the rna binding protein fused in sarcoma (fus) functions

Characterization of FUS at Sites of DNA damage

1

The RNA Binding Protein Fused In Sarcoma (FUS) Functions Downstream of PARP in

Response to DNA Damage

Adam S. Mastrocola1,2, Sang Hwa Kim1, Anthony T. Trinh1, Lance A. Rodenkirch3,

and Randal S. Tibbetts1*

From the Department of Human Oncology, University of Wisconsin School of Medicine and Public Health, Madison, Wisconsin1

Molecular and Environmental Toxicology Center, University of Wisconsin, Madison, Wisconsin2

W.M. Keck Laboratory for Biological Imaging, University of Wisconsin, Madison, Wisconsin3

*Running Title: Characterization of FUS at Sites of DNA damage

To whom Correspondence should be addressed: Randal Tibbetts, Department of Human Oncology University of Wisconsin-Madison, 1111 Highland Ave., Madison, WI 53705. Tel: (608) 262-0027. E-mail: [email protected]

Keywords: DNA Damage Response, FUS, RNA Binding Protein, Double-Strand Break, PARP

Background: FUS has been implicated in the DNA damage response; however, the mechanisms are unknown.

Results: FUS recruitment to DNA lesions is PARP-dependent. Depletion of FUS disrupts DNA repair.

Conclusions: FUS functions downstream of PARP and promotes double-strand break repair.

Significance: This work identifies FUS as a novel factor at DNA lesions and furthers our understanding of RNA binding proteins in maintaining genomic stability.

SUMMARY

The list of factors that participate in the DNA damage response (DDR) to maintain genomic stability has expanded significantly to include a role for proteins involved in RNA processing. Here, we provide evidence that the RNA

binding protein (RBP) fused in sarcoma/translocated in liposarcoma (FUS) is a novel component of the DDR. We demonstrate that FUS is rapidly recruited to sites of laser-induced DNA double strand-breaks (DSBs) in a manner that requires poly(ADP-ribose) (PAR) polymerase (PARP) activity, but is independent of ataxia-telangiectasia mutated (ATM) kinase function. FUS recruitment is mediated by the arginine/glycine-rich (RGG) domains, which directly interact with PAR. In addition, we identify a role for the prion-like domain (PLD) in promoting accumulation of FUS at sites of DNA damage. Finally, depletion of FUS diminished DNA double-strand break (DSB) repair through both homologous recombination (HR) and non-homologous end-joining (NHEJ), implicating FUS as an upstream participant in both pathways. These results identify FUS as a new factor in the immediate response to DSBs that functions downstream of PARP to preserve genomic integrity.

http://www.jbc.org/cgi/doi/10.1074/jbc.M113.497974The latest version is at JBC Papers in Press. Published on July 5, 2013 as Manuscript M113.497974

Copyright 2013 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from


http://ww

w.jbc.org/

Dow

nloaded from


http://ww

w.jbc.org/

Dow

nloaded from


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/cgi/doi/10.1074/jbc.M113.497974

http://www.jbc.org/

http://www.jbc.org/

http://www.jbc.org/

http://www.jbc.org/


2

______________________________________

INTRODUCTION Exposure to genotoxic agents including ionizing radiation (IR), H2O2, and radiomimetic drugs poses a significant challenge to genomic integrity that is combated by evolutionarily conserved pathways that are collectively referred to as the DDR (1, 2). Central to this paradigm is the activation of apical PIKKs (phosphoinositide 3-kinase-like kinases) including ATM, ATM and Rad3-related (ATR), and DNA-dependent protein kinase (DNA-PK) that serve as proximal DNA damage signal transducers. The best characterized of these, ATM, is activated by DSBs to phosphorylate an estimated 700 substrates (3) that impact cell cycle regulation, apoptosis, DNA repair, and many other cellular processes. ATM rapidly accumulates at sites of DSBs in an MRE11/RAD50/NBS1 (MRN) -dependent manner and phosphorylates the histone variant H2AX on Serine 139 (γH2AX) (4, 5). γH2AX serves as a scaffold for the recruitment of the mediator protein MDC1 (6-8) and subsequent localization of the E3 ubiquitin ligases, RNF8 and RNF168 (9-13). RNF8 and RNF168 activities are required for the recruitment of the RAP80-ABRA1-BRCA1 complex (12, 13) and p53-binding protein 1 (53BP1) (10, 12-14). The composition of the recruitment complexes may dictate whether DSBs are repaired via NHEJ or HR repair mechanisms (15). Working in parallel to the γH2AX-mediated recruitment pathway is a PARP-dependent pathway that responds primarily to DNA single-strand breaks (SSBs) and participates in SSB repair and alternative- NHEJ (A-NHEJ) (16-19). PARP ADP-ribosylates (PARylates) target proteins including histones and itself at sites of damage, which creates binding sites for proteins harboring PAR-binding domains (20). PARP is required for the recruitment of CHD4/NuRD and Polycomb group (PcG) transcriptional repressor complexes, which mediate histone deacetylation and chromatin compaction near the break site, presumably to reduce interference between transcription and DSB repair (21-24).

FUS is a 526 amino acid member of the FET family of RBPs, which include Ewing’s Sarcoma (EWSR1), Tata-binding protein-associated factor 2N (TAF15), and the Drosophila ortholog of FUS, SARFH/Cabeza (25, 26). FUS was initially identified as a fusion oncogene in myxoid liposarcoma, in which the transcriptional activation domain of FUS is fused to the C/EBP homologous protein (CHOP) (27, 28). In addition, FUS fusion proteins have been identified in a variety of human cancers including acute myeloid leukemia, angiomatoid fibrous histiocytoma, and fibromyxoid sarcoma (29). FUS is composed of N-terminal Q/G/S/Y-rich and Gly-rich regions that comprise a PLD (30), an RNA recognition motif (RRM), RGG domains, and a C-terminal zinc finger domain (ZNF) (Fig. 2A) (31). FUS binds RNA (32, 33); ssDNA and dsDNA (33-35), and has been shown to shuttle between the nucleus and cytoplasm (33). In addition to its participation in transcription, FUS has proposed physiological activities involving microRNA processing, splicing, and mRNA transport and maturation (36, 37). Thus, FUS seems to fulfill broad functions in gene expression through transcriptional and posttranscriptional mechanisms. Intriguingly, dominant mutations in FUS cause inherited forms of amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTD) (38, 39). It is believed that ALS-associated mutations lead to trapping and aggregation of FUS in the cytoplasm; however, other pathogenic mechanisms may be at play. FUS also has an emergent, yet poorly understood participation in the DDR. FUS-/- mice exhibit defects in B-lymphocyte development and activation, male sterility, chromosomal instability, and radiosensitivity—phenotypes that are closely aligned with DSB repair defects (40, 41). Cellular extracts from FUS-/- testes are unable to promote pairing between homologous DNA sequences in vitro (41) and FUS was shown to promote D-loop formation (34), an essential step in the repair of DSBs through the HR pathway (42). Thus, the available evidence suggests that FUS participates in HR repair, possibly through direct actions at DSBs.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


3

FUS may also regulate the DDR through transcriptional mechanisms. Wang et al showed that FUS is recruited to the cyclin D1 (CCND1) promoter through an interaction with sense and anti-sense non-coding CCND1 RNAs. Through inhibition of CREB-binding protein (CBP), FUS acts to repress CCND1 expression in response to DNA damage (43). Finally, the finding that FUS is directly phosphorylated by ATM on Ser-42 and possibly neighboring PIKK consensus motifs in response to DNA damage provides strong circumstantial support for its role in the DDR (44); however, the functional significance of these posttranslational modifications is uncertain. Here, we demonstrate that FUS functions in cis to DNA damage via a PARP-dependent mechanism, which is mediated partially, if not completely, through binding of the RGG2 domain to PAR. In addition, we identify a role for the N-terminal PLD in accumulation of FUS at sites of DNA damage. Finally, FUS is required for efficient DNA repair through both HR and NHEJ pathways and for radioresistance. These data establish that FUS is dynamically regulated by DNA damage and functions downstream of PARP to maintain the stability of the genome. EXPERIMENTAL PROCEDURES Cell culture, DNA damage and drugs—U-2 OS and HEK-293T cell lines were obtained from the American Type Culture Collection (ATCC). The HEK-293 cell lines EJ5-GFP and DR-GFP were a kind gift from Dr. Jeremy Stark (Beckman Research Institute of the City of Hope)(45, 46). HEK-293T and HEK 293 cell lines were grown in Dulbecco’s Modified Eagle Medium (Cellgro). The U-2 OS cell line was grown in McCoy’s medium. ATM (KU-55933) and PARP (PJ34) inhibitors (Calbiochem) were used at a final concentration of 20 µM and 1 µM, respectively. DNA-PK inhibitor (NU-7441) (R and D Systems) was used at a final concentration of 5 µM. All of the inhibitors were applied 1 h prior to subsequent analysis. IR was delivered using a JL Shepherd Model JL-109 irradiator with a 137Cs source at 4.03 Gy/minute. Plasmids and transfections—The GFP-Myc-FUS(WT), GFP-Myc-FUS(R521G) and GFP-

Myc-FUS(R524S) plasmids were a kind gift from Dr. Robert Baloh (Cedars-Sinai Medical Center). The GFP-FUS plasmid was a kind gift from Dr. Lawrence Hayward (University of Massachusetts Medical School) and was used for the generation of the following mutants: S42A, S26A/S42A/S61A/S84A (FUS4A), and C428A/C444A/C447A. pCI-NEO FUS(4F-L) was a kind gift from Dr. Udai Pandey (Louisiana State University Health Sciences Center) and was cloned into pCDNA5/FRT/TO/GFP (Addgene plasmid 19444 (47). EWSR1 was cloned into pCDNA5/FRT/TO/GFP from pDEST/EWSR1 (Addgene plasmid 26377) (48). The mCherry and I-SceI plasmids were a kind gift from Dr. Sandra Weller (University of Connecticut Health Center). Point mutants were generated using primers designed by the QuikChange primer design program from Agilent Technologies. N-terminal truncation mutants (Δ1-285, Δ1-374, Δ1-467) were created using primers generating an internal start codon and were cloned into pCDNA5/FRT/TO/GFP. All primers were purchased from Integrated DNA Technologies (IDT). The internal deletion mutant, Δ204-475, was generated through the digestion of a full-length PCR product with BSPHI and EcoRI, which removes the RRM (33). The fragments flanking the RRM were purified and ligated to yield Δ204-475. Mutations were verified by direct sequencing. All transfections were performed using Lipofectamine 2000 (Invitrogen) following the manufacturer’s instructions. Cells were analyzed 24-72h post-transfection. Laser microirradiation—U-2 OS cells were plated onto 35 mm glass-bottom dishes (MatTek Corporation). Cells were either transfected using the outlined procedure or used directly for microirradiation. Cells were pre-sensitized with 10 µg/mL Hoechst 33342 (Invitrogen) for 20 minutes at 37°C. Microirradiation was performed with an A1R confocal microscope (Nikon) equipped with a 37°C heating stage and 405-nm laser diode focused through a 60X Plan APO VC/1.4 oil objective. All microirradiation was performed using a laser power output of 40%. Live cell imaging was monitored using NIS-Elements


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


4

viewer software (Nikon). Quantification of images was performed using ImageJ (NIH) software. Lentivirus—The pLKO.1 system was used to package lentiviruses and deliver short hairpin RNA (shRNA). The following shRNA target sequences were designed using the RNAi Consortium online tool (Broad Institute) and were cloned into pLKO.1-TRC (Addgene plasmid 10878)(49), according to the manufacturer’s suggestions: FUS #1 5’-ATGAATGCAACCAGTGTAAGG-3’; FUS #2 5’-CAATTCCTGATCACCCAAGGG-3’; CtIP 5’- CGGCAGCAGAATCTTAAACTT-3’; Lig4 5’- GCCCGTGAATATGATTGCTAT-3’. Addgene plasmid 1864 containing a non-targeting (NT) shRNA was used as the control (50). Lentiviral particles were produced by transient transfection of HEK-293T cells with pLKO.1, psPAX2 (Addgene plasmid 12260), and pMD2.G (Addgene plasmid 12259) in a ratio of 4:3:1. U-2 OS, HEK-293 EJ5-GFP and HEK-293 DR-GFP cells were infected with lentivirus and maintained in 1.5 µg/mL puromycin. Immunofluorescence microscopy (IF) —Cells adhered to glass coverslips were washed with phosphate-buffered saline (PBS), fixed with 4% paraformaldehyde, and permeabilized with 0.2% Triton-X 100 in PBS at room temperature (RT). Where indicated, cells were pre-extracted with CSK buffer (10 mM HEPES pH 7.4, 300 mM Sucrose, 100 mM NaCl, 3 mM MgCl2, 0.5% Triton-X 100) for 2 min on ice. Cells were blocked in 3% BSA for 30 minutes at RT and then incubated overnight at 4°C with the indicated antibodies including: EWSR1 (Millipore #DR1063), γH2AX (Millipore #05636), FUS (Santa Cruz (SC) #47711), and MDC1 (Sigma #HPA006915). Cells were then incubated with either Alexa Fluor-488 or Alexa Fluor-594 secondary antibodies (Invitrogen) for 1 h at RT. Images were captured using an A1R confocal microscope (Nikon) equipped with a 60X Plan APO VC/1.4 oil objective and processed using Image J software. Western blotting—U-2 OS, HEK-293 EJ5-GFP and HEK-293 DR-GFP cells were washed with PBS and lysed in ice-cold cell lysis buffer (50 mM Tris buffer, pH 7.5, 300 mM NaCl, 10% glycerol, 0.5% Triton-X 100, 2 mM MgCl2, 3 mM

EDTA) supplemented with protease and phosphatase inhibitors. Cell extracts were clarified by centrifugation at 20,000 X g for 10 minutes. Proteins were denatured and resolved by SDS-PAGE, transferred to polyvinylidene difluoride (PVDF) membranes, and probed with the indicated primary antibodies including: DNA-PKcs (Neomarker #MS423), FUS (SC #47711), GFP (SC # 9996), HA (Roche #11667475001), HSP90 (Cell Signaling #4877), KU70 (SC #1487), Lig4 (Abcam #80514), and PAR (Trevigen #4336-BPC-100). Quantitative real-time PCR—Total RNA was prepared using Trizol (Life Technologies) according to the manufacturer’s protocol. The cDNA was generated from 2 µg of total RNA by reverse transcription using the iScript cDNA synthesis kit (Bio-Rad). Two percent of the synthesized cDNA reaction was subjected to reaction in a MyiQ real-time PCR (Bio-Rad) with FastStart DNA Master SYBR Green I (Roche Applied Science). CtIP primers used were: (Forward) 5’- AGACAGTTTCTCCCAAGCAG -3’; (Reverse) 5’- CATCACCTTTAAAATACGGCTCC -3’. Primers were designed using SciTools Real-Time PCR Primer Design Tool (IDT). Colony-forming assay—Early passage U-2 OS cells expressing NT, FUS #1, or FUS #2 shRNA were plated at a low density and allowed to adhere overnight. Cells were exposed to the indicated dose of IR and incubated for an additional 10-14 days with fresh media supplemented every 5 days. Subsequently, cells were harvested, fixed with methanol, and stained with 0.5% crystal violet. The results were normalized to plating efficiency. PAR-binding assays—HA-FUS was transiently expressed in U-2 OS cells and purified with HA-Agarose beads (Sigma #A2095). Alternatively, endogenous FUS was immunopreciptated (FUS antibody Abcam #23439) from U-2 OS cells expressing either a NT control shRNA or FUS #2 shRNA. Finally, GFP, GFP-FUS, or GFP-FUS(RGG2) were transiently expressed in U-2 OS cells and purified using antibody against GFP. Immunoprecipitates were vigorously washed in Hi-salt lysis buffer adjusted to 500 mM NaCl


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


5

and incubated with 25 nM PAR in TBST (0.1% Tween 20) containing 300 mM NaCl for 1 h. The immunoprecipitates were washed in TBST adjusted to 500 mM NaCl and resuspended with Laemmli-buffer, boiled and spotted onto nitrocellulose membrane. Immunoblotting was performed with the indicated antibodies. DNA repair assays—The measurement of NHEJ- and HR-mediated DSB repair has been described previously (45, 46). Briefly, 1.25x106 HEK-293 EJ5-GFP or DR-GFP cells expressing shRNA against a NT control, FUS, CtIP or Lig4 were seeded onto 60 mm plates. The following day cells were transfected with plasmids expressing I-SceI and mCherry using Lipofectamine 2000. After approximately 72 h the cells were harvested and analyzed by flow-cytometry for GFP and mCherry expression. mCherry served as a transfection control. GFP expression was normalized to transfection efficiency. RESULTS FUS and EWSR1 are recruited to sites of DNA damage—Given that RNA processing factors, including RBMX, PPM1G, THRAP3, hnRNPUL1 and -2, and NONO (51-54) have been shown to participate in the DDR and localize to DNA-damage sites, we examined whether this was true for FUS. Human U-2 OS cells were sensitized with Hoechst dye followed by microirradiation with a 405 nm laser. Under these conditions, we observed a robust accumulation of GFP-FUS at DNA damage tracks as marked by staining for γH2AX or MDC1 (Fig. 1A). It should be noted that we did not detect FUS accumulation within microirradiated regions in the absence of Hoechst pre-sensitization. Interestingly, although we observed the recruitment of both FUS and MDC1, very little colocalization within the stripe was observed suggesting that these proteins occupy spatially distinct sites at damaged chromatin (Fig. 1A). In addition to concentrated GFP-FUS at laser stripes, we observed a subpopulation within structures that resembled nucleoli (Fig. 1A). Finally, we examined the subnuclear localization of TAR DNA-binding protein 43 (TDP-43), an RBP that

interacts with FUS and whose mutation is also causal for inherited forms of ALS (55-60); however, GFP-TDP-43 did not accumulate at sites of laser-induced DNA damage (LIDD) under conditions that clearly led to recruitment of GFP-FUS (Fig. 1A). As shown in Fig. 1B, GFP-FUS accumulation at LIDD was detectable as early as 20 sec post-damage with peak intensity at approximately 5 min. The nucleolar subpopulation of GFP-FUS was also observed prior to UV exposure suggesting that FUS may be a constituent of nucleoli in undamaged cells. Interestingly, upon damage, the intensity of this population decreased significantly (Fig. 1B compare 20 sec and 5 min), but then increased at later time points (Fig. 1B compare 5 min and 30 min). Finally, although we were unable to detect FUS accumulation at IR-induced foci (IRIF), we did observe the accumulation of endogenous FUS at LIDD (Fig. 1C). Similar to results observed with GFP-FUS, the majority of FUS did not colocalize with MDC1 (Fig. 1C). These data demonstrate that upon DNA damage, FUS is reorganized within the cell including loss of nucleolar FUS and rapid recruitment to sites of DNA damage. We also examined EWSR1, which is a closely related member of the FET family of RBPs (61). Like GFP-FUS, GFP-EWSR1 rapidly and robustly accumulated at LIDD. However, whereas GFP-FUS recruitment persisted for at least 30 min, GFP-EWSR1 recruitment was extinguished within 20 min (Fig. 1B). In addition, endogenous EWSR1 was also detected at LIDD (Fig. 1C). Thus, rapid targeting to DNA damage is an intrinsic property of both FUS and EWSR1; however, FUS is more persistent at LIDD, suggesting the functions of these proteins may be non-identical. Recruitment of FUS to sites of DNA damage is not disrupted by mutations in the RRM or ZNF—FUS contains a single RRM and ZNF (Fig. 2A) and has been shown to bind RNA, ssDNA, and dsDNA. To examine a potential role for nucleic acid binding in localizing FUS to DNA damage, we utilized GFP-FUS expression constructs harboring mutations in the RRM or ZNF. Mutation of four Phe (305, 341, 359, and 368) to Leu within the RRM (4F-L) severely


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


6

abrogates RNA binding. (63, 64); however, expression of GFP-FUS(4F-L) did not alter recruitment to LIDD (Fig. 2B). Next, we examined a requirement for the ZNF of FUS, which belongs to the RanBP2-type family (65). Based on the participation of Cys 428, 444, and 447 in coordinating zinc (65), we mutated these residues to generate GFP-FUS(C428/444/447A). Similar to the RRM mutant, disruption of the ZNF did not inhibit FUS localization (Fig. 2B). These data suggest that recruitment of FUS to DNA damage is unlikely to involve direct binding to nucleic acid through the RRM or ZNF. In addition, we examined two mutations associated with hereditary ALS, which lie within the predicted nuclear localization signal (NLS) located at the C-terminus of FUS (36). Neither of these mutants abrogated FUS accumulation at LIDD (Fig. 2C). FUS localization to sites of DNA damage is PARP-dependent—ATM and PARP signaling represent two important mechanisms for recruitment of DDR factors to DNA lesions (66). Several ATM and DNA-PK phosphorylation sites have been identified within the Q/G/S/Y-rich region of FUS. Specifically, Ser-42 was shown to be phosphorylated in response to IR in an ATM-dependent manner (44). However, treatment of cells with the ATM inhibitor KU-55933 (ATMi) or the DNA-PK inhibitor NU-7441 (DNA-PKi) did not alter FUS recruitment to LIDD (Fig. 2D). We also mutated Ser-42 to Ala as well as three other Ser residues that have been shown to be phosphorylated by DNA-PK (Ser-26, 61, and 84) to generate GFP-FUS(4A) (44, 67). Neither GFP-FUS(S42A) or FUS4A altered accumulation at LIDD (Fig. 2D). Taken together, these data demonstrate that PIKK signaling does not mediate FUS recruitment to damage sites (Fig. 2D). In contrast, treatment with the PARP inhibitor PJ34 (PARPi) completely blocked FUS accumulation (Fig. 2D). The kinetics of FUS accumulation were comparable to other factors whose recruitment is PARP-dependent (Fig. 1B) (21, 51). Many of these factors are capable of binding to PAR directly; therefore, we tested the ability of FUS to interact with PAR polymers in vitro. HA-FUS

interacted with PAR chains, suggesting that FUS is recruited to damaged chromatin through a direct interaction with PARylated substrates (Fig. 3A). The specificity of the FUS-PAR interaction was confirmed using cell lines rendered deficient for FUS through RNAi (Fig. 3B). The RGG2 domain is sufficient for localization to sites of DNA damage, while the PLD promotes robust accumulation—To begin characterizing the domains responsible for mediating the accumulation of FUS at LIDD, we generated several N-terminal truncation mutants fused to GFP (Fig. 4A). Interestingly, the presence of the RGG2 domain alone was sufficient to mediate localization to DNA damage, albeit with delayed and reduced accumulation relative to full-length FUS (Fig. 4B and C). GFP-FUS(RGG1/2) displayed slightly increased accumulation suggesting that all the RGG domains may contribute to PAR binding (Fig. 4C). Although capable of targeting to LIDD, the maximal accumulation of the N-terminal truncation mutants was ~20% of the full-length FUS protein (Fig. 4C). FUS harbors a low-complexity PLD spanning amino acids 1-239 (30). We hypothesized that this region amplified FUS accumulation at sites of DNA damage, potentially through oligomerization. Therefore, we generated an internal deletion mutant (Δ204-475), which retains the majority of the PLD fused to the RGG2 domain (PLD/RGG2). The recruitment of GFP-FUS(PLD/RGG2) was much stronger than recruitment of GFP-FUS harboring the RGG2 domain alone, but did not reach the level seen for full-length GFP-FUS (Fig. 4B and C). We conclude that the PLD makes a major contribution to FUS targeting to DNA damage. The above results suggested that RGG2 specifies FUS targeting to LIDD through an interaction with PAR. Indeed, recruitment of GFP-FUS(RGG2) to LIDD was completely inhibited by pre-treatment with PARP inhibitor (Fig. 5A). Furthermore, immunoprecipitated GFP-FUS(RGG2) interacted with PAR polymers in vitro to a similar if not greater extent than full-length GFP-FUS (Fig. 5B). Finally, cells depleted of endogenous FUS by


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


7

shRNA displayed a similar recruitment of GFP-FUS(RGG2) to LIDD (data not shown) suggesting that its recruitment was not simply due to an interaction with endogenous FUS protein. Taken together, these data suggest a model whereby the RGG2 domain, possibly in cooperation with the other RGG domains, mediates FUS targeting to DNA damage through interaction with PAR, whereas the PLD amplifies and/or stabilizes FUS accumulation at DNA damage sites. Finally, because microirradiation induces a variety of DNA alterations including SSBs and DSBs as well as base modifications we sought to examine the localization of FUS at defined DSBs using chromatin immunoprecipitation (ChIP). We employed a U-2 OS cell line developed by Legube and colleagues that expresses a 4-hydroxytamoxifen (4-OHT)-inducible AsiSI restriction endonuclease (62). Although γH2AX enrichment was observed at each AsiSI test locus following 4-OHT induction, we failed to detect accumulation of FUS (data not shown). Based on the rapid and transient recruitment of FUS to sites of DNA damage, we may be unable to observe FUS enrichment using this technique. FUS promotes efficient DSB repair—FUS-/-

murine embryonic fibroblasts (MEFs) display increased chromosomal instability and radiosensitivity (40, 41). Therefore, to address a biological requirement for human FUS in the response to DNA damage, we utilized a lentiviral system to stably express short-hairpin RNA (shRNA) in U-2 OS cells against a NT control sequence, a coding sequence (CDS) of FUS mRNA (FUS #1 shRNA), or the 3’ untranslated region (UTR) (FUS #2 shRNA). shRNA mediated knockdown of FUS conferred a modest reduction in clonogenic cell survival in response to a 4 Gy dose of IR (Fig. 6); however, these results fell just short of statistical significance using a 95% confidence interval. It is possible that the residual FUS protein is sufficient to promote radioresistance and/or that EWSR1 fulfills some of the same functions in genome protection. To address the contribution of FUS at sites of DNA damage, we initially focused on a potential

role for FUS in the recruitment of other SSB and DSB-targeted proteins. Both the SSB repair protein XRCC1 and chromatin remodeling factor CHD4 are recruited to DNA damage in a PARP-dependent manner (21, 68); however, depletion of FUS did not disrupt targeting of either XRCC1 or CHD4 (data not shown). In addition, FUS knockdown had no effect on recruitment of histone deacetylase 2 (HDAC2) which also accumulates at sites of DNA damage (data not shown) (69). Similarly, the phosphorylation of ATM substrates, including 53BP1 and CHK2, (70-73) was comparable between irradiated control and FUS-depleted U-2 OS cells, suggesting that FUS is not required for ATM signaling (data not shown). We next tested the impact of FUS silencing on DBS repair, focusing first on NHEJ. We transduced the EJ5-GFP NHEJ reporter cell line developed by Stark and colleagues (46) with FUS or various control shRNAs and measured GFP reactivation upon transient transfection with a plasmid encoding the I-SceI restriction enzyme by flow cytometry. shRNA-mediated knockdown of FUS resulted in a significant (~30%) reduction in NHEJ compared to cells expressing a NT shRNA control (Fig. 7A). For the purposes of comparison, knockdown of the essential NHEJ factor DNA ligase IV (Lig4) caused a >50% reduction of NHEJ in this assay (Fig. 7A). Importantly, FUS depletion did not alter the expression of critical NHEJ factors KU70 and DNA-PKcs (Fig. 7B and C). These findings imply a supportive role for FUS in NHEJ. Previous work has shown that FUS is capable of supporting D-loop formation, which suggests a potential role in HR (34). To test this we used the HEK-293 DR-GFP reporter cell line, which specifically measures repair through HR (46). Knockdown of FUS with either of two shRNAs caused an ~30% reduction in HR efficiency, whereas knockdown of CtIP, which is required for DSB resection (74), resulted in ~50% decrease (Fig. 7D-F). These data suggest that FUS functions in an early step in DSB repair that may be common to both NHEJ and HR.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


8

DISCUSSION In this work, we demonstrated that the RBP FUS is rapidly recruited to DNA lesions in a PARP-dependent manner and is capable of interacting with PAR chains directly. Although other studies have implicated a role for FUS in maintaining resistance to genotoxic stress, possibly via participation in HR repair (34, 40, 41), the present results indicate that FUS functions are required for optimal DSB repair through both NHEJ and HR. FUS joins a growing list of RNA processing factors including RBMX, PPM1G, THRAP3, hnRNPUL1 and -2, and NONO, that are recruited to the proximity of DSBs and whose activities are required for genotoxin resistance and DNA repair (51-54). Substrate PARylation provides molecular scaffolding for the localization of factors involved in DNA repair to sites of damage (20, 42). PARylation also appears to provide a common mechanism for the recruitment of at least a subset of RNA processing factors to DNA damage sites including RBMX and NONO (51, 52, 75). NONO is recruited by virtue of an RRM1 domain-dependent interaction with PAR (52). In contrast, the RRM of FUS is dispensable for recruitment to LIDD, though this does not rule out a contribution of the RRM to FUS functions once it accumulates at DNA damage. Our data indicate that the RGG2 domain interacts with PAR polymers in vitro and mediates the recruitment of FUS to sites of DNA damage. In support of this, FUS was recently identified as a PAR-associated protein through quantitative proteomic approaches (76). The RGG domain of the RNA processing factor hnRNPUL1 mediates recruitment to sites of DNA damage (54, 75), suggesting that this motif may function generally as an atypical PAR-binding domain. The fact that FUS targeting to DNA damage was not fully supported by RGG2 suggests that the other RGG repeats may contribute to PAR binding. It is also possible that PAR-independent interactions contribute to the stable association of FUS with DNA damage. In the hnRNPUL1 paradigm, full recruitment required both the MRN complex and PARP-1 (54, 75). We

envision a similar scenario for FUS, with the low-complexity PLD stabilizing FUS recruitment through heterotypic or homotypic interactions. The FUS PLD has the unusual property of forming hydrogel droplets upon concentration (67, 77) and it was proposed that reversible oligomerization of the PLD plays an important role in the assembly and disassembly of ribonucleoprotein splicing complexes. It is worth considering that a similar oligomerization-dependent mechanism augments the assembly of FUS complexes at DNA damage. Finally, ChIP experiments failed to reveal FUS recruitment to restriction enzyme-induced DSBs (data not shown), suggesting that FUS does not persist at DSBs for long periods of time. Other transient players in DSB repair, including PARP, are also difficult to detect using this method (G. Legube, personal communication). The details of FUS participation in the immediate response to DNA damage are yet to be determined; however, given that FUS silencing impacted both HR and NHEJ, it may act in a process common to both pathways. FUS could potentially facilitate DSB repair by modulating DSB-proximal transcription, and/or through removal of nascently transcribed RNAs. FUS could also deliver non-coding RNAs that are increasingly implicated in DSB repair through unknown mechanisms (78). Non-exclusively, FUS was recently identified as a SUMO E3 ligase for Ebp1 p42 (79), which raises the intriguing possibility that FUS also acts as a SUMO E3 ligase at DSBs. Indeed, a requirement for sumoylation by the E3 ligase enzymes PIAS1 and PIAS4 at DSBs is established (80). Functional analyses of RNA-binding and sumoylation-deficient mutants of FUS will help illuminate the validity of these models. It is also tempting to speculate that oncogenic FUS fusions possess aberrant DSB repair properties. Our results suggest that FUS-CHOP fusion proteins harboring the FUS PLD but lacking RGG repeats are unlikely to support FUS DNA repair activities, and this could be a relevant consideration in FUS-CHOP positive myxoid liposarcomas, which tend to be radiosensitive (81). Finally, given that EWSR1 was also recruited to DNA damage, it may function semi-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


9

redundantly with FUS in DSB repair. Indeed, similar to FUS-/- mice, EWSR1-/- mice are highly sensitive to IR and display defects in meiosis and B-lymphocyte development (82). Future studies will be required to define the relative contributions of FET family RBPs to DSB repair and genome integrity. ______________________________________ Acknowledgments- We would like to thank Jeremy Stark for providing the HEK-293 EJ5-

GFP and DR-GFP cell lines; Robert Baloh for providing the GFP-Myc-FUS WT, R521G, and R524S plasmids; Lawrence Hayward for providing the GFP-FUS plasmid, Udai Pandey for providing the pCI-NEO FUS 4F-L plasmid, and Sandra Weller for providing the I-SceI and mCherry plasmids. This work was supported, in whole or in part, by National Institute of Health Grants CA115783 (to R.S.T) and T32 ES007015 (to A.S.M).

REFERENCES

1. Harper, J. W., and Elledge, S. J. (2007) The DNA damage response: ten years after. Mol Cell 28, 739–745

2. Jackson, S. P., and Bartek, J. (2009) The DNA-damage response in human biology and disease. Nature 461, 1071–1078

3. Matsuoka, S., Ballif, B. A., Smogorzewska, A., McDonald, E. R., Hurov, K. E., Luo, J., Bakalarski, C. E., Zhao, Z., Solimini, N., Lerenthal, Y., Shiloh, Y., Gygi, S. P., and Elledge, S. J. (2007) ATM and ATR substrate analysis reveals extensive protein networks responsive to DNA damage. Science 316, 1160–1166

4. Rogakou, E. P., Pilch, D. R., Orr, A. H., Ivanova, V. S., and Bonner, W. M. (1998) DNA double-stranded breaks induce histone H2AX phosphorylation on serine 139. J Biol Chem 273, 5858–5868

5. Lee, J.-H., and Paull, T. T. (2007) Activation and regulation of ATM kinase activity in response to DNA double-strand breaks. Oncogene 26, 7741–7748

6. Lou, Z., Minter-Dykhouse, K., Franco, S., Gostissa, M., Rivera, M. A., Celeste, A., Manis, J. P., van Deursen, J., Nussenzweig, A., Paull, T. T., Alt, F. W., and Chen, J. (2006) MDC1 maintains genomic stability by participating in the amplification of ATM-dependent DNA damage signals. Mol Cell 21, 187–200

7. Stewart, G. S., Wang, B., Bignell, C. R., Taylor, A. M. R., and Elledge, S. J. (2003) MDC1 is a mediator of the mammalian DNA damage checkpoint. Nature 421, 961–966

8. Stucki, M., Clapperton, J. A., Mohammad, D., Yaffe, M. B., Smerdon, S. J., and Jackson, S. P. (2005) MDC1 directly binds phosphorylated histone H2AX to regulate cellular responses to DNA double-strand breaks. Cell 123, 1213–1226

9. Sakasai, R., and Tibbetts, R. (2008) RNF8-dependent and RNF8-independent regulation of 53BP1 in response to DNA damage. J Biol Chem 283, 13549–13555

10. Mailand, N., Bekker-Jensen, S., Faustrup, H., Melander, F., Bartek, J., Lukas, C., and Lukas, J. (2007) RNF8 ubiquitylates histones at DNA double-strand breaks and promotes assembly of repair proteins. Cell 131, 887–900

11. Wang, B., and Elledge, S. J. (2007) Ubc13/Rnf8 ubiquitin ligases control foci formation of the Rap80/Abraxas/Brca1/Brcc36 complex in response to DNA damage. Proc Natl Acad Sci USA 104, 20759–20763

12. Stewart, G. S., Panier, S., Townsend, K., Al-Hakim, A. K., Kolas, N. K., Miller, E. S., Nakada, S., Ylanko, J., Olivarius, S., Mendez, M., Oldreive, C., Wildenhain, J., Tagliaferro, A., Pelletier, L., Taubenheim, N., Durandy, A., Byrd, P. J., Stankovic, T., Taylor, A. M. R., and Durocher, D. (2009) The RIDDLE syndrome protein mediates a ubiquitin-dependent signaling cascade at sites of DNA damage. Cell 136, 420–434

13. Doil, C., Mailand, N., Bekker-Jensen, S., Menard, P., Larsen, D. H., Pepperkok, R., Ellenberg, J., Panier, S., Durocher, D., Bartek, J., Lukas, J., and Lukas, C. (2009) RNF168 binds and amplifies ubiquitin conjugates on damaged chromosomes to allow accumulation of repair proteins. Cell 136, 435–446

14. Kolas, N. K., Chapman, J. R., Nakada, S., Ylanko, J., Chahwan, R., Sweeney, F. D., Panier, S., Mendez, M., Wildenhain, J., Thomson, T. M., Pelletier, L., Jackson, S. P., and Durocher, D. (2007) Orchestration of the DNA-damage response by the RNF8 ubiquitin ligase. Science 318, 1637–1640


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


10

15. Chapman, J. R., Taylor, M. R. G., and Boulton, S. J. (2012) Playing the end game: DNA double-strand break repair pathway choice. Mol Cell 47, 497–510

16. Langelier, M.-F., Planck, J. L., Roy, S., and Pascal, J. M. (2012) Structural basis for DNA damage-dependent poly(ADP-ribosyl)ation by human PARP-1. Science 336, 728–732

17. Eustermann, S., Videler, H., Yang, J.-C., Cole, P. T., Gruszka, D., Veprintsev, D., and Neuhaus, D. (2011) The DNA-binding domain of human PARP-1 interacts with DNA single-strand breaks as a monomer through its second zinc finger. J Mol Biol 407, 149–170

18. Huber, A., Bai, P., de Murcia, J. M., and de Murcia, G. (2004) PARP-1, PARP-2 and ATM in the DNA damage response: functional synergy in mouse development. DNA Repair (Amst) 3, 1103–1108

19. Wang, M., Wu, W., Wu, W., Rosidi, B., Zhang, L., Wang, H., and Iliakis, G. (2006) PARP-1 and Ku compete for repair of DNA double strand breaks by distinct NHEJ pathways. Nucleic Acids Res 34, 6170–6182

20. De Vos, M., Schreiber, V., and Dantzer, F. (2012) The diverse roles and clinical relevance of PARPs in DNA damage repair: current state of the art. Biochem. Pharmacol. 84, 137–146

21. Polo, S. E., Kaidi, A., Baskcomb, L., Galanty, Y., and Jackson, S. P. (2010) Regulation of DNA-damage responses and cell-cycle progression by the chromatin remodelling factor CHD4. EMBO J 29, 3130–3139

22. Chou, D. M., Adamson, B., Dephoure, N. E., Tan, X., Nottke, A. C., Hurov, K. E., Gygi, S. P., Colaiácovo, M. P., and Elledge, S. J. (2010) A chromatin localization screen reveals poly (ADP ribose)-regulated recruitment of the repressive polycomb and NuRD complexes to sites of DNA damage. Proc Natl Acad Sci USA 107, 18475–18480

23. Smeenk, G., Wiegant, W. W., Vrolijk, H., Solari, A. P., Pastink, A., and van Attikum, H. (2010) The NuRD chromatin-remodeling complex regulates signaling and repair of DNA damage. J. Cell Biol. 190, 741–749

24. Lai, A. Y., and Wade, P. A. (2011) Cancer biology and NuRD: a multifaceted chromatin remodelling complex. Nat Rev Cancer 11, 588–596

25. Bertolotti, A., Lutz, Y., Heard, D. J., Chambon, P., and Tora, L. (1996) hTAF(II)68, a novel RNA/ssDNA-binding protein with homology to the pro-oncoproteins TLS/FUS and EWS is associated with both TFIID and RNA polymerase II. EMBO J 15, 5022–5031

26. Stolow, D. T., and Haynes, S. R. (1995) Cabeza, a Drosophila gene encoding a novel RNA binding protein, shares homology with EWS and TLS, two genes involved in human sarcoma formation. Nucleic Acids Res 23, 835–843

27. Crozat, A., Aman, P., Mandahl, N., and Ron, D. (1993) Fusion of CHOP to a novel RNA-binding protein in human myxoid liposarcoma. Nature 363, 640–644

28. Rabbitts, T. H., Forster, A., Larson, R., and Nathan, P. (1993) Fusion of the dominant negative transcription regulator CHOP with a novel gene FUS by translocation t(12;16) in malignant liposarcoma. Nat Genet 4, 175–180

29. Law, W. J., Cann, K. L., and Hicks, G. G. (2006) TLS, EWS and TAF15: a model for transcriptional integration of gene expression. Brief Funct Genomic Proteomic 5, 8–14

30. Gitler, A. D., and Shorter, J. (2011) RNA-binding proteins with prion-like domains in ALS and FTLD-U. Prion 5, 179–187

31. Iko, Y., Kodama, T. S., Kasai, N., Oyama, T., Morita, E. H., Muto, T., Okumura, M., Fujii, R., Takumi, T., Tate, S.-I., and Morikawa, K. (2004) Domain architectures and characterization of an RNA-binding protein, TLS. J Biol Chem 279, 44834–44840

32. Prasad, D. D., Ouchida, M., Lee, L., Rao, V. N., and Reddy, E. S. (1994) TLS/FUS fusion domain of TLS/FUS-erg chimeric protein resulting from the t(16;21) chromosomal translocation in human myeloid leukemia functions as a transcriptional activation domain. Oncogene 9, 3717–3729

33. Zinszner, H., Sok, J., Immanuel, D., Yin, Y., and Ron, D. (1997) TLS (FUS) binds RNA in vivo and engages in nucleo-cytoplasmic shuttling. J Cell Sci 110 ( Pt 15), 1741–1750

34. Baechtold, H., Kuroda, M., Sok, J., Ron, D., Lopez, B. S., and Akhmedov, A. T. (1999) Human 75-kDa DNA-pairing protein is identical to the pro-oncoprotein TLS/FUS and is able to promote D-loop formation. J Biol Chem 274, 34337–34342

35. Perrotti, D., Bonatti, S., Trotta, R., Martinez, R., Skorski, T., Salomoni, P., Grassilli, E., Lozzo, R. V., Cooper, D. R., and Calabretta, B. (1998) TLS/FUS, a pro-oncogene involved in multiple chromosomal translocations, is a novel regulator of BCR/ABL-mediated leukemogenesis. EMBO J 17, 4442–4455


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


11

36. Lagier-Tourenne, C., Polymenidou, M., and Cleveland, D. W. (2010) TDP-43 and FUS/TLS: emerging roles in RNA processing and neurodegeneration. Hum Mol Genet 19, R46–64

37. Schwartz, J. C., Ebmeier, C. C., Podell, E. R., Heimiller, J., Taatjes, D. J., and Cech, T. R. (2012) FUS binds the CTD of RNA polymerase II and regulates its phosphorylation at Ser2. Genes Dev 26, 2690–2695

38. Vance, C., Rogelj, B., Hortobágyi, T., De Vos, K. J., Nishimura, A. L., Sreedharan, J., Hu, X., Smith, B., Ruddy, D., Wright, P., Ganesalingam, J., Williams, K. L., Tripathi, V., Al-Saraj, S., Al-Chalabi, A., Leigh, P. N., Blair, I. P., Nicholson, G., de Belleroche, J., Gallo, J.-M., Miller, C. C., and Shaw, C. E. (2009) Mutations in FUS, an RNA processing protein, cause familial amyotrophic lateral sclerosis type 6. Science 323, 1208–1211

39. Kwiatkowski, T. J., Bosco, D. A., Leclerc, A. L., Tamrazian, E., Vanderburg, C. R., Russ, C., Davis, A., Gilchrist, J., Kasarskis, E. J., Munsat, T., Valdmanis, P., Rouleau, G. A., Hosler, B. A., Cortelli, P., de Jong, P. J., Yoshinaga, Y., Haines, J. L., Pericak-Vance, M. A., Yan, J., Ticozzi, N., Siddique, T., McKenna-Yasek, D., Sapp, P. C., Horvitz, H. R., Landers, J. E., and Brown, R. H. (2009) Mutations in the FUS/TLS gene on chromosome 16 cause familial amyotrophic lateral sclerosis. Science 323, 1205–1208

40. Kuroda, M., Sok, J., Webb, L., Baechtold, H., Urano, F., Yin, Y., Chung, P., de Rooij, D. G., Akhmedov, A., Ashley, T., and Ron, D. (2000) Male sterility and enhanced radiation sensitivity in TLS(-/-) mice. EMBO J 19, 453–462

41. Hicks, G. G., Singh, N., Nashabi, A., Mai, S., Bozek, G., Klewes, L., Arapovic, D., White, E. K., Koury, M. J., Oltz, E. M., Van Kaer, L., and Ruley, H. E. (2000) Fus deficiency in mice results in defective B-lymphocyte development and activation, high levels of chromosomal instability and perinatal death. Nat Genet 24, 175–179

42. Thompson, L. H. (2012) Recognition, signaling, and repair of DNA double-strand breaks produced by ionizing radiation in mammalian cells: The molecular choreography. Mutat Res 751, 158–246

43. Wang, X., Arai, S., Song, X., Reichart, D., Du, K., Pascual, G., Tempst, P., Rosenfeld, M. G., Glass, C. K., and Kurokawa, R. (2008) Induced ncRNAs allosterically modify RNA-binding proteins in cis to inhibit transcription. Nature 454, 126–130

44. Gardiner, M., Toth, R., Vandermoere, F., Morrice, N. A., and Rouse, J. (2008) Identification and characterization of FUS/TLS as a new target of ATM. Biochem J 415, 297–307

45. Pierce, A. J., Johnson, R. D., Thompson, L. H., and Jasin, M. (1999) XRCC3 promotes homology-directed repair of DNA damage in mammalian cells. Genes Dev 13, 2633–2638

46. Bennardo, N., Cheng, A., Huang, N., and Stark, J. M. (2008) Alternative-NHEJ is a mechanistically distinct pathway of mammalian chromosome break repair. PLoS Genet. 4, e1000110

47. Hageman, J., and Kampinga, H. H. (2009) Computational analysis of the human HSPH/HSPA/DNAJ family and cloning of a human HSPH/HSPA/DNAJ expression library. Cell Stress Chaperones 14, 1–21

48. Hoell, J. I., Larsson, E., Runge, S., Nusbaum, J. D., Duggimpudi, S., Farazi, T. A., Hafner, M., Borkhardt, A., Sander, C., and Tuschl, T. (2011) RNA targets of wild-type and mutant FET family proteins. Nat Struct Mol Biol 18, 1428–1431

49. Stewart, S. A., Dykxhoorn, D. M., Palliser, D., Mizuno, H., Yu, E. Y., An, D. S., Sabatini, D. M., Chen, I. S. Y., Hahn, W. C., Sharp, P. A., Weinberg, R. A., and Novina, C. D. (2003) Lentivirus-delivered stable gene silencing by RNAi in primary cells. RNA 9, 493–501

50. Sarbassov, D. D., Guertin, D. A., Ali, S. M., and Sabatini, D. M. (2005) Phosphorylation and regulation of Akt/PKB by the rictor-mTOR complex. Science 307, 1098–1101

51. Adamson, B., Smogorzewska, A., Sigoillot, F. D., King, R. W., and Elledge, S. J. (2012) A genome-wide homologous recombination screen identifies the RNA-binding protein RBMX as a component of the DNA-damage response. Nat Cell Biol 14, 318–328

52. Krietsch, J., Caron, M.-C., Gagné, J.-P., Ethier, C., Vignard, J., Vincent, M., Rouleau, M., Hendzel, M. J., Poirier, G. G., and Masson, J.-Y. (2012) PARP activation regulates the RNA-binding protein NONO in the DNA damage response to DNA double-strand breaks. Nucleic Acids Res

53. Beli, P., Lukashchuk, N., Wagner, S. A., Weinert, B. T., Olsen, J. V., Baskcomb, L., Mann, M., Jackson, S. P., and Choudhary, C. (2012) Proteomic Investigations Reveal a Role for RNA Processing Factor THRAP3 in the DNA Damage Response. Mol Cell

54. Polo, S. E., Blackford, A. N., Chapman, J. R., Baskcomb, L., Gravel, S., Rusch, A., Thomas, A.,


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


12

Blundred, R., Smith, P., Kzhyshkowska, J., Dobner, T., Taylor, A. M. R., Turnell, A. S., Stewart, G. S., Grand, R. J., and Jackson, S. P. (2012) Regulation of DNA-end resection by hnRNPU-like proteins promotes DNA double-strand break signaling and repair. Mol Cell 45, 505–516

55. Gitcho, M. A., Baloh, R. H., Chakraverty, S., Mayo, K., Norton, J. B., Levitch, D., Hatanpaa, K. J., White, C. L., Bigio, E. H., Caselli, R., Baker, M., Al-Lozi, M. T., Morris, J. C., Pestronk, A., Rademakers, R., Goate, A. M., and Cairns, N. J. (2008) TDP-43 A315T mutation in familial motor neuron disease. Ann. Neurol. 63, 535–538

56. Sreedharan, J., Blair, I. P., Tripathi, V. B., Hu, X., Vance, C., Rogelj, B., Ackerley, S., Durnall, J. C., Williams, K. L., Buratti, E., Baralle, F., de Belleroche, J., Mitchell, J. D., Leigh, P. N., Al-Chalabi, A., Miller, C. C., Nicholson, G., and Shaw, C. E. (2008) TDP-43 mutations in familial and sporadic amyotrophic lateral sclerosis. Science 319, 1668–1672

57. Kabashi, E., Bercier, V., Lissouba, A., Liao, M., Brustein, E., Rouleau, G. A., and Drapeau, P. (2011) FUS and TARDBP but Not SOD1 Interact in Genetic Models of Amyotrophic Lateral Sclerosis. PLoS Genet. 7, e1002214

58. Yokoseki, A., Shiga, A., Tan, C.-F., Tagawa, A., Kaneko, H., Koyama, A., Eguchi, H., Tsujino, A., Ikeuchi, T., Kakita, A., Okamoto, K., Nishizawa, M., Takahashi, H., and Onodera, O. (2008) TDP-43 mutation in familial amyotrophic lateral sclerosis. Ann. Neurol. 63, 538–542

59. Van Deerlin, V. M., Leverenz, J. B., Bekris, L. M., Bird, T. D., Yuan, W., Elman, L. B., Clay, D., Wood, E. M., Chen-Plotkin, A. S., Martinez-Lage, M., Steinbart, E., McCluskey, L., Grossman, M., Neumann, M., Wu, I.-L., Yang, W.-S., Kalb, R., Galasko, D. R., Montine, T. J., Trojanowski, J. Q., Lee, V. M.-Y., Schellenberg, G. D., and Yu, C.-E. (2008) TARDBP mutations in amyotrophic lateral sclerosis with TDP-43 neuropathology: a genetic and histopathological analysis. Lancet Neurol 7, 409–416

60. Kühnlein, P., Sperfeld, A.-D., Vanmassenhove, B., Van Deerlin, V., Lee, V. M.-Y., Trojanowski, J. Q., Kretzschmar, H. A., Ludolph, A. C., and Neumann, M. (2008) Two German kindreds with familial amyotrophic lateral sclerosis due to TARDBP mutations. Arch. Neurol. 65, 1185–1189

61. Couthouis, J., Hart, M. P., Erion, R., King, O. D., Diaz, Z., Nakaya, T., Ibrahim, F., Kim, H.-J., Mojsilovic-Petrovic, J., Panossian, S., Kim, C. E., Frackelton, E. C., Solski, J. A., Williams, K. L., Clay-Falcone, D., Elman, L., McCluskey, L., Greene, R., Hakonarson, H., Kalb, R. G., Lee, V. M.-Y., Trojanowski, J. Q., Nicholson, G. A., Blair, I. P., Bonini, N. M., Van Deerlin, V. M., Mourelatos, Z., Shorter, J., and Gitler, A. D. (2012) Evaluating the role of the FUS/TLS-related gene EWSR1 in amyotrophic lateral sclerosis. Hum Mol Genet

62. Iacovoni, J. S., Caron, P., Lassadi, I., Nicolas, E., Massip, L., Trouche, D., and Legube, G. (2010) High-resolution profiling of gammaH2AX around DNA double strand breaks in the mammalian genome. EMBO J 29, 1446–1457

63. Daigle, J. G., Lanson, N. A., Smith, R. B., Casci, I., Maltare, A., Monaghan, J., Nichols, C. D., Kryndushkin, D., Shewmaker, F., and Pandey, U. B. (2012) RNA binding ability of FUS regulates neurodegeneration, cytoplasmic mislocalization and incorporation into stress granules associated with FUS carrying ALS-linked mutations. Hum Mol Genet

64. Sun, Z., Diaz, Z., Fang, X., Hart, M. P., Chesi, A., Shorter, J., and Gitler, A. D. (2011) Molecular determinants and genetic modifiers of aggregation and toxicity for the ALS disease protein FUS/TLS. PLoS Biol. 9, e1000614

65. Nguyen, C. D., Mansfield, R. E., Leung, W., Vaz, P. M., Loughlin, F. E., Grant, R. P., and Mackay, J. P. (2011) Characterization of a family of RanBP2-type zinc fingers that can recognize single-stranded RNA. J Mol Biol 407, 273–283

66. Ciccia, A., and Elledge, S. J. (2010) The DNA damage response: making it safe to play with knives. Mol Cell 40, 179–204

67. Han, T. W., Kato, M., Xie, S., Wu, L. C., Mirzaei, H., Pei, J., Chen, M., Xie, Y., Allen, J., Xiao, G., and McKnight, S. L. (2012) Cell-free formation of RNA granules: bound RNAs identify features and components of cellular assemblies. Cell 149, 768–779

68. Okano, S., Lan, L., Caldecott, K. W., Mori, T., and Yasui, A. (2003) Spatial and temporal cellular responses to single-strand breaks in human cells. Mol Cell Biol 23, 3974–3981

69. Miller, K. M., Tjeertes, J. V., Coates, J., Legube, G., Polo, S. E., Britton, S., and Jackson, S. P. (2010) Human HDAC1 and HDAC2 function in the DNA-damage response to promote DNA nonhomologous end-joining. Nat Struct Mol Biol 17, 1144–1151

70. Muñoz, I. M., Jowsey, P. A., Toth, R., and Rouse, J. (2007) Phospho-epitope binding by the BRCT


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


13

domains of hPTIP controls multiple aspects of the cellular response to DNA damage. Nucleic Acids Res 35, 5312–5322

71. Matsuoka, S., Rotman, G., Ogawa, A., Shiloh, Y., Tamai, K., and Elledge, S. J. (2000) Ataxia telangiectasia-mutated phosphorylates Chk2 in vivo and in vitro. Proc Natl Acad Sci USA 97, 10389–10394

72. Melchionna, R., Chen, X. B., Blasina, A., and McGowan, C. H. (2000) Threonine 68 is required for radiation-induced phosphorylation and activation of Cds1. Nat Cell Biol 2, 762–765

73. Ahn, J. Y., Schwarz, J. K., Piwnica-Worms, H., and Canman, C. E. (2000) Threonine 68 phosphorylation by ataxia telangiectasia mutated is required for efficient activation of Chk2 in response to ionizing radiation. Cancer Res 60, 5934–5936

74. Sartori, A. A., Lukas, C., Coates, J., Mistrik, M., Fu, S., Bartek, J., Baer, R., Lukas, J., and Jackson, S. P. (2007) Human CtIP promotes DNA end resection. Nature 450, 509–514

75. Hong, Z., Jiang, J., Ma, J., Dai, S., Xu, T., Li, H., and Yasui, A. (2013) The Role of hnRPUL1 Involved in DNA Damage Response Is Related to PARP1. PLoS ONE 8, e60208

76. Gagné, J.-P., Isabelle, M., Lo, K. S., Bourassa, S., Hendzel, M. J., Dawson, V. L., Dawson, T. M., and Poirier, G. G. (2008) Proteome-wide identification of poly(ADP-ribose) binding proteins and poly(ADP-ribose)-associated protein complexes. Nucleic Acids Res 36, 6959–6976

77. Kato, M., Han, T. W., Xie, S., Shi, K., Du, X., Wu, L. C., Mirzaei, H., Goldsmith, E. J., Longgood, J., Pei, J., Grishin, N. V., Frantz, D. E., Schneider, J. W., Chen, S., Li, L., Sawaya, M. R., Eisenberg, D., Tycko, R., and McKnight, S. L. (2012) Cell-free formation of RNA granules: low complexity sequence domains form dynamic fibers within hydrogels. Cell 149, 753–767

78. Chowdhury, D. Choi, Y.E., and Brault, M.E. (2013) Charity begins at home: non-coding RNA functions in DNA repair. Nat Rev Mol Cell Biol. 14, 181-9.

79. Oh, S.-M., Liu, Z., Okada, M., Jang, S.-W., Liu, X., Chan, C.-B., Luo, H., and Ye, K. (2010) Ebp1 sumoylation, regulated by TLS/FUS E3 ligase, is required for its anti-proliferative activity. Oncogene 29, 1017–1030

80. Galanty, Y., Belotserkovskaya, R., Coates, J., Polo, S., Miller, K. M., and Jackson, S. P. (2009) Mammalian SUMO E3-ligases PIAS1 and PIAS4 promote responses to DNA double-strand breaks. Nature 462, 935–939

81. Pitson, G., Robinson, P., Wilke, D., Kandel, R. A., White, L., Griffin, A. M., Bell, R. S., Catton, C. N., Wunder, J. S., and O'Sullivan, B. (2004) Radiation response: an additional unique signature of myxoid liposarcoma. Int. J. Radiat. Oncol. Biol. Phys. 60, 522–526

82. Li, H., Watford, W., Li, C., Parmelee, A., Bryant, M. A., Deng, C., O'Shea, J., and Lee, S. B. (2007) Ewing sarcoma gene EWS is essential for meiosis and B lymphocyte development. J. Clin. Invest. 117, 1314–1323

FIGURE LEGENDS FIGURE 1. FUS is recruited to sites of DNA damage. (A) Detection of GFP-FUS and GFP-TDP-43 at laser-induced DNA damage (LIDD). U-2 OS cells expressing the indicated GFP-tagged protein were laser microirradiated, fixed within 10 minutes, and processed for indirect IF with the indicated antibodies. (B) Time course of GFP-FUS and GFP-EWSR1 occupancy at DNA damage sites. Cells expressing the indicated GFP-tagged protein were laser microirradiated and monitored by live cell imaging. Shown are representative images from at least two independent experiments. (C) Detection of endogenous FUS and EWSR1 at LIDD. ~50 cells were laser microirradiated within 15 minutes. Cells were extracted prior to fixation and processed with the indicated antibodies. FIGURE 2. PARP-dependent recruitment of FUS to sites of DNA damage. (A) Domain architecture of FUS. Abbreviations: RNA recognition motif (RRM), arginine/glycine-rich (RGG), zinc finger domain (ZNF), nuclear localization signal (L). Mutations in the RRM or ZNF of FUS do not disrupt targeting to DNA damage sites. (B) U-2 OS cells expressing the indicated GFP-FUS constructs were laser microirradiated and monitored by live cell imaging. (C) ALS-associated mutations in FUS do not abrogate localization to LIDD. U-2 OS cells expressing GFP-Myc-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


14

FUS(WT), R521G, or R524S were laser microirradiated and monitored by live cell imaging. (D) FUS localization to sites of DNA damage is PARP-dependent. U-2 OS cells expressing GFP-FUS(WT), S42A, or FUS4A were laser microirradiated and recruitment was monitored by live cell imaging. Where indicated, cells expressing GFP-FUS(WT) were pre-treated with ATM-, DNA-PK-, or PARP-inhibitor for 1h prior to damage. Shown are representative images from at least two independent experiments. FIGURE 3. FUS interacts with PAR. (A) HA-FUS protein was immunopurified from U-2 OS cells and incubated with 25 nM PAR for 1 h. The interaction was examined by dot-blotting with anti-PAR antibody. (B) Endogenous FUS was immunopurified from U-2 OS cells expressing shRNA against either a non-targeting (NT) control sequence or the 3’ UTR of FUS (#2). PAR binding was performed as in A. Shown are representative blots from at least two independent experiments. FIGURE 4. The RGG2 domain is sufficient to accumulate at LIDD. (A) Depiction of FUS truncation and internal deletion mutants used in this study. (B) U-2 OS cells expressing the indicated GFP-FUS constructs were laser microirradiated and monitored by live cell imaging. (C) Quantification of FUS accumulation at sites of DNA damage (purple boxes) at the indicated time points using ImageJ software. FUS accumulation was normalized by subtracting the pre-exposure fluorescence for each cell analyzed. A minimum of five cells were analyzed from two independent experiments. Error bars; SEM from two independent experiments. FIGURE 5. The minimal FUS RGG2 domain binds PAR. (A) U-2 OS cells expressing GFP-FUS(RGG2) were mock or pre-treated with PARP-inhibitor for 1 h prior to laser microirradiation. Recruitment was monitored by live cell imaging. Shown are representative images from at least two independent experiments. (B) GFP alone, GFP-FUS, or GFP-FUS(RGG2) proteins were immunopurified from U-2 OS cells and incubated with 25 nM PAR for 1 h. The interaction was examined by dot-blotting with anti-PAR antibody. Shown are representative blots from at least two independent experiments. FIGURE 6. FUS depletion confers modest radiosensitivity in human cells. (A) Clonogenic survival in response to IR of U-2 OS cells expressing either NT, FUS #1, or FUS #2 shRNA. Error bars; SEM from two independent experiments. (C) Western blot showing FUS expression in shRNA cell lines. FIGURE 7. FUS is required for efficient DSB repair by NHEJ and HR. (A) HEK-293 EJ5-GFP cells or (D) HEK-293 DR-GFP were infected with lentivirus to deliver NT, FUS, Lig4, or CtIP shRNA and incubated for 48 h at which time, cells were transfected with plasmids encoding I-SceI and mCherry and incubated for an additional 72 h. Cells were then harvested and analyzed by (A and D) flow cytometry or Western blotting (B, C, and E). (F) CtIP knockdown by qPCR. Shown in A and D are repair frequencies relative to the NT shRNA control from at least three independent experiments, except for the Lig4 control, which represents technical replicates. Asterisks denote a statistical difference when compared to the NT shRNA control of p<0.01.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

A

B

Figure 1 C

FUS MDC1 MERGE GFP-FUS

GFP-TDP-43

MDC1

γH2AX

MDC1

GFP-FUS

MERGE

MERGE

MERGE MERGE EWSR1 MDC1 MERGE

Time post- microirradiation

GFP-FUS

- 20 sec 2 min 5 min 10 min 20 min 30 min

GFP-EWSR1


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

374 422 463 526

GFP-Myc-FUS(R521G)

GFP-Myc-FUS(R524S)

GFP-Myc-FUS(WT)


- 2 min - 2 min

GFP-FUS(C428/444/ 447A)

GFP-FUS(WT)


B C

A Gly-rich RRM RGG1 ZNF RGG2 L Q/G/S/Y-rich

GFP-FUS(4F-L)

1 165 285 267

GFP-FUS

- 2 min 2 min 2 min

Mock ATMi PARPi - -

D 2 min

DNA-PKi -


2 min GFP-FUS(S42A)

- 2 min

GFP-FUS(4A) -


Figure 2 by guest on A

pril 11, 2018http://w

ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Figure 3

A INPUT IP: HA

EV HA- FUS EV

HA- FUS

HA

FUS

IP: HA

EV HA- FUS

INPUT

PAR 1/100

B IP: FUS

NT FUS #2 shRNA

WB: FUS Input

FUS #2

NT { shR

NA

1 1/5 DILUTION

WB: PAR

WB: PAR


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

165 239

Figure 4

A Prion-Like domain (PLD)

Δ1-285 (RRM/RGG1/2)

Δ1-374 (RGG1/2)

Δ1-467 (RGG2)

Δ204-475 (PLD/RGG2)

- 10 60 120 300 539

Full Length

RRM/RGG1/2

RGG1/2

RGG2

PLD/RGG2

Time post- microirradiation (s)

B

C

Gly-rich RRM RGG1 ZNF RGG2 L Q/G/S/Y-rich 1 285 374 422 463 526

Full Length

RRM RGG1 ZNF RGG2 L

RGG1 ZNF RGG2 L

RGG2 L

Gly-rich Q/G/S/Y-rich RGG2 L

Figure 5

A

- 2 min

Mock Time post-microirradiation - 2 min

PARPi

B

GFP-FUS(RGG2)

Input 1/100

IP: GFP

GFP-FUS

GFP-FUS(RGG2) GFP

WB: PAR

WB: GFP

HSP90

FUS

NT #1 #2

FUS shRNA

B A

Figure 6

Figure 7

NT #1 #2 FUS

shRNA

HSP90

KU70

DNA-PKcs

B

A

HSP90

FUS

NT #1 #2

FUS

shRNA

D

* *

E

C

HSP90

FUS

shRNA NT #1 #2

FUS

HSP90

Lig4

shRNA NT Lig4

F

* * * *

S. TibbettsAdam S. Mastrocola, Sang Hwa Kim, Anthony T. Trinh, Lance A. Rodenkirch and Randal

in Response to DNA DamageThe RNA Binding Protein Fused In Sarcoma (FUS) Functions Downstream of PARP

published online July 5, 2013J. Biol. Chem.

10.1074/jbc.M113.497974Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M113.497974

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;M113.497974v1&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2013/07/05/jbc.M113.497974

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=early/2013/07/05/jbc&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2013/07/05/jbc.M113.497974

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/

the rna binding protein fused in sarcoma (fus) functions

Documents