaline phosphatase (Cedarlane Laboratories) at 1:5,000 dilution,all in 0.1 M Tris-buffered saline (pH 8). Pretreatment of �108 beads withrHtpB-specific antiserum (diluted 1:100) was done at 37°C for 1 h in 200 �l ofPBS with 0.2% BSA, followed by three washes with 1 ml of PBS. All beads werestored in PBS with 0.05% sodium azide (J. T. Baker, Phillipsburg NJ). Beforeuse, all beads were washed three times with PBS and counted directly in aPetroff-Hausser chamber (Hausser Scientific).

Association of beads with cells. CHO-wt and CHO-htpB cells seeded on22-by-22 mm no. 0 glass coverslips (Fisher Scientific) in six-well plates (5 � 105

cells/coverslip) were cultured for 48 h in 3 ml of culture medium. Cells werewashed three times with 1 ml of PBS, and differently coated blue fluorescentbeads were added at a bead/cell ratio of 20 in culture medium. Plates werecentrifuged at 1,000 � g for 5 min at 25°C, to enhance bead-cell contact, andincubated for different times at 37°C in 5% CO2. Unattached beads were re-moved by six washes with PBS. The cells were then stained for 30 min at 37°C in5% CO2 with 5 �M 5-chloro-methyl-fluorescein diacetate (Molecular Probes) in1 ml of medium with antibiotics, washed three times with PBS, and chased for 20min with 1 ml of fresh medium. Cells were then fixed in 4% paraformaldehydein PBS for 10 min and mounted with Vectashield (Vector Laboratories Canada,Burlington, Ontario, Canada) on glass slides. The number of beads/cell wasdetermined by direct fluorescence microscopy counts in a BX61 Olympus mi-croscope.

Beads and L. pneumophila association with mitochondria. CHO-wt and CHO-htpB cells were seeded onto coverslips in six-well plates and incubated withdifferently coated blue fluorescent beads, as described in the previous section. L.pneumophila grown on BCYE for 3 days were harvested in 5 ml of distilled H2O(dH2O), and the bacterial suspension standardized to 1 optical density unit at620 nm (�109 bacterial cells/ml). An inoculum of �108 bacteria was prepared in3 ml of �MEM without antibiotics, vortexed thoroughly, and added to each well.The plates were centrifuged at 1,000 � g for 5 min at 25°C to promote bead- orbacterium-cell contact and incubated for 1 h to allow internalization. Unattachedbeads or bacteria were removed with six washes with PBS and the mitochondriawere stained (1 h samples), or the cells were further incubated for 2 h with freshmedium prior to staining (3 h samples). Staining was done with 300 nM Mito-

4726 CHONG ET AL. INFECT. IMMUN.


.org/D

ownloaded from

http://iai.asm.org/

Tracker Orange CMTMRos (Molecular Probes) diluted in prewarmed�MEM–5% FBS with antibiotics for 45 min at 37°C in 5% CO2, followed bythree PBS washes, and a 10-min chase in fresh medium. Association with mito-chondria was quantified in a BX61 Olympus fluorescence microscope equippedwith an Evolution QET monochrome camera (Media Cybernetics), and imageswere taken and processed by using Image Pro Plus (version 5.0.1; Media Cyber-netics).

Isolation and immunolabeling of phagosomes containing beads. Four 25-cm2

cell culture flasks (Falcon) were seeded with 107 PMA-activated U937 cells in 7ml of fresh RPMI 1640, and incubated for 2 days. After the nonadherent cellswere washed with RPMI, each flask contained �5 � 106 U937-derived macro-phages, which were incubated with red fluorescent Lp02, or beads, at a ratio of�1,000 bacteria/cell or �100 beads/cell. U937 cells did not efficiently take upLp02dotB, and thus formalin-killed red fluorescent Lp02 (10% formalin in PBSfor 10 min, followed by three washes with PBS) was used as a negative control.Flasks were centrifuged at 500 � g for 10 min at 25°C in a swing-out no. 1622rotor of a Universal 32R centrifuge (Hettich, Beverly, MA) and subsequentlyincubated at 37°C for 3 h with hourly centrifugations (as described above) tomaximize bacterium- or bead-cell contact. Phagosomes containing bacteria orbeads were then isolated by the method of Chakraborty et al. (9) using siliconizedpolypropylene microcentrifuge tubes (Sigma). The cells were washed three timeswith 5 ml of PBS at 37°C and scraped into 1 ml of cold homogenization buffer(250 mM sucrose, 20 mM HEPES, 0.5 mM EGTA, and 0.1% gelatin, adjusted topH 7.0 with 6 N KOH). Scraped cells were lysed by 12 forceful passages througha 27-gauge needle, and the lysate was centrifuged at 400 � g for 10 min at 4°Cto pellet the cell debris and unbroken cells. The supernatant (�1 ml) wascentrifuged at 2,000 � g for 20 min at 4°C to pellet phagosomes, which wereeither processed for electron microscopy (see below) or fixed for 15 min at 4°Cin 2% paraformaldehyde in 1 ml of PBS. Fixed phagosomes were pelleted bycentrifugation at 12,000 � g for 3 min and resuspended in 1 ml of PBS with 0.1%Triton X-100 for 10 min at room temperature. Immunolabeling with an anti-cytochrome c mouse monoclonal (0.5 mg/ml; Zymed-Invitrogen, Carlsbad, CA)and Alexa Fluor 546-conjugated goat anti-mouse IgG (Molecular Probes) wasperformed as follows, in a volume of 200 �l: step 1, 2% BSA in PBS added tophagosomes for 1 h at room temperature; step 2, monoclonal antibody diluted1:600 in PBS with 0.2% BSA for 1 h at 37°C; and step 3, anti-mouse IgG diluted1:1,000 in PBS with 0.2% BSA for 1 h at 37°C. All steps were followed by twowashes in PBS with centrifugation at 12,000 � g for 3 min at room temperaturein a Hettich MICRO 20 microcentrifuge. Immunolabeled phagosomes wereresuspended in 0.4 ml of PBS and run in a FACScalibur (BD BiosciencesCanada, Mississauga, Ontario, Canada) to score the colocalization of red fluo-rescence (bacteria or beads) and green fluorescence (mitochondria). Ten thou-sand events were acquired per sample with the forward scatter acquisition set atE02, and data from the FL1 and FL4 channels were saved and plotted.

Effect of beads, L. pneumophila, and ectopic expression of HtpB on cytoskeletalorganization. CHO-htpB cells, grown on 22-by-22-mm coverslips in six-wellplates (as described above), were either incubated with green fluorescent beadsfor up to 3 h, infected with L. pneumophila for up to 3 h, or washed three timeswith fresh �MEM without doxycycline and further cultured in this medium for48 h. Cells were then fixed for 10 min in 4% paraformaldehyde in �MEM,permeabilized for 5 min in 0.1% Triton X-100 in PBS, and blocked for 30 min in2% BSA in PBS. F-actin was stained for 20 min with 5 U of Alexa Fluor546-conjugated phalloidin (Molecular Probes)/ml. Tubulin was stained withmonoclonal antibody DM1A (a gift from Tom MacRae, Dalhousie University) ata 1:500 dilution, followed by Alexa Fluor 546-conjugated goat anti-rabbit anti-body (Molecular Probes) diluted at 1:200, all in PBS. F-actin and tubulin orga-nization were assessed by using an LSM 510 confocal microscope equipped withargon 458/488-nm and helium/neon 548-nm lasers, and images were capturedand processed by using 3D for LSM and the LSM-5 image browser, respectively(Carl Zeiss Canada, Toronto, Ontario, Canada).

Bead and L. pneumophila association with lysosomes in CHO-htpB cells. Thelysosomal network of CHO-htpB cells grown on coverslips was prelabeled for 1 hat 37°C in 5% CO2 with 100 �g of Texas Red ovalbumin (TrOv; MolecularProbes)/ml in 1 ml of �MEM. Prelabeled cells were washed three times with PBSand chased for 1 h in fresh �MEM. Differently coated blue fluorescent beads orGFP-legionellae were added for 1 h to the prelabeled cells as described inprevious sections. Cells were washed six times with PBS, fixed in paraformalde-hyde-periodate-lysine–5% sucrose (55), and mounted with ProLong Gold Anti-fade (Molecular Probes) (1-h samples) or further incubated for 2 h in fresh�MEM at 37°C in 5% CO2 (3-h samples) prior to fixation, mounting, and analysisby fluorescence microscopy. Phagosome-lysosome fusion was also assessed usingLAMP-1 as a marker. Differently coated blue beads or Lp02 and Lp02dotB wereadded to CHO-htpB cells for 1 h. Cells were either washed six times with PBS

and extracellular beads labeled for 1 min with 0.5 mg of Texas Red-dextran(Molecular Probes)/ml in �MEM at room temperature or washed six times withPBS and further incubated for 2 h in fresh �MEM at 37°C in 5% CO2 beforeextracellular bead labeling. Cells were then fixed with paraformaldehyde–perio-date–lysine–5% sucrose (55), permeabilized for 10 s in methanol, and blocked 30min in 2% BSA in PBS. LAMP-1 was immunostained with monoclonal antibodyUH1 hybridoma supernatant (Developmental Studies Hybridoma Bank, IowaCity, IA) diluted 1:2 and Alexa Fluor 488-conjugated goat anti-mouse IgG(Molecular Probes) diluted 1:200. Lp02 and Lp02dotB were immunostained withrabbit anti-MOMP serum (8) diluted 1:2,000, followed by Alexa Fluor 546-conjugated goat anti-rabbit IgG (Molecular Probes) diluted 1:1,000. Coverslipsmounted on glass slides with ProLong Gold Antifade (Molecular Probes) wereanalyzed by fluorescence microscopy, and only intracellular beads (lacking a redrim of Texas Red-dextran) were scored.

Association of beads with the ER in CHO-htpB cells. Cells were incubated withdifferently coated yellow-green fluorescent beads as described in previous sec-tions. The ER was stained for 15 min at 37°C in 5% CO2 with 1 �M ER-TrackerBlue-White DPX (Molecular Probes) in �MEM, followed by three PBS washes,and a 10-min chase in �MEM. Cells were fixed and mounted, as described above,for fluorescence microscopy. In addition, CHO-htpB cells were incubated withblue fluorescent beads, fixed and permeabilized as described in the previoussection for TrOv staining, and blocked for 30 min in PBS containing 2% goatserum (PBS-G). The ER was then immunostained with a BiP-specific rabbitantibody (Affinity Bioreagents, Golden, CO) diluted 1:250 in PBS-G, followed byOregon Green 488-conjugated goat anti-rabbit IgG (Molecular Probes) diluted1:1,000 in PBS-G. Coverslips were mounted on glass slides as described aboveand analyzed by fluorescence microscopy.

Transmission electron microscopy (TEM). CHO-htpB cells or U937-derivedmacrophages in 6-well plates were incubated with differently coated blue fluo-rescent beads or infected with L. pneumophila as described above. The bead/cellratios were adjusted to 20 for CHO-htpB cells and 10 for macrophages. CHO-htpB cells were infected with L. pneumophila at a bacterium/cell ratio of �200.Macrophages were infected with Lp02 at a ratio of 20 or with Lp02dotB (whichwas internalized less efficiently) at a ratio of 200. Cells were then gently scraped,pelleted at 500 � g for 5 min at room temperature, fixed overnight at 4°C with2.5% glutaraldehyde in 0.1 M sodium cacodylate pH 7, and washed three timesin 0.1 M cacodylate at room temperature.

Pelleted phagosomes containing beads were fixed for 2 h at room temperature(without resuspending or disturbing the pellet) in cacodylate buffer containing2.5% glutaraldehyde. Phagosomes were washed three times with cacodylatebuffer, without disturbing the pellet. The pellets of fixed cells and phagosomeswere postfixed with 1% osmium tetroxide in double-distilled H2O for 1 h at 4°C.They were then en bloc stained with aqueous uranyl acetate, dehydrated inacetone, embedded in epoxy resin, ultrathin sectioned, and stained with uranylacetate and lead salts as described elsewhere (26). Sectioned specimens wereobserved in a JEOL JEM 1230 transmission electron microscope equipped witha high-resolution Hamamatsu ORCA-HR digital camera.

Invasion and intracellular growth assays. CHO-htpB cells were seeded at 2 �105cells/well into 24-well plates and grown for 48 h. When expression of eHtpBwas needed, cells were grown for 48 h in �MEM without doxycycline. Immedi-ately before the assays, cells were washed three times with PBS and replenishedwith �MEM without antibiotics (except for 10 ng of doxycycline/ml whenneeded). Lp02 or Lp02dotA grown on BCYE for 3 days were harvested in dH2O,and the bacterial suspensions were standardized to an optical density at 620 nmof 1 U (�109 legionellae/ml). Inocula of �5 � 107 bacteria (to provide abacterium/cell ratio of �200) or mixed inocula of bacteria (as described above)and 5 � 106 beads (to provide a bead/cell ratio of �25) were added in �MEM(with or without doxycycline) in triplicate. Plates were centrifuged at 1,000 � gfor 5 min at 25°C to promote bead- and (or) bacterium-cell contact and furtherincubated at 37°C in 5% CO2 for 1 h. Monolayers were washed six times withPBS, treated for 1.5 h with �MEM–5% FBS containing 100 �g of gentamicin/mland washed three times with PBS. Cells were then either (i) lysed immediately in1 ml of dH2O to determine both invasion rate and time zero counts for intra-cellular growth assays or (ii) replenished with fresh �MEM (and 10 ng ofdoxycycline/ml when needed) and incubated for an additional 24, 48, or 72 h toobtain bacterial cell counts. All CFU/ml (equal to CFU/well) counts were per-formed in dH2O-lysed cells (final volume, 1 ml), using dH2O as a diluent, andsamples were plated onto BCYE agar.

Statistics. Unless otherwise stated, statistical significance was assessed with aone-way analysis of variance (http://www.physics.csbsju.edu/stats/anova.html).For multiple comparisons, one-way analysis of variance and the Bonferroni posttest (http://graphpad.com/quickcalcs/posttest1.cfm) were used, and for pairwise



.org/D

ownloaded from

http://iai.asm.org/

comparisons of proportions the Fisher exact test was applied using Minitabsoftware (v15.1.30.0; Minitab, Inc., State College, PA).

Attempt to delete htpB in L. pneumophila Lp02. Allelic replacement of htpBwith a kanamycin resistance (Kmr) cassette was attempted using the counter-selectable plasmid pBRDX (47), which consists of the pBOC20 backbone (car-rying cat and sacB) with an added rdxA gene of Helicobacter pylori, encoding anitroreductase capable of activating metronidazole (7). Briefly, 707 bp of up-stream and 620 bp of downstream flanking DNA sequences of the htpAB operonof L. pneumophila Lp02 were amplified by PCR using the primers htpABP1

(forward) and htpABP2 (reverse) (for the upstream or F1 region) and htpABP3

(forward) and htpABP4 (reverse) (for the downstream or F2 region) (Table 1).The F1 product containing NotI and BamHI restriction sites and the F2 productcontaining BamHI and XhoI restriction sites were ligated sequentially intopBluescript KS to create pBS-htpABF1F2. Digestion of pBS-htpABF1F2 withBamHI and subsequent ligation of the Kmr cassette restricted with BamHI fromplasmid p34S-Km3 (17) between F1 and F2 resulted in the construct htpABKan,which was then subcloned from pBluescript into the NotI and XhoI sites ofpBRDX and electroporated (4, 82) into L. pneumophila Lp02. Transformantswere selected on BCYE agar with 40 �g of kanamycin/ml, and potential allelicrecombinants were counterselected for the absence of rdxA, sacB, and cat byreplica plating Kmr transformants onto BCYE with 5% (wt/vol) sucrose, BCYEwith 20 �g of metronidazole/ml, or BCYE with 10 �g of chloramphenicol/ml.The presence of htpB was probed by PCR using htpB-forward and htpB-reverseprimers (Table 1) and by immunoblotting (see above).

RESULTS

CHO cells associate well with differently coated microbeads.Even though our previous work with HtpB-coated beads wasdone in HeLa cells (25), here we used CHO cells for theirexperimental advantages: (i) they support the intracellulargrowth of L. pneumophila (42, 43), (ii) genetic tools for theectopic expression of recombinant proteins are available, (iii)CHO cells show a spread distribution of nonfilamentous mi-tochondria, and (iv) CHO cells show a better association thanHeLa cells with microbeads. At a bead/cell ratio of 20, wepreviously determined that HeLa cells associated, in average,with 1 BSA-coated bead/cell (25), whereas CHO-wt cells (atthe same bead/cell ratio) associated with two BSA-coatedbeads/cell (Table 2). All beads tested associated similarly withCHO-wt and CHO-htpB cells not expressing eHtpB, and dif-ferences in the number of beads per cell (which fluctuatedbetween two and five) were not statistically significant for anytype of bead (Table 2).

Phagosomes containing L. pneumophila and HtpB-coatedbeads attract mitochondria. In agreement with the originalobservation of Horwitz that nascent phagosomes containing L.pneumophila rapidly become surrounded by small vesicles andmitochondria (33), �80% of phagosomes containing L. pneu-mophila strain Lp02 were observed by TEM to be surroundedby mitochondria and/or small vesicles in infected CHO-htpBcells not expressing eHtpB (Fig. 1A) and in U937-derivedmacrophages (Fig. 1E). In contrast, Lp02dotB phagosomes didnot recruit mitochondria or vesicles (data not shown). At 1 hafter the addition of beads to CHO-htpB cells, �70% ofphagosomes containing HtpB-coated beads were surroundedwith mitochondria (Fig. 1B) and/or vesicles (not shown), asLp02 did, whereas �80% of phagosomes containing the vari-ous control beads were not (Fig. 1C and D). These observa-tions were replicated in U937-derived macrophages (Fig. 1F toH). The interaction of phagosomes containing Lp02 or HtpB-coated beads and mitochondria persisted at later times, asshown in TEM specimens fixed 3, 6, and 24 h after inoculation(Fig. 1I to K).

HtpB-coated beads are significantly more capable thanother beads to associate with mitochondria in CHO cells.Using quantitative fluorescence microscopy, we determinedthat 1 and 3 h after the addition of beads to CHO-wt cells,significantly more HtpB- and rHtpB-coated beads (P 0.01)were closely surrounded by mitochondria in relation to theother beads tested (Fig. 2A). Pretreatment of HtpB-coatedbeads with an rHtpB-specific antibody caused the levels ofmitochondrial association to drop from 70 to 75% to 40 to45%, suggesting specificity (Fig. 2A). Given the possible con-tamination of purified HtpB with L. pneumophila components,it is important to particularly compare the effects mediated byHtpB-coated beads to those mediated by beads coated withrHtpB and in-house GroEL. The latter two protein prepara-tions were obtained (via the same purification method) froman E. coli whole-cell lysate and likely carried similar E. colicontaminants, but, most importantly, rHtpB-coated beads car-ried no L. pneumophila components other than HtpB.

We confirmed the results obtained with CHO-wt cells inCHO-htpB cells not expressing eHtpB (Fig. 2B) and derivedfurther data from the use of additional controls. The commer-cially available GroEL was not significantly more capable ofmediating association with mitochondria than our in-houseGroEL. The level of mitochondrial association of Lp02dotB(used as negative control) was no different from that of thecontrol beads and, similarly, the mitochondrial association lev-els of HtpB-coated beads and L. pneumophila Lp02 (used aspositive control) were not significantly different. Finally, pre-treatment of HtpB-coated beads with antibodies significantlyreduced their mitochondrial association levels in CHO-htpBcells, but antibody pretreatment of GroEL-coated beads hadno significant effect. We concluded that inert beads coated withHtpB or rHtpB were as competent as virulent, live Lp02 atattracting mitochondria.

Two representative fluorescence microscopy images ofCHO-htpB cells stained with MitoTracker are shown in Fig. 2Cand D as examples of how fluorescent blue coated beads werescored as associated, or not, with mitochondria. It should benoted that the number of mitochondria associated with L.pneumophila or the differently coated beads was not deter-

TABLE 2. Fluorescence microscopy quantification, by direct counts,of the number of differently coated beads associated with

CHO-wt and CHO-htpB cells not expressing eHtpB

Type of beadcoating

Mean no. of beads per cell � SDa

CHO-wt cells CHO-htpB cellsb

1 h 3 h 1 h 3 h

BSA 1.6 � 0.6 2 � 0.9 2 � 0.4 (NS) 2.1 � 0.4 (NS)HtpB 2.7 � 0.1 2.8 � 1.9 2 � 0.2 3 � 0.8rHtpB 2.2 � 0.4 2 � 0.6 ND 3.1 � 1.0 (NS)GroEL ND ND 3.1 � 0.2 (NS) 5 � 0.8 (NS)In-house GroEL 2.7 � 0.7 2.4 � 0.6 ND 4.3 � 0.2 (NS)None 5.9 � 1.3 5 � 3.8 3.1 � 0.6 (NS) 5 � 1.7 (NS)HtpB PAbc 1.5 (n � 1) 1.7 � 0.3 ND 2.6 � 1.2 (NS)

a The results are the means of two experiments for CHO-wt cells and threeexperiments for CHO-htpB cells, with 50 to 100 scored cells/experiment.

b eHtpB was repressed in the presence of 10ng of doxycycline/ml. P values,calculated only for CHO-htpB cells (n � 3) in relation to HtpB-coated beads,indicated no significant differences (NS) at 1 and 3 h.

c Beads were treated with rHtpB-specific antiserum (PAb) before they wereadded to the cells.



.org/D

ownloaded from

http://iai.asm.org/

mined. Therefore, a bacterium or a bead closely surrounded byor in contact with mitochondria was scored as one positiveevent (Fig. 2), regardless of how many mitochondria wereinvolved. Consequently, the effect of HtpB may have beenunderestimated.

Phagosomes containing HtpB-coated beads, purified fromU937-derived macrophages, closely interact with mitochon-dria. The resolution of MitoTracker staining in U937-derivedmacrophages was low because these cells did not stretch thinly,and their mitochondria appeared filamentous. Therefore, wequantified the association of phagosomes with mitochondria byTEM in whole U937-derived macrophages and by flow cytom-etry in preparations of isolated phagosomes.

TEM provided excellent resolution in single planes (ultra-thin sections) and allowed us to accurately determine any mi-tochondrion-phagosome contacts, as well as the number ofmitochondria in contact with each phagosome (e.g., Fig. 1F).The results presented in Table 3 confirmed that phagosomes

containing HtpB-coated beads were as competent as Lp02LCVs at recruiting mitochondria and (on average) �2.3-foldmore likely to contact mitochondria than phagosomes contain-ing BSA- or GroEL-coated beads, as previously shown inCHO-htpB cells not expressing eHtpB (Fig. 2). Moreover, thetotal number of mitochondria per scored phagosomes was sig-nificantly higher for Htp-coated beads in relation to controlbeads (Table 3).

By flow cytometry, isolated LCVs containing red fluorescentLp02 cells were 4.3-fold more likely to colocalize with mito-chondria than phagosomes containing formalin-killed fluores-cent Lp02 cells, validating the usefulness of flow cytometry indetecting interactions between isolated phagosomes and mito-chondria. In our experiments with isolated phagosomes con-taining beads, we found an intrinsic variability in the net num-ber of colocalization events between experiments, but aconsistent ratio of events between bead preparations was main-tained. Therefore, we calculated the fold values in relation to

FIG. 1. TEM shows that Lp02 and HtpB-coated beads attract mitochondria. (A) CHO-htpB cells infected with L. pneumophila Lp02 for �20min prior to processing. (B to D) CHO-htpB cells incubated with HtpB (B)-, BSA (C)-, or GroEL (D)-coated beads for 1 h. CHO-htp cells didnot express eHtpB. (E to H) In U937-derived macrophages (fixed 1 h after infection or addition of beads), Lp02 (E) and HtpB-coated beads(F) attracted mitochondria and portions of smooth ER, whereas BSA (G)- or GroEL (H)-coated beads showed no effect. For panels A to H, blackarrows indicate sectioned bacteria or beads, black arrowheads indicate mitochondria, small white arrows indicate rough ER, and white arrowheadsindicate smooth ER. Bars, 0.5 �m. Between 30 and 50 phagosomes were scored per cell type. Lp02 (I) and HtpB-coated beads (J and K) inCHO-htpB cells not expressing eHtpB were fixed at 6 h (J) and 24 h (I and K) postinoculation. At these later times, some phagosomes containingHtpB-coated beads were surrounded by a cloud of mitochondria (J and K). “B”, examples of bacterial cells in LCVs; “L”, latex beads. White arrowsindicate examples of mitochondria.



.org/D

ownloaded from

http://iai.asm.org/

preparations of BSA-coated beads, which showed both thelowest variability between and within experiments and the low-est colocalization numbers per 10,000 events in all experiments(110 � 129, n � 4). Representative flow cytometry experimentsare shown in Fig. 3A and B. Isolated phagosomes containingHtpB-coated beads were (2 � 0.5)-fold (n � 4) more likely tocolocalize with mitochondria than phagosomes containingBSA-coated beads. This was consistent with the �2-fold per-cent ratio and the �2.3-fold percent ratio observed in CHOcells by fluorescence microscopy and in U937 macrophages byTEM between HtpB- or rHtpB-coated beads and the controlbeads with mitochondria (shown in Fig. 2 and Table 3, respec-tively). The colocalization of mitochondria with purified

phagosomes containing GroEL-coated beads was (1.3 � 0.3)-fold higher (n � 4) than the basal level of BSA-coated beads,and the fold increase observed for phagosomes with rHtpB-coated beads was 3.0 � 2.1 (n � 4). To confirm whether thecolocalization of red and green fluorescence represented a trueinteraction of phagosomes and mitochondria, or simple parti-cle proximity, we used TEM.

Approximately 50 to 60% of the beads in TEM sections didnot have a surrounding membrane, perhaps explaining the lownumber of colocalization events quantified by flow cytometry.All beads within phagosomes were tightly surrounded by amembrane, as previously reported (25). About 60% of HtpB-coated beads in phagosomes showed sectioned mitochondria

FIG. 2. Quantitative fluorescence microscopy analysis of mitochondria recruitment by L. pneumophila Lp02 and HtpB-coated beads. (A) Bargraph showing the percentages (means 1 SD, n � 3 experiments, 100 scored cells/experiment) of differently coated beads associated withmitochondria at 1 and 3 h postinoculation in CHO-wt cells. P values were calculated in relation to HtpB-coated beads. **, (P 0.01); ns, nosignificance. (B) Bar graph as in panel A, but with CHO-htpB cells not expressing eHtpB. P values were calculated in relation to HtpB-coatedbeads. **, P 0.01; *, P 0.05; ns, no significance. (C and D) Representative composite images of CHO-htpB cells incubated with blue fluorescentHtpB (C)- or GroEL (D)-coated beads for 1 h and stained with red MitoTracker. Mitochondria within one bead radius around each bead wereconsidered as one positive event. Arrows point to positive beads, and arrowheads point to beads not associated with mitochondria. As a sizereference, the diameter of the beads is 1 �m.



.org/D

ownloaded from

http://iai.asm.org/

in the immediate vicinity (Fig. 3C). Occasionally, we had theopportunity to see perpendicular sections of the phagosome-mitochondrion interface (Fig. 3D and E), showing an intimateinteraction that caused the mitochondrial membrane to de-form. Although mitochondria were also seen in the vicinity of�25% of in-house GroEL-coated beads (free or in phago-somes), intimate contact was not observed. These results indi-cated that only phagosomes containing HtpB-coated beadsclosely interacted with mitochondria and suggested that mostpositive events observed by flow cytometry with GroEL-coatedbeads likely represented particle proximity rather than closecontact interactions.

HtpB-coated beads alter the organization of the actin cy-toskeleton in CHO cells. Because cytoskeleton integrity is cru-cial in organelle trafficking (6, 57, 77) and L. pneumophilainduces cytoskeletal rearrangements in infected cells (16, 44,78), we examined whether HtpB-coated beads had an effect onthe cytoskeleton of CHO cells.

Approximately 80% of untreated (no beads) CHO-wt cellsshowed fine stress fibers (such as those shown in Fig. 4A forCHO-htpB cells). However, cells associated with HtpB-coatedbeads (82%) or rHtpB-coated beads (70%) showed what wecalled the “altered actin” phenotype (Table 4), which consistedof no obvious stress fibers and a strong staining of peripheralF-actin bundles. Similar results were obtained with CHO-htpBcells, although the basal level of altered actin was higher thanin CHO-wt cells. F-actin rearrangement was not bead/cell ratiodependent, e.g., more BSA-coated beads per cell did not in-duce the effect, and some cells with only one HtpB-coatedbead attached still showed the altered actin phenotype (datanot shown).

Immunostaining with a tubulin-specific antibody showed nochanges in the microtubule network of CHO-htpB cells in-fected with Lp02 or incubated with HtpB-coated beads in re-lation to untreated cells. All cells showed an intact network ofmicrotubules radiating from a central region (data not shown).We thus concluded that HtpB presented on the surface ofmicrobeads specifically and strongly mediates a rearrangementof F-actin, which is not induced by GroEL-coated beads anddoes not involve the microtubule network.

Ectopic expression of eHtpB in the cytoplasm of CHO-htpBcells has an effect on the actin cytoskeleton similar to that ofexternally added HtpB-coated beads. To directly compare theeffects of HtpB added from without (in the form of beads) tothe effects of ectopic HtpB (eHtpB produced from within) inthe same cells, we conducted a more thorough assay withCHO-htpB cells not expressing eHtpB that included additionalbead controls and live L. pneumophila (Fig. 4). Infection ofCHO-htpB cells with Lp02 induced the same altered actinphenotype produced by HtpB-coated beads (Fig. 4A to C),albeit to a lesser extent (Fig. 4F). However, infection withLp02dotB, or incubation with GroEL-coated beads induced nochange (Fig. 4D and E). The quantification of cells with alteredactin microfilaments at 1 and 3 h (Fig. 4F) indicated that (i)HtpB-coated beads were more able than Lp02 cells to inducethe altered actin phenotype; (ii) pretreatment of HtpB-coatedbeads with antibody eliminated the effect, whereas the anti-body did not have an effect on GroEL-coated beads; and (iii)the induced effect was clearly transient for both live Lp02 andHtpB-coated beads. The basal level of untreated cells showingthe altered actin phenotype fluctuated between 28% � 5% and36% � 5%.

Expression of eHtpB in the cytoplasm of CHO-htpB cellswas effectively controlled by doxycycline (Fig. 5A and B) butshown to be variable between cells, particularly at low doxycy-cline concentrations, e.g., 0.01 ng/ml (Fig. 5C). We thus chosenot to regulate intermediate eHtpB levels and decided to un-ambiguously induce HtpB expression in 0 ng of doxycycline/mland repress it with 10 ng of doxycycline/ml in an on/off fashion.We also included recombinant GroEL and DsRed2 as controlproteins expressed in transiently transfected cells. InducedCHO-htpB cells and transiently transfected cells expressingeHtpB showed a significant alteration of the actin cytoskeletonthat was not present in cells expressing the control recombi-nant proteins (Fig. 5D and E). The similarity of this effect tothat produced by HtpB-coated beads was striking but alsopuzzling in terms of understanding how a protein presentedfrom both sides of the plasma membrane had the same effect.Of importance is that cells expressing eHtpB did not showalterations in shape, size, ultrastructure, growth rate, microtu-

TABLE 3. TEM quantification, by direct counts, of the number of mitochondria found in contact with phagosomes containingL. pneumophila or differently coated beads, in U937-derived macrophages at 3 h postinoculation

Phagosome content

Events scoreda

No. of cellsobserved

No. ofphagosomes (/–)

Total no. ofphagosomes P value 1 Total MT/total no.

of phagosomes P value 2

Bacteriab

Lp02 528 16/28 44 0.828 23/44 0.675

Beads coated with:HtpB 678 16/32 48 NA 28/48 NAGroEL 564 8/36 44 0.153 10/44 0.001BSA 1,008 4/30 34 0.036 6/34 0.001

a Only 3.4 to 8.3% of the cell sections observed showed phagosomes. The “” phagosomes refer to those in contact with mitochondria; “�” phagosomes were notin contact with mitochondria. Association with vesicles or ER was not scored. “Total MT” refers to the total number of mitochondria observed in contact withphagosomes, and the “total number of phagosomes” refers to all of the phagosomes scored. P value 1 was calculated for differences in ratios of “” phagosomes tototal phagosomes in relation to HtpB-coated beads, using the Fisher exact test. P value 2 was calculated for differences in ratios of the total MT to the total phagosomesin relation to HtpB-coated beads, using the Fisher exact test. NA, not applicable.

b We did not find enough phagosomes containing Lp02dotB to provide a meaningful quantification. Only two phagosomes were observed, with no associatedmitochondria.



.org/D

ownloaded from

http://iai.asm.org/

bule organization, and overall distribution of the mitochondriaand ER (not shown).

HtpB-coated beads do not recruit ER or alter the lysosomalnetwork. Using quantitative fluorescence microscopy, wefound that differently coated beads did not conclusively asso-ciate with the ER network of CHO-htpB cells, either throughimmunostaining of BiP or through direct staining with ER-Tracker Blue-White DPX. Likewise, ribosome studding and

rough ER association with phagosomes containing HtpB-coated beads was not consistently observed by TEM at 1 h(e.g., Fig. 1B and F) or 6- and 24-h incubations (e.g., Fig. 1Jand K), indicating that HtpB does not mediate interactionswith the ER.

Maturation of LCVs or bead-containing phagosomes alongthe endocytic pathway was first evaluated by scoring the colo-calization with LAMP-1, a protein of late endosomes and ly-

FIG. 3. Quantitative analysis by flow cytometry and corresponding TEM analysis of mitochondrial recruitment by LCVs or phagosomescontaining HtpB-coated beads in U937 macrophages. (A and B) Representative flow cytometry plots (in arbitrary fluorescence intensity units)showing colocalization of isolated LCVs containing red fluorescent Lp02 (A) or isolated phagosomes containing BSA-, GroEL-, and HtpB-coatedred fluorescent beads (B) with green fluorescent immunostained mitochondria. The clustering of events (in the form of bands) along the y axis ofthe plots in panel B likely represent groups of one, two, and three beads simultaneously detected. Colocalization events (the number given on eachplot) were those within the upper right rectangle of each plot in relation to a total count of 10,000 events/plot. (C) TEM image of a sectionedphagosome containing one HtpB-coated bead and surrounding mitochondrial sections. The arrowhead points to a representative mitochondrionsection. Bar, 200 nm. (D) TEM image showing that mitochondria sometimes appeared morphologically “empty” (area marked by the asterisk) asalso seen in panel E. Bar, 100 nm. (E) Detail of a close interaction between a mitochondrion and a phagosome containing one HtpB-coated bead.Notice the deformed mitochondrial membrane at the mitochondrion-phagosome interface. An arrowhead points at the mitochondrial outermembrane, a white arrow points at the phagosomal membrane, and black arrow points at the bead’s surface. Notice how tightly the phagosomalmembrane surrounds the contained bead. Size bar, 100 nm.



.org/D

ownloaded from

http://iai.asm.org/

sosomes. At 1 and 3 h after infection, Lp02 LCVs seldomcolocalized with LAMP-1, but phagosomes containing the dotBmutant more frequently acquired LAMP-1 staining (Table 5).Regardless of the type of coating, phagosomes containingbeads all showed positive LAMP-1 staining at significantlyhigher frequencies in relation to Lp02 LCVs or even the dotBmutant-containing phagosomes (P 0.05, Table 5).

We next assessed phagosome-lysosome fusion in CHO-htpB

cells using TrOv. In agreement with the findings of Joshi et al.(41), phagosomes containing Lp02 or the dotB mutant rarelycolocalized with TrOv at either 1 h or 3 h postinfection (Table6). In contrast, phagosomes containing beads (regardless of thetype of coating) all colocalized with TrOv at significantlyhigher frequencies in relation to live L. pneumophila (P 0.01,Table 6). However, among all bead types used, HtpB-coatedbeads consistently showed, at 1 h postinoculation, the lowestfrequency of colocalization with TrOv (Table 6). Collectively,these results indicate that whereas HtpB modestly delays thedelivery of TrOv to phagosomes containing beads, it cannotblock phagosome-lysosome fusion.

Cell invasion and intracellular growth of Lp02dotA is notchanged in the presence of HtpB-coated beads or eHtpB. In-tracellular growth of a dotA avirulent mutant in macrophagescan be restored when the mutant is cointernalized into thesame phagosome with wild-type L. pneumophila (15). There-fore, we set out to determine whether HtpB-coated beads oreHtpB could restore the intracellular growth of Lp02dotA orenhance the invasiveness and growth of Lp02 in CHO-htpBcells.

TEM of CHO-htpB cells infected with Lp02 in the presenceof BSA-coated or HtpB-coated beads showed that bacteria andbeads did not colocalize in the same phagosome (Fig. 6A and

FIG. 4. Confocal microscopy analysis of the F-actin rearrangements induced by L. pneumophila Lp02 and HtpB-coated beads in CHO-htpBcells not expressing eHtpB. (A to E) Representative single-slice overlay images of untreated CHO-htpB control cells (A), cells infected for 1 h withGFP-expressing Lp02 (B) or GFP-expressing Lp02dotB (D), or cells incubated with green fluorescent HtpB (C)- or GroEL (E)-coated beads for1 h. F-actin was labeled with phalloidin-Alexa Fluor 546 (red). Size bars, 10 �m. The arrow in panel A points at cytoplasmic stress fibers, and thearrow in panel B points at peripheral F-actin bundles. The altered actin phenotype was characterized by the loss of stress fibers and theaccentuation of peripheral F-actin bundles (clearly seen in panels B and C). (F) Bar graph showing percentages (means 1 SD, n � 3 independentexperiments) of CHO-htpB cells associated with bacteria or beads that show the altered actin phenotype at 1 and 3 h after infection or beadaddition. P values were calculated in relation to HtpB-coated beads. **, P 0.01; and *, P 0.05.

TABLE 4. Fluorescence microscopy quantification, by direct counts,of CHO cells that showed an altered actin microfilaments network

after a 2-h exposure to differently coated beads

Bead coating

Mean % cells with an altered actinphenotype � SDa

CHO-wt cellsb CHO-htpBc

None 23.4 � 4.7 34.5 � 8.3HtpB 81.8 � 0.4 62.4 � 14.4rHtpB 69.5 � 12.5 72.7 � 4.2In-house GroEL 21.0 � 4.4 32.7 � 15.1

a The results are the means of two experiments, with 100 scored cells/experi-ment.

b The percentage of CHO-wt cells with no beads and altered actin was 23.2 �4.9 (n � 8).

c CHO-htpB cells in these experiments did not express eHtpB. The percentageof CHO-htpB cells with no beads and altered actin was 36.4 � 16.7 (n � 8).



.org/D

ownloaded from

http://iai.asm.org/

B). However, �50% of the internalized dotA mutants colocal-ized with BSA-coated or HtpB-coated beads (Fig. 6C and D).We concluded that Lp02 and Lp02dotA, despite having similarinvasion rates in CHO-htpB cells not expressing eHtpB(0.28% � 0.04% and 0.30% � 0.07%, respectively, expressedas means � the standard deviation [SD; n � 6] of the percentintracellular bacteria/bacterial inoculum, after a 3-h incuba-tion), they clearly followed different pathways of internaliza-tion. The invasion rates of Lp02 and Lp02dotA did not changein the presence of beads, regardless of their coating. Phago-somes containing Lp02dotA alone did not show associatedmitochondria and, even though HtpB-coated beads attracted

mitochondria to the phagosomes shared with Lp02dotA (e.g.,Fig. 6D), they did not rescue the intracellular growth of themutant (Fig. 7A). However, when we examined the effect ofthe differently coated beads on the intracellular growth ofLp02, there was a slight but consistent improvement of earlygrowth in the presence of HtpB-coated beads (Fig. 7B).

In invasion assays with Lp02 and Lp02dotA in CHO-htpBcells expressing eHtpB, no differences were detected in rela-tion to invasion of cells not producing eHtpB (Fig. 7C). Inaddition, the intracellular growth of Lp02 in CHO-htpB cellswas very similar in the presence or absence of eHtpB, and theproduction of eHtpB did not restore the intracellular growth of

FIG. 5. Expression of eHtpB in CHO-htpB cells and its effect on the actin cytoskeleton. (A) Reference image (Ponceau-S stained) for theimmunostained nitrocellulose membrane shown in panel B. Loading equivalence, �6 � 105 CHO-htpB cells/lane. (B) Immunoblot analysis ofeHtpB in cells incubated for 48 h in various concentrations of doxycycline. The fold increase shown is relative to the eHtpB produced in 1 ng ofdoxycycline/ml. An arrowhead points at full-size eHtpB (�60 kDa) within the box. Strongly immunostained bands under the box likely representeHtpB degradation products. Lane Std, protein standards (the masses are indicated at the far left in kilodaltons). (C) Representative images, indifferential interference contrast (DIC) or epifluorescence (Anti-rHtpB PAb) modes, showing eHtpB expression at different doxycycline (Dox)concentrations. The bar in the top right micrograph indicates 10 �m and applies to all of the micrographs. (D) Representative fluorescenceconfocal microscopy grayscale images showing the effect of various recombinant proteins (R-protein) upon the actin cytoskeleton of CHO-AA8Tet-Off cells (F-actin). CHO-htpB cells were observed after 48 h in doxycycline-free medium, and transiently transfected AA8 cells were observed48 h after transfection. The bar in the top right micrograph indicates 10 �m and applies to all of the micrographs. (E) Bar graph showingpercentages (means � 1 SD from three independent experiments) of cells with altered F-actin after ectopic expression of proteins in transientlytransfected CHO-AA8 cells (left) and stably transfected CHO-htpB cells (right). Background levels of altered actin were provided by nontrans-fected cells (AA8) and noninduced CHO-htpB cells, respectively. P values in the transient group were calculated in relation to cells expressingHtpB. **, P 0.01.



.org/D

ownloaded from

http://iai.asm.org/

Lp02dotA (Fig. 7D). Collectively, these results indicated thatwhile HtpB-coated beads might promote the growth of virulentL. pneumophila in trans, they cannot compensate for all of thesignals and type IV secreted factors missing from the dotAmutant, which would be necessary for LCV maturation andinitiation of intracellular growth.

Failure to delete htpB from L. pneumophila Lp02. To directlyinvestigate the role of HtpB in Legionella pathogenesis, weattempted to delete htpB by allelic replacement and character-ize the mutant’s ability to alter mitochondrial trafficking andmicrofilament organization. Hundreds of Kmr Lp02 transfor-mants grew on BCYE with kanamycin and, upon replica plat-ing, we were able to counterselect potential allelic recombi-nants that were kanamycin, metronidazole, and sucroseresistant but chloramphenicol sensitive. However, the presenceof htpB was confirmed by PCR, and HtpB was detected byimmunoblotting, in all of the potential �htpB clones. We havebeen unable to fully explain these results, which suggest thatgenetic rearrangements occurred to avoid deletion of an es-

sential gene, wherein the Kmr transformants were forced togrow in a highly selective medium.

DISCUSSION

Shortly after internalization of virulent L. pneumophila byhost cells, LCVs associate with mitochondria, which then re-main associated with the LCVs for different lengths of time, asshown by ultrastructural studies of infected monocytes (33),MRC-5 cells (60), and HeLa cells (26). Phagosomes containingHtpB-coated beads consistently recruited mitochondria inCHO cells and U937-derived macrophages, and mitochondriaremained associated with phagosomes in CHO cells for up to24 h, thereby demonstrating that, when presented on the sur-face of inert beads, HtpB is sufficient to emulate this L. pneu-mophila trait.

The conclusions derived from the application of our twofunctional models are restricted to the impact of purified orrecombinant HtpB on cultured cells, out of the context of anatural L. pneumophila infection. Therefore, it remains to bedetermined whether HtpB has a virulence-related role of im-portance to L. pneumophila pathogenesis. One way to provideevidence for such a role would be to delete htpB from the L.pneumophila genome. However, we could not delete htpB byallelic replacement with pBRDX, a methodology that we andothers have successfully used to delete at least six L. pneumo-phila genes (47, 56; unpublished results), suggesting that it isthe essential nature of htpB and not the method used thatimpeded the deletion. The essential nature of htpB has alsobeen suggested by others (20). These investigators could notdelete the stress regulator gene rpoH from the genome of L.pneumophila or replace the rpoH promoter by a controllableIPTG-inducible promoter, and although they observed a re-duced amount of htpB transcripts in clones carrying antisense

TABLE 5. Fluorescence microscopy quantification, by direct counts,of colocalization events between differently coated beads or bacteria

and LAMP-1-positive compartments (late endosomes andlysosomes) in CHO-htpB cells not expressing eHtpB

Type of particlea

Mean % particles colocalized withLAMP-1 � SD (P) atb:

1 hpostinoculation

3 hpostinoculation

BSA-coated beads 71 � 2 (n.s) 77 � 7 (NS)HtpB-coated beads 67 � 4 75 � 10GroEL-coated beads 68 � 9 (NS) 76 � 4 (NS)Uncoated beads 71 � 8 (NS) 74 � 5 (NS)HtpB-coated beads PAb* 74 � 9 (NS) 76 � 10 (NS)GroEL-coated beads PAb* 71 � 7 (NS) 76 � 12 (NS)L. pneumophila Lp02 8 � 0 (0.01) 13 � 3 (0.01)Lp02dotB mutant 25 � 2 (0.05) 39 � 4 (0.05)

a �, Beads were preincubated with rHtpB-specific rabbit polyclonal antiserum(PAb), before inoculation of the CHO-htpB cells. PAb cross-reacts with GroEL.

b Results are the means of three experiments, with 50 beads or bacterial cellsscored per experiment. P values, calculated as multiple comparisons, are shownin parentheses in relation to HtpB-coated beads. NS, not significant.

TABLE 6. Fluorescence microscopy quantification, by direct counts,of colocalization events between differently coated beads or

bacteria and TrOv-labeled lysosomes in CHO-htpB cellsnot expressing eHtpB

Type of particlea

Mean % particles colocalized with TrOv� SD (P) atb:

1 h postinoculation 3 h postinoculation

BSA-coated beads 33 � 3 (0.05) 40 � 4 (0.05)HtpB-coated beads 23 � 2 32 � 3GroEL-coated beads 29 � 1 (0.05) 34 � 2 (NS)Uncoated beads 32 � 1 (0.05) 37 � 1 (NS)HtpB-coated beads PAb* 31 � 4 (0.05) 38 � 2 (NS)GroEL-coated beads PAb* 41 � 1 (0.05) 34 � 3 (NS)L. pneumophila Lp02 1 � 0 (0.01) 1 � 0 (0.01)Lp02dotB mutant 1 � 0 (0.01) 1 � 0 (0.01)

a �, Beads were preincubated with rHtpB-specific rabbit polyclonal antiserum(PAb) before inoculation of the CHO-htpB cells. PAb cross-reacts with GroEL.

b The results are the means of three experiments, with 100 scored beads orbacteria/experiment. P values, calculated as multiple comparisons, are given inparentheses in relation to HtpB-coated beads. NS, not significant.

FIG. 6. Electron micrographs of L. pneumophila internalized byCHO-htpB cells not expressing eHtpB in the presence of coated beads.CHO-htpB cells were infected for 1 h with Lp02 plus BSA-coatedbeads (A), Lp02 plus HtpB-coated beads (B), Lp02dotA plus BSA-coated beads (C), or Lp02dotA plus HtpB-coated beads (D). Colocal-ization of bacteria (arrows) and coated beads (arrowheads) in the samephagosomes is presented in panels C and D. Bars, 0.5 �m. At least 50cell sections (�100 phagosomes) were scored per experiment.



.org/D

ownloaded from

http://iai.asm.org/

sequences for rpoH or htpB the levels of HtpB were not re-duced (20). Although temperature-sensitive htpB mutantscould in principle be created, they would likely show secondarydefects arising from defective folding of many proteins, andphenotypic changes in these mutants could be equivocally as-signed to the defective HtpB. We have hypothesized that a wayto overcome the barrier imposed by htpB’s essentiality andavoid the ambiguity of temperature-sensitive mutants would beto create an htpAB deletion mutant after inserting the groELSoperon from E. coli in the L. pneumophila chromosome.GroELS could thus provide the presumed essential chaperoninfunctions, while GroEL (being unable to attract mitochondriawhen presented on microbeads) would likely have no contri-bution to the recruitment of mitochondria in the htpB deletionmutant. Finally, an alternate approach would be to determinewhether HtpB mediates mitochondrial recruitment when ex-pressed in a surrogate intracellular bacterial pathogen thatdoes not naturally recruit mitochondria. For the latter, how-ever, it would be necessary to demonstrate that HtpB can besecreted and properly localized to the cell surface of the sur-rogate pathogen.

In spite of the high similarity that exists between bacterialchaperonins, the fact that HtpB’s ability to recruit mitochon-dria and alter stress fibers was not shared with GroEL suggeststhat specific HtpB domains are responsible for these effects.

That few amino acid changes could result in new chaperoninfunctions is a baffling but not unprecedented issue, since Yo-shida et al. (87) unequivocally established that only 4 aminoacid changes transformed the GroEL from E. coli into a potentinsect toxin. Future work could thus be focused on the use oftruncated or amino acid-substituted forms of HtpB in ourfunctional models, as an experimental tool to identify suchspecific domains.

Recruitment of host mitochondria to the LCV in humanmonocytes depends on a functional Dot/Icm system, as retro-spectively inferred from experiments with a spontaneous L.pneumophila mutant unable to recruit mitochondria (36), latershown to regain a wild-type phenotype by genetic complemen-tation with the dot/icm locus (53). By reporting that dotA anddotB mutants were unable to attract mitochondria in CHOcells, we have provided further evidence for the need of afunctional Dot/Icm system in mitochondrial recruitment.These results imply that a potential link exists between HtpBand the Dot/Icm system, a link also suggested by the observa-tion that dot/icm mutants accumulate HtpB in the periplasm(1). Either HtpB is secreted by the Dot/Icm system, or Dot/Icmeffectors are also required (besides HtpB) for optimal mito-chondrial recruitment (functional redundancy).

Recruitment of mitochondria to the LCV is a feature sharedwith the parasitophorous vacuoles of Chlamydia psittaci (54, 62),

FIG. 7. Invasiveness and intracellular growth of L. pneumophila in CHO-htpB cells in the presence of coated beads or eHtpB. (A and B) Graphsshowing the growth or survival curves of L. pneumophila, presented as mean CFU/ml � 1 SD from two independent experiments run in triplicatewith either Lp02dotA (A) or Lp02 (B) in the presence of differently coated beads. P values were calculated in relation to growth in the presenceof HtpB-coated beads. *, P 0.05. (C) Bar graph showing percentages (means � 1 SD from two independent experiments run in triplicate) ofbacterial invasion for Lp02 or Lp02dotA in CHO-htpB cells expressing (eHtpB) or not (–eHtpB) endogenous HtpB. Invasion was calculated asthe percent bacteria that survived a gentamicin treatment in relation to the bacterial inoculum. (D) Graph showing the growth and survival curvesof Lp02 and Lp02dotA, respectively, presented as the mean CFU/ml � 1 SD (n � 3 experiments) in CHO-htpB cells expressing (eHtpB) or notexpressing endogenous HtpB.



.org/D

ownloaded from

http://iai.asm.org/

Toxoplasma gondii (74), and Encephalitozoon microsporidia (71).As far as we know, the molecular mechanism of recruitment hasbeen described only in the case of T. gondii, where the N terminusof ROP2, a T. gondii protein localized to the parasitophorousvacuole membrane, has characteristics of a mitochondrial target-ing signal sequence and is exposed to the host cytosol (73). ROP2inserts into the mitochondrial membrane tethering the organelleto the vacuole. HtpB is abundantly released into the lumen of theLCV in infected HeLa cells (24, 32) and possesses the conservedglycine- and methionine-rich C terminus responsible for themembrane-targeted lipochaperonin activity previously reportedfor GroEL (81). However, even if HtpB could associate with theLCV membrane, the lack of both a predicted mitochondrial tar-geting signal and an overall homology to ROP2 suggest that HtpBrecruits mitochondria by a novel, yet-to-be-described mechanism.

The actin rearrangement mediated by HtpB was not relatedto the actin polymerization changes required for internaliza-tion. That is, CHO cells similarly internalized all beads, butonly HtpB-coated beads induced the disappearance of stressfibers. In addition, Lp02dotA invaded CHO cells but did notalter stress fibers. Based on our results with CHO-htpB cells,which indicated that HtpB induces the disappearance of stressfibers when it is presented from either side of the plasmamembrane, we propose that this postinvasion rearrangementof F-actin is the result of an HtpB-mediated signaling event.HtpB may get inserted into the plasma and/or LCV mem-brane, emulating a lipochaperonin activity (81), from where itcould directly or indirectly initiate a signaling process. Alter-natively, HtpB could interact with plasma membrane surfacesignaling molecules (e.g., Ras) that also signal from endomem-branes while in transit to the plasma cell membrane (10, 11).Evidence to support an HtpB-mediated signaling mechanismincludes the following: (i) the striking morphological resem-blance between our altered actin phenotype and that inducedin porcine aortic endothelial cells by the constitutive activationof the signaling molecule Rnd1 (2); (ii) bacterial chaperonins,in general, modulate cell signaling pathways (reviewed in ref-erence 51) and, in particular, can activate extracellular signal-regulated kinase 1/2-mitogen-activated protein kinase path-ways when added to the cell culture medium (88, 89); (iii)HtpB modulates cytokine mRNA levels and interleukin-1 se-cretion in macrophages via a protein kinase C-dependent sig-naling pathway (64); and (iv) HtpB has the ability to deliver anintracellular signal in Saccharomyces cerevisiae that activatestwo signaling pathways controlled by Ras2p and results inpseudohyphal growth (66). Moreover, the fact that Lp02 andHtpB-coated beads did not colocalize in the same phagosome(Fig. 6) suggests that the beneficial effect of HtpB-coatedbeads on the early growth of Lp02 (Fig. 7B) was indirect,perhaps mediated through a signaling mechanism.

Mitochondrial movement primarily occurs along microtu-bule tracks in eukaryotic cells (57, 77), and disruption of actinmicrofilaments results in increased mitochondrial movementalong microtubule tracks in sea urchin coelomocytes (46). Inaddition, the transient clustering of mitochondria around thenucleus of PtK2 cells infected with vaccinia virus happens to bea response to virus-mediated changes in F-actin organization,which in turn depends on intact microtubules (72). Because themicrotubule network remained unaffected during both L.pneumophila infection and exposure to HtpB-coated beads, we

propose that the transient HtpB-mediated perturbation of theactin cytoskeleton (as a putative signaling response) might, infact, constitute the mechanism of mitochondrial recruitment tothe LCV. Disruption of stress fibers and recruitment of mito-chondria were two robust effects induced by the same proteinattached onto beads. This causal convergence, in addition tothe common dependence of these effects on type IV secretionduring infection with live L. pneumophila, provides furthersupport to the argument that the transient L. pneumophila-induced changes in F-actin organization could result in mito-chondrial recruitment to the LCV.

Possible explanations for the failure of eHtpB in alteringmitochondrial trafficking might include the lack of a directionalsignal and the sustained alteration of the actin cytoskeleton. Ininduced CHO-htpB cells, eHtpB was found throughout thecytoplasm, and even in the nucleus (Fig. 5). If the signalinghypothesis is correct, a cell expressing eHtpB would potentiallyreceive multiple signals from everywhere, whereas internalizedLp02 or HtpB-coated beads would deliver localized, direc-tional signals. Moreover, the altered actin phenotype of in-duced CHO-htpB cells persisted for days, as opposed to thatresulting from the interaction with Lp02 or HtpB-coatedbeads, which only lasted hours. Although the transient natureof the latter effect could be explained by the breakdown ofbead-bound HtpB within phagosomes, we determined by dotimmunoblotting that beads recovered from U937-derived mac-rophages 3 h after addition still tested positive for the presenceof chaperonins (data not shown). Therefore, the delivery of alocalized signal with transient effects might be crucial to redi-recting the trafficking of mitochondria to the LCV, after whicha tight interaction between the vacuolar and mitochondrialmembranes (as suggested by Fig. 3E) may assure a persistentassociation throughout the intracellular growth cycle of L.pneumophila. The molecular basis for this tight interaction iscurrently unknown, but its strength was further suggested bythe fact that it persisted throughout the phagosome isolationprocedure. Alternative explanations to the signaling hypothesisare that (i) HtpB might physically recruit (bind) host factorsresponsible for the observed effects, as reported for other L.pneumophila factors that recruit host effectors to the LCV andregulate its trafficking (18, 43), and (ii) HtpB may directlyinteract with F-actin. An example of an effector that binds toactin and induces F-actin rearrangements is SipA, a Salmonellafactor involved in bacterial internalization (90).

The colocalization of HtpB-coated beads and bacteria in thesame phagosome or the presence of eHtpB in the host cellcytoplasm of CHO-htpB cells did not rescue the intracellulargrowth of Lp02dotA. This is not surprising because HtpB alonewas unable to induce recruitment of ER to the LCV or effec-tively inhibit fusion with lysosomes. The establishment of theLCV involves multiple Dot/Icm translocated effectors with ap-parently redundant functions (reviewed in reference 59). Inthis respect, the study of L. pneumophila’s intracellular biologyis unlikely to involve, at this point, the simultaneous deletion ofall genes encoding redundant effectors (some of which may beessential). Therefore, the complexity of functional redundancyin L. pneumophila could be alternatively addressed by usingprotein functional models. Our studies constitute an exampleof how the application of two functional models to the study ofan essential L. pneumophila protein has unfolded two seem-



.org/D

ownloaded from

http://iai.asm.org/

ingly unique functions of purified and recombinant HtpB anda novel facet of chaperonin biology.

ACKNOWLEDGMENTS

We thank Michele Swanson (University of Michigan at Ann Arbor) forgenerously hosting A.C. in her lab and providing training, as well as themeans to conduct BiP-labeling and TrOv-labeling experiments. Her dis-cussions in relation to the role of HtpB in L. pneumophila pathogenesis,as well as her critical reading of an early precursor to the manuscript, arealso greatly appreciated. The generosity of Karen Brassinga (a formerDalhousie University colleague), Paul Sigler, and Hubert Hilbi, for do-nating plasmids, as well as that of Ralph Isberg and Joe Vogel, fordonating strains, is also acknowledged. We thank Paul S. Hoffman (aformer Dalhousie University colleague) for monoclonal antibodyGW2X4B8B2H6, MOMP-specific antiserum, and plasmids pBRDX andpSH16; Andrew Issekutz for U937 cells; and Radhey Gupta for CHOcells. Mary Ann Trevors and Kaitlyn Carson are gratefully acknowledgedfor their help in processing TEM specimens and statistical analyses, re-spectively. The UH1 LAMP-1-specific antibody developed by S. Uthaya-kumar and B. L. Granger was obtained from the Developmental StudiesHybridoma Bank, developed under the auspices of the NICHD andmaintained by the University of Iowa, Department of Biological Sciences,Iowa City.

This study was funded by a Discovery grant to R.A.G. from theNatural Sciences and Engineering Research Council of Canada.R.A.G. holds an NSERC Canada Research Chair in food- and water-borne bacterial pathogens.

REFERENCES

1. Allan, D. S. 2002. Secretion of Hsp60 chaperonin (GroEL) homologs byLegionella pneumophila. M.Sc. thesis. Dalhousie University, Halifax, NovaScotia, Canada.

2. Aspenstrom, P., A. Fransson, and J. Saras. 2004. Rho GTPases have diverseeffects on the organization of the actin filament system. Biochem. J. 377:327–337.

3. Berger, K. H., J. J. Merriam, and R. R. Isberg. 1994. Altered intracellulartargeting properties associated with mutations in the Legionella pneumophiladotA gene. Mol. Microbiol. 14:809–822.

4. Berk, S. G., G. Faulkner, E. Garduno, M. C. Joy, M. A. Ortiz-Jimenez, andR. A. Garduno. 2008. Packaging of live Legionella pneumophila into pelletsexpelled by Tetrahymena spp. does not require bacterial replication anddepends on a Dot/Icm-mediated survival mechanism. Appl. Environ. Micro-biol. 74:2187–2199.

5. Blander, S. J., and M. A. Horwitz. 1993. Major cytoplasmic membraneprotein of Legionella pneumophila, a genus common antigen and member ofthe hsp60 family of heat shock proteins, induces protective immunity in aguinea pig model of Legionnaires’ disease. J. Clin. Investig. 91:717–723.

6. Boldogh, I. R., and L. A. Pon. 2006. Interactions of mitochondria with theactin cytoskeleton. Biochim. Biophys. Acta 1763:450–462.

7. Brassinga, A. K. C., M. A. Croxen, C. J. Shoemaker, M. G. Morash, J. J.LeBlanc, and P. S. Hoffman. 2006. Novel use of Helicobacter pylori nitroreduc-tase (rdxA) as a counterselectable marker in allelic vector exchange to createLegionella pneumophila Philadelphia-1 mutants, p. 339–342. In N. P. Cianciotto,Y. Abukwaik, P. H. Edelstein, B. S. Fields, D. F. Geary, T. G. Harrison, C. A.Joseph, R. M. Ratcliff, J. E. Stout, and M. S. Swanson (ed.), Legionella: state ofthe art 30 years after its recognition. ASM Press, Washington, DC.

8. Butler, C. A., and P. S. Hoffman. 1990. Characterization of a major 31-kilodalton peptidoglycan-bound protein of Legionella pneumophila. J. Bac-teriol. 172:2401–2407.

9. Chakraborty, P., S. Sturgill-Koszycki, and D. G. Russell. 1994. Isolation andcharacterization of pathogen-containing phagosomes. Methods Cell Biol.45:261–276.

10. Chiu, V. K., T. Bivona, A. Hach, J. B. Sajous, J. Silletti, H. Wiener, R. L.Johnson, A. D. Cox, and M. R. Philips. 2002. Ras signalling on the endo-plasmic reticulum and the Golgi. Nat. Cell Biol. 4:343–350.

11. Choy, E., V. K. Chiu, J. Silletti, M. Feoktistov, T. Morimoto, D. Michaelson,L. E. Ivanov, and M. R. Philips. 1999. Endomembrane trafficking of ras: theCAAX motif targets proteins to the ER and Golgi. Cell 98:69–80.

12. Cirillo, J. D., S. L. Cirillo, L. Yan, L. E. Bermudez, S. Falkow, and L. S.Tompkins. 1999. Intracellular growth in Acanthamoeba castellanii affectsmonocyte entry mechanisms and enhances virulence of Legionella pneumo-phila. Infect. Immun. 67:4427–4434.

13. Cirillo, S. L., L. E. Bermudez, S. H. El-Etr, G. E. Duhamel, and J. D. Cirillo.2001. Legionella pneumophila entry gene rtxA is involved in virulence. Infect.Immun. 69:508–517.

14. Cirillo, S. L., J. Lum, and J. D. Cirillo. 2000. Identification of novel lociinvolved in entry by Legionella pneumophila. Microbiology 146:1345–1359.

15. Coers, J., C. Monahan, and C. R. Roy. 1999. Modulation of phagosomebiogenesis by Legionella pneumophila creates an organelle permissive forintracellular growth. Nat. Cell Biol. 1:451–453.

16. Coxon, P. Y., J. T. Summersgill, J. A. Ramirez, and R. D. Miller. 1998. Signaltransduction during Legionella pneumophila entry into human monocytes.Infect. Immun. 66:2905–2913.

17. Dennis, J. J., and G. J. Zylstra. 1998. Improved antibiotic-resistance cas-settes through restriction site elimination using Pfu DNA polymerase PCR.BioTechniques 25:772–776.

18. Derre, I., and R. R. Isberg. 2004. Legionella pneumophila replication vacuoleformation involves rapid recruitment of proteins of the early secretory sys-tem. Infect. Immun. 72:3048–3053.

19. Derre, I., and R. R. Isberg. 2005. LidA, a translocated substrate of theLegionella pneumophila type IV secretion system, interferes with the earlysecretory pathway. Infect. Immun. 73:4370–4380.

20. Ewann, F., and P. S. Hoffman. 2006. Modulation of rpoH expression using anantisense strategy, p. 336–338. In N. P. Cianciotto, Y. AbuKwaik, P. H.Edelstein, B. S. Fields, D. F. Geary, T. G. Harrison, C. A. Joseph, R. M.Ratcliff, J. E. Stout, and M. S. Swanson (ed.), Legionella-State of the art 30years after its recognition. ASM Press, Washington, DC.

21. Fernandez, R. C., S. M. Logan, S. H. Lee, and P. S. Hoffman. 1996. Elevatedlevels of Legionella pneumophila stress protein Hsp60 early in infection ofhuman monocytes and L929 cells correlate with virulence. Infect. Immun.64:1968–1976.

22. Frisk, A., C. A. Ison, and T. Lagergard. 1998. GroEL heat shock protein ofHaemophilus ducreyi: association with cell surface and capacity to bind toeukaryotic cells. Infect. Immun. 66:1252–1257.

23. Gabay, J. E., and M. A. Horwitz. 1985. Isolation and characterization of thecytoplasmic and outer membranes of the Legionnaires’ disease bacterium(Legionella pneumophila). J. Exp. Med. 161:409–422.

24. Garduno, R. A., G. Faulkner, M. A. Trevors, N. Vats, and P. S. Hoffman.1998. Immunolocalization of Hsp60 in Legionella pneumophila. J. Bacteriol.180:505–513.

25. Garduno, R. A., E. Garduno, and P. S. Hoffman. 1998. Surface-associatedHsp60 chaperonin of Legionella pneumophila mediates invasion in a HeLacell model. Infect. Immun. 66:4602–4610.

26. Garduno, R. A., F. D. Quinn, and P. S. Hoffman. 1998. HeLa cells as a modelto study the invasiveness and biology of Legionella pneumophila. Can. J.Microbiol. 44:430–440.

27. Gibson, F. C., III, A. O. Tzianabos, and F. G. Rodgers. 1994. Adherence ofLegionella pneumophila to U-937 cells, guinea-pig alveolar macrophages, andMRC-5 cells by a novel, complement-independent binding mechanism. Can.J. Microbiol. 40:865–872.

28. Gupta, R. S. 1995. Evolution of the chaperonin families (Hsp60, Hsp10, andTcp-1) of proteins and the origin of eukaryotic cells. Mol. Microbiol. 15:1–11.

29. Gupta, R. S., T. K. W. Ho, M. R. K. Moffat, and R. Gupta. 1982. Podophyl-lotoxin-resistant mutants of Chinese hamster ovary cells: alteration in amicrotubule-associated protein. J. Biol. Chem. 257:1071–1078.

30. Helsel, L. O., W. F. Bibb, C. A. Butler, P. S. Hoffman, and R. M. McKinney.1988. Recognition of a genus-wide antigen of Legionella by a monoclonalantibody. Curr. Microbiol. 16:201–208.

31. Hoffman, P. S., C. A. Butler, and F. D. Quinn. 1989. Cloning and tempera-ture-dependent expression in Escherichia coli of a Legionella pneumophilagene coding for a genus-common 60-kilodalton antigen. Infect. Immun.57:1731–1739.

32. Hoffman, P. S., L. Houston, and C. A. Butler. 1990. Legionella pneumophilahtpAB heat shock operon: nucleotide sequence and expression of the 60-kilodalton antigen in L. pneumophila-infected HeLa cells. Infect. Immun.58:3380–3387.

33. Horwitz, M. A. 1983. Formation of a novel phagosome by the Legionnaires’disease bacterium (Legionella pneumophila) in human monocytes. J. Exp.Med. 158:1319–1331.

34. Horwitz, M. A. 1983. The Legionnaires’ disease bacterium (Legionella pneu-mophila) inhibits phagosome-lysosome fusion in human monocytes. J. Exp.Med. 158:2108–2126.

35. Horwitz, M. A. 1984. Phagocytosis of the Legionnaires’ disease bacterium(Legionella pneumophila) occurs by a novel mechanism: engulfment within apseudopod coil. Cell 36:27–33.

36. Horwitz, M. A. 1987. Characterization of avirulent mutant Legionella pneu-mophila that survive but do not multiply within human monocytes. J. Exp.Med. 166:1310–1328.

37. Horwitz, M. A., and F. R. Maxfield. 1984. Legionella pneumophila inhibits acid-ification of its phagosome in human monocytes. J. Cell Biol. 99:1936–1943.

38. Horwitz, M. A., and S. C. Silverstein. 1980. Legionnaires’ disease bacterium(Legionella pneumophila) multiples intracellularly in human monocytes.J. Clin. Investig. 66:441–450.

39. Horwitz, M. A., and S. C. Silverstein. 1983. Intracellular multiplication ofLegionnaires’ disease bacteria (Legionella pneumophila) in human mono-cytes is reversibly inhibited by erythromycin and rifampin. J. Clin. Investig.71:15–26.

40. Ingmundson, A., A. Delprato, D. G. Lambright, and C. R. Roy. 2007. Legio-



.org/D

ownloaded from

http://iai.asm.org/

nella pneumophila proteins that regulate Rab1 membrane cycling. Nature450:365–369.

41. Joshi, A. D., S. Sturgill-Koszycki, and M. S. Swanson. 2001. Evidence thatDot-dependent and -independent factors isolate the Legionella pneumophilaphagosome from the endocytic network in mouse macrophages. Cell Micro-biol. 3:99–114.

42. Kagan, J. C., and C. R. Roy. 2002. Legionella phagosomes intercept vesiculartraffic from endoplasmic reticulum exit sites. Nat. Cell Biol. 4:945–954.

43. Kagan, J. C., M. P. Stein, M. Pypaert, and C. R. Roy. 2004. Legionella subvertthe functions of Rab1 and Sec22b to create a replicative organelle. J. Exp.Med. 199:1201–1211.

44. Khelef, N., H. A. Shuman, and F. R. Maxfield. 2001. Phagocytosis of wild-type Legionella pneumophila occurs through a wortmannin-insensitive path-way. Infect. Immun. 69:5157–5161.

45. Kozak, M. 1987. At least six nucleotides preceding the AUG initiator codonenhance translation in mammalian cells. J. Mol. Biol. 196:947–950.

46. Krendel, M., G. Sgourdas, and E. M. Bonder. 1998. Disassembly of actinfilaments leads to increased rate and frequency of mitochondrial movementalong microtubules. Cell Motil. Cytoskeleton 40:368–378.

47. LeBlanc, J. J., R. J. Davidson, and P. S. Hoffman. 2006. Compensatoryfunctions of two alkyl hydroperoxide reductases in the oxidative defensesystem Legionella pneumophila. J. Bacteriol. 188:6235–6244.

48. Liu, Y., and Z. Q. Luo. 2007. The Legionella pneumophila effector SidJ isrequired for efficient recruitment of endoplasmic reticulum proteins to thebacterial phagosome. Infect. Immun. 75:592–603.

49. Lu, H., and M. Clarke. 2005. Dynamic properties of Legionella-containingphagosomes in Dictyostelium amoebae. Cell Microbiol. 7:995–1007.

50. Machner, M. P., and R. R. Isberg. 2006. Targeting of host Rab GTPasefunction by the intravacuolar pathogen Legionella pneumophila. Dev. Cell11:47–56.

51. Maguire, M., A. R. Coates, and B. Henderson. 2002. Chaperonin 60 unfoldsits secrets of cellular communication. Cell Stress Chaperones 7:317–329.

52. Mampel, J., T. Spirig, S. S. Weber, J. A. J. Haagensen, S. Molin, and H.Hilbi. 2006. Planktonic replication is essential for biofilm formation by Le-gionella pneumophila in a complex medium under static and dynamic flowconditions. Appl. Environ. Microbiol. 72:2885–2895.

53. Marra, A., S. J. Blander, M. A. Horwitz, and H. A. Shuman. 1992. Identifi-cation of a Legionella pneumophila locus required for intracellular multipli-cation in human macrophages. Proc. Natl. Acad. Sci. USA 89:9607–9611.

54. Matsumoto, A., H. Bessho, K. Uehira, and T. Suda. 1991. Morphologicalstudies of the association of mitochondria with chlamydial inclusions and thefusion of chlamydial inclusions. J. Electron. Microsc. 40:356–363.

55. McLean, I. W., and P. K. Nakane. 1974. Periodate-lysine-paraformaldehydefixative. A new fixation for immunoelectron microscopy. J. Histochem. Cy-tochem. 22:1077–1083.

56. Morash, M. G., A. K. Brassinga, M. Warthan, P. Gourabathini, R. A. Gar-duno, S. D. Goodman, and P. S. Hoffman. 2009. Reciprocal expression ofintegration host factor and HU in the developmental cycle and infectivity ofLegionella pneumophila. Appl. Environ. Microbiol. 75:1826–1837.

57. Morris, R. L., and P. J. Hollenbeck. 1995. Axonal transport of mitochondriaalong microtubules and F-actin in living vertebrate neurons. J. Cell Biol.131:1315–1326.

58. Newton, H. J., F. M. Sansom, V. Bennett-Wood, and E. L. Hartland. 2006.Identification of Legionella pneumophila-specific genes by genomic subtrac-tive hybridization with Legionella micdadei and identification of lpnE, a generequired for efficient host cell entry. Infect. Immun. 74:1683–1691.

59. Ninio, S., and C. R. Roy. 2007. Effector proteins translocated by Legionellapneumophila: strength in numbers. Trends Microbiol. 15:372–380.

60. Oldham, L. J., and F. G. Rodgers. 1985. Adhesion, penetration and intra-cellular replication of Legionella pneumophila: an in vitro model of patho-genesis. J. Gen. Microbiol. 131:697–706.

61. Payne, N. R., and M. A. Horwitz. 1987. Phagocytosis of Legionella pneumo-phila is mediated by human monocyte complement receptors. J. Exp. Med.166:1377–1389.

62. Peterson, E. M., and L. M. de la Maza. 1988. Chlamydia parasitism: ultra-structural characterization of the interaction between the chlamydial cellenvelope and the host cell. J. Bacteriol. 170:1389–1392.

63. Ragaz, C., H. Pietsch, S. Urwyler, A. Tiaden, S. S. Weber, and H. Hilbi. 2008.The Legionella pneumophila phosphatidylinositol-4 phosphate-binding typeIV substrate SidC recruits endoplasmic reticulum vesicles to a replication-permissive vacuole. Cell Microbiol. 10:2416–2433.

64. Retzlaff, C., Y. Yamamoto, S. Okubo, P. S. Hoffman, H. Friedman, and T. W.Klein. 1996. Legionella pneumophila heat-shock protein-induced increase ofinterleukin-1 beta mRNA involves protein kinase C signalling in macro-phages. Immunology 89:281–288.

65. Ridenour, D. A., S. L. Cirillo, S. Feng, M. M. Samrakandi, and J. D. Cirillo.2003. Identification of a gene that affects the efficiency of host cell infection

by Legionella pneumophila in a temperature-dependent fashion. Infect. Im-mun. 71:6256–6263.

66. Riveroll, A. L. 2005. The Legionella pneumophila chaperonin: an investiga-tion of virulence-related roles in a yeast model. Ph.D. thesis. DalhousieUniversity, Halifax, Nova Scotia, Canada.

67. Rowbotham, T. J. 1986. Current views on the relationships between amoe-bae, legionellae and man. Isr. J. Med. Sci. 22:678–689.

68. Roy, C. R., K. H. Berger, and R. R. Isberg. 1998. Legionella pneumophilaDotA protein is required for early phagosome trafficking decisions that occurwithin minutes of bacterial uptake. Mol. Microbiol. 28:663–674.

69. Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratory manual,3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

70. Sauer, J. D., J. G. Shannon, D. Howe, S. F. Hayes, M. S. Swanson, and R. A.Heinzen. 2005. Specificity of Legionella pneumophila and Coxiella burnetiivacuoles and versatility of Legionella pneumophila revealed by coinfection.Infect. Immun. 73:4494–4504.

71. Scanlon, M., G. J. Leitch, G. S. Visvesvara, and A. P. Shaw. 2004. Relation-ship between the host cell mitochondria and the parasitophorous vacuole incells infected with Encephalitozoon microsporidia. J. Eukaryot. Microbiol.51:81–87.

72. Schepis, A., B. Schramm, C. A. de Haan, and J. K. Locker. 2006. Vacciniavirus-induced microtubule-dependent cellular rearrangements. Traffic7:308–323.

73. Sinai, A. P., and K. A. Joiner. 2001. The Toxoplasma gondii protein ROP2mediates host organelle association with the parasitophorous vacuole mem-brane. J. Cell Biol. 154:95–108.

74. Sinai, A. P., P. Webster, and K. A. Joiner. 1997. Association of host cellendoplasmic reticulum and mitochondria with the Toxoplasma gondii para-sitophorous vacuole membrane: a high-affinity interaction. J. Cell Sci. 110:2117–2128.

75. Steinert, M., M. Ott, P. C. Luck, E. Tannich, and J. Hacker. 1994. Studies onthe uptake and intracellular replication of Legionella pneumophila in proto-zoa and in macrophage-like cells. FEMS Microbiol. Ecol. 15:299–308.

76. Sturgill-Koszycki, S., and M. S. Swanson. 2000. Legionella pneumophilareplication vacuoles mature into acidic, endocytic organelles. J. Exp. Med.192:1261–1272.

77. Summerhayes, I. C., D. Wong, and L. B. Chen. 1983. Effect of microtubules andintermediate filaments on mitochondrial distribution. J. Cell Sci. 61:87–105.

78. Susa, M., and R. Marre. 1999. Legionella pneumophila invasion of MRC-5cells induces tyrosine protein phosphorylation. Infect. Immun. 67:4490–4498.

79. Swanson, M. S., and R. R. Isberg. 1995. Association of Legionella pneumophilawith the macrophage endoplasmic reticulum. Infect. Immun. 63:3609–3620.

80. Tilney, L. G., O. S. Harb, P. S. Connelly, C. G. Robinson, and C. R. Roy.2001. How the parasitic bacterium Legionella pneumophila modifies itsphagosome and transforms it into rough ER: implications for conversion ofplasma membrane to the ER membrane. J. Cell Sci. 114:4637–4650.

81. Torok, Z., I. Horvath, P. Goloubinoff, E. Kovacs, A. Glatz, G. Balogh, and L.Vigh. 1997. Evidence for a lipochaperonin: association of active protein-folding GroESL oligomers with lipids can stabilize membranes under heatshock conditions. Proc. Natl. Acad. Sci. USA 94:2192–2197.

82. Viswanathan, V. K., and N. P. Cianciotto. 2000. Electroporation of Legio-nella species, p. 203–211. In Electro-transformation of bacteria. SpringerVerlag Publications, Heidelberg, Germany.

83. Vogel, J., C. Roy, and R. R. Isberg. 1996. Use of salt to isolate Legionellapneumophila mutants unable to replicate in macrophages. Ann. N. Y. Acad.Sci. 797:271–272.

84. Watarai, M., I. Derre, J. Kirby, J. D. Growney, W. F. Dietrich, and R. R.Isberg. 2001. Legionella pneumophila is internalized by a macropinocytoticuptake pathway controlled by the Dot/Icm system and the mouse Lgn1 locus.J. Exp. Med. 194:1081–1096.

85. Wieland, H., F. Goetz, and B. Neumeister. 2004. Phagosomal acidification isnot a prerequisite for intracellular multiplication of Legionella pneumophilain human monocytes. J. Infect. Dis. 189:1610–1614.

86. Winn, W. C., Jr. 1988. Legionnaires disease: historical perspective. Clin.Microbiol. Rev. 1:60–81.

87. Yoshida, N., K. Oeda, E. Watanabe, T. Mikami, Y. Fukita, K. Nishimura, K.Komai, and K. Matsuda. 2001. Protein function: chaperonin turned insecttoxin. Nature 411:44.

88. Zhang, L., S. L. Pelech, D. Mayrand, D. Grenier, J. Heino, and V. J. Uitto.2001. Bacterial heat shock protein-60 increases epithelial cell proliferationthrough the ERK1/2 MAP kinases. Exp. Cell Res. 266:11–20.

89. Zhang, L., S. Pelech, and V. J. Uitto. 2004. Long-term effect of heat shockprotein 60 from Actinobacillus actinomycetemcomitans on epithelial cell vi-ability and mitogen-activated protein kinases. Infect. Immun. 72:38–45.

90. Zhou, D., M. S. Mooseker, and J. E. Galan. 1999. Role of the Salmonellatyphimurium actin binding protein SipA in bacterial internalization. Science283:2092–2095.

Editor: J. B. Bliska



.org/D

ownloaded from

http://iai.asm.org/

the purified and recombinant legionella pneumophila … · audrey chong, 1† celia a. lima, david...

Documents