This article was downloaded by: [US Fish & Wildlife Service]On: 07 December 2011, At: 12:47Publisher: Taylor & FrancisInforma Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House,37-41 Mortimer Street, London W1T 3JH, UK

Transactions of the American Fisheries SocietyPublication details, including instructions for authors and subscription information:http://www.tandfonline.com/loi/utaf20

The Reproductive Biology of Siscowet and Lean LakeTrout in Southern Lake SuperiorFrederick Goetz a , Shawn Sitar b , Daniel Rosauer a , Penny Swanson c , Charles R. Bronte d ,Jon Dickey c & Crystal Simchick aa School of Freshwater Sciences, University of Wisconsin–Milwaukee, 600 East GreenfieldAvenue, Milwaukee, Wisconsin, 53204, USAb Michigan Department of Natural Resources, Marquette Fisheries Research Station, 484Cherry Creek Road, Marquette, Michigan, 49855, USAc National Oceanic and Atmospheric Administration–Fisheries, Northwest Fisheries ScienceCenter, 2725 Montlake Boulevard East, Seattle, Washington, 98112–2097, USAd U.S. Fish and Wildlife Service, Green Bay Fish and Wildlife Conservation Office, 2661 ScottTower Drive, New Franken, Wisconsin, 54229, USA

Available online: 17 Nov 2011

To cite this article: Frederick Goetz, Shawn Sitar, Daniel Rosauer, Penny Swanson, Charles R. Bronte, Jon Dickey & CrystalSimchick (2011): The Reproductive Biology of Siscowet and Lean Lake Trout in Southern Lake Superior, Transactions of theAmerican Fisheries Society, 140:6, 1472-1491

To link to this article: http://dx.doi.org/10.1080/00028487.2011.630276

PLEASE SCROLL DOWN FOR ARTICLE

Full terms and conditions of use: http://www.tandfonline.com/page/terms-and-conditions

This article may be used for research, teaching, and private study purposes. Any substantial or systematicreproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form toanyone is expressly forbidden.

The publisher does not give any warranty express or implied or make any representation that the contentswill be complete or accurate or up to date. The accuracy of any instructions, formulae, and drug doses shouldbe independently verified with primary sources. The publisher shall not be liable for any loss, actions, claims,proceedings, demand, or costs or damages whatsoever or howsoever caused arising directly or indirectly inconnection with or arising out of the use of this material.

Transactions of the American Fisheries Society 140:1472–1491, 2011C© American Fisheries Society 2011ISSN: 0002-8487 print / 1548-8659 onlineDOI: 10.1080/00028487.2011.630276

ARTICLE

The Reproductive Biology of Siscowet and Lean Lake Troutin Southern Lake Superior

Frederick Goetz*School of Freshwater Sciences, University of Wisconsin–Milwaukee, 600 East Greenfield Avenue,Milwaukee, Wisconsin 53204, USA

Shawn SitarMichigan Department of Natural Resources, Marquette Fisheries Research Station,484 Cherry Creek Road, Marquette, Michigan 49855, USA

Daniel RosauerSchool of Freshwater Sciences, University of Wisconsin–Milwaukee, 600 East Greenfield Avenue,Milwaukee, Wisconsin 53204, USA

Penny SwansonNational Oceanic and Atmospheric Administration–Fisheries, Northwest Fisheries Science Center,2725 Montlake Boulevard East, Seattle, Washington 98112–2097, USA

Charles R. BronteU.S. Fish and Wildlife Service, Green Bay Fish and Wildlife Conservation Office,2661 Scott Tower Drive, New Franken, Wisconsin 54229, USA

Jon DickeyNational Oceanic and Atmospheric Administration–Fisheries, Northwest Fisheries Science Center,2725 Montlake Boulevard East, Seattle, Washington 98112–2097, USA

Crystal SimchickSchool of Freshwater Sciences, University of Wisconsin–Milwaukee, 600 East Greenfield Avenue,Milwaukee, Wisconsin 53204, USA

AbstractLean and siscowet morphotypes of lake trout Salvelinus namaycush in Lake Superior are thought to be genetically

separate, but the reproductive isolating mechanism is unknown. The testicular and ovarian cycles and reproductivehormone levels of these morphotypes were determined from May to October in populations east and west of theKeweenaw Peninsula in southern Lake Superior. The gonadosomatic index (GSI) increased from August to October forlean and siscowet males and females east of the Keweenaw Peninsula and for siscowets west of the Keweenaw Peninsula.Circulating estradiol-17β (E2) levels and ovarian GSIs increased simultaneously in females of both morphotypes.However, circulating 11-ketotestosterone (11-KT) levels in lean and siscowet males were not significantly elevateduntil October even though testicular GSIs increased by August. Transcripts of the follicle stimulating hormone (FSH)beta subunit (an indirect measure of FSH activity) increased in lean and siscowet males and females during Augustand September, when GSIs were increasing for both morphotypes. The seasonal changes in GSIs and hormonelevels indicate that both lean and siscowet individuals in southern Lake Superior populations undergo reproductive

*Corresponding author: rick@uwm.eduReceived November 13, 2010; accepted May 26, 2011

1472

Dow

nloa

ded

by [

US

Fish

& W

ildlif

e Se

rvic

e] a

t 12:

47 0

7 D

ecem

ber

2011

REPRODUCTIVE BIOLOGY OF SISCOWET AND LEAN LAKE TROUT 1473

maturation at the same time in the fall; therefore, reproductive timing does not appear to genetically isolate themorphotypes in these populations. A proportion of the sampled females (lean lake trout: 54%; siscowets: 42%)exhibited no increase in GSI from August to October, strongly suggesting that in any given year some proportion ofthe population does not reproduce. This was also observed in males but at a lower percentage (19–20%). Fish that didnot have maturing gonads from August to October also had lower E2 and 11-KT levels than maturing fish. Fecunditymeasured for lean and siscowet lake trout was not statistically different and was similar to historical values.

The lake trout Salvelinus namaycush is the dominant nativesalmonine predator in the Laurentian Great Lakes and is thefocus of a large international restoration and management ef-fort by federal, state, provincial, and tribal fisheries agencies. InLake Superior, there are three principal lake trout morphotypes:lean, siscowet, and humper. These forms have differing mor-phologies (Eschmeyer and Phillips 1965; Lawrie and Rahrer1973; Moore and Bronte 2001) and osteology (Burnham-Curtisand Smith 1994); they also occupy different habitats that aremainly separated on the basis of bathymetry, although there issome spatial overlap (Moore and Bronte 2001; Bronte et al.2003). Lean lake trout, which were originally found in all ofthe Great Lakes, tend to be distributed in waters shallowerthan 100 m. Siscowet-like lake trout were once present in allof the Great Lakes except Lake Ontario (Krueger and Ihssen1995). While they are found outside the basin, in the GreatLakes, siscowet-like lake trout are present only in Lake Superiorwhere they occur mostly at depths greater than 100 m (Bronteet al. 2003). Siscowets have larger fins and eyes, a shorter snout,larger caudal peduncle, and higher lipid content in the musclethan lean lake trout (Eschmeyer and Phillips 1965; Moore andBronte 2001). Humper lake trout (also known as “bankers”)derive their name from the offshore humps that they inhabit(Lawrie and Rahrer 1973; Burnham-Curtis and Bronte 1996).Humper lake trout have large fins, a short head with large eyesand convex snout, a thin abdominal wall (Rahrer 1965; Khanand Qadri 1970; Moore and Bronte 2001), and lipid content thatis intermediate between those of lean and siscowet lake trout(Eschmeyer and Phillips 1965).

Garden-variety rearing experiments have shown that sis-cowets and lean lake trout derived from wild populations inLake Superior exhibit the same morphological and physiolog-ical (e.g., lipid levels) phenotypes when grown under envi-ronmental conditions as do wild lean and siscowet lake trout(Stauffer and Peck 1981; Goetz et al. 2010). These results, incombination with evidence from microsatellite studies (Pageet al. 2004), strongly suggest that differences between lean andsiscowet lake trout are genetic and are not the result of en-vironmental plasticity. To maintain these genetic differences,partial reduction in migration and gene flow between popula-tions should occur by (1) prezygotic barriers that restrict randommating (e.g., the seasonal timing of reproduction or location ofspawning sites), (2) postzygotic barriers (e.g., the viability andfitness of hybrids), or (3) both mechanisms. Examples of sepa-ration can be observed in coexisting morphotypes of Arctic char

Salvelinus alpinus, which exhibit both temporal and spatial re-productive isolation (Sandlund et al. 1992; Elliot and Baroudy1995; Hesthagen et al. 1995; Telnes and Saegrov 2004); how-ever, reproductive isolation has not yet been reported for laketrout morphotypes.

Many studies have described spawning and reproductivestaging of lean lake trout from North American lakes (Martinand Olver 1980). However, relatively few studies have examinedother lake trout forms. Even for lean lake trout, only a few stud-ies have comprehensively followed gonadal maturation in bothsexes throughout the year for wild fish from the same popula-tions or sampling sites. Eschmeyer (1955) reported that ovarianweights in Lake Superior siscowets peaked by late Septemberand in two cases by late July, whereas in lean lake trout the ovar-ian weights peaked from October to November. Bronte (1993)captured one ripe male siscowet and one ripe female siscowet(sperm and eggs flowing readily) in late April from deep wa-ter northeast of the Apostle Islands in Lake Superior. Humperlake trout in Lake Superior have been observed in spawningcondition during August (Burnham-Curtis and Bronte 1996)and mid-September off Isle Royale (Rahrer 1965) and duringSeptember at Klondike Reef (U.S. Fish and Wildlife Service,New Franken, Wisconsin, unpublished data). In addition, threefemale humper or siscowet lake trout that were ripe or spentwere observed in June off the eastern extremity of Isle Royale(Eschmeyer 1955). Thus, one isolating mechanism may be therelative timing of reproductive maturation and spawning amonglake trout forms. To address the possible genetic separation ofthese lake trout morphotypes by the seasonal timing of repro-duction, we assessed gonadal maturation in male and femalesiscowets and lean lake trout from two areas in southern LakeSuperior during spring to fall by analyzing temporal changes inthe gonadosomatic index (GSI) and by histological examinationof cytological changes in the gonads.

Another way to assess the stage of gonadal maturation in fishis to measure seasonal changes in the levels of key reproductivehormones, including gonadal steroids (estrogens and androgens)and pituitary gonadotropins (gonadotropic hormones [GTHs]:follicle stimulating hormone [FSH] and luteinizing hormone[LH]). The levels of these hormones are correlated with the de-gree of gonadal growth and maturation (Swanson 1991; Gomezet al. 1999; Campbell et al. 2006). The primary estrogenic steroidin female salmonids is estradiol-17β (E2), which is producedunder the control of FSH by follicle cells (theca and granulosacells) surrounding the developing oocyte (Fostier et al. 1983;

Dow

nloa

ded

by [

US

Fish

& W

ildlif

e Se

rvic

e] a

t 12:

47 0

7 D

ecem

ber

2011

1474 GOETZ ET AL.

Planas et al. 2000; Young et al. 2005). The primary androgenin salmonids is 11-ketotestosterone (11-KT), which is also con-trolled by FSH (Planas and Swanson 1995). In the female, LHis involved in the stimulation of the final maturational events(i.e., germinal vesicle breakdown) in the follicle (Lubzens et al.2010), whereas in males LH plays a major role in regulatingsperm maturation and the release of sperm into the sperm duct(spermiation; Schulz et al. 2010).

Changes in the levels of sex steroids during gonadal matura-tion have been documented in many salmonids, including brooktrout Salvelinus fontinalis (Tam et al. 1986; de Montgolfieret al. 2009), Arctic char (Mayer et al. 1992; Frantzen et al.1997; Tveiten et al. 1998), and whitespotted char Salvelinusleucomaenis (Kagawa et al. 1981). To our knowledge, there hasbeen only one study that reported the circulating levels of sexsteroids in lake trout, and this was in captive lean lake troutbroodstocks (Foster et al. 1993). Thus, in the current study, thecirculating levels of E2 in females and 11-KT in males that wereassayed for GSI and cytology were measured as another indexof the seasonal changes in gonad maturation.

Although GTH levels in wild or captive chars Salvelinusspp. have not been reported, several such studies have been con-ducted on rainbow trout Oncorhynchus mykiss (Prat et al. 1996;

Davies et al. 1999; Gomez et al. 1999). Attempts to measureplasma GTH levels in chars by using current assays for salmonFSH and LH have so far been unsuccessful (P. Swanson, unpub-lished data). Past studies have demonstrated that there is somecorrelation between circulating FSH and the FSH transcript lev-els in the rainbow trout pituitary (Gomez et al. 1999), and severalstudies of other fish species have observed seasonal changes inpituitary GTH transcript levels in relation to the reproductivecycle (Sohn et al. 1999; Hellqvist et al. 2006; Martyniuk et al.2009). Thus, changes in pituitary transcript levels of the LH andFSH beta subunits in the same lake trout that were sampled forGSI and steroid levels were analyzed as an indirect measure ofchanges in GTHs during the seasonal gonadal cycle.

METHODSField collection of fish.—During 2006–2008, lean and sis-

cowet lake trout were collected by using multifilament bottom-set gill nets (stretch measure mesh sizes = 11.4, 12.7, 14.0,and 15.2 cm) at two areas in the Michigan waters of southernLake Superior (Figure 1). Nets were 1.83 m high, their lengthsvaried from 360 to 2,300 m, and they were set for one to twonights. During 2007 and 2008, lake trout were collected monthly

FIGURE 1. Locations of lean lake trout (open circles) and siscowet lake trout (shaded triangles) sampling sites in Lake Superior east and west of the KeweenawPeninsula.

Dow

nloa

ded

by [

US

Fish

& W

ildlif

e Se

rvic

e] a

t 12:

47 0

7 D

ecem

ber

2011

REPRODUCTIVE BIOLOGY OF SISCOWET AND LEAN LAKE TROUT 1475

between May and October east of the Keweenaw Peninsula nearMarquette, Michigan (hereafter, “EK area”). In 2006, sampleswere collected from the EK area only in June. West of theKeweenaw Peninsula (hereafter, “WK area”), lake trout werecollected during May, August, and October in 2007 and 2008;however, insufficient numbers of lean lake trout were collectedfrom the WK area. Thus, for lean lake trout, only data from fishsampled in the EK area were analyzed for GSI and hormonelevels. At each sampling area, bathymetric depths of lean laketrout sampling stations were less than 80 m and depths of sis-cowet sampling stations were greater than 90 m. The targetednumber of fish to be collected at each area per sampling timewas 15 individuals of each morphotype and each sex. Given thatthe objective of this study was to profile seasonal gonadal mat-uration, attempts were made to restrict fish sampling to maturelean lake trout and siscowets (total length [TL] ≥ 550 mm) byusing the gill-net meshes described above based on previouslyreported selectivity curves (Hansen et al. 1997). Recent infor-mation on length at maturity indicates that most of the lean andsiscowet lake trout are mature at a TL of 550 mm or greater(Sitar and He 2006; S. Sitar, unpublished data). Hatchery-originlake trout that were previously stocked for restoration (Hansenet al. 1995) were excluded from analyses. Lean and siscowetlake trout were differentiated based on their morphometry, in-cluding the shape and relative size of the head, the size of thefins, and the location and size of the eyes (Moore and Bronte2001); the depth at which the fish were sampled was also usedto differentiate between the morphotypes (Bronte et al. 2003).Total length (nearest 1 mm), weight (nearest 5.0 g), and sexwere recorded for each fish, and the gonads, otoliths, pituitaries,and a blood sample were collected from each individual. Weused analysis of variance (ANOVA) in R version 2.8.1 to testfor significant differences (α = 0.05) in mean TL and weightbetween lean lake trout and siscowets by sex and sampling site.The lateral views of the head and whole body of each fish werephotographed with a digital camera to address questions regard-ing morphotype identification.

Age determination.—Extracted sagittal otoliths from a subsetof female lean and siscowet lake trout that were collected fromthe EK area during September 2007 and 2008 were used toassess ages. In the laboratory, whole otoliths were sanded onthe dorsal surface to establish a sagittal plane, which exposedthe annuli for counting under a compound microscope. Sandedotoliths were soaked in mineral oil, and annuli were countedvisually by using a compound microscope with reflected light;counts were aided by use of a digital camera and computer withthe Hierarchical Discrete Correlation/Wallis Filter in OPTIMASversion 6.5 (Media Cybernetics 1999). Differences in mean ageby morphotype and maturity category were assessed by use oftwo-way ANOVA (α = 0.05; R version 2.8.1).

Gonad assays.—Gonad pairs were held in plastic bags onice during fish collection and were then immediately weighed(nearest 0.1 g) onshore for calculation of the GSI ([gonadweight/body weight] × 100). For statistical analysis, GSIs were

logit transformed (log10[x/{1 − x}]) and were analyzed by two-way ANOVA with morphotype and time as factors, followed byTukey’s post hoc test in Minitab version 15.1.30.0. Differenceswere considered significant at P-values of 0.05 or less. Further-more, monthly GSI distributions for each sex were tested for nor-mality by using a one-sample Kolmogorov–Smirnov test in Pre-dictive Analytics Software version 18.0 (α = 0.05; SPSS, Inc.)to determine GSI groupings according to maturational state.

After gonads were weighed, a small piece of each gonadpair from each fish was placed in Altmann’s fixative (Humason1972) for 48 h. Fixed sections were washed in tap water andwere held in a 50% solution of ethanol until processing. Histo-logical processing was carried out by Mass Histology Service,Inc. (Boston, Massachusetts), and included tissue dehydration,paraffin embedding, sectioning, staining, and slide preparation.One slide was produced for each gonad sample and was stainedwith hematoxylin and eosin. Sections were viewed under a com-pound microscope, and each sampled fish was assigned to a stageof oogenesis (Nagahama 1983) or spermatogenesis (Kusakabeet al. 2006).

Fecundity analysis.—During September and October 2008,the ovaries of prespawning female lean lake trout (n = 17) andsiscowets (n = 25) sampled from the EK area were used toestimate fecundity. For each fish, two cross-sections from eachovary were excised and weighed (nearest 0.1 g). The number ofvitellogenic eggs (>3 mm) was counted twice for each ovariansection, the counts were averaged, and the average was thendivided by the section weight to estimate the number of eggsper kilogram of sectioned ovary. The mean number of eggsper kilogram for all four sections (E) was then estimated. Thetotal number of eggs per female was estimated as E times thetotal weight of ovaries (O). Total fecundity per individual fish(TF), expressed as eggs per kilogram of total body weight, wascalculated as

TF = E × O

W,

where W is total body wet weight (nearest 0.1 kg). Based ona priori indications that fecundity was higher in lean lake troutthan in siscowets (Eschmeyer 1955; Peck 1988), we tested thedifference in mean relative fecundity between lean and siscowetlake trout by using Welch’s two-sample t-test in R version 2.8.1(H0: lean TF > siscowet TF; α = 0.05).

Fecundity was analyzed as a function of TL (mm) and weight(g). Both relationships were analyzed with a linear model (lmfunction in R version 2.8.1); length data were log transformed.Potential differences in intercept between lean and siscowetlake trout were evaluated by including morphotype as a factorin the models. Furthermore, possible differences in slope be-tween the two morphotypes were evaluated by including theinteraction between morphotype and body size (TL or weight)in the models. Nonsignificant intercepts or slopes were removedin a stepwise fashion from the models based on Student’s t-test

Dow

nloa

ded

by [

US

Fish

& W

ildlif

e Se

rvic

e] a

t 12:

47 0

7 D

ecem

ber

2011

1476 GOETZ ET AL.

TABLE 1. Primer sequences for cloning and quantitative reverse-transcription polymerase chain reaction (qPCR) of the beta subunits of lake trout folliclestimulating hormone (FSH) and luteinizing hormone (LH; F = forward primer; R = reverse primer; W = A or T; Y = C or T).

GenBank accession Annealing temperatureGene name number Primer name (◦C) Primer sequence (5′–3′)

CloningFSH beta subunit FSHb F 58 ATGTACTGCACCCACTTAAAGAYGC

FSHb R 56 CTAGTGGGTTTACWAYGCAGCTCLH beta subunit LHb F 60 AGCCCTGTCAGCCCATCAAC

LHb R 57 ACATACAACCTACAAGCCCATGTC

qPCRFSH beta subunit HM057170 FSH F 58 GTTGCCATGCTTATGCGATC

FSH R 58 CTTAAAGATGCTGCAGCTGGLH beta subunit HM057171 LH F 58 CAGACTGTGTCTCTGGAGAAG

LH R 58 CCTACAAGCCCATGTCTGTAGActin ABI20511 Act F 58 AGCAAGCAGGAATACGACGA

Act R 58 AGCCATGCCAATGAGACTGA

values (α = 0.05). Differences in intercept and slope betweenlean and siscowet lake trout were determined by use of anal-ysis of covariance. Relative fecundity (eggs/kg) was estimatedonly when the intercept was not significantly different fromzero, and the slope was interpreted as the number of eggs perkilogram. The difference in relative fecundity between lean andsiscowet lake trout was based on the statistical difference inslopes.

Estradiol and 11-ketotestosterone analyses.—At collection,a 5.0-mL blood sample was drawn from the caudal vein ofeach fish by using a heparinized syringe fitted with an 18-gaugeneedle. The blood was held on ice until collections were com-plete, and the sample was then centrifuged at 2,000 × gravity(g) for 20 min at 4◦C. The plasma was removed and frozenin aliquots at −20◦C until steroid assay. Plasma samples wereextracted twice with either 1.5 mL of ether (for E2 in females)or 1.0 mL of dichloromethane (for 11-KT in males). Extractswere dried at 37◦C under a nitrogen atmosphere. Estradiol wasmeasured in female plasma samples via radioimmunoassay (de-scribed by Sower and Schreck 1982) by using an antibody(cross-reactivities: estrone, 2.6%; estriol, 4.2%; testosterone,0.02%; Korenman et al. 1974) purchased from Dr. GordonNiswender (Colorado State University, Fort Collins). Measure-ment of 11-KT in male plasma samples was accomplished withan enzyme immunoassay (described by Cuisset et al. 1994) byusing tracer- and secondary-antibody-coated plates purchasedfrom Cayman Chemical (Ann Arbor, Michigan). Primary 11-KTantiserum (cross-reactivities: testosterone, 3.4%; dihydrotestos-terone, 2.25%; androstenedione, <0.1%; Schulz 1984) was pro-vided by Dr. Rudiger Schulz (Department of Biology, Universityof Utrecht, The Netherlands). Interassay coefficients of varia-tion were 5.89% for E2 and 13.21% for 11-KT. The E2 and11-KT levels were analyzed by two-way ANOVA with morpho-type and time as factors, followed by Tukey’s post hoc test inMinitab version 15.1.30.0 (α = 0.05).

Pituitary gonadotropin beta subunit transcript analysis.—Atcollection, the skull of each fish was opened, and the pituitarywas removed and placed in an RNase/DNase-free, 1.5-mL mi-crocentrifuge tube that was held on dry ice. In the laboratory,pituitary samples were transferred from dry ice to a −80◦Cfreezer until assay.

The beta subunits of lake trout FSH and LH were clonedby using reverse-transcription (RT) polymerase chain reaction(PCR) with degenerate primers (Table 1) derived from othersalmonid GTHs. Total RNA was extracted from lake trout pi-tuitaries by using TRI reagent (Sigma–Aldrich) according tothe manufacturer’s instructions (Chomcynski and Sacchi 1987;Chomcynski 1993). Pools of selected RNA samples collectedduring May–October were used for RT-PCR to ensure that bothGTHs would be present. Complementary DNA (cDNA) wasproduced by RT in a PTC-200 thermocycler (Bio-Rad Labo-ratories). Oligo(dT) primer (0.25 µg) was added to 500 ng oftotal RNA in a volume of 5 µL. The mixture was allowed toincubate at 70◦C for 5 min and then at 4◦C for 5 min; 4 µLof 5× reaction buffer, 2.4 µL of MgCl2 (25 mM), 1 µL of de-oxynucleotide triphosphate mix (10 mM), 1 µL of the PromegaImProm-II RT system, and 6.6 µL of water were then added andincubated at 25◦C for 5 min, at 37◦C for 1 h, and at 70◦C for15 min.

Gradient PCR was performed on cDNA by using degenerateprimers (Table 1) and AmpliTaq Gold (Applied Biosystems).The PCR products were separated on agarose gels and viewedunder ultraviolet illumination. Potential bands of interest werecut and purified with the QIAquick gel extraction kit (Qiagen).Purified DNA was ligated into vector pCR2.1 by using the TOPOcloning kit (Invitrogen), and TOPO 10 competent cells weretransformed with ligated plasmid. After colony PCR was per-formed to identify positive clones, plasmid DNA was producedand sequenced by using the dideoxy chain termination methodwith Big Dye Terminator (Applied Biosystems) and the M13

Dow

nloa

ded

by [

US

Fish

& W

ildlif

e Se

rvic

e] a

t 12:

47 0

7 D

ecem

ber

2011

REPRODUCTIVE BIOLOGY OF SISCOWET AND LEAN LAKE TROUT 1477

reverse primer. The reactions were precipitated and resuspendedin Hi-Di formamide with EDTA and were run on an ABI Prism3730 automated sequencer (Applied Biosystems). Sequencechromatogram files were trimmed for quality by using phredsoftware (Ewing and Green 1998), vector screened with crossmatch (www.phrap.org/phrap.docs/phrap.html), and analyzedlocally with BLASTX against the National Center for Biotech-nology Information (NCBI) nonredundant protein database andwith BLASTN against the NCBI nucleotide database.

Quantitative RT-PCR (qPCR) was used for the analysis ofFSH and LH beta subunit transcript levels in only those fish thatwere sampled in 2007. Total RNA was isolated from pituitariesby using the illustra RNAspin 96 RNA isolation kit (GE Health-care) according to the manufacturer’s protocol. Briefly, 300 µLof a lysis buffer were added to each pituitary sample and ho-mogenized by using a plastic micropestle in a 1.5-mL tube. Thehomogenized samples were then transferred to a 96-well plate,and 300 µL of a neutralization buffer were added to each sample.The solution was then transferred to the RNAspin RNA bindingplate and was centrifuged for 2 min at 5,600 × g (Allegra 25Rcentrifuge; Beckman Coulter). Desalting buffer (500 µL) wasadded to each well of the binding plate and was centrifuged for2 min at 5,600 × g; the flow-through was then discarded. Ge-nomic DNA was removed by adding the endonuclease DNaseI and incubating at room temperature for 15 min. Wash buffer(500 µL) was added to each well of the binding plate and wascentrifuged for 2 min at 5,600 × g, followed by the addition ofdesalting buffer (800 µL) and centrifugation for 2 min at 5,600× g. The flow-through was discarded. The RNA was eluted byusing 50 µL of RNase-free water that was applied directly tothe bottom of the binding plate; the plate was then allowed to sitat room temperature for 2 min and was centrifuged for 3 min at5,600 × g. The concentration of each sample was obtained byanalyzing 1.5 µL on a NanoDrop ND1000 spectrophotometer(Thermo Scientific).

The cDNA was produced by RT exactly as described abovefor cloning the lake trout FSH and LH beta subunits. All qPCRreactions were created as master mixes, and individual reactionscontained the following: 2.0 µL of cDNA, 5 pM each of theforward and reverse gene primers (Table 1), and 12.5 µL ofPower SYBR Green PCR Master Mix (Applied Biosystems).Cycling and fluorescence measurements were carried out in anMx3000P qPCR system (Stratagene) with the following cyclingparameters: 1 cycle of 95◦C for 10 min; and 40 cycles of 95◦C for15 s and 58◦C for 1 min. Fluorescence readings were taken at theend of each cycle. Immediately after cycling, a melting curveanalysis was run. Amplification products from qPCR primerswere analyzed initially on agarose gels to ensure the presenceof single bands of the correct size, and quality control for qPCRincluded the analysis of (1) no-template controls for the absenceof primer dimers and (2) dissociation curves for the presence ofsharp single peaks.

Raw data were processed with Real-Time PCR Miner (Zhaoand Fernald 2005). Quantification was performed by calculating

the relative messenger RNA concentration (R0) for each geneper individual sample. Briefly, this was calculated by using thefollowing equation:

R0 = 1

(1 + E)Ct,

where E is the gene efficiency (calculated as the average of allindividual sample efficiencies across all reactions for a givengene/qPCR plate) and Ct is the cycle number at threshold (Zhaoand Fernald 2005). The R0 for each gene was normalized toa control R0 (actin: see Table 1) from each individual sample.The total amount of FSH or LH beta subunit transcript perpituitary was calculated by adjusting for the total amount ofRNA extracted for each sample and was calculated as follows:

Total(GTHpituitary) = qPCRGTH(×RNApituitary)/0.5,

where total GTHpituitary is the total amount of FSH or LH betasubunit in the pituitary, qPCRGTH is the normalized qPCR levelof FSH or LH beta subunit, RNApituitary is the total amount ofRNA (µg) in the pituitary, and 0.5 is the amount of RNA (µg)used for cDNA synthesis. The FSH beta subunit levels wereanalyzed with two-way ANOVA (factors = morphotype andtime), followed by Tukey’s post hoc test in Minitab version15.1.30.0 (α = 0.05).

RESULTS

Length and Weights of Sampled FishAmong all years and sampling sites, 463 lean lake trout and

600 siscowets were collected (Table 2). At the EK sites, thetotal numbers of lean and siscowet lake trout sampled weresimilar (379 lean lake trout; 413 siscowets). At the WK sites,187 siscowets were collected, but only 84 lean lake trout weresampled. Thus, for lean lake trout, only data from EK-sampledfish were subsequently analyzed for GSI and hormone levels.For EK samples, mean TL did not differ between lean andsiscowet lake trout (F1, 788 = 0.41, P = 0.52) or between malesand females (F1, 795 = 0.0004, P = 0.98; Table 2). Lean laketrout sampled at WK sites were shorter than siscowets (F1, 267

= 41.8, P < 0.001) for both sexes. Among WK samples, therewere no differences in mean TL of males versus females withinmorphotypes (F1, 267 = 0.18, P = 0.67). Lean lake trout fromWK sites were shorter than those from EK sites (F1, 459 = 17.1,P < 0.001). However, siscowets from WK sites were longerthan those from EK sites (F1, 596 = 14.9, P < 0.001).

Mean weights of fish sampled at EK sites did not differbetween lean lake trout and siscowets (F1, 788 = 0.02, P = 0.90)or between males and females (F1, 788 = 0.06, P = 0.81; Table2). For samples collected at WK sites, siscowets were heavierthan lean lake trout (F1, 267 = 33.5, P < 0.001) and weights werenot different between sexes (F1, 267 = 0.24, P = 0.63). Withinmorphotypes, siscowets from WK sites were heavier than those

Dow

nloa

ded

by [

US

Fish

& W

ildlif

e Se

rvic

e] a

t 12:

47 0

7 D

ecem

ber

2011

1478 GOETZ ET AL.

TABLE 2. Mean (with 95% confidence interval [CI]) total length (TL; mm) and weight (g) of lean and siscowet lake trout collected during 2006–2008 inMichigan waters of Lake Superior west (WK) and east (EK) of the Keweenaw Peninsula. For a given variable, values with differing letters were significantlydifferent (ANOVA: P < 0.05).

WK EK

Morphotype Statistic TL Weight n TL Weight n

MalesLean Mean 588 a 1,597 x 34 627 b 2,155 y 193

95% CI 575–601 1,476–1,718 616–637 1,975–2,334Siscowet Mean 644 c 2,392 y 97 622 b 2,055 y 207

95% CI 630–659 2,154–2,630 614–630 1,943–2,167

FemalesLean Mean 595 a 1,726 x 50 623 b 2,058 y 186

95% CI 581–608 1,574–1,878 614–632 1,928–2,187Siscowet 646 c 2,419 y 90 622 b 2,179 y 206

95% CI 632–660 2,210–2,627 611–633 2,018–2,340

from EK sites (F1, 596 = 9.8, P < 0.01) and lean lake trout fromEK sites were heavier than those from WK sites (F1, 459 = 12.4,P < 0.001).

Female Gonadosomatic IndicesFrequency plots of the individual female GSIs across all

samples indicated that from August to October, there was anincrease in the ovarian size of lean and siscowet lake trout sam-pled at EK sites and siscowets sampled at WK sites (Figure 2).However, statistical analyses also indicated that monthly GSIdistributions were nonnormal for female lean lake trout fromAugust to October and for female siscowets during Septemberand October (P < 0.05), suggesting that not all females hadmaturing ovaries at this time of year. Thus, we categorized fe-males sampled during August–October into two groups—thosewith maturing ovaries (GSI ≥ 3.0) and those without matur-ing ovaries (GSI < 3.0)—based on the GSI distributions fromSeptember and October, when the ovaries of a proportion of thefish were clearly increasing in size. These groupings were fur-ther supported by scatter plots of individual GSI as a function ofloge transformed E2 levels, another reproductive indicator (seeEstradiol Levels section below; Figure A.1). Based on an exam-ination of GSIs for only those fish with maturing ovaries fromAugust to October, there was a significant increase in the meanGSIs of female lean and siscowet lake trout at EK sites and fe-male siscowets at WK sites during those months (Figure 3a).

Of the 177 female siscowets collected at EK and WK sitesfrom August to October, 74 (42%) had GSIs less than 3.0; of the106 lean lake trout sampled at EK sites during the same time, 57(54%) had GSIs less than 3.0. Within the September-sampledgroups of lean or siscowet lake trout, those with maturing ovarieswere similar in age to those with nonmaturing ovaries (two-way ANOVA: F1, 70 = 3.8, P = 0.056; Table 3). However,lean lake trout that contained nonmaturing or maturing ovarieswere significantly younger than siscowets with the same ovarymaturation status (two-way ANOVA: F1, 70 = 306.4, P < 0.001).

Ovarian HistologyOocytes varied in size and stage of development among

months. During May, the largest oocytes were primarily in thecortical alveolus and yolk granule stages, and this observationwas similar for both morphotypes (Table 4; Figure 4a, b).Although GSIs of females did not increase in June and July(Figures 2, 3a), more ovaries contained oocytes in the primaryand secondary yolk globule stages during those months (Table4; Figure 4c, d). In August, the ovaries of females with GSIsof 3.0 or greater contained oocytes that were at least 2.0 mm indiameter (Figure 4e). Histology was not performed on ovariescollected during August–October since the oocytes were toolarge and yolky to embed and section (Figure 4f).

TABLE 3. Mean (with 95% confidence interval [CI]) age (years) and totallength (TL; mm) of female lean and siscowet lake trout sampled in Lake Superioreast of the Keweenaw Peninsula during September 2007 and 2008. Females withnonmaturing ovaries had gonadosomatic indices (GSIs) less than 3.0, and thosewith maturing ovaries had GSIs of 3.0 or greater. Mean ages with differentletters are significantly different (two-way ANOVA: F1, 70 = 306.4, P < 0.001).

Without maturing With maturingVariable Statistic ovaries ovaries

Lean lake troutAge Mean 8.8 z 10.2 z

95% CI 7.8–9.7 9.2–11.2TL Mean 618 661

95% CI 603–634 620–702n 22 16

SiscowetsAge Mean 20.7 y 22 y

95% CI 18.5–22.8 20.6–23.5TL Mean 630 663

95% CI 603–657 630–697n 12 23

Dow

nloa

ded

by [

US

Fish

& W

ildlif

e Se

rvic

e] a

t 12:

47 0

7 D

ecem

ber

2011

REPRODUCTIVE BIOLOGY OF SISCOWET AND LEAN LAKE TROUT 1479

FIGURE 2. Frequency distributions of gonadosomatic indices (GSIs) in rela-tion to sampling month for female lake trout in Lake Superior: (a) lean morpho-type sampled east of the Keweenaw Peninsula (EK); (b) siscowet morphotypesampled in the EK area; and (c) siscowet morphotype sampled west of theKeweenaw Peninsula (WK). Circles represent individual GSIs; horizontal linesindicate the GSI value (3.0) used to differentiate fish with maturing versusnonmaturing ovaries. Numbers below the x-axes indicate total sample sizes;numbers above the x-axes indicate sample sizes of fish with GSIs less than 3.0(August–October only).

From August to October, the ovaries of nearly every fish withnonmaturing gonads (GSI < 3.0), regardless of morphotype,contained a proportion of normal (i.e., no signs of degeneration)oocytes in various stages (e.g., Figure 4h: cortical alveolus andyolk granule stages; Figure 5a, b: cortical alveolus stage). Forsiscowets with nonmaturing ovaries, 51% of the normal oocytes

FIGURE 3. (a) Mean (+SD) gonadosomatic indices (GSIs) of female lean laketrout (white bars) and siscowet lake trout (black bars) sampled from Lake Supe-rior east of the Keweenaw Peninsula (EK; May–October) and female siscowets(gray bars) sampled west of the Keweenaw Peninsula (WK; May, August, andOctober). Mean female GSIs for May–July were calculated from all samples,whereas only GSIs greater than or equal to 3.0 were used to compute means forAugust–October. (b) Mean (+SD) GSIs of male lean lake trout (white bars) andsiscowets (black bars) sampled at EK sites (May–October) and male siscowets(gray bars) sampled at WK sites (May, August, and October) are presented.Mean male GSIs for May–July were calculated from all samples, whereas onlyGSIs of 1.0 or greater were used to compute means for August–October. Withina morphotype population, bars with different letters represent significantly dif-ferent means (P < 0.05). Numbers below the bars indicate sample sizes.

were in the cortical alveolus stage, 20% were in the yolk granulestage, 26% were in the primary yolk globule stage, and 3% werein the secondary yolk globule stage. For lean lake trout withnonmaturing ovaries, 66% of the normal oocytes were in thecortical alveolus stage, 21% were in the yolk granule stage, 9%were in the primary yolk globule stage, and 4% were in thesecondary yolk globule stage.

From August to October, many of the fish with nonmatur-ing ovaries also contained degenerating oocytes, most of whichwere large in size (1.5–2.0 mm; Figure 4g, h). Degeneratingoocytes were characterized by a condensed and granulated cy-toplasm and collapsed zonae pellucidae (Figure 4g, h). Amongsiscowets with GSIs less than 3.0, 55% contained ovaries withdegenerating oocytes; among lean lake trout with GSIs less than3.0, 35% contained ovaries with degenerating oocytes. In addi-tion, while difficult to quantify, many of the nonmaturing ovariesof siscowets contained resorbing follicles, some of which were

Dow

nloa

ded

by [

US

Fish

& W

ildlif

e Se

rvic

e] a

t 12:

47 0

7 D

ecem

ber

2011

1480 GOETZ ET AL.

TABLE 4. Percentage of females with ovaries in various stages of oogenesisfor lean and siscowet lake trout sampled in Lake Superior east of the KeweenawPeninsula (EK; stages: CA = cortical alveolus; YG = yolk granule; PYG =primary yolk globule; SYG = secondary yolk globule; TYG = tertiary yolkglobule). See Figure 4 for examples of each oocyte stage. Note that staging wasnot conducted on females with maturing ovaries (gonadosomatic index ≥ 3.0)sampled in August–October; the ovaries could not be processed for histologybecause of the large amount of yolk. Staging of ovaries from siscowets sampledwest of the Keweenaw Peninsula is not presented since only the May samplecould be staged.

Ovarian stage

Month N CA YG PYG SYG TYG

Lean lake trout at EK sitesMay 25 84 12 4 0 0Jun 43 74 6 13 3 3Jul 12 75 0 8 17 0

Siscowets at EK sitesMay 35 58 30 12 0 0Jun 41 50 17 20 13 0Jul 17 63 13 6 19 0

quite large and numerous in histological sections (Figure 5a,b). This phenomenon was observed less frequently in lean laketrout with nonmaturing ovaries.

In all of the ovaries sampled from May to July, the numberof fish that had resorbing or postovulatory follicles (e.g., seeFigure 4a, b) was quantified. The follicles were smaller thanthose described in the nonmaturing ovaries of fish sampled fromAugust to October (e.g., Figure 5a, b). With the exception of fishcontaining nonmaturing ovaries, we did not assess samples forresorbing or postovulatory follicles after July because the sizeof the maturing oocytes (diameter > 2.0 mm) at this time madeit difficult to obtain a sufficient amount of extrafollicular tissuewithin a histological section where these follicles were located.From May to July, postovulatory or resorbing follicles wereobserved in 96% of the siscowets compared with 32% of thelean lake trout.

Estradiol LevelsCirculating E2 levels were relatively low from May to July

in lean and siscowet lake trout but increased significantly duringAugust in lake trout (both morphotypes) with maturing ovaries,coincident with the increase in GSI (Figure 6a). Levels remainedelevated from August to October. As with GSIs, the mean E2levels from August to October (Figure 6a) were computed onlyfor fish with maturing ovaries. The mean E2 levels of femalesthat had nonmaturing ovaries from August to October were lowand, with one exception (August sample of siscowets in the EKarea), were significantly lower than the corresponding levelsfor females with maturing ovaries within a morphotype at eachsampling time (Figure 7a).

Male Gonadosomatic IndicesFrequency plots of the GSIs for individual males across all

samples indicated that there was an increase in the testicularsize of lean and siscowet lake trout sampled at EK sites andsiscowets sampled at WK sites from August to October (Figure8). Statistical analyses indicated that the monthly GSI distri-butions did not deviate from normality (except for the August-sampled siscowets), but the frequency plots (Figure 8) suggestedthat some individuals sampled during August–October did nothave maturing testes; however, the numbers were lower than theobserved number of females with nonmaturing gonads. Thus,we categorized males from August–October samples into twogroupings—those with maturing testes (GSI ≥ 1.0) and thosewithout maturing testes (GSI < 1.0)—based on the GSI dis-tributions from September and October, when the testes of aproportion of the fish were clearly increasing in size. Unlikethe relationship of ovarian GSIs and E2 levels in females, the11-KT levels in males were not correlated with testicular GSIsuntil October (see 11-Ketotestosterone Levels section below);however, scatter plots of individual GSIs as a function of loge

transformed 11-KT levels in October supported the GSI group-ings for maturing and nonmaturing testes (Figure A.2). Of the190 male siscowets that were collected at EK and WK sites fromAugust to October, 36 (19%) had GSIs less than 1.0; of the 123lean lake trout males that were collected at EK sites during thesame period, 25 (20%) had GSIs less than 1.0. Based on onlythe GSIs of fish with maturing testes from August to October,the mean GSIs of male lean and siscowet lake trout in the EKarea and male siscowets in the WK area significantly increasedduring that period (Figure 3b).

Testicular HistologyThe testes of fish sampled in May from EK or WK sites were

primarily filled with spermatogonia that had not yet undergonespermatogenesis (Table 5; Figure 5c). By July, nearly half of themales had testes that had begun spermatogenesis and containedsome spermatocytes (Table 5; Figure 5d). From July to October,development of the testes continued: all stages of spermatoge-nesis were observed by August, and increasing quantities ofmature sperm were observed during September and October(Table 5; Figure 5e–g). Testicular development staged by his-tology was similar across morphotypes from the EK sites andbetween siscowets sampled from the EK and WK sites (Table5). No signs of spermatogenesis were apparent in males that hadGSIs less than 1.0 for either morphotype sampled from Augustto October (Figure 5h).

11-Ketotestosterone LevelsUnlike the E2 levels in females, 11-KT levels in males

remained low during May–August even though the maleGSIs significantly increased in August (Figures 3b, 6b). Mean11-KT levels increased in September but were not significantlydifferent from levels in August. By October, 11-KT levels inmales of both morphotypes were significantly elevated relative

Dow

nloa

ded

by [

US

Fish

& W

ildlif

e Se

rvic

e] a

t 12:

47 0

7 D

ecem

ber

2011

REPRODUCTIVE BIOLOGY OF SISCOWET AND LEAN LAKE TROUT 1481

FIGURE 4. Lake trout ovarian histology: (a) oocytes in the cortical alveolus (CA) stage, depicting CAs in the periphery and postovulatory follicles (Fs); (b)oocytes in the early yolk granule (YG) stage, with pink-stained YGs forming in the periphery (Fs are also shown); (c) oocytes in the beginning of the primaryyolk globule (YGL) stage; (d) oocytes in the secondary YGL stage; (e) YGLs nearly fused in the tertiary YGL stage; (f) ovary of a siscowet lake trout sampled inSeptember, showing oocytes approximately 4 mm in diameter; and (g), (h) degenerating oocytes (DOs) containing collapsed zonae pellucidae (ZP) and normalCA- and YG-stage oocytes in lake trout with nonmaturing ovaries (gonadosomatic indices < 3.0) sampled during August–October.

Dow

nloa

ded

by [

US

Fish

& W

ildlif

e Se

rvic

e] a

t 12:

47 0

7 D

ecem

ber

2011

1482 GOETZ ET AL.

FIGURE 5. Lake trout ovarian and testicular histology: (a), (b) resorbing follicles (RFs) and normal cortical alveolus (CA)-stage oocytes in lake troutwith nonmaturing ovaries (gonadosomatic indices [GSIs] < 3.0) sampled during August–October; (c) stage 1 of spermatogenesis, with testis containing onlyspermatogonia (SG); (d) stage 2 of spermatogenesis, with testis beginning to form spermatocytes (SCs); (e) stage 3 testis exhibiting all stages of spermatogenesis,including SCs, spermatids (STs), and mature sperm (SP); (f) stage 4 testis containing less than 50% SP; (g) stage 5 testis containing greater than 50% SP; and(h) representative nonmaturing testis showing only SG, from a male siscowet lake trout sampled during September (GSI < 1.0; total length = 691 mm; weight =2,525 g).

Dow

nloa

ded

by [

US

Fish

& W

ildlif

e Se

rvic

e] a

t 12:

47 0

7 D

ecem

ber

2011

REPRODUCTIVE BIOLOGY OF SISCOWET AND LEAN LAKE TROUT 1483

TABLE 5. Percentage of males with testes in various stages of spermatoge-nesis for lean and siscowet lake trout sampled in Lake Superior east (EK) andwest (WK) of the Keweenaw Peninsula (stages: 1 = spermatogonia only; 2 =spermatocytes; 3 = all stages of spermatogenesis; 4 = less than 50% maturesperm; 5 = greater than 50% mature sperm). See Figure 5 for examples of eachstage. Testicular staging was conducted on all samples collected in May–July,whereas only males with gonadosomatic indices of 1.0 or greater were used forstaging of August–October testis samples.

Testicular stage

Month N 1 2 3 4 5

Lean lake trout at EK sitesMay 32 100 0 0 0 0Jun 28 52 48 0 0 0Jul 10 55 45 0 0 0Aug 25 22 27 41 11 0Sep 34 13 0 21 58 8Oct 39 12 0 3 44 41

Siscowets at EK sitesMay 49 92 8 0 0 0Jun 27 78 22 0 0 0Jul 15 60 40 0 0 0Aug 14 33 36 30 0 0Sep 27 18 15 33 30 3Oct 45 0 0 14 61 25

Siscowets at WK sitesMay 23 78 22 0 0 0Aug 27 18 18 45 18 0Oct 34 11 0 0 67 22

to May–August levels (Figure 6b). As with females, onlythose males with testicular GSIs of 1.0 or greater were used tocompute the mean 11-KT levels for August–October. Because11-KT levels in maturing fish did not increase during August,the 11-KT levels in males with testicular GSIs less than 1.0 weresignificantly lower than the corresponding levels in fish withmaturing testes only for the September and October samples(Figure 7b).

Pituitary Gonadotropin Beta Subunit Transcript LevelsPortions of the lake trout FSH and LH beta subunit transcripts

were cloned by using RT-PCR. The cloned 412-nucleotide seg-ment of the lake trout FSH beta subunit (GenBank accessionnumber HM057170) that encoded a partial protein of 135 aminoacids was 96% identical to the FSH beta subunit protein of rain-bow trout (NP 001118058). At the nucleotide level, the 412-nucleotide fragment was 95% identical to the correspondingrainbow trout sequence. The cloned 489-nucleotide segment ofthe lake trout LH beta subunit (accession number HM057171)encoded a partial protein of 115 amino acids that was 100%identical to the LH beta subunit protein of coho salmon O.kisutch (AAO72300). At the nucleotide level, the 489-nucleotide

FIGURE 6. Mean (+SD) plasma levels of (a) estradiol-17β (E2) in femalelake trout and (b) 11-ketotestosterone (11-KT) in male lake trout of the leanmorphotype (white bars) and siscowet morphotype (black bars) sampled fromLake Superior east of the Keweenaw Peninsula (EK; May–October) and fe-male and male siscowets (gray bars) sampled west of the Keweenaw Peninsula(WK; May, August, and October). Mean female E2 and male 11-KT levels forMay–July were calculated from all samples, whereas only individuals with ma-turing gonads (females with gonadosomatic indices [GSIs] ≥ 3.0; males withGSIs ≥ 1.0) were used to compute the means for August–October. Within a mor-photype population, bars with different letters represent significantly differentmeans (P < 0.05). Numbers below bars indicate sample sizes.

fragment was 98% identical to the corresponding coho salmonsequence.

Quantitative PCR was performed on beta subunits of both LHand FSH in the pituitaries; however, LH beta subunit transcriptswere only observed in a small number of samples from October,when GSIs were elevated (results not shown). In contrast, FSHbeta subunit transcript was observed at all times, although ageneral pattern in expression was observed wherein the FSHbeta subunit transcript was low in May and June, increased inAugust and September, and then decreased in October (Figure9). The levels of FSH beta messenger RNA were statisticallyhigher in August, September, or both compared with May, June,or both for siscowet females and males in the EK area, forsiscowet males in the WK area, and for lean males in the EKarea. The same monthly trend in FSH beta subunit transcriptexpression was observed in lean females sampled at EK sitesand in siscowet females sampled at WK sites, but the values

Dow

nloa

ded

by [

US

Fish

& W

ildlif

e Se

rvic

e] a

t 12:

47 0

7 D

ecem

ber

2011

1484 GOETZ ET AL.

FIGURE 7. Mean (+SD) plasma levels of (a) estradiol-17β (E2) in femalelake trout and (b) 11-ketotestosterone (11-KT) in male lake trout of the leanmorphotype (white bars) and siscowet morphotype (black bars) sampled fromLake Superior east of the Keweenaw Peninsula (EK; August–October) andfemale and male siscowets (gray bars) sampled west of the Keweenaw Peninsula(WK; August and October). Individuals with nonmaturing gonads are depicted(females with gonadosomatic indices [GSIs] < 3.0; males with GSIs < 1.0).Asterisks indicate significant (P < 0.05) differences from the correspondingmean E2 or 11-KT level (August–October) in Figure 6 (i.e., for individualswith maturing gonads). Within a morphotype population, E2 and 11-KT did notdiffer between samples of individuals with nonmaturing gonads from August toOctober. Numbers below bars indicate sample sizes.

were not significantly different. The FSH beta transcript levelsmeasured from August to October in females with GSIs less than3.0 and males with GSIs less than 1.0 appeared to be lower at alltimes than the corresponding levels in females and males withmaturing gonads (female GSI ≥ 3.0; male GSI ≥ 1.0) within amorphotype per sampling period (compare Figures 9 and 10).However, these differences were not significant, probably as aresult of the small sample sizes used in the comparisons.

FecundityThe average size of fish used in the assessment of fecundity

was similar between morphotypes: mean TL was 663 mm forlean lake trout and 655 mm for siscowets, and mean weight

FIGURE 8. Frequency distribution of gonadosomatic indices (GSIs) in rela-tion to sampling month for male lake trout in Lake Superior: (a) lean morpho-type sampled east of the Keweenaw Peninsula (EK); (b) siscowet morphotypesampled in the EK area; and (c) siscowet morphotype sampled west of theKeweenaw Peninsula (WK). Circles represent individual GSIs; horizontal linesindicate the GSI value (1.0) used to differentiate fish with maturing versusnonmaturing testes. Numbers below the x-axes indicate total sample sizes, andnumbers above the x-axes indicate sample sizes of fish with GSIs less than 1.0.

was 2,590 g for lean lake trout and 2,716 g for siscowets. Theslopes (F1, 38 = 0.02, P = 0.89) and intercepts (F1, 38 = 0.6, P =0.44) for fecundity as a function of log-transformed TL werenot significantly different between lean lake trout and siscowets(Figure 11a). For fecundity as a function of weight, the interceptdid not differ between lean lake trout and siscowets (t1, 38 =1.44, P > 0.15). In a reduced model, the common intercept

Dow

nloa

ded

by [

US

Fish

& W

ildlif

e Se

rvic

e] a

t 12:

47 0

7 D

ecem

ber

2011

REPRODUCTIVE BIOLOGY OF SISCOWET AND LEAN LAKE TROUT 1485

FIGURE 9. Mean (+SD) whole-pituitary follicle stimulating hormone (FSH)beta subunit transcript levels in (a) female lake trout and (b) male lake troutof the lean (white bars) and siscowet (black bars) morphotypes sampled fromLake Superior east of the Keweenaw Peninsula (EK; May–October 2007) andsiscowets (gray bars) sampled west of the Keweenaw Peninsula (WK; May,August, and October 2007). Mean FSH levels for May–June were calculatedfrom all samples, whereas only individuals with maturing gonads (femaleswith gonadosomatic indices [GSIs] ≥ 3.0; males with GSIs ≥ 1.0) were usedto compute the means for August–October. Within a morphotype population,bars with different letters represent significantly different means (P < 0.05).Numbers below bars indicate sample sizes.

was only marginally different from zero (t1, 39 = 2.25, P >

0.03), but a significant difference in slope between lean laketrout and siscowets was detected (F2, 39 = 82.9, P < 0.0001).The final model had an intercept of zero for both lean laketrout and siscowets (Figure 11b). Based on the slopes, relativefecundity was 1,404 eggs/kg (95% confidence interval [CI] =1,250–1,558 eggs/kg) for lean lake trout and 1,167 eggs/kg (95%CI = 1,049–1,286 eggs/kg) for siscowets. The average relativefecundity for lean lake trout was far above the 95% CI forsiscowets, and the average relative fecundity for siscowets wasfar below the 95% CI for lean lake trout. The slight overlapbetween the two CIs occurred because the common intercept ofthe regression lines marginally differed from zero (see reducedmodel above).

DISCUSSIONAlthough a number of studies have reported on the reproduc-

tion of lean lake trout in various North American lakes (sum-marized by Martin and Olver 1980), the current study is the firstto systematically track gonadal development in siscowet lake

FIGURE 10. Mean (+SD) whole-pituitary follicle stimulating hormone (FSH)beta subunit transcript levels for (a) female lake trout with nonmaturing ovaries(gonadosomatic indices [GSIs] < 3.0) and (b) male lake trout with nonmaturingtestes (GSIs < 1.0). Samples represent lean (white bars) and siscowet (blackbars) morphotypes from Lake Superior east of the Keweenaw Peninsula (EK;August–October 2007) and siscowets (gray bars) west of the Keweenaw Penin-sula (WK; August and October 2007). Within a given morphotype population,levels did not differ between sampling times; means also did not differ from thecorresponding values for fish with maturing gonads (August–October; Figure9). Numbers below bars indicate sample sizes.

trout from the same geographic sites over an extended period ofthe year (spring to fall) and to directly compare it with gonadaldevelopment in a lean lake trout population. To assess seasonalchanges in gonadal development, we measured the changes inGSI, gonadal cytology, and reproductive hormone levels. Over-all, our results provide strong evidence that the timing of gonadalmaturation in both female and male siscowets is synchronizedwithin a population; over the 2 years of the study, gonadal matu-ration within the examined lake trout populations occurred fromlate summer to fall, as has been generally observed in other charspecies (brook trout: Tam et al. 1986; de Montgolfier et al. 2009;Arctic char: Frantzen et al. 1997). Further, the results show thatin some Lake Superior populations, the timing of gonadal mat-uration is virtually identical for lean and siscowet lake trout.The results of several studies have suggested that lean and sis-cowet lake trout are genetically distinct (Page et al. 2004; Goetzet al. 2010); therefore, some reduction in gene flow should

Dow

nloa

ded

by [

US

Fish

& W

ildlif

e Se

rvic

e] a

t 12:

47 0

7 D

ecem

ber

2011

1486 GOETZ ET AL.

FIGURE 11. Relationship between total number of eggs and (a) total lengthor (b) weight of mature female lake trout of the lean and siscowet morphotypessampled from Lake Superior east of the Keweenaw Peninsula during Septemberand October 2008.

occur between them. However, the results presented here in-dicate that if the lean and siscowet lake trout populations wesampled are reproductively isolated, the timing of gonad mat-uration is not involved, although the timing of spawning (i.e.,release of gametes) could still be different.

Ripe male and female siscowets (eggs and milt flowingfreely) have been collected in late April from deep water(118–145 m) northeast of the Apostle Islands in Lake Supe-rior (Bronte 1993); the timing indicated in the study by Bronte(1993) is quite different from that presented here. Eschmeyer(1955) reported that three ripe siscowet or humper lake troutwere collected in June off the eastern extremity of Isle Royale(no depth was reported). Further, historical accounts of lake troutin Lake Superior have indicated that siscowets reproduce eitherearlier than lean lake trout (Milner 1874) or at various times ofthe year (Goode 1888; Sweeny 1890). Siscowet females withpostvitellogenic ovaries in prespawning condition and siscowetmales with mature testes have been collected in May off IsleRoyale (100–150-m depth; S. Sitar, unpublished data). Collec-tively, these observations suggest that siscowet populations in

different parts of the lake could have maturation or spawningtimes that differ from those reported here for southern Lake Su-perior. If so, this would be similar to the sympatric populationsof Arctic char morphotypes that spawn in the spring or late win-ter as well as in the fall (Elliot and Baroudy 1995; Klemetsenet al. 1997; Telnes and Saegrov 2004).

In addition to the changes in the GSI, we observed correla-tions between the levels of several reproductive hormones andchanges in GSI. In fact, this study provides the first report ofseasonal changes in the levels of reproductive hormones in wildlake trout. Changes in the circulating levels of E2 in femalelean and siscowet lake trout were very similar to those reportedfor other chars in which the E2 levels increased dramaticallybetween July and August (Tam et al. 1986; Frantzen et al. 1997;Tveiten et al. 1998). Where it was measured, this increase cor-related well with a large increase in ovarian GSI (Tam et al.1986; Frantzen et al. 1997), as was also observed in the presentstudy. However, E2 levels in lake trout appeared to remain ele-vated in October, whereas in Arctic char and brook trout therewas an obvious decrease in E2 levels (Tam et al. 1986; Mayeret al. 1992; Tveiten et al. 1998). In salmonids, estrogen levelsdecrease drastically at the time of oocyte maturation and ovu-lation (Goetz et al. 1987). Thus, the decrease is related to thetiming of oocyte maturation and not just to the time of year. Oursamples did not contain many fish that were undergoing meioticmaturation or that were spent. Thus, because our last samplingwas in October and fish may spawn in November, we may havemissed fish with the low E2 levels that are generally found atthe time of ovulation.

Male lake trout undergoing gonadal maturation had signif-icant increases in circulating 11-KT, the primary androgen insalmonids. However, the timing of the increase in 11-KT didnot directly coincide with the August increase in testicular GSI.The 11-KT levels increased later, in September and October,after the GSI had already increased. This pattern is similar toobservations of captive rainbow trout, which exhibited a sub-stantial increase in testicular GSI and progression of spermato-genesis 2–3 months prior to any significant increase in plasma11-KT levels (Kusakabe et al. 2006). It is also notable that theplasma levels of 11-KT in lake trout were variable and that thepeak mean levels (October) were lower than those reported forcaptive fish. This is probably attributable to the nature of field-sampled animals, which are often less synchronized than captivefish. In brook trout that spawned during November, significantincreases in GSI and plasma 11-KT levels occurred in July,and the mean 11-KT levels peaked in September and declinedat spawning in October and November (de Montgolfier et al.2009). Similar seasonal changes in 11-KT have been reportedfor Arctic char (Mayer et al. 1992; Tveiten et al. 1998), but thosestudies did not report changes in GSI.

We originally wanted to measure circulating levels of FSHand LH, but we could not detect either FSH or LH in thelake trout plasma samples by using immunoassays developedfor coho salmon (P. Swanson, unpublished data). The lack of

Dow

nloa

ded

by [

US

Fish

& W

ildlif

e Se

rvic

e] a

t 12:

47 0

7 D

ecem

ber

2011

REPRODUCTIVE BIOLOGY OF SISCOWET AND LEAN LAKE TROUT 1487

detection of LH in plasma is not surprising because we did notobtain many samples from spawning fish. In salmon and trout,LH levels are generally low or undetectable prior to spawningand then increase at spawning (Prat et al. 1996; Davies et al.1999; Gomez et al. 1999). However, the inability to measureplasma FSH was surprising; this inability was probably not dueto major differences in antigenic sites of the molecules because(1) the beta subunits are highly conserved among salmonids and(2) these assays have been used for both rainbow trout (Davieset al. 1999) and Atlantic salmon Salmo salar (Oppenberntsenet al. 1994). In lieu of plasma hormone levels, we chose to mea-sure pituitary FSH and LH beta subunit transcript levels. Studieshave demonstrated a relationship between transcript levels of theFSH beta subunit and circulating FSH levels in rainbow trout(Gomez et al. 1999), and studies have examined the seasonalchanges in LH and FSH beta subunit transcript levels in dif-ferent fish species (Martyniuk et al. 2009; Mittelholzer et al.2009). Thus, we measured the levels of FSH and LH beta sub-unit transcripts in lake trout pituitaries as an indirect method ofassessing seasonal changes in GTHs. Transcripts for FSH betasubunit were detected in the pituitaries of all fish at all samplingtimes from May to October, whereas LH beta subunit transcriptwas only detected during October and was not detected in allfish. In separate collections, we sampled lean lake trout thatwere caught directly on the spawning shoals, and all of thosefish had measurable levels of LH beta subunit transcript in thepituitary (results not shown). This result is consistent with therole of LH in later stages of oogenesis and spermatogenesis insalmonids (Swanson et al. 2003; Rosenfeld et al. 2007).

One issue with evaluating pituitary hormone transcript datais how best to express it to reflect changes in the pituitary’scapacity to produce and secrete hormones into circulation dur-ing the reproductive cycle. In many studies that have monitoredpituitary hormone content by immunoassay, data are often re-ported per pituitary to fully capture the seasonal changes inhormone production. Similar issues have been described whenmonitoring changes in transcripts for steroidogenic enzymes inthe testes of fish (Kusakabe et al. 2006). When we analyzed thenormalized FSH beta subunit transcript levels from fish sampledduring May–October, we did not observe any seasonal trendsin the means. However, when we adjusted the values on thebasis of the total yield of RNA extracted per pituitary to reflectthe total amount within the entire pituitary, we found that FSHbeta subunit transcript levels peaked in approximately August orSeptember for both sexes within both morphotypes. This peakis consistent with the observed changes in gonadal developmentand plasma sex steroid levels during the same period.

An additional observation from this study was that a propor-tion of female and male lake trout within populations from theEK and WK areas did not undergo gonadal maturation. Thisoccurred in both lean and siscowet lake trout and was obviousin both sexes starting in August, when GSIs increased, thusreflecting gonadal growth. Hence, a certain proportion of theadults within these populations, regardless of morphotype, ap-

parently refrain from spawning in some years. In lake trout,this has been previously referred to as “intermittent spawning”(Martin and Olver 1980) or as fish that were “infertile” (Fry1949). Such an occurrence in fish is now more commonly re-ferred to as “skipped spawning” or as “spawning omission”(Rideout et al. 2005). Investigations on lake trout populationsin several Canadian lakes have suggested that 8–87% of the fe-males in a population may skip spawning (Miller and Kennedy1948; Kennedy 1954; Cuerrier and Schultz 1957; Rawson 1961;Johnson 1972, 1973).

In the current study, 42% of female siscowets and 54% offemale lean lake trout sampled from August to October hadGSIs less than 3.0 and would not have spawned in the fall.Because lean lake trout generally mature at a larger size thansiscowets (S. Sitar, unpublished data), the percentage of leanfemales with nonmaturing gonads is probably inflated by in-cluding fish with GSIs less than 3.0 that were actually immature(had not yet reached puberty) and would not have spawned any-way. Nearly all of the siscowets sampled from May to July thatwere examined histologically contained postovulatory follicles,suggesting that they had prior reproductive activity and there-fore were not immature. However, only 32% of female lean laketrout contained postovulatory follicles during the same time,suggesting that a higher proportion of lean females were imma-ture. Postovulatory follicles in fish ovaries have been described(Saborido-Rey and Junquera 1998; Witthames et al. 2009) andcan be used to track past spawning events. In some fish, such asnorthern anchovy Engraulis mordax, the postovulatory folliclesdo not last very long (Hunter and Goldberg 1980), whereas inAtlantic cod Gadus morhua they can last for 3–5 months afterspawning (Saborido-Rey and Junquera 1998). Given the largesize of lake trout follicles, resorption after spawning or afteroocyte degeneration probably takes a long time, especially forsiscowets since they are mostly demersal and the water temper-atures they experience throughout the year are colder than thoseexperienced by lean lake trout. Whether this might influence thehigher incidence of postovulatory follicles observed in siscowetsversus lean lake trout is unclear. Further, the potential level ofspawning omission in siscowets may be underestimated becauseour sampling protocol was restricted to 550-mm and larger fishand thus may have excluded smaller siscowets that were stillold enough to reproduce. As we observed, siscowets were olderat a given length than lean lake trout. Since younger, maturefish are more likely to skip spawning than older fish (Rideout etal. 2005; Jorgensen et al. 2006; Rideout and Rose 2006), sizecould have influenced our estimate of spawning omission insiscowets.

Relative to females, spawning omission in males is reportedmuch less frequently because of the greater difficulty in visu-ally assessing the reproductive stage of the testes (Miller andKennedy 1948; Johnson 1972). To our knowledge, the onlypast study that specifically addressed spawning omission inmale lake trout was conducted in the Waterton Lakes, Alberta,where 42% of sampled males did not appear to be reproducing

Dow

nloa

ded

by [

US

Fish

& W

ildlif

e Se

rvic

e] a

t 12:

47 0

7 D

ecem

ber

2011

1488 GOETZ ET AL.

(Cuerrier and Schultz 1957), similar to the percentage of fe-males with nonmaturing ovaries in the present study. In ourstudy, 19–20% of the males had nonmaturing testes based onGSI and histology, and this percentage was similar betweenmorphotypes. Among the males sampled from August to Octo-ber, all those with GSIs less than 1.0 had testes that looked thesame macroscopically and histologically and that were com-posed only of spermatogonia, similar to the testes of malessampled in May. However, among females sampled duringAugust–October, those with GSIs less than 3.0 had ovariesthat varied in oocyte development and cytology. Many of thenonmaturing ovaries contained oocytes that were undergoingdegeneration. Curiously, many of these oocytes were relativelylarge (1.5–2.0 mm) and appeared to have reached the yolk glob-ule stage before degenerating. The lower E2 levels in these fishare probably related to the follicular degeneration. Spawningomission has been described for many fishes and appears totake several forms, including retention of fully mature oocytesor ovulated eggs, resorption of oocytes that have begun vitello-genesis (accumulation of yolk protein), and cessation of oocytedevelopment prior to vitellogenesis (Rideout et al. 2005). Basedon this and our observations, we hypothesize that the femalelake trout that exhibit skipped spawning begin to undergo go-nadal maturation, but then the maturational process stops and thelargest oocytes begin to degenerate and to be resorbed. Oocytesin lake trout that were undergoing normal development attaineda diameter of about 2.0 mm at the yolk globule stage in August;thus, the mechanism that activates degeneration and resorptionprobably takes place in July or August.

Currently, management of lake trout in much of the upperGreat Lakes relies on age-structured stock assessment modelsto generate safe harvest limits (e.g., Modeling Subcommittee2009). A key population metric generated by the models isspawning stock biomass per recruit (SSBR). Estimates of SSBRrequire female maturation-at-age schedules, and a failure toaccount for the fraction of mature females that are undergoingspawning omission would lead to overestimation of the SSBRand estimates of safe harvest.

In this study, fecundity of lean and siscowet lake trout wasfound to be similar to historical values (Eschmeyer 1955; Peck1988). Although the siscowet fecundity at size was somewhatcomparable to that observed for lean lake trout, the size-at-agerelationship was drastically different for the two morphotypes.For example, a mature female lean lake trout that is 660 mmwould produce about 3,400 eggs and would be approximately10 years old, whereas a female siscowet of the same size wouldproduce around 2,900 eggs and would be approximately 22years old (Table 3). This clearly illustrates that age is a keyfactor to consider when contrasting the growth or reproductivecapacity of lean and siscowet lake trout.

In conclusion, the observed seasonal changes in GSI, go-nadal histology, and reproductive hormone levels demonstratethat there is little difference in the timing of gonadal maturationbetween lean and siscowet lake trout populations in southern

Lake Superior, suggesting that reproductive timing does notgenetically isolate the morphotypes in these populations. Fur-thermore, not all siscowet or lean lake trout in these populationsreproduce every year, and this finding could have importantimplications for the management of lake trout in Lake Superior.

ACKNOWLEDGMENTSThe crews of the R/V Judy and R/V Lake Char, including

Brandon Bastar, Dawn Dupras, Greg Kleaver, Helen Morales,Kevin Rathbun, Dan Traynor, and Tim Wille, worked extremelyhard in the field collection of fish for this study. Henry Quin-lan and Mark Brouder (Ashland Fish and Wildlife ConservationOffice, U.S. Fish and Wildlife Service) and Bill Mattes (GreatLakes Indian Fish and Wildlife Commission) provided addi-tional and essential field support for collections. This study wassupported by a grant from the Great Lakes Fishery Commis-sion (to F.G., S.S., and C.B.) and by the Michigan Departmentof Natural Resources (Federal Aid in Sport Fish RestorationProject F-81-R). The findings and conclusions in this article arethose of the authors and do not necessarily represent the viewsof the U.S. Fish and Wildlife Service. Reference to trade namesdoes not imply endorsement by the U.S. Government.

REFERENCESBronte, C. R. 1993. Evidence of spring spawning lake trout in Lake Superior.

Journal of Great Lakes Research 19:625–629.Bronte, C. R., M. P. Ebener, D. R. Schreiner, D. S. DeVault, M. M. Petzold,

D. A. Jensen, C. Richards, and S. J. Lozano. 2003. Fish community changein Lake Superior, 1970–2000. Canadian Journal of Fisheries and AquaticSciences 60:1552–1574.

Burnham-Curtis, M. K., and G. R. Smith. 1994. Osteological evidence of geneticdivergence of lake trout (Salvelinus namaycush) in Lake Superior. Copeia1994:843–850.

Burnham-Curtis, M. K., and C. R. Bronte. 1996. Otoliths reveal a diverse agestructure for humper lake trout in Lake Superior. Transactions of the AmericanFisheries Society 125:844–851.

Campbell, B., J. Dickey, B. Beckman, G. Young, A. Pierce, H. Fukada, andP. Swanson. 2006. Previtellogenic oocyte growth in salmon: relationshipsamong body growth, plasma insulin-like growth factor-1, estradiol-17beta,follicle-stimulating hormone and expression of ovarian genes for insulin-like growth factors, steroidogenic-acute regulatory protein and receptors forgonadotropins, growth hormone, and somatolactin. Biology of Reproduction75:34–44.

Chomcynski, P. 1993. A reagent for the single-step simultaneous isolationof RNA, DNA and protein from cell and tissue samples. Biotechniques15:532–537.

Chomcynski, P., and N. Sacchi. 1987. Single-step method of RNA isolationby acid guanidinium thiocyanate-phenol extraction. Analytical Biochemistry162:156–159.

Cuerrier, J.-P., and F. H. Schultz. 1957. Studies on the lake trout and commonwhitefish in Waterton Lakes, Waterton Lakes National Park, Alberta. WildlifeManagement Bulletin 3:1–41.

Cuisset, B., P. Pradelles, D. E. Kime, E. R. Kuhn, P. Babin, S. Davail,and F. Lemenn. 1994. Enzyme-immunoassay for 11-ketotestosterone us-ing acetylcholinesterase as label - application to the measurement of 11-ketotestosterone in plasma of Siberian sturgeon. Comparative Biochem-istry and Physiology C Pharmacology Toxicology & Endocrinology 108:229–241.

Dow

nloa

ded

by [

US

Fish

& W

ildlif

e Se

rvic

e] a

t 12:

47 0

7 D

ecem

ber

2011

REPRODUCTIVE BIOLOGY OF SISCOWET AND LEAN LAKE TROUT 1489

Davies, B., N. Bromage, and P. Swanson. 1999. The brain-pituitary-gonadal axis of female rainbow trout Oncorhynchus mykiss: effects ofphotoperiod manipulation. General and Comparative Endocrinology 115:155–166.

de Montgolfier, B., A. Faye, C. Audet, and D. G. Cyr. 2009. Seasonal variationsin testicular connexin levels and their regulation in the brook trout, Salvelinusfontinalis. General and Comparative Endocrinology 162:276–85.

Elliot, J. M., and E. Baroudy. 1995. The ecology of Arctic charr, Salvelinusalpinus, and brown trout, Salmo trutta, in Windemere (northeast England).Nordic Journal Freshwater Research 71:33–48.

Eschmeyer, P. H. 1955. The reproduction of lake trout in southern Lake Superior.Transactions of the American Fisheries Society 84:47–74.

Eschmeyer, P. H., and A. M. Phillips. 1965. Fat content of the flesh of siscowetsand lake trout from Lake Superior. Transactions of the American FisheriesSociety 94:62–74.

Ewing, B., and P. Green. 1998. Base-calling of automated sequencer traces usingphred II: error probabilities. Genome Research 8:186–94.

Foster, N. R., D. V. O’Connor, and C. B. Schreck. 1993. Gamete ripening andhormonal correlates in 3 strains of lake trout. Transactions of the AmericanFisheries Society 122:252–267.

Fostier, A., B. Jalabert, R. Billard, B. Breton, and Y. Zohar. 1983. The gonadalsteroids. Pages 277–372 in D. J. Randall, W. S. Hoar, and E. M. Donaldson,editors. Fish physiology, volume 9, part A. Academic Press, New York.

Frantzen, M., H. K. Johnsen, and I. Mayer. 1997. Gonadal development andsex steroids in a female Arctic charr broodstock. Journal of Fish Biology51:697–709.

Fry, F. E. J. 1949. Statistics of a lake trout fishery. Biometrics 5:27–67.Goetz, F., D. Rosauer, S. Sitar, G. Goetz, C. Simchick, S. Roberts, R. Johnson,

C. Murphy, C. R. Bronte, and S. MacKenzie. 2010. A genetic basis for thephenotypic differentiation between siscowet and lean lake trout (Salvelinusnamaycush). Molecular Ecology 19(Supplement 1):176–196.

Goetz, F. W., A. Y. Fostier, B. Breton, and B. Jalabert. 1987. Hormonal changesduring meiotic maturation and ovulation in the brook trout (Salvelinus fonti-nalis). Fish Physiology and Biochemistry 3:203–211.

Gomez, J. M., C. Weil, M. Ollitrault, P. Y. Le Bail, B. Breton, and F. Le Gac.1999. Growth hormone (GH) and gonadotropin subunit gene expression andpituitary and plasma changes during spermatogenesis and oogenesis in rain-bow trout (Oncorhynchus mykiss). General and Comparative Endocrinology113:413–28.

Goode, G. B. 1888. American fishes: a popular treatise upon the game and foodfishes of North America with special reference to habitats and methods ofcapture. Standard Book, New York.

Hansen, M. J., C. P. Madenjian, J. H. Selgeby, and T. E. Helser. 1997. Gillnetselectivity for lake trout (Salvelinus namaycush) in Lake Superior. CanadianJournal of Fisheries and Aquatic Sciences 54:2483–2490.

Hansen, M. J., J. W. Peck, R. G. Schorfhaar, J. H. Selgeby, D. R. Schreiner,S. T. Schram, B. L. Swanson, W. R. MacCallum, M. K. Burnham-Curtis,G. L. Curtis, J. W. Heinrich, and R. J. Young. 1995. Lake trout (Salvelinusnamaycush) populations in Lake Superior and their restoration in 1959–1993.Journal of Great Lakes Research 21(Supplement 1):152–175.

Hellqvist, A., M. Schmitz, I. Mayer, and B. Borg. 2006. Seasonal changesin expression of LH-beta and FSH-beta in male and female three-spinedstickleback, Gasterosteus aculeatus. General and Comparative Endocrinol-ogy 145:263–269.

Hesthagen, T., K. Hindar, B. Jonsson, J. O. Ousdal, and H. Holthe. 1995. Effectsof acidification on normal and dwarf Arctic charr Salvelinus alpinus (L) in aNorwegian Lake. Biological Conservation 74:115–123.

Humason, G. L. 1972. Animal tissue techniques. Freeman, San Francisco.Hunter, J. R., and S. R. Goldberg. 1980. Spawning incidence and batch fecun-

dity in northern anchovy Engraulis mordax. U.S. National Marine FisheriesService Fishery Bulletin 77:641–652.

Johnson, L. 1972. Keller Lake: characteristics of a culturally unstressedsalmonid community. Journal of the Fisheries Research Board of Canada29:731–740.

Johnson, L. 1973. Stock and recruitment in some unexploited Canadian Arcticlakes. Conseil International pour l’Exploration de la Mer Extrait des Rapportset Proces-Verbaux 164:219–227.

Jorgensen, C., B. Ernande, O. Fiksen, and U. Dieckmann. 2006. The logic ofskipped spawning in fish. Canadian Journal of Fisheries and Aquatic Sciences63:200–211.

Kagawa, H., K. Takano, and Y. Nagahama. 1981. Correlation of plasmaestradiol-17 beta and progesterone levels with ultrastructure and histochem-istry of ovarian follicles in the white-spotted char, Salvelinus leucomaenis.Cell Tissue Research 218:315–29.

Kennedy, W. A. 1954. Growth, maturity and mortality in the relatively unex-ploited lake trout, Cristivomer namaycush, of Great Slave Lake. Journal ofthe Fisheries Research Board of Canada 11:827–852.

Khan, N. Y., and S. U. Qadri. 1970. Morphological differences in Lake Superiorlake charr. Journal of the Fisheries Research Board of Canada 27:161–167.

Klemetsen, A., P.-A. Amundsen, R. Knudsen, and B. Hermansen. 1997. Aprofundal, winter-spawning morph of Arctic charr Salvelinus alpinus (L.) inLake Fjellfrosvatn, northern Norway. Nordic Journal of Freshwater Research73:13–23.

Korenman, S. G., R. H. Stevens, L. A. Carpenter, M. Robb, G. D. Niswender, andB. M. Sherman. 1974. Estradiol radioimmunoassay without chromatography:procedure, validation and normal values. Journal of Clinical Endocrinologyand Metabolism 38:718–20.

Krueger, C. C., and P. E. Ihssen. 1995. Review of genetics of lake trout inthe Great Lakes: history, molecular genetics, physiology, strain comparisons,and restoration management. Journal of Great Lakes Research 21(Supplement1):348–363.

Kusakabe, M., I. Nakamura, J. Evans, P. Swanson, and G. Young. 2006. Changesin mRNAs encoding steroidogenic acute regulatory protein, steroidogenicenzymes and receptors for gonadotropins during spermatogenesis in rainbowtrout testes. Journal of Endocrinology 189:541–54.

Lawrie, A. H., and J. F. Rahrer. 1973. Lake Superior: a case history of the lakeand its fisheries. Great Lakes Fishery Commission Technical Report 19.

Lubzens, E., G. Young, J. Bobe, and J. Cerda. 2010. Oogenesis in teleosts: howeggs are formed. General and Comparative Endocrinology 165:367–89.

Martin, N. V., and C. H. Olver. 1980. The lake charr, Salvelinus namaycush.Pages 205–277 in E. K. Balon, editor. Charrs: salmonid fishes of the genusSalvelinus. Dr W. Junk, The Hague, The Netherlands.

Martyniuk, C. J., K. J. Kroll, W. F. Porak, C. Steward, H. J. Grier, and N.D. Denslow. 2009. Seasonal relationship between gonadotropin, growth hor-mone, and estrogen receptor mRNA expression in the pituitary gland oflargemouth bass. General and Comparative Endocrinology 163:306–317.

Mayer, I., M. Schmitz, B. Borg, and R. Schulz. 1992. Seasonal endocrinechanges in male and female Arctic charr (Salvelinus alpinus). 1. Plasmalevels of 3 androgens, 17-alpha-hydroxy-20-beta-dihydroprogesterone, and17-beta-estradiol. Canadian Journal of Zoology 70:37–42.

Miller, R. B., and W. A. Kennedy. 1948. Observations on the lake trout of GreatBear Lake. Journal of the Fisheries Research Board of Canada 7:176–189.

Milner, J. W. 1874. The fisheries of the Great Lakes and the species of Coregonusor white fish. Appendix A in Report on the fisheries of the Great Lakes; theresult of inquiries prosecuted in 1871 and 1872. U.S. Commission of Fish andFisheries, Report of the Commissioner for 1872 and 1873, Part II, Washington,D.C.

Mittelholzer, C., E. Andersson, G. L. Taranger, D. Consten, T. Hirai, B.Senthilkumaran, Y. Nagahama, and B. Norberg. 2009. Molecular charac-terization and quantification of the gonadotropin receptors FSH-R and LH-Rfrom Atlantic cod (Gadus morhua). General and Comparative Endocrinology160:47–58.

Modeling Subcommittee. 2009. Technical Fisheries Committee adminis-trative report 2009: status of lake trout and lake whitefish popula-tions in the 1836 treaty-ceded waters of Lake Superior, Huron, andMichigan with recommended yield and effort levels for 2009. Avail-able: www.michigan.gov/documents/dnr/2009-status-report 303561 7.pdf.(November 2010).

Dow

nloa

ded

by [

US

Fish

& W

ildlif

e Se

rvic

e] a

t 12:

47 0

7 D

ecem

ber

2011

1490 GOETZ ET AL.

Moore, S. A., and C. R. Bronte. 2001. Delineation of sympatric morphotypes oflake trout in Lake Superior. Transactions of the American Fisheries Society130:1233–1240.

Nagahama, Y. 1983. The functional morphology of teleost gonads. Pages223–275 in D. J. Randall, W. S. Hoar, and E. M. Donaldson, editors. Fishphysiology, volume 9, part A. Academic Press, New York.

Oppenberntsen, D. O., S. O. Olsen, C. J. Rong, G. L. Taranger, P. Swanson, andB. T. Walther. 1994. Plasma levels of eggshell zr-proteins, estradiol-17-beta,and gonadotropins during an annual reproductive-cycle of Atlantic salmon(Salmo salar). Journal of Experimental Zoology 268:59–70.

Page, K. S., K. T. Scribner, and M. Burnham-Curtis. 2004. Genetic diversityof wild and hatchery lake trout populations: relevance for management andrestoration in the Great Lakes. Transactions of the American Fisheries Society133:674–691.

Peck, J. W. 1988. Fecundity of hatchery and wild lake trout in Lake Superior.Journal of Great Lakes Research 14:9–13.

Planas, J. V., J. Athos, F. W. Goetz, and P. Swanson. 2000. Regulation of ovar-ian steroidogenesis in vitro by follicle-stimulating hormone and luteinizinghormone during sexual maturation in salmonid fish. Biology of Reproduction62:1262–1269.

Planas, J. V., and P. Swanson. 1995. Maturation-associated changes in the re-sponse of the salmon testis to the steroidogenic actions of gonadotropins(GTH-I and GTH-II) in vitro. Biology of Reproduction 52:697–704.

Prat, F., J. P. Sumpter, and C. R. Tyler. 1996. Validation of radioimmunoassaysfor two salmon gonadotropins (GTH I and GTH II) and their plasma concen-trations throughout the reproductive cycle in male and female rainbow trout(Oncorhynchus mykiss). Biology of Reproduction 54:1375–82.

Rahrer, J. F. 1965. Age, growth, maturity, and fecundity of “humper” lake trout,Isle Royale, Lake Superior. Transactions of the American Fisheries Society94:75–83.

Rawson, D. S. 1961. The lake trout of Lac la Ronge, Saskatchewan. Journal ofthe Fisheries Research Board of Canada 18:423–462.

Rideout, R. M., and G. A. Rose. 2006. Suppression of reproduction in Atlanticcod Gadus morhua. Marine Ecology Progress Series 320:267–277.

Rideout, R. M., G. A. Rose, and M. P. M. Burton. 2005. Skipped spawning infemale iteroparous fishes. Fish and Fisheries 6:50–72.

Rosenfeld, H., I. Meiri, and A. Elizur. 2007. Gonadotropic regulation of oocytedevelopment. Pages 175–202 in P. Babin, J. Cerda, and E. Lubzens, edi-tors. The fish oocyte: from basics to biotechnological applications. Springer,Dordrecht, The Netherlands.

Saborido-Rey, F., and S. Junquera. 1998. Histological assessment of variationsin sexual maturity of cod (Gadus morhua L.) at the Flemish Cap (north-westAtlantic). ICES Journal of Marine Science 55:515–521.

Sandlund, O. T., K. Gunnarsson, P. M. Jonasson, B. Jonsson, T. Lindem, K.P. Magnusson, H. J. Malmquist, H. Sigurjonsdottir, S. Skulason, and S. S.Snorrason. 1992. The Arctic charr Salvelinus alpinus in Thingvallavatn. Oikos64:305–351.

Schulz, R. 1984. Serum levels of 11-oxotestosterone in male and 17beta-estradiol in female rainbow trout (Salmo gairdneri) during the first repro-ductive cycle. General and Comparative Endocrinology 56:111–120.

Schulz, R. W., L. R. de Franca, J. J. Lareyre, F. Legac, H. Chiarini-Garcia,R. H. Nobrega, and T. Miura. 2010. Spermatogenesis in fish. General andComparative Endocrinology 165:390–411.

Sitar, S. P., and J. X. He. 2006. Growth and maturity of hatchery and wild leanlake trout during population recovery in Michigan waters of Lake Superior.Transactions of the American Fisheries Society 135:915–923.

Sohn, Y. C., Y. Yoshiura, M. Kobayashi, and K. Aida. 1999. Seasonal changesin mRNA levels of gonadotropin and thyrotropin subunits in the gold-fish, Carassius auratus. General and Comparative Endocrinology 113:436–444.

Sower, S. A., and C. B. Schreck. 1982. Steroid and thyroid hormones duringsexual maturation of coho salmon (Oncorhynchus kisutch) in seawater andfreshwater. General and Comparative Endocrinology 47:42–53.

Stauffer, T. M., and J. W. Peck. 1981. Morphological characteristics of juvenilelake trout of various races. Michigan Department of Natural Resources, Study408, Final Report, Lansing.

Swanson, P. 1991. Salmon gonadotropins: reconciling old and new ideas. Pages2–7 in A.P. Scott, J. P. Sumpter, D. E. Kime., and M. S. Rolf, editors. Repro-ductive physiology of fish. FishSymp91, Sheffield, UK.

Swanson, P., J. T. Dickey, and B. Campbell. 2003. Biochemistry and physiologyof fish gonadotropins. Fish Physiology and Biochemistry 28:53–59.

Sweeny, R. O. S. 1890. The siskiwit. Transactions of the American FisheriesSociety 19:84–86.

Tam, W. H., R. J. J. Roy, and R. Makaran. 1986. Ovarian cycle and plasma con-centrations of estrogen and vitellogenin in brook trout (Salvelinus fontinalis,Mitchell). Canadian Journal of Zoology 64:744–751.

Telnes, T., and H. Saegrov. 2004. Reproductive strategies in two sympatricmorphotypes of Arctic charr in Kalandsvatnet, west Norway. Journal of FishBiology 65:574–579.

Tveiten, H., I. Mayer, H. K. Johnsen, and M. Jobling. 1998. Sex steroids, growthand condition of Arctic charr broodstock during an annual cycle. Journal ofFish Biology 53:714–727.

Witthames, P. R., A. Thorsen, H. Murua, F. Saborido-Rey, L. N. Greenwood,R. Dominguez, M. Korta, and O. S. Kjesbu. 2009. Advances in methodsfor determining fecundity: application of the new methods to some marinefishes. U.S. National Marine Fisheries Service Fishery Bulletin 107:148–164.

Young, G., P. M. Lokman, M. Kusakabe, I. Nakamura, and F. W. Goetz. 2005.Gonadal steroidogenesis in teleost fish. Pages 155–223 in C. Hew, editor.Hormones and their receptors in fish reproduction: molecular aspects of fishand marine biology. World Scientific Press, Hackensack, New Jersey.

Zhao, S., and R. D. Fernald. 2005. Comprehensive algorithm for quantita-tive real-time polymerase chain reaction. Journal of Computational Biology12:1047–64.

Dow

nloa

ded

by [

US

Fish

& W

ildlif

e Se

rvic

e] a

t 12:

47 0

7 D

ecem

ber

2011

REPRODUCTIVE BIOLOGY OF SISCOWET AND LEAN LAKE TROUT 1491

APPENDIX: RELATIONSHIPS BETWEEN THEGONADOSOMATIC INDEX AND GONADAL STEROIDS

FIGURE A.1. Scatter plot of the gonadosomatic index (GSI) versus loge trans-formed estradiol-17β (ng/mL) for female lake trout sampled in Lake Superiorduring August–October: (a) lean morphotype sampled east of the KeweenawPeninsula (EK); and (b) siscowet morphotype sampled from the EK area andwest of the Keweenaw Peninsula (WK). Horizontal lines indicate the GSI value(3.0) used to differentiate fish with maturing versus nonmaturing ovaries.

FIGURE A.2. Scatter plot of the gonadosomatic index (GSI) versus loge

transformed 11-ketotestosterone (ng/mL) for male lake trout sampled in LakeSuperior during October: (a) lean morphotype sampled east of the KeweenawPeninsula (EK); and (b) siscowet morphotype sampled from the EK area andwest of the Keweenaw Peninsula (WK). Lines indicate the GSI value (1.0) usedto differentiate fish with maturing versus nonmaturing testes.D

ownl

oade

d by

[U

S Fi

sh &

Wild

life

Serv

ice]

at 1

2:47

07

Dec

embe

r 20

11