the rho kinase pathway regulates mouse adult neural precursor cell migration

TISSUE-SPECIFIC STEM CELLS

The Rho Kinase Pathway Regulates Mouse Adult Neural

Precursor Cell Migration

SOO YUEN LEONG, CLARE H. FAUX, ALISA TURBIC, KIRSTY J. DIXON, ANN M. TURNLEY

Centre for Neuroscience, The University of Melbourne, Victoria, Australia

Key Words. Rho-dependent kinase • Polysialated-NCAM • Subventricular zone • Neural stem cell • Rostral migratory stream • Rac1

ABSTRACT

Adult neural precursor cells (NPCs) in the subventricularzone (SVZ) normally migrate via the rostral migratorystream (RMS) to the olfactory bulb (OB). Following neu-ral injury, they also migrate to the site of damage. Thisstudy investigated the role of Rho-dependent kinase(ROCK) on the migration of NPCs in vitro and in vivo. In

vitro, using neurospheres or SVZ explants, inhibition ofROCK using Y27632 promoted cell body elongation, pro-

cess protrusion, and migration, while inhibiting NPC chainformation. It had no effect on proliferation, apoptosis, ordifferentiation. Both isoforms of ROCK were involved.

Using siRNA, knockdown of both ROCK1 and ROCK2was required to promote NPC migration and morphologi-cal changes; knockdown of ROCK2 alone was partially

effective, with little/no effect of knockdown of ROCK1

alone. In vivo, infusion of Y27632 plus Bromodeoxyuridine(BrdU) into the lateral ventricle for 1 week reduced thenumber of BrdU-labeled NPCs in the OB compared withBrdU infusion alone. However, ROCK inhibition did notaffect the tangential-to-radial switch of NPC migration, aslabeled cells were present in all OB layers. The decrease

in NPC number at the OB was not attributed to adecrease in NPCs at the SVZ. However, ROCK inhibition

decreased the density of BrdU-labeled cells in the RMSand increased the distribution of these cells to ectopicbrain regions, such as the accessory olfactory nucleus,

where the majority differentiated into neurons. These find-ings suggest that ROCK signaling regulates NPC migra-tion via regulation of cell-cell contact and chain migration.

STEM CELLS 2011;29:332–343

Disclosure of potential conflicts of interest is found at the end of this article.

INTRODUCTION

Adult neural precursor cells (NPCs) are predominantly locatedin the subventricular zone (SVZ) of the lateral ventricles or inthe subgranular zone of the dentate gyrus. The SVZ NPCs pro-duce neuroblasts that normally migrate along the rostral migra-tory stream (RMS) and integrate into the olfactory bulb (OB)but following central nervous system (CNS) damage NPCs canalso migrate from the SVZ to the site of damage [1, 2].

For appropriate migration to the correct site, cell adhe-sion/traction, competency to migrate, and ability to respond todirectional signals is required. For NPCs, molecules such asintegrins [3, 4] and cell adhesion molecules, such as the NPCmarker, polysialated neural cell adhesion molecule (PSA-NCAM) [5–11], are involved in providing the framework formigration, whereas a number of growth factors, such as epi-dermal growth factor (EGF) confer the capacity for migration[12, 13]. These factors make the cells competent to migrateand may be permissive factors allowing NPCs to respond todirectional cues. Directional migration cues, which are rele-vant following neural injury, include members of the chemo-kine family, such as CXCL12/CXCR4 [14–16]. Axon guid-ance molecules, such as Slits [17, 18] and other factors [19,

20], also play a role in the directed NPC migration along theRMS, along with chemoattractive agents secreted from theOB such as sonic hedgehog [21] or secreted or membrane-bound factors on the astrocytic glial tube that surrounds theNPCs in the RMS [22, 23].

NPC intrinsic molecules, such as PSA-NCAM also regu-late how NPCs respond to external cues. Removal of PSAfrom NCAM molecules resulted in dispersion of chains intoindividual cells, suggesting that PSA is required to maintainthe chains of neuroblasts within the RMS [24]. PSA acts likea repulsive agent to lower cell adhesion of NCAM and createsa permissive environment for cell translocation. The absenceof PSA enhances cell adhesions via various molecules such asNCAM, L1, integrins, and cadherins [25–28].

Therefore, there are many external influences that modulate theability of a NPC to migrate to the correct site, under normal physio-logical conditions or after neural injury. However, at the level of theindividual NPC, these signals must be integrated to produce theappropriate response. Candidates for such regulatory roles includemembers of the Rho-GTPase family of molecules, such as Rho andRac1, which translate external signals into alterations in cytoskeletalreorganization and hence have the ability to influence migration. Alarge body of literature has characterized the cellular mechanismsand signal transduction pathways of Rho, Rho-dependent kinase

Author contributions: S.Y.L.: conception and design, collection and assembly of data, data analysis and interpretation, manuscriptwriting; C.H.F. and A.T.: collection and assembly of data, data analysis and interpretation; K.J.D.: collection of data; A.M.T.:conception and design, financial support, data analysis and interpretation, manuscript writing, final approval of manuscript.

Correspondence: Ann M. Turnley, Ph.D., Centre for Neuroscience, The University of Melbourne, Victoria 3010, Australia. Telephone:613-8344-3981; Fax: 613-9349-5917; e-mail: [email protected] Received February 2, 2010; accepted for publication November19, 2010; first published online in STEM CELLS EXPRESS December 9, 2010. VC AlphaMed Press 1066-5099/2009/$30.00/0 doi: 10.1002/stem.577

STEM CELLS 2011;29:332–343 www.StemCells.com

(ROCK) and related regulatory members, such as Rac and PI3K, oncellular motility and chemotaxis in various cell types [29–36].

We hypothesized that targeting these pathways would al-ter NPC migration under basal conditions and could be attrac-tive therapeutic targets following neural injury to increasenumbers of NPCs at the injury site to aid repair. There arespecific inhibitors of Rho and Rac1 pathways, some of whichare currently in clinical use. Inhibitors of ROCK, the majordownstream mediator of Rho-GTPase activation, such asY27632 and HA1077 (Fasudil), have shown promise as pro-moters of neural repair. HA1077 is in clinical use for manag-ing cerebral vasospasm associated with subarachnoid hemor-rhage and is under clinical trial for acute ischemic stroke[37], among other conditions. Application of Y27632 has alsobeen investigated for promotion of neurite outgrowth and axo-nal regeneration [38–45] and inactivation of Rho or ROCKsignaling promoted functional recovery and/or axonal regener-ation after neural injuries [46–48].

Here, we have examined the roles of Rho-GTPases onadult mouse SVZ-derived NPC migration using three models.In vitro, preliminary screening and quantitation of the effectsof Rho-GTPase inhibitors was performed on neurospheres,which showed that inhibition of the Rho pathway markedlyenhanced, and inhibition of the Rac1 pathway markedly inhib-ited NPC migration. In terms of potential therapeutic useful-ness, inhibition of the Rho pathway was chosen for furtheranalysis. Enhanced migration in the presence of Y27632 wasfirst confirmed in vitro using SVZ explants and then tested invivo. Infusion of Y27632 into the lateral ventricle had noeffect on numbers of NPCs in the SVZ, but decreased num-bers of newborn cells in the OB and decreased NPC densityin the RMS, with increased numbers of newborn neurons inectopic sites, such as accessory olfactory nucleus (AON).

MATERIALS AND METHODS

Mice

All use of experimental animals was approved by the AnimalExperimentation Ethics Committee of the University ofMelbourne. All procedures were conducted in strict accordancewith the National Health and Medical Research Council of Aus-tralia guidelines.

Rho-GTPase Inhibitors

The ROCK inhibitors Y27632 (Sigma, Sydney, Australia,www.sigmaaldrich.com) and HA1077 (Upstate [Millipore], NSW,Australia, www.millipore.com) and the Rac1 inhibitor (Merck,Kilsyth, Victoria, www.merck.com) were dissolved in water andthe PI3K inhibitor LY294002 (Merck) in DMSO (Sigma) di-methyl sulfoxide (DMSO) (0.1%) was used as a control forLY294002 addition. The inhibitors were used at the concentra-tions as indicated in the results.

Neurosphere Assays

Neurosphere cultures were established from the anterior SVZ of6- to 8-week-old male C57BL/6 mice (Biomedical Animal Facil-ity, The University of Melbourne) and cultured in complete neu-rosphere medium containing 20 ng/ml EGF (PeproTech, Austra-lian Laboratory Services, Sydney, Australia, www.peprotech.com)and 10 ng/ml fibroblast growth factor-2 (FGF2) (PeproTech), aspreviously described [49]. The cultures were used for experimentsat 5–6 days in vitro (DIV) between passages 1–5.

Neurospheres were plated on fibronectin (Chemicon, Teme-cula, California, www.chemicon.com) in complete neurospheremedium/EGF/FGF2 and treated with inhibitors for migration, pro-liferation, differentiation, and apoptosis analyses. Neurospheres

that were >100 lm or <80 lm in diameter were excluded fromthe assays. A migrating neurosphere was defined as when theneurosphere was completely dispersed (indistinguishable center ofthe sphere) at 24 hours. Migration was assessed by (a) the extentof cell migration (area of migration), (b) the extent of cell distri-bution (minimum distance of closest cells measured from the nu-cleus), and (c) the density of cell distribution (number of neigh-boring cells within 20-lm radius of each cell). The measurementof area of migration was performed using ImageJ (Wayne Ras-band, NIH) and the macro ‘‘Hull and Circle’’ (NIH) written byAudre Karperien, Charles Sturt University, Australia and ThomasR. Roy, University of Alberta, Canada. A second macro, writtenby Tet Woo Lee, University of Auckland, New Zealand. (e-mail:tw. [email protected]) and based on the Euclidean DistanceAlgorithm, was used with ImageJ (NIH) for the minimum dis-tance and cell density analyses. Data were collected from threeindependent experiments, with a minimum of 35 neurospheresper treatment group for each migration experiment. For prolifera-tion and apoptosis assays, the percent of Ki67- or cleaved cas-pase-3-positive cells was determined from 10 nonoverlappingfields, with at least triplicate wells per condition from three inde-pendent experiments.

siRNA Knockdown of ROCK

ROCK1 and ROCK2 expression was downregulated in neuro-spheres using siRNA. siRNAs targeting ROCK1 or ROCK2 werepurchased from Invitrogen: (Melbourne, Australia, www.invitro-gen.com) Rock1 Stealth Select RNAi 3 siRNA Set (MSS208676;MSS208677; MSS276868) and Rock2 Stealth Select RNAi 3siRNA Set (MSS208679; MSS208680; MSS 208681). These wereused as pooled 40 nM sets: ROCK1 or ROCK2 sets alone (eachindividual siRNA at 13.3 nM) or ROCK1 and ROCK2 sets com-bined (each individual siRNA at 6.6 nM). The negative controlsiRNA (Stealth RNAi siRNA Negative Control Med GC; Invitro-gen) was also used at 40 nM. Additionally, all transfectionsincluded 40 nM BLOCKiT Alexa Fluor Red Fluorescent ControlRNA (Invitrogen) to allow detection of transfected cells. Neuro-spheres were dissociated as for passaging, then transfected usingAmaxa nucleofection with mouse NSC nucleofector solution,essentially according to the manufacturer’s instructions (Lonza,Switzerland, www.lonzabio.com), with modifications to increasecell survival and transfection efficiency [50]. Cells were growninto neurospheres, plated onto fibronectin-coated 24-well plates,and assessed in the migration assay, as above or RNA wasextracted.

SVZ Explant Cultures

Cultures of SVZ explants were established from postnatal 3-day-old C57BL/6 pups. SVZ tissue at 2.10- to 2.20-mm Bregma wasdissected, placed in ice-cold undiluted growth factor reducedMatrigel (Becton-Dickinson, North Ryde, Australia, www.bd.com), and overlaid with Neurobasal medium containing B27 sup-plement (Invitrogen) and 0.5 mM glutamine, with or without 5lM or 50 lM Y27632 for 24 hours. The patterns of explantmigration were categorized into (a) chain migration, which wasdefined by the formation of cell chains consisting of three ormore cells with contacting cell bodies exiting the explants or (b)dispersed migration, which was defined by dissociated cellsmigrating individually from the explants. The pattern of migra-tion was expressed as a percent of total number of explantsexhibiting each type of migration pattern from three independentexperiments, with a minimum of triplicate wells per treatmentgroup for each experiment.

Lateral Ventricle Infusion

Brain infusion cannulae and Alzet osmotic pumps (Model 1007D,0.5 ll/hr, 7-day duration; BioScientific, NSW, Australia, www.alzet.com) were used. Control mice were infused with bromo-deoxyuridine (BrdU; 10 mg/ml) and treated mice were infusedwith BrdU plus Y27632 (100 lM). Adult mice were anesthetized

Leong, Faux, Turbic et al. 333

www.StemCells.com

with an intraperitoneal injection of 120 mg/kg Ketamil (Keta-mine Hydrochloride, Troy Laboratories, Smithfield, NSW,www.troylab.com.au) and 16 mg/kg Xylazil (Xylazine Hydro-chloride, Troy Laboratories). Using aseptic techniques, cannulaewere inserted into the right lateral ventricle (0.0-mm Bregma,0.8-mm medial-lateral, 2.5-mm deep). Animals were given anal-gesia (Metacam, Boehringer Ingelheim, North Ryde, Australia,www.boehringer-ingelheim.com) in drinking water for 48 hourspostsurgery. The infusion assembly was left in place for 7 daysor 1 month, and then the brains were removed for analysis.

Tissue Preparation

Mice were anesthetized with 100 mg/kg of sodium pentobarbi-tone (Lethabarb, Virbac, Milperra, Australia, www.virbac.com.au)and perfused transcardially. Brains were removed and postfixedin 4% paraformaldehyde overnight then cyroprotected in sucrose.Whole brains were frozen in Tissue-Tek optimal cutting tempera-ture compound (OCT; Sakura-Finetek, The Netherlands, www.sakuraeu.com), and 10-lm coronal sections were collected at thelevel of OB (3.5- to 4.0-mm Bregma), RMS (2.5- to 3.0-mmBregma), anterior SVZ (1.0 to �0.5 mm Bregma), and the infu-sion site (0.2 to �0.2 mm Bregma) for analysis. Coordinatesaccording to [51].

Immunochemistry

For fluorescence immunocytochemistry, neurospheres were para-formaldehyde-fixed and blocked with 5% v/v goat serum alone orwith 0.2% v/v Triton-X 100 (Sigma) in phosphate-buffered saline(PBS). Neurospheres were incubated with rabbit anti-Ki67 (Labvision, Fremont, CA, www.labvision.com), rabbit-cleaved cas-pase-3 (Cell Signaling, Arundel, Australia, www.cellsignal.com),mouse anti-bIII-tubulin (Promega, Madison WI, www.promega.

com), rabbit antiglial fibrillary acidic protein (GFAP) (Dako, Car-pentaria, CA, www.dako.com) or rabbit anti-ROCK1 (Santa Cruz,CA, www.scbt.com) overnight and then goat anti-rabbit Cy2 oranti-mouse Cy3 (Jackson ImmunoResearch, West Grove, PA,www.jacksonimmuno.com), or donkey anti-rabbit Alexa488 (Invi-trogen) for 1-hour. For ROCK2 immunostaining with goat anti-ROCK2 (Santa Cruz) and donkey anti-goat Cy2 (Jackson Immu-noresearch), neurospheres were fixed in methanol. All cultureswere counterstained with 40,6-diamidino-2-phenylindole (DAPI).

For peroxidase immunohistochemistry, cryosections were post-fixed for 10 minutes, endogenous peroxidases inhibited in 0.3% v/v H2O2 in methanol for 30 minutes, the DNA denatured by 20minutes in 2 N HCl at 37�C. Sections were blocked with 5% v/vdonkey serum (Invitrogen) and 0.2% v/v Triton-X 100 in PBS andincubated with sheep anti-BrdU overnight (Exalpha Biologicals,MA, www.exalpha.com) followed by biotinylated rabbit anti-sheep(Vector Laboratories, Burlingame, CA) for 1 hour. Sections wereincubated with ABC solution (Vector Laboratories, Burlingame,CA, www.vectorlabs.com) for 30 minutes, then washed and devel-oped in diaminobenzidine liquid chromogen (Dako, Carpentaria,California). Sections were coverslipped in DPX (Merck). For fluo-rescent BrdU immunohistochemistry, the H2O2 incubation stepwas omitted and donkey anti-sheep Cy3 or Alexa488 (JacksonImmunoResearch) was used, with rabbit anti-GFAP (Dako), mouseanti-NeuN (Millipore) or rat anti-CD11b (Millipore), and donkeyanti-rabbit Alexa488 (Molecular Probes, Invitrogen), goat anti-mouse Cy3, or anti-rat Cy3 (Jackson ImmunoResearch).

BrdU1 Cell Number Analysis

The number of BrdUþ cells was determined from cryosections atleast 100-lm apart, at the level of OB, RMS, anterior SVZ, andthe infusion site. BrdUþ cell counts were performed in defined

Figure 1. Effects of Rho-GTPase inhibitors on neural precursor cell (NPC) morphology, proliferation, and survival. (A): Untreated NPCsmigrated as interconnected cells with lamellipodia. (B): Y27632-treated NPCs showed thinning of cell bodies and decreased lamellipodia, with‘‘growth cone-like’’ protrusions at the leading tips of the cells (arrows in [B0]). (C): Rac1 inhibitor-treated NPCs showed reduced membrane pro-trusion and did not migrate away from the neurosphere. (D): LY294002-treated NPCs showed predominantly rounded cell bodies, with limitedlamellipodia. DAPI-stained nuclei of (E) control, (F) Y27632, (G) Rac inhibitor, and (H) LY294002-treated cells. Scale bar ¼ 100 lm (A–D);25 lm (B0); 200 lm (E–H). There were no differences in (I) number of cells per neurosphere, (J) proliferation, and (K) apoptosis. Mean 6SEM of n ¼ 3 independent experiments. Abbreviations: DMSO, dimethyl sulfoxide; DAPI, 40,6-diamidino-2-phenylindole.

334 ROCK Regulates Adult NPC Migration

regions and the area of each region was measured. Results wereexpressed as cells per millimeter square. At the OB, differentregions (granular, mitral, external plexiform, and periglomerularcell layers) were analyzed separately. The SVZ was defined asthe entire lateral wall of the lateral ventricle, including the dor-sal-lateral segment. Analysis of the RMS included determiningthe density of BrdUþ cells and the number of neighboring cellswithin 20 lm of each individual cell within one 250 � 250-lmregion of the RMS in each section (n ¼ 8 sections per animal).At the level of the RMS, the number of BrdUþ cells in the AONand anterior cortex was also determined (n � 30 sections per ani-mal). For analysis at 1 week, four control and five treated animalswere examined. For analysis at 1 month, three control and twotreated animals examined and the investigator was blind to treat-ment. Area measurements were performed using AxioVision v3.1image analysis program (Zeiss, North Ryde, Australia,www.zeiss.com.au).

Reverse Transcription Polymerase Chain Reaction

Total RNA was extracted from neurospheres using a total RNApurification kit according to the manufacturer’s instructions (QIA-GEN, Doncaster, Australia, www.qiagen.com). Total RNA wasreverse transcribed into cDNA using SuperScript III first-strandsynthesis system (Invitrogen) and polymerase chain reaction(PCR) was performed using ROCK1 forward 50ATGTCGACTGGGGACAGTTTTG30 and reverse 50CATCACCGCCTTGGGATTTTAA30 primers, ROCK2 forward 50GATGGCTTAAATTCCTTGGTCC30 and reverse 50GAGCTGCCGTCTCTCTTATGTT30 primers, b-actin forward 50CTGAAGTACCCCATTGAACATGGC30 and reverse 50CAGAGCAGTAATCTCCTTCTGCAT30

primers and glyceraldehyde 3-phosphate dehydrogenase(GAPDH) forward 50GGTGAAGGTCGGTGTGAACG30 andreverse 50TTGGCTCAACCCTTCAAGTGG30 primers. Theannealing temperature for PCR was 58�C and performed for 25cycles. Gels were imaged and digitized using gel documenta-tion equipment (Fuji LAS3000, Fujifilm, Sydney, Australia,www.fujifilm.com.au) band intensity calculated using Image J(NIH) software and normalized to actin or GAPDH.

Statistics

All data were presented as mean 6 SEM and statistical analyseswere performed using GraphPad Prism v4.03 (GraphPad Soft-ware, Inc., San Diego, CA, www.graphpad.com) with p < .05considered statistically significant. For in vitro experiments, com-parisons between groups were analyzed using analysis of variance(ANOVA), with Dunnett’s test for migration assays and Tukey’stest for proliferation, apoptosis, and explant assays. For in vivoexperiments, data were analyzed using the unpaired t test.

RESULTS

ROCK, Rac1, and PI3K Inhibitors Affected theMorphology of NPCs In Vitro

Neurospheres were plated onto fibronectin with ROCK, Rac1,and PI3K inhibitors. Untreated NPCs had lamellipodia andmigrated as sheets of interconnected cells (Fig. 1A). Treat-ment with Y27632 for ROCK inhibition promoted an elon-gated, mostly bipolar shape (Fig. 1B), with ‘‘growth cone-

Figure 2. The effect of ROCK, Rac1, and PI3K inhibition on NPC migration. The extent of NPC migration was assessed by analysis of thespread of DAPI-stained nuclei. (A, B, C): The area covered by the migrating cells, (A0, B0, C0) the number of neighboring NPCs with a 20-lmradius of each cell (cell density), and (A00, B00, C00) the minimum distance between neighboring cells. Results were normalized as a percentage ofcontrol untreated values and show the mean 6 SEM of n ¼ 3 independent experiments. *, p < .05; **, p < .01; ***, p < .001. Abbreviations:DMSO, dimethyl sulfoxide; DAPI, 40,6-diamidino-2-phenylindole; NPCs, neural precursor cells; Unt, untreated.


www.StemCells.com

like’’ lamellipodial formations restricted to the tips of theleading edges (Fig. 1B0). ROCK inhibition significantlyreduced the membrane contact between the migratory NPCsand promoted single-cell migration. In contrast, few, if any,Rac1 inhibitor-treated NPCs migrated away from the neuro-spheres (Fig. 1C). Rac1 inhibition reduced lamellipodial for-mation and maintained high cell-cell contact. Treatment withLY294002 to inhibit PI3K also reduced lamellipodial forma-tion (Fig. 1D), but did not interfere with NPC migration.

The morphological changes were reflected in the ‘‘close-ness’’ of NPC association in the plated neurospheres, asassessed by DAPI labeling of nuclei (Fig. 1E–1H). ROCK in-hibition showed the loosest NPC association (Fig. 1F) com-pared with control neurospheres (Fig. 1E), whereas Rac1 in-hibitor treated NPCs were closely associated (Fig. 1G) andLY294002 had little effect (Fig. 1H). There were no signifi-

cant differences in the size or density of the neurospheresbetween the treatment groups (Fig. 1I). In addition, none ofthe treatments significantly affected NPC proliferation (Fig.1J) or apoptosis (Fig. 1K) under these conditions. Addition-ally, they did not affect NPC differentiation into bIII-tubulinexpressing neurons or GFAP-expressing astrocytes (data notshown). This suggested that the varying degrees of ‘‘close-ness’’ were likely a reflection of effects on cell-to-cell associ-ation and/or migration.

ROCK Inhibition Increased and Rac1 InhibitionDecreased NPC Migration In Vitro

To examine the degree of cell association, the area of themigrated cells within a neurosphere, the density of NPCs withina 20-lm radius of each cell, and the minimum distance betweencells in each neurosphere were examined by automated analysis

Figure 3. Neural precursorcells (NPCs) express both iso-forms of ROCK and ROCKinhibition prevented chain for-mation of neurosphere-derivedNPCs. (A): NPCs expressedROCK1 and 2 isoforms byreverse transcription polymerasechain reaction. (B) Similar toY27632, the ROCK inhibitorHA1077 (25 lM) reducedlamellipodial formation and pro-moted cell body elongation. (C):Untreated NPCs migrated asconnected cells and (D) Y27632(25 lM)-treated NPCs as singlecells on fibronectin at 24 hours.(E): By 72 hours, untreatedNPCs formed chains. (F):ROCK inhibition (Y27632) pre-vented chain formation. Intro-duction of Y27632 after chainformation at 72 hours disassoci-ated the chains, whereas re-moval of ROCK inhibition after72 hours of Y27632 treatmentre-established the chains. (G):Untreated NPCs did not formNPC chains on laminin but (H)ROCK inhibition induced mem-brane thinning and cell bodyelongation. Scale bar ¼ 50 lm(B); 100 lm (C–H). Abbrevia-tion: ROCK, Rho-dependentkinase.


of DAPI stained nuclei. In a dose-dependent manner, Y27632increased the area of NPC spread (Fig. 2A, ANOVA p <.0001), decreased the number of neighboring NPCs within a 20-lm radius (Fig. 2A0, ANOVA p < .0001) and increased theminimum distance between the NPCs (Fig. 2A00, ANOVA p <.0001). In contrast, Rac1 inhibitor treatment decreased the areacovered (Fig. 2B, ANOVA p < .001), increased cell density atthe highest concentrations (Fig. 2B0, ANOVA p ¼ .06 overalland p < .05 for 50-lM Rac1 inhibitor by post hoc test), anddecreased the minimum distance between NPCs (Fig. 2B00,ANOVA p ¼ .01). LY294002 treatment did not significantlychange the area of spread (Fig. 2C, ANOVA p ¼ .61), cell den-sity (Fig. 2C0, ANOVA p ¼ 0. 06), or minimum distancebetween cells (Fig. 2C00, ANOVA p ¼ .66). ROCK inhibitiontherefore significantly increased NPC migration, Rac1 inhibitionsignificantly decreased NPC migration, and PI3K inhibition did

not affect NPC migration under any of the criteria that wereused for these migration analyses. Addition of LY294002 did,however, effectively downregulate the PI3K pathway (Support-ing Information Fig. 1), whereas Y27632 decreased phosphoryla-tion of myosin light chain II (Supporting Information Fig. 2), amajor regulator of the cytoskeleton downstream of ROCKsignaling.

Effect of ROCK Inhibition on NPC MorphologyWas Reversible and Similar Regardless of Substrateor ROCK Inhibitor Used

Reverse transcription polymerase chain reaction (RT-PCR) wasused to determine that NPCs expressed both ROCK1 and ROCK2isoforms (Fig. 3A) and the correct identities of the PCR expressionproducts were confirmed by DNA sequencing (data not shown).To confirm that the effects of Y27632 were through ROCK

Figure 4. Both isoforms of ROCK regulate neural precursor cell (NPC) morphology and migration, but ROCK2 is more potent than ROCK1.siRNA was used to downregulate ROCK1 and/or ROCK2 expression. Transfection efficiency was assessed in live cells (A, E, I, M) by uptake ofa red fluorescent RNA (B, F, J, N), indicating that the majority of NPCs in the plated neurospheres were successfully transfected. Successfuldownregulation of ROCK1 and ROCK2 RNA and protein expression was observed by reverse transcription polymerase chain reaction (Q) andimmunostaining for ROCK1 (C, G, K, O) and ROCK2 (D, H, L, P), respectively. ROCK1 downregulation alone had no effect on cell morphol-ogy or migration (E–H, R) compared with negative control siRNA (A–D, R). ROCK2 downregulation induced an elongated morphology in somecells and enhanced the area of migration (I–L, R), whereas combined downregulation of ROCK1 and ROCK2 induced a bipolar morphology inmost cells and further increased the area of migration (M–P, R). (R): The area of migration is expressed as area per cell number to compensatefor variability in neurosphere size and shows the mean 6 SEM of n ¼ 3 individual experiments, from three neurosphere lines. **, p < .01; ***,p < .001. Scale bar ¼ 50 lm (A–P). Abbreviations: DAPI, 40,6-diamidino-2-phenylindole; GAPDH, glyceraldehyde 3-phosphate dehydrogenase;ROCK, rho-dependent kinase.


www.StemCells.com

inhibition, the effect of another widely used ROCK inhibitor,HA1077 (10–100 lM), was tested and produced similar effects toY27632 (Fig. 3B). The effect on NPC morphology in the presenceof ROCK inhibition was independent of extracellular matrix (ECM)substrate used, with Y27632 inducing an elongated and generallybipolar morphology on both fibronectin and laminin. In untreatedconditions, whole neurospheres plated on fibronectin formed amonolayer within 24 hours (Fig. 3C), but by 72 hours the cellsformed chain-like structures (Fig. 3E) and this was blocked byROCK inhibition. Addition of Y27632 to the NPC chains at 72hours promoted chain dissociation and cell dispersal, whereas re-moval of Y27632 from separated cells at 72 hours led to formationof NPC chains (Fig. 3E, 3F). Although the NPCs did not formchains on the laminin substrate, the effect of ROCK inhibition onNPC morphology on laminin was also reversible (Fig. 3G, 3H).

Both ROCK1 and ROCK2 Regulate NPCMorphology and Migration

As NPCs expressed both isoforms of ROCK and the inhibitorsused blocked both isoforms, siRNA knockdown was used toexamine the relative contributions of ROCK1 and ROCK2 onNPC morphology and migration. Negative control, ROCK1,

ROCK2, or ROCK1 and ROCK2 siRNAs were transfectedinto NPCs, along with a red fluorescent RNA to allow detec-tion of transfected cells. Transfected cells were grown intoneurospheres, then plated onto fibronectin for 24 hours. Virtu-ally all cells in neurospheres that adhered to the fibronectinshowed red fluorescence, indicating very high transfection ef-ficiency (Fig. 4B, 4F, 4J, 4N). Immunostaining for ROCK1(Fig. 4C, 4G, 4K, 4O) or ROCK2 (Fig. 4D, 4H, 4L, 4P) orRT-PCR (Fig. 4Q) indicated that ROCK1 and ROCK2 expres-sion was decreased in the presence of ROCK1 and ROCK2siRNA, respectively. By densitometric analysis, ROCK1 RNAwas decreased to approximately 20% of control levels withROCK1 siRNA alone and to 60% when combined withROCK2 siRNA. ROCK2 RNA was decreased to 30% of con-trol levels with ROCK2 siRNA alone and to 50% when com-bined with ROCK1 siRNA. NPCs transfected with ROCK1siRNA were flat, showed cell-cell contact and limited migra-tion, similar to control transfected cells (Fig. 4A–4H, 4R).NPCs transfected with ROCK2 RNA showed significantlyincreased migration, with a mix of cell morphologies rangingfrom the same as control cells to cells with an elongated mor-phology (Fig. 4I–4L, 4R). Cells transfected with both ROCK1and ROCK2 siRNAs showed a morphology that was similarto that observed with Y27632; the cells had an elongatedbipolar morphology, little cell-cell contact and a furtherincreased area of migration (Fig. 4M–4P, 4R).

ROCK Inhibition Decreased Chain Migrationfrom SVZ Explants

ROCK inhibition reduced neurosphere-derived NPC chain for-mation, however, the cells had been passaged and may notreflect chain formation from primary NPCs. Therefore, weexamined the effect of ROCK inhibition on migration ofNPCs from SVZ explants as a better in vitro model of NPCchain migration. Approximately 50% of the explants con-tained cells that migrated into the Matrigel and they did so ei-ther as chains or as individual cells (Fig. 5A–5E). Under basalconditions, the percentage of explants that showed eithermode of migration was similar (Fig. 5E). ROCK inhibitionwith Y27632 (5 lm and 50 lM) inhibited chain migrationand promoted a dispersed pattern of cell migration (Fig. 5E).

ROCK Inhibition Altered SVZ-Derived NPCMigration In Vivo

To determine whether ROCK inhibition altered NPC migra-tion in vivo, Y27632 and BrdU were infused into the lateralventricle of adult mice for 1 week and brains were examinedat 1 week and 1 month. Intrathecal coadministration of BrdUenabled us to infer that the BrdU-labeled NPCs and theirprogeny had also been exposed to Y27632 or vehicle control(saline). Cryosections were collected from four regions of thebrain: from the center of the OB, the forebrain including theRMS, the anterior SVZ, and at the site of infusion (injurysite).

ROCK Inhibition Increased the Area of the SVZ

Y27632-treated animals showed a slightly increased SVZ areaat 1 week, especially apparent at the dorsal lateral segment ofthe lateral ventricle (Fig. 6A–6C). This was not due to anincrease in the number of BrdUþ cells within the SVZ.BrdUþ NPCs of the treated SVZ (Fig. 6B) appeared lessdensely packed than the BrdUþ NPCs in the SVZ of the con-trol animals (Fig. 6A), however, analysis of the number ofcells per SVZ section showed no significant differencebetween the control and the treated animals (Fig. 6D),although there was a trend to decreased density (Fig. 6E).

Figure 5. ROCK inhibition prevented chain migration of subventric-ular zone (SVZ) explant-derived cells. Representative examples ofuntreated (A, B) and Y27632 (5 lM and 50 lM)-treated (C, D) SVZexplants cultured in Matrigel. Cells of both untreated and treatedexplants exhibited two patterns of migration, (A, A0, C) chain migra-tion and (B, B0, D) dissociated migration. (E): Untreated explantsequivalently showed either mode of migration. Y27632 decreased thepercentage of explants showing chain migration and increased thepercentage showing dissociated migration. Scale bar ¼ 100 lm (A–D); 25 lm (A0, B0). Mean 6 SEM of n ¼ 3 independent experiments.**, p < .01; ***, p < .001.


These results suggest that ROCK inhibition did not signifi-cantly alter the number of BrdUþ NPCs within the SVZ.

ROCK Inhibition Decreased Numbers of NewbornNPCs in the OB

The number of BrdUþ NPCs was counted at the OB-end ofthe RMS (RMS-OB) and the granule, mitral, external plexi-form, and glomerular cell layers of the OB at 1 week (Fig.6F–6H). ROCK inhibition showed a trend of decreased NPCdensity at the RMS-OB compared with the untreated animals(Fig. 6G). Within the OB proper, in the Y27632-infused ani-mals there were significant decreases in the density of new-born NPCs, particularly in the granule, mitral, and externalplexiform layers (Fig. 6H).

ROCK Inhibition Decreased Cell Densityin the RMS

After 1 week, BrdUþ NPCs within the RMS of the treatedanimals appeared less densely packed compared with the con-trol RMS and numerous BrdUþ cells were scattered beyondthe boundary of the treated RMS (Fig. 7B). Measurement ofthe RMS indicated that ROCK inhibition did not change thetransverse area (Fig. 7C), however, the cell density in theRMS of treated mice was decreased compared with control

(Fig. 7D), as was the number of neighboring NPCs within 20lm of a given cell (Fig. 7E).

Increased Ectopic Migration Outside the RMS

Newborn NPCs were frequently seen detached and leadingaway from the core of the treated RMS (Fig. 7B). At 1 week,ROCK inhibition appeared to enhance ectopic migration ofNPCs outside of the RMS to areas such as the AON and theanterior cortex, with increased numbers of BrdUþ cells (Fig.7F). Immunostaining for PSA-NCAM was observed asexpected within the tight cluster of migrating precursors ofthe RMS in the control and treated animals (Fig. 7G, 7H).Treated animals frequently showed PSA-NCAMþ cells scat-tered beyond the boundary of the RMS, in addition to themigrating cells of the RMS. Ectopic cells in the anterior cor-tex (Fig. 7I) and the AON (Fig. 7J) of both the control andtreated animals also showed expression of PSA-NCAM. Thissuggested that the BrdUþ cells observed outside of the RMSwere possibly NPCs that had migrated from the RMS or SVZ.The comparative increase in number of BrdU-labeled cellswas also observed in the AON at 1 month. The majority oflabeled cells were NeuNþ neurons, with a modest increase inthe percentage of NeuN colabeled cells in treated animals(Fig. 7K–7M). However, in the anterior cortex, very few

Figure 6. ROCK inhibitiondecreased neural precursor cell(NPC) migration to the olfactorybulb. (A, B): Mice were infusedwith BrdU 6 Y27632 into theright lateral ventricle for 7 daysand then brains were immuno-stained for BrdU labeling.Treated SVZ showed less tightlypacked BrdUþ NPCs, especiallywithin the dorsolateral corner(dotted lines in [A, B]). (C):ROCK inhibition modestlyincreased the area of SVZ but(D) did not affect the number ofBrdUþ NPCs per section or (E)cell density in the SVZ. Scalebar ¼ 50 lm (A, B). (F): In theolfactory bulb, ROCK inhibition(G) showed a trend to decreasenumbers of newborn NPCs atthe RMS-OB and (H) decreasednumbers of NPCs in the granule,mitral, and EPL layers. Mean 6SEM of five treated mice andfour control mice; *, p < .05;**, p < .01 comparing controland treated in each region.Abbreviations: BrdU, bromo-deoxyuridine; EPL, externalplexiform; Gr, granule; GL, glo-merular cell layer; Mi, mitral;RMS-OB, rostral migratorystream region of the olfactorybulb; SVZ, subventricular zone.


www.StemCells.com

BrdUþ cells remained at 1 month (<1 cell per section) andeven fewer were NeuNþ (<1%).

To determine whether ROCK inhibition enhanced recruit-ment of newborn NPCs to the injury induced by insertion ofthe infusion cannula, the number of BrdUþ cells at the mar-gin and the periphery of the injury site was examined at 1

week. The injury site had many BrdUþ cells, whereas thecontralateral side showed few BrdUþ cells in the cortex (Sup-porting Information Fig. 3), with no significant differencebetween control and treated animals (Supporting InformationFig. 3B). There was an increased percentage of proliferativeastrocytes at the margin but not the periphery of the injury

Figure 7. Rho-dependent kinase (ROCK) inhibition decreased neural precursor cell (NPC) density in the RMS and induced ectopic migration.Mice were infused with BrdU 6 Y27632 into the right lateral ventricle as earlier. (A): The vertical line on the schematic indicates the level ofRMS collected for analysis and the coronal view indicates the forebrain regions that were assessed. (B): BrdUþ NPCs in the treated RMSappeared more dispersed and frequently showed scattered precursors beyond the boundary of the RMS. Dotted lines indicate the region definedas RMS. (C): The area of the RMS was the same in control and treated mice. (D): ROCK inhibition decreased cell density in the treated RMS,and (E) the number of neighboring NPCs within 20 lm of a given cell. (F): ROCK inhibition induced an increase in the number of BrdUþ cellsin regions outside of the RMS, such as the anterior cortex. (G): Control NPCs in the RMS expressed PSA-NCAM (green); DAPI (blue), and (H)NPCs of Y27632-infused animals expressed PSA-NCAM at and adjacent to the RMS. PSA-NCAM expression was also detected on isolated cellsin (I) the anterior cortex and (J) at the AON. (K): Ectopic migration into the AON was more obvious at 1 month, with an increase in totalBrdUþ cell numbers and NeuNþ neurons. (L): The majority of the BrdUþ cells were NeuNþ neurons and the percentage was increased intreated animals. (M): Representative image showing BrdU and NeuN colabeling in the AON of a treated mouse. Mean 6 SEM of five treatedmice and four control mice at 1 week and two treated and three control mice at 1 month. *, p < .05. Scale bar ¼ 50 lm (B, I, J); 200 lm (G,

H); 100 lm (M). Abbreviations: AON, accessory olfactory nucleus; BrdU, bromodeoxyuridine; RMS, rostral migratory stream.


site of the treated mice, with no difference in the percentageof CD11bþ macrophages (Supporting Information Fig. 3B,3C–3E).

DISCUSSION

This study examined the effects of Rho-GTPase inhibition onNPC migration. The inhibition of ROCK increased neuro-sphere-derived NPC migration, whereas Rac1 inhibitiondecreased and PI3K inhibition had no effect on migration.Given the potential for ROCK inhibition to thus increasemigration of adult NPCs in a therapeutic setting, the effect ofROCK inhibition on NPC biology was then characterized inmore detail using neurospheres, SVZ explants and in vivoanalyses. In each of these model systems, ROCK signalingplayed a significant role in NPC-NPC contact; inhibition ofROCK prevented neurosphere-derived NPC chain formationand SVZ explant chain migration, as well as NPC-NPC asso-ciation in vivo. Unlike for neurospheres, which exhibited gen-eral increased migration in response to ROCK inhibition,infusion of Y27632 into the lateral ventricles decreasedmigration of NPCs to the OB. However, BrdUþ cell numberswere increased in ectopic sites, such as anterior cortex at 1week and AON by 1 month, suggesting that, similar to the invitro results, migration was enhanced but there was a partialloss of directed migration.

Regulation of NPC Morphology and Migration byRho GTPase Signaling

ROCK, Rac1, and PI3K differentially affected NPC migra-tion. In vitro, the inhibition of Rac1 and PI3K affectedlamellipodial protrusion of NPCs, indicating highly con-served roles for these molecules in modulating the actin cy-toskeleton at the cell front that is required for environmentalsensing. The inhibition of PI3K limited the production oflamellipodia but did not affect migration, indicating that thePI3K pathway was not essential for NPC motility. ROCKinhibition of NPCs also influenced the mode of cell migra-tion, changing the way the NPCs interacted, promotingmembrane retraction, and loss of contact with neighboringcells. As a result, the treated NPCs predominantly migratedin single-cell pattern. This was the case using two chemicalinhibitors of ROCK, Y27632 and HA1077. We demonstratedthat adult NPCs express both isoforms of ROCK, namelyROCK1 and ROCK2. These isoforms share 65% proteinhomology and especially high conservation at the kinase-binding domain (92% homology) [52]. Because of this high-sequence homology, development of an exclusively ROCK1or ROCK2 inhibitor has proven to be difficult and most ofthe inhibitors currently available target both isoforms, there-fore, the relative contributions of each isoform is difficult todetermine. Using siRNA-mediated knockdown of ROCK1and/or ROCK2 expression, we showed that both isoformsare involved in regulating NPC migration and morphology,as decreased expression of both was required to reproducethe effect of Y27632. However, unlike ROCK1, knockdownof ROCK2 was partially effective, suggesting that it may bethe dominant isoform in NPCs and can compensate fordecreased expression of ROCK1.

The change to a single-cell migration mode in ROCKinhibited NPCs is of importance as it potentially alters sig-nal transduction between NPCs, which ultimately influencesthe response of the NPCs to a variety of factors. In vivo,following Y27632 infusion into the lateral ventricle, theensuing decrease in NPC-NPC association appeared to nega-

tively impact on the basic navigational capability of theNPCs to the OB, resulting in a partial loss of directedmigration. Physiologically, NPCs in the SVZ/RMS migratein a closely associated chain formation, ensheathed by net-works of glial fibers [7, 9, 10, 53]. Close association amongNPCs or between NPCs and glial cells within the RMS isbelieved to be important to maintain chain migration, as dis-ruption to the cell-cell interactions disrupts NPC chainmigration. Several classes of adhesion and guidance mole-cules, such as integrins and laminin, have been identified,which are important for NPC chain migration [3, 54, 55].Furthermore, these molecules signal through downstreamRho/ROCK effectors [56–59]. A collective consensus is thatmultiple receptor-induced signals act synergistically to medi-ate the chain migration of NPCs in the RMS. The currentwork indicates that the Rho pathway is a key player inmodulating this migration, as inhibition of ROCK inducedchain dissociation and redistribution of NPCs to other brainregions, such as the AON and anterior cortex.

Regulation of NPC Survival and Differentiationby Rho-GTPases

We found no effect on survival or differentiation of NPCs invitro; however, there was an increased percentage of BrdUþneurons in the AON, indicating a possible survival or differ-entiation advantage in vivo. The percentage of astrocytes atthe injury site was increased at 1 week, but given the shorttime frame for differentiation, this is most likely due toincreased proliferation of local reactive cortical astrocytes[60], proliferation of which is enhanced by ROCK inhibition[61]. In other neural stem cell systems, ROCK inhibition hasbeen shown to affect survival and differentiation. Under con-ditions that induce apoptosis, ROCK inhibition can promoteNPC survival, such as following transplantation of embryonicstem (ES) cell-derived NPCs [62]. In human ES cell-derivedneural stem cells, it also promotes differentiation into neuralcrest-like cells [63] and blocks lysophosphatidic acid (LPA)–induced inhibition of neuronal differentiation, with no effecton neuronal differentiation by itself [64]. Recently, systemicinfusion of HA1077 (Fasudil), another ROCK inhibitor, wasreported to promote proliferation and neurogenesis of SVZNPCs following hypoxia/reperfusion in mice [65], however,whether or not Fasudil had an effect on NPCs in noninjuredanimals was not reported.

Regulation of NPC Migration to Sitesof Neural Damage

Studies examining progressive neurodegenerative diseases andmodels of Parkinson’s, Huntington’s, and Alzheimer’s dis-eases have indicated that SVZ-derived NPCs can be activatedand mobilized, although to a limited degree, to the site ofdamage [66–71], as also reported for stroke and traumaticbrain injury. Ischemic stroke induced neurogenesis in therodent SVZ [1, 72, 73] and stimulated newborn precursormigration to the peri-infarct regions [74, 75]. This migrationmay be induced by SDF-1/CXCL4, which plays a role indirecting newborn neurons toward an ischemic lesion [76]and may be enhanced by release of mitogenic factors, such asEGF [77, 78].

Enhancement of migration of NPCs to damaged neural tis-sue would be hoped to improve repair. However, although in-hibition of ROCK promoted NPC migration in vitro, this wasnot in a directed fashion and indeed in vivo, this led to adecrease in the normal physiological migration of NPCs tothe OB. This is probably not because migration was decreased


www.StemCells.com

per se but that the normal, directed migration along the RMSwas disrupted, causing some NPCs to migrate to ectopic sites.

Use of ROCK Inhibitors for Treatmentof Neural Damage

ROCK inhibitors are currently in use or in human trials for avariety of CNS and non-CNS conditions [37, 79–88]. Appli-cation of ROCK inhibitors in vivo may affect NPC cell-cellassociation and promote aberrant NPC migration, leading toaltered NPC signal transduction. The current findings suggestthat inhibition of ROCK may interfere with physiologicalNPC homing mechanisms, as reflected by the increased redis-tribution of newborn NPCs to brain regions other than thephysiological integration site. This phenomenon may be a sec-ondary result of the disruption of NPC-NPC association.Overall, our findings indicate that the use of ROCK inhibitionas a clinical tool may have unexpected impact on NPCs and

warrants further study to fully elucidate potential beneficialand detrimental effects.

ACKNOWLEDGMENTS

This work was supported by National Health and MedicalResearch Council of Australia Project grant (#454384) andFellowship to A.M.T. (#350226).

DISCLOSURE OF POTENTIAL CONFLICTS

OF INTEREST

The authors indicate no potential conflicts of interest.

REFERENCES

1 Arvidsson A, Collin T, Kirik D et al. Neuronal replacement from en-dogenous precursors in the adult brain after stroke. Nat Med 2002;8:963–970.

2 Parent JM. The role of seizure-induced neurogenesis in epileptogene-sis and brain repair. Epilepsy Res 2002;50:179–189.

3 Belvindrah R, Hankel S, Walker J et al. Beta1 integrins control theformation of cell chains in the adult rostral migratory stream. J Neuro-sci 2007;27:2704–2717.

4 Murase S, Horwitz AF. Deleted in colorectal carcinoma and differen-tially expressed integrins mediate the directional migration of neural pre-cursors in the rostral migratory stream. J Neurosci 2002;22:3568–3579.

5 Bonfanti L, Theodosis DT. Expression of polysialylated neural celladhesion molecule by proliferating cells in the subependymal layer ofthe adult rat, in its rostral extension and in the olfactory bulb. Neuro-science 1994;62:291–305.

6 Cremer H, Lange R, Christoph A et al. Inactivation of the N-CAMgene in mice results in size reduction of the olfactory bulb and deficitsin spatial learning. Nature 1994;367:455–459.

7 Doetsch F, Garcia-Verdugo JM, Alvarez-Buylla A. Cellular composi-tion and three-dimensional organization of the subventricular germinalzone in the adult mammalian brain. J Neurosci 1997;17:5046–5061.

8 Hu H, Tomasiewicz H, Magnuson T et al. The role of polysialic acidin migration of olfactory bulb interneuron precursors in the subven-tricular zone. Neuron 1996;16:735–743.

9 Jankovski A, Sotelo C. Subventricular zone-olfactory bulb migratorypathway in the adult mouse: Cellular composition and specificity asdetermined by heterochronic and heterotopic transplantation. J CompNeurol 1996;371:376–396.

10 Lois C, Garcia-Verdugo JM, Alvarez-Buylla A. Chain migration ofneuronal precursors. Science 1996;271:978–981.

11 Rousselot P, Lois C, Alvarez-Buylla A. Embryonic (PSA) N-CAMreveals chains of migrating neuroblasts between the lateral ventricleand the olfactory bulb of adult mice. J Comp Neurol 1995;351:51–61.

12 Aguirre A, Rizvi TA, Ratner N et al. Overexpression of the epidermalgrowth factor receptor confers migratory properties to nonmigratorypostnatal neural progenitors. J Neurosci 2005;25:11092–11106.

13 Boockvar JA, Kapitonov D, Kapoor G et al. Constitutive EGFR sig-naling confers a motile phenotype to neural stem cells. Mol Cell Neu-rosci 2003;24:1116–1130.

14 Dziembowska M, Tham TN, Lau P et al. A role for CXCR4 signalingin survival and migration of neural and oligodendrocyte precursors.Glia 2005;50:258–269.

15 Imitola J, Raddassi K, Park KI et al. Directed migration of neuralstem cells to sites of CNS injury by the stromal cell-derived factor1alpha/CXC chemokine receptor 4 pathway. Proc Natl Acad Sci USA2004;101:18117–18122.

16 Tran PB, Ren D, Veldhouse TJ et al. Chemokine receptors areexpressed widely by embryonic and adult neural progenitor cells. JNeurosci Res 2004;76:20–34.

17 Nguyen-Ba-Charvet KT, Picard-Riera N, Tessier-Lavigne M et al.Multiple roles for slits in the control of cell migration in the rostralmigratory stream. J Neurosci 2004;24:1497–1506.

18 Sawamoto K, Wichterle H, Gonzalez-Perez O et al. New neurons fol-low the flow of cerebrospinal fluid in the adult brain. Science 2006;311:629–632.

19 Ward M, McCann C, DeWulf M et al. Distinguishing between direc-tional guidance and motility regulation in neuronal migration. J Neu-rosci 2003;23:5170–5177.

20 Wu W, Wong K, Chen J et al. Directional guidance of neuronalmigration in the olfactory system by the protein Slit. Nature 1999;400:331–336.

21 Angot E, Loulier K, Nguyen-Ba-Charvet KT et al. Chemoattractiveactivity of sonic hedgehog in the adult subventricular zone modulatesthe number of neural precursors reaching the olfactory bulb. StemCells (Dayton, Ohio) 2008;26:2311–2320.

22 Peretto P, Giachino C, Aimar P et al. Chain formation and glial tubeassembly in the shift from neonatal to adult subventricular zone of therodent forebrain. J Comp Neurol 2005;487:407–427.

23 Peretto P, Merighi A, Fasolo A et al. Glial tubes in the rostral migra-tory stream of the adult rat. Brain Res Bull 1997;42:9–21.

24 Hu H. Polysialic acid regulates chain formation by migrating olfactoryinterneuron precursors. J Neurosci Res 2000;61:480–492.

25 Acheson A, Sunshine JL, Rutishauser U. NCAM polysialic acid canregulate both cell-cell and cell-substrate interactions. J Cell Biol 1991;114:143–153.

26 Fujimoto I, Bruses JL, Rutishauser U. Regulation of cell adhesion bypolysialic acid. Effects on cadherin, immunoglobulin cell adhesionmolecule, and integrin function and independence from neural cell ad-hesion molecule binding or signaling activity. J Biol Chem 2001;276:31745–31751.

27 Kiss JZ, Rougon G. Cell biology of polysialic acid. Curr Opin Neuro-biol 1997;7:640–646.

28 Rutishauser U, Landmesser L. Polysialic acid in the vertebrate nerv-ous system: A promoter of plasticity in cell-cell interactions. TrendsNeurosci 1996;19:422–427.

29 Altman J, Das GD. Autoradiographic and histological studies of post-natal neurogenesis. I. A longitudinal investigation of the kinetics,migration and transformation of cells incorporating tritiated thymidinein neonate rats, with special reference to postnatal neurogenesis insome brain regions. J Comp Neurol 1966;126:337–389.

30 Bryan BA, D’Amore PA. What tangled webs they weave: Rho-GTPase control of angiogenesis. Cell Mol Life Sci 2007;64:2053–2065.

31 Cain RJ, Ridley AJ. Phosphoinositide 3-kinases in cell migration. BiolCell 2009;101:13–29.

32 Charest PG, Firtel RA. Big roles for small GTPases in the control ofdirected cell movement. Biochem J 2007;401:377–390.

33 Fryer BH, Field J. Rho, Rac, Pak and angiogenesis: Old roles andnewly identified responsibilities in endothelial cells. Cancer Lett 2005;229:13–23.

34 Iijima M, Huang YE, Devreotes P. Temporal and spatial regulation ofchemotaxis. Dev Cell 2002;3:469–478.

35 Ladwein M, Rottner K. On the Rho’d: The regulation of membraneprotrusions by Rho-GTPases. FEBS Lett 2008;582:2066–2074.

36 Yamazaki D, Kurisu S, Takenawa T. Regulation of cancer cell motil-ity through actin reorganization. Cancer Sci 2005;96:379–386.

37 Shibuya M, Hirai S, Seto M et al. Effects of fasudil in acute ischemicstroke: Results of a prospective placebo-controlled double-blind trial.J Neurol Sci 2005;238:31–39.

38 Borisoff JF, Chan CC, Hiebert GW et al. Suppression of Rho-kinaseactivity promotes axonal growth on inhibitory CNS substrates. MolCell Neurosci 2003;22:405–416.

39 Chan CC, Khodarahmi K, Liu J et al. Dose-dependent beneficial anddetrimental effects of ROCK inhibitor Y27632 on axonal sprouting


and functional recovery after rat spinal cord injury. Exp Neurol 2005;196:352–364.

40 Fournier AE, Takizawa BT, Strittmatter SM. Rho kinase inhibitionenhances axonal regeneration in the injured CNS. J Neurosci 2003;23:1416–1423.

41 Fuentes EO, Leemhuis J, Stark GB et al. Rho kinase inhibitorsY27632 and H1152 augment neurite extension in the presence of cul-tured Schwann cells. J Brachial Plex Peripher Nerve Inj 2008;3:19.

42 Kubo T, Yamaguchi A, Iwata N et al. The therapeutic effects of Rho-ROCK inhibitors on CNS disorders. Ther Clin Risk Manag 2008;4:605–615.

43 Kubo T, Yamashita T. Rho-ROCK inhibitors for the treatment ofCNS injury. Recent Pat CNS Drug Discov 2007;2:173–179.

44 Lingor P, Teusch N, Schwarz K et al. Inhibition of Rho kinase(ROCK) increases neurite outgrowth on chondroitin sulphate proteo-glycan in vitro and axonal regeneration in the adult optic nerve invivo. J Neurochem 2007;103:181–189.

45 Lingor P, Tonges L, Pieper N et al. ROCK inhibition and CNTF interact onintrinsic signalling pathways and differentially regulate survival and regener-ation in retinal ganglion cells. Brain 2008;131:250–263.

46 Dergham P, Ellezam B, Essagian C et al. Rho signaling pathway tar-geted to promote spinal cord repair. J Neurosci 2002;22:6570–6577.

47 McKerracher L, Higuchi H. Targeting Rho to stimulate repair afterspinal cord injury. J Neurotrauma 2006;23:309–317.

48 Mueller BK, Mack H, Teusch N. Rho kinase, a promising drug targetfor neurological disorders. Nat Rev Drug Discov 2005;4:387–398.

49 Turnley AM, Faux CH, Rietze RL et al. Suppressor of cytokine sig-naling 2 regulates neuronal differentiation by inhibiting growth hor-mone signaling. Nat Neurosci 2002;5:1155–1162.

50 Hohenstein KA, Pyle AD, Chern JY et al. Nucleofection mediateshigh-efficiency stable gene knockdown and transgene expression inhuman embryonic stem cells. Stem Cells (Dayton, Ohio) 2008;26:1436–1443.

51 Paxinos G, Franklin KBJ. The Mouse Brain in Stereotaxic Coordi-nates. Academic Press, San Diego, CA, USA, 2001.

52 Nakagawa O, Fujisawa K, Ishizaki T et al. ROCK-I and ROCK-II,two isoforms of Rho-associated coiled-coil forming protein serine/threonine kinase in mice. FEBS Lett 1996;392:189–193.

53 Doetsch F, Alvarez-Buylla A. Network of tangential pathways forneuronal migration in adult mammalian brain. Proc Natl Acad SciUSA 1996;93:14895–14900.

54 Murase S, Horwitz AF. Directions in cell migration along the rostralmigratory stream: The pathway for migration in the brain. Curr TopDev Biol 2004;61:135–152.

55 Emsley JG, Hagg T. alpha6beta1 integrin directs migration of neuro-nal precursors in adult mouse forebrain. Exp Neurol 2003;183:273–285.

56 Juliano RL. Signal transduction by cell adhesion receptors and the cy-toskeleton: Functions of integrins, cadherins, selectins, and immuno-globulin-superfamily members. Annu Rev Pharmacol Toxicol 2002;42:283–323.

57 Juliano RL, Reddig P, Alahari S et al. Integrin regulation of cell sig-nalling and motility. Biochem Soc Trans 2004;32:443–446.

58 Keely P, Parise L, Juliano R. Integrins and GTPases in tumour cellgrowth, motility and invasion. Trends Cell Biol 1998;8:101–106.

59 Schwartz MA, Shattil SJ. Signaling networks linking integrins and rhofamily GTPases. Trends Biochem Sci 2000;25:388–391.

60 Buffo A, Rite I, Tripathi P et al. Origin and progeny of reactive glio-sis: A source of multipotent cells in the injured brain. Proc Natl AcadSci USA 2008;105:3581–3586.

61 Puschmann TB, Turnley AM. Eph receptor tyrosine kinases regulateastrocyte cytoskeletal rearrangement and focal adhesion formation.J Neurochem 2010;113:881–894.

62 Koyanagi M, Takahashi J, Arakawa Y et al. Inhibition of the Rho/ROCKpathway reduces apoptosis during transplantation of embryonic stem cell-derived neural precursors. J Neurosci Res 2008;86:270–280.

63 Hotta R, Pepdjonovic L, Anderson RB et al. Small-molecule inductionof neural crest-like cells derived from human neural progenitors. StemCells (Dayton, Ohio) 2009;27:2896–2905.

64 Dottori M, Leung J, Turnley AM et al. Lysophosphatidic acid inhibitsneuronal differentiation of neural stem/progenitor cells derived fromhuman embryonic stem cells. Stem Cells (Dayton, Ohio) 2008;26:1146–1154.

65 Ding J, Li QY, Yu JZ et al. Fasudil, a Rho kinase inhibitor, drivesmobilization of adult neural stem cells after hypoxia/reoxygenationinjury in mice. Mol Cell Neurosci 2010;43:201–208.

66 Aponso PM, Faull RL, Connor B. Increased progenitor cell proli-feration and astrogenesis in the partial progressive 6-hydroxydopaminemodel of Parkinson’s disease. Neuroscience 2008;151:1142–1153.

67 Collin T, Arvidsson A, Kokaia Z et al. Quantitative analysis of thegeneration of different striatal neuronal subtypes in the adult brain fol-lowing excitotoxic injury. Exp Neurol 2005;195:71–80.

68 Curtis MA, Penney EB, Pearson J et al. The distribution of progenitor cellsin the subependymal layer of the lateral ventricle in the normal and Hunting-ton’s disease human brain. Neuroscience 2005;132:777–788.

69 de Chevigny A, Cooper O, Vinuela A et al. Fate mapping and lineageanalyses demonstrate the production of a large number of striatal neu-roblasts after transforming growth factor alpha and noggin striatalinfusions into the dopamine-depleted striatum. Stem Cells (Dayton,Ohio) 2008;26:2349–2360.

70 Gordon RJ, Tattersfield AS, Vazey EM et al. Temporal profile of sub-ventricular zone progenitor cell migration following quinolinic acid-induced striatal cell loss. Neuroscience 2007;146:1704–1718.

71 Tattersfield AS, Croon RJ, Liu YW et al. Neurogenesis in the striatumof the quinolinic acid lesion model of Huntington’s disease. Neuro-science 2004;127:319–332.

72 Jin K, Minami M, Xie L et al. Ischemia-induced neurogenesis is pre-served but reduced in the aged rodent brain. Aging Cell 2004;3:373–377.

73 Yamashita T, Ninomiya M, Hernandez Acosta P et al. Subventricularzone-derived neuroblasts migrate and differentiate into mature neuronsin the post-stroke adult striatum. J Neurosci 2006;26:6627–6636.

74 Zhang R, Zhang Z, Wang L et al. Activated neural stem cells contrib-ute to stroke-induced neurogenesis and neuroblast migration towardthe infarct boundary in adult rats. J Cereb Blood Flow Metab 2004;24:441–448.

75 Zhang RL, LeTourneau Y, Gregg SR et al. Neuroblast division duringmigration toward the ischemic striatum: A study of dynamic migratoryand proliferative characteristics of neuroblasts from the subventricularzone. J Neurosci 2007;27:3157–3162.

76 Thored P, Arvidsson A, Cacci E et al. Persistent production of neu-rons from adult brain stem cells during recovery after stroke. StemCells (Dayton, Ohio) 2006;24:739–747.

77 Baldauf K, Reymann KG. Influence of EGF/bFGF treatment on prolif-eration, early neurogenesis and infarct volume after transient focal is-chemia. Brain Res 2005;1056:158–167.

78 Ninomiya M, Yamashita T, Araki N et al. Enhanced neurogenesis in the is-chemic striatum following EGF-induced expansion of transit-amplifying cellsin the subventricular zone. Neurosci Lett 2006;403:63–67.

79 Fukumoto Y, Mohri M, Inokuchi K et al. Anti-ischemic effects offasudil, a specific Rho-kinase inhibitor, in patients with stable effortangina. J Cardiovasc Pharmacol 2007;49:117–121.

80 Inokuchi K, Ito A, Fukumoto Y et al. Usefulness of fasudil, a Rho-ki-nase inhibitor, to treat intractable severe coronary spasm aftercoronary artery bypass surgery. J Cardiovasc Pharmacol 2004;44:275–277.

81 Kishi T, Hirooka Y, Masumoto A et al. Rho-kinase inhibitor improvesincreased vascular resistance and impaired vasodilation of the forearmin patients with heart failure. Circulation 2005;111:2741–2747.

82 Masumoto A, Mohri M, Shimokawa H et al. Suppression of coronaryartery spasm by the Rho-kinase inhibitor fasudil in patients with vaso-spastic angina. Circulation 2002;105:1545–1547.

83 Mohri M, Shimokawa H, Hirakawa Y et al. Rho-kinase inhibitionwith intracoronary fasudil prevents myocardial ischemia in patientswith coronary microvascular spasm. J Am Coll Cardiol 2003;41:15–19.

84 Nagata K, Kondoh Y, Satoh Y et al. Effects of fasudil hydrochlorideon cerebral blood flow in patients with chronic cerebral infarction.Clin Neuropharmacol 1993;16:501–510.

85 Otsuka T, Ibuki C, Suzuki T et al. Vasodilatory effect of subsequentadministration of fasudil, a rho-kinase inhibitor, surpasses that of ni-troglycerin at the concentric coronary stenosis in patients with stableangina pectoris. Circ J 2006;70:402–408.

86 Shibuya M, Suzuki Y, Sugita K et al. Effect of AT877 on cerebralvasospasm after aneurysmal subarachnoid hemorrhage. Results of aprospective placebo-controlled double-blind trial. J Neurosurg 1992;76:571–577.

87 Shimokawa H. Rho-kinase as a novel therapeutic target in treatmentof cardiovascular diseases. J Cardiovasc Pharmacol 2002;39:319–327.

88 Vicari RM, Chaitman B, Keefe D et al. Efficacy and safety of fasudilin patients with stable angina: A double-blind, placebo-controlled,phase 2 trial. J Am Coll Cardiol 2005;46:1803–1811.

See www.StemCells.com for supporting information available online.


the rho kinase pathway regulates mouse adult neural precursor cell migration

Documents