the role of bacteriophage lambda gpk in tail assembly and ... · the role of bacteriophage lambda...
TRANSCRIPT
![Page 1: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/1.jpg)
The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry
by
David Lawson Coburn
A thesis submitted in conformity with the requirements for the degree of Master of Science
Graduate Department of Molecular Genetics University of Toronto
© Copyright by David Lawson Coburn (2011)
![Page 2: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/2.jpg)
ii
The Role of Bacteriophage Lambda gpK in Tail Assembly and
Host Cell Entry
David Lawson Coburn
Master of Science
Graduate Department of Molecular Genetics
University of Toronto
2011
Abstract
The bacteriophage lambda tail protein gpK is required for tail assembly. The activity of the
protein can be found at the assembling tail tip and is believed to be localized to this structure.
GpK is a 27 kDa protein that has sequence identity to two families of proteins: the Mov34 family
of peptidases and the NlpC/P60 family of peptidoglycan endopeptidases. Point substitutions and
complementation data confirm that gpK possesses each of these domains and that they can
function in trans. When the Mov34 domain is inactivated tail assembly is disrupted whereas
when the NlpC/P60 domain is inactivated tails assemble but are inactive. Evidence is presented
here that the C-terminal domain possesses lytic activity in isolation but not when part of the full-
length protein.
![Page 3: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/3.jpg)
iii
Acknowledgments
Firstly, I must give thanks to my supervisor Dr. Alan Davidson for giving me the opportunity to
complete my Master’s thesis in his laboratory. I am grateful for the advice he has provided me
with and for improving my scientific thinking. I would also like to thank my supervisory
committee members Dr. Lynne Howell, Dr. William Navarre and Dr. Aled Edwards for their
guidance.
Thanks to all the members of the Davidson Lab. They have been an excellent group of people to
work with. I appreciate all the advice and assistance I have received from everyone throughout
my Master’s. I would particularly like to thank Vivek Paul for his advice and assistance with
setting up a suitable assay for testing the lytic activity of gpK.
Thanks must also go to Dr. Gwenael Badis, Shaheynoor Talukder and Dr. Timothy Hughes for
introducing me to academic research and for giving me my first opportunity to experience the
Department of Molecular Genetics.
Most importantly, thanks to all my loved ones for their enduring support.
![Page 4: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/4.jpg)
iv
Table of Contents
Acknowledgments.......................................................................................................................... iii
Table of Contents ........................................................................................................................... iv
List of Tables ................................................................................................................................. vi
List of Figures ............................................................................................................................... vii
List of Abbreviations ................................................................................................................... viii
Chapter 1 Introduction .....................................................................................................................1
1 Introduction .................................................................................................................................1
1.1 Tail assembly in phage lambda ............................................................................................1
1.2 The role of lambda gpK .......................................................................................................3
1.3 The process of DNA injection .............................................................................................5
1.4 Phage associated PG-hydrolases ..........................................................................................6
1.5 The peptidoglycan layer of E. coli .......................................................................................7
1.6 The Mov34 family of proteins .............................................................................................9
1.7 The NlpC/P60 family of proteins .......................................................................................11
1.8 Research goals ...................................................................................................................13
Chapter 2 Materials and Methods ..................................................................................................14
2 Materials and Methods ..............................................................................................................14
2.1 Media and Buffers..............................................................................................................14
2.2 Preparation of Kam phage lysates and titration of phage ..................................................15
2.3 Cloning of the full-length sequence of gene K ..................................................................16
2.4 PCR amplification of the K locus and cloning of each domain in isolation ......................18
2.5 Ligation-independent cloning (LIC) ..................................................................................18
2.6 Generation of lambda lysogens in non-suppressor strains and confirmation of
lysogeny .............................................................................................................................18
![Page 5: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/5.jpg)
v
2.7 Preparation and transformation of competent cells ...........................................................19
2.8 In vivo complementation assays.........................................................................................19
2.9 Mutagenesis techniques .....................................................................................................20
2.10 Protein expression and purification ..................................................................................20
2.11 Determination of protein concentration ............................................................................21
2.12 Circular dichroism spectroscopy.......................................................................................21
2.13 Purification, visualization and activity of lambda tails from the pETail plasmid ............21
2.14 SDS-PAGE and Western Blotting ....................................................................................22
2.15 PG hydrolysis assay using chloroform treated E. coli ......................................................22
2.16 Cell lysis assay by lambda holin co-expression and release of β-galactosidase ...............23
Chapter 3 Results ...........................................................................................................................24
3 Results .......................................................................................................................................24
3.1 Correction of the sequence of lambda gene K and the position of Kam mutants ..............24
3.2 Complementation of a Kam phage with plasmid-expressed gpK ......................................25
3.3 Identification of important residues for the function of gpK in vivo .................................26
3.4 Lambda gpK consists of two separate domains .................................................................28
3.5 Assembly of lambda tails from the pETail plasmid ...........................................................29
3.6 Evaluation of the function of gpK as a PG-degrading enzyme .........................................31
Chapter 4 Discussion .....................................................................................................................35
4 Discussion .................................................................................................................................35
References ......................................................................................................................................41
![Page 6: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/6.jpg)
vi
List of Tables
Table 1. Strains used in this work ................................................................................................. 14
Table 2. Primers used in this work................................................................................................ 16
![Page 7: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/7.jpg)
vii
List of Figures
Figure 1. Transmission electron micrograph of phage lambda....................................................... 1
Figure 2. Schematic of lambda tail assembly ................................................................................. 2
Figure 3. Alignment of gpK homologues in tailed phages. ............................................................ 4
Figure 4. Schematic of E. coli peptidoglycan. ................................................................................ 8
Figure 5. The active site of AfJAMM. .......................................................................................... 10
Figure 6. The active site of Spr. .................................................................................................... 11
Figure 7. Alignment of current lambda gene K sequence and K from Kam phages. .................... 24
Figure 8. Complementation of Kam phages with gpK and its purification. ................................. 26
Figure 9. Residues of functional importance for gpK................................................................... 27
Figure 10. Complementation of Kam phage with domains supplied in trans. ............................. 29
Figure 11. Activity (titre) and assembly of tails produced from wild-type (WT) and point
substitutions of gpK. ..................................................................................................................... 30
Figure 12. Examination of the ability of purified gpK to lyse CHCl3-treated cells. ..................... 31
Figure 13. Cell lysis by holin co-expression assay. ...................................................................... 32
Figure 14. Cell lysis by release of β-galactosidase assay. ............................................................ 33
Figure 15. Model of peptidoglycan lysis by the CTD of gpK. ..................................................... 39
![Page 8: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/8.jpg)
viii
List of Abbreviations
BLAST Basic local alignment search algorithm
CHAP Cysteine, histidine-dependent amidohydrolase/peptidase
CTD C-terminal domain
DAP Diaminopimelic acid
DNA Deoxyribonucleic acid
dNTPs Deoxyribonucleotide triphosphates
DTT Dithiothreitol
LIC Ligation-independent cloning
MPN Mpr1, Pad1 N-terminal
mRNA Messenger ribonucleic acid
Ni-NTA Nickel nitriloacetic acid
NTD N-terminal domain
ONP Ortho-nitrophenol
ONPG Ortho-nitrophenyl-β-D-galactopyranoside
PBS Phosphate-buffered saline
PCR Polymerase chain reaction
pfu Plaque forming units
PG Peptidoglycan
rpm Revolutions per minute
TEM Transmission electron microscope/microscopy
![Page 9: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/9.jpg)
1
Chapter 1 Introduction
1 Introduction
Bacteriophage lambda is one of the most extensively studied biological systems providing
important insights into the mechanisms by which viruses infect their hosts, how genes are
regulated, and the assembly of macromolecular protein structures. Despite decades of research
there are still a number of critical aspects of its biology that remain unknown. This thesis
examines the role of the lambda protein gpK in the assembly of the phage tail and the process of
DNA injection. Previous work has shown that gpK is essential for the formation of lambda tails
and that it is likely positioned in the host-proximal tail tip. The localization of gpK in addition to
the fact that it possesses homology to enzymes involved in the degradation of the bacterial cell
wall suggests it plays an important role in the process of
DNA entry into the host.
Lambda is a double-stranded DNA bacteriophage that
possesses a DNA-housing head and a long non-contractile
tail whose function is critical in host recognition. In the
mature virion, the head is 60 nm in diameter and the tail
structure is 150 nm in length and 9 nm wide (Katsura
1983) as shown in Figure 1. These head and tail structures
assemble via independent pathways (Casjens and King
1975) and can be combined together to form infective
phage particles (Weigle 1968). Gene K is one of the 11
genes that are involved in the assembly of the phage tail
(Parkinson 1968). Some of the earlier work on phage
lambda identified the gene products of several of these
genes including gpK, which encodes a 27 kDa protein, by examining the bands that are absent in
amber mutant cell lysates (Murialdo and Siminovitch 1972).
1.1 Tail assembly in phage lambda
Head
Tail
Tail
Figure 1. Transmission electron
micrograph of phage lambda.
Tails are visible with characteristic
striations. Bar is 100 nm.
![Page 10: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/10.jpg)
2
The vast majority of phages (96%) possess tails and most of these have long non-contractile tails
like lambda (Ackermann 2009) making them members of the Siphoviridae family. As the tail
forms the first contacts with the host cell it has a critical role in the infection process. The
lambda tail genes are transcribed as a single mRNA, along with other morphogenetic genes, and
the variation in translation start sequences helps control the relative quantities of each protein
produced (Sampson et al. 1988). How the tail forms has been well characterized in lambda.
Using amber mutants in the 11 tail genes Katsura and Kuhl (1975) were able to determine the
order in which each gene acted. A diagram of tail assembly is presented in Figure 2. The
mechanism was elucidated by preparing cell lysates of lambda lysogens possessing amber
mutations in each tail gene and fractionating them by sucrose gradient centrifugation. This
resulted in the formation of various tail intermediates that migrated at different velocities or S
values in the gradient. Next they added each fraction to crude lysates of all the other tail-
Figure 2. Schematic of lambda tail assembly
Tail assembly begins with the protein gpJ to which gpI, gpL and gpK bind forming a
15 S initiator complex. The tape measure protein, gpH, and gpM are added to this
forming a 25 S complex. To this the major tail protein, gpV, binds in a stack of 32
hexameric disks until polymerization pauses allowing the protein gpU to bind to the
head-proximal end of the tail. The final step of assembly requires the protein gpZ to
form active phage particles.
![Page 11: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/11.jpg)
3
deficient lysates and observed successful complementation by the formation of plaques on a
lawn of bacterial cells. As proteins are added to the assembling tail structure it increases in size
and when a protein is missing, as in lysates of various tail gene amber mutants, assembly is
halted resulting in intermediate structures. If a protein functions early in assembly then its
activity will be found in the upper part of a sucrose gradient in lysates lacking downstream
proteins. For example, the 15 S fraction of an H- lysate can complement a crude J
- lysate, thus
exhibiting J+ activity. In this way they determined tail assembly begins with gpJ forming a 15 S
initiator complex to which gpI, gpL and gpK bind in that order. A larger 25 S structure is formed
by the addition of gpG, gpH and gpM. This structure serves as a platform to which the major tail
protein, gpV, polymerizes to form a stack of 32 hexameric disks forming the tail tube. After
polymerization the tail terminator protein gpU binds as a hexamer on top of the tail tube (Katsura
and Tsugita 1977). The protein gpZ functions at the end of tail assembly to produce a fully-
infective phage particle. The specific role each protein performs is known in some detail; for
example gpJ is the tail fibre by means of which lambda binds its cell-surface receptor LamB
(Wang et al. 2000). The proteins gpL and gpM are able to form pseudo-initiator structures that
allow gpV to polymerize into polytubes (Katsura 1976), thus it is suspected that gpL and gpM
form structural components of the tail. The tape measure protein, gpH, helps determine the
length of the tail while the proteins gpG and gpGT (the result of a -1 translational frameshift)
appear to function as molecular chaperones for gpH, assisting in assembly but not appearing in
the final phage particle (Katsura 1987, Levin et al. 1993). During tail assembly the 90 kDa tape
measure protein undergoes a cleavage reaction at its C-terminus around the time that gpU acts to
form a 78 kDa product gpH* (Tsui and Hendrix 1983, Walker et al. 1982). The purpose of this
proteolysis is not entirely clear but it has been hypothesized that it could serve as an energy store
aiding in the DNA injection process (Katsura 1983).
1.2 The role of lambda gpK
The protein gpK acts early in the process of tail assembly. It is the fourth protein to act because
the 15 S fraction of a K- lysate possesses J
+, I
+, and L
+ activity (Katsura 1976). The function of
gpL is clearly upstream of gpK because the 15 S fraction of an L- lysate does not exhibit K
+
activity and downstream of gpJ and gpI because it complements J- and I
- lysates. The fact that
the activity of gpK sediments with the 15 S structure where the tail fibre gpJ is found suggests
![Page 12: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/12.jpg)
4
that gpK would form a component of the tail tip. K- lysates exhibit a curious feature in that their
400 S fraction can complement virtually all other tail-deficient lysates (Katsura and Kuhl 1975).
It is important to note that the sedimentation coefficient of whole lambda phage particles is also
400 S. This led Katsura to propose an alternative pathway whereby tail assembly proceeds as
normal without the presence of gpK forming a non-infective particle with the same
sedimentation velocity as full phages. Katsura observed that the 4 S fractions of some tail-
deficient lysates, other than K- lysates, were able to exhibit K
+ activity suggesting that free gpK
was complementing the 400 S K- particle produced in K
- lysates, possibly by binding to the tail
tip. The phage yield or titre observed by complementing the 400 S fraction was relatively low
indicating that the efficiency of this reaction was only a fraction of normal assembly. An
important point to consider about these studies is that the particular amber mutant of gene K used
encodes the first 215 out of 247 amino acid residues of gpK. One way to interpret the
observation of particles with equal sedimentation velocities as wild-type phage but low
infectivity is that the N-terminal domain (NTD) of the protein participates in the assembly
process while the C-terminal domain (CTD) plays an important role in rendering phage particles
infectious.
Figure 3. Alignment of gpK homologues in tailed phages.
The alignment was generated by performing a PSI-BLAST using the protein sequence of gpK,
see below, on tailed phages. The results were aligned with the Mov34 domain protein AfJAMM
(PDB ID: 1R5X) and the NlpC/P60 domain protein Spr (PDB ID: 2K1G), which were added
manually, using the MUSCLE algorithm in Jalview 6. Residues are coloured, if they are above
the 60% sequence identity threshold, based on the Clustalx colour scheme. The arrows denote
conserved residues selected for mutagenesis see section 3.3.
![Page 13: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/13.jpg)
5
The Basic Local Alignment Search Tool (BLAST) (Altschul et al. 1997) is useful for identifying
the potential function of query proteins by comparing their identity to proteins of known
function. Interestingly, using the sequence of lambda gpK as a query in a BLAST search reveals
that it shares similarity to many other phage proteins and is predicted to possess two distinct
domains. The NTD has identity to the Mov34 family of proteins while the CTD has identity to
the NlpC/P60 family of proteins. The results of a BLAST search are shown in Figure 3. The
Mov34 family is a group of peptidases while the NlpC/P60 family of proteins has been identified
as a group of γ-glutamyl-mesodiaminopimelic acid endopeptidases or N-acetylmuramoyl-L-
alanine amidases (Anantharaman and Aravind 2003). Since the bonds that are hydrolyzed by the
these enzymes are present in the peptidoglycan (PG) layer of lambda’s host, Escherichia coli, a
plausible function of gpK is to cleave these bonds during the process of DNA injection. With this
in mind I will discuss below aspects of the process of DNA injection as well as the
characteristics of PG in E. coli. It is quite striking that a phage protein would contain two
different putative enzymes each with potentially different functions. After, I will elaborate on
what is currently known about the Mov34 and NlpC/P60 families of enzymes.
1.3 The process of DNA injection
Lambda must initially recognize its host via the interaction between gpJ and its cell surface
receptor LamB. Next, a channel traversing the outer membrane, periplasm and cytoplasmic
membrane must form to permit DNA injection into the cytoplasm. Several pieces of evidence
support this model. Firstly, transmembrane channels are formed in liposomes bearing the LamB
receptor when exposed to phage particles and lambda DNA can be found within the lumen
(Roessner and Ihler 1986). These channels allow the transit of small molecules but not proteins
into and out of the lumen. The initial interaction between gpJ and LamB is considered to be
reversible but an irreversible interaction occurs after this step whereby the tail tube is in direct
contact with the membrane. In this more stable complex gpJ is found to be protease sensitive
whereas gpH*, initially protease sensitive, becomes protease resistant after phage associate with
liposomes bearing LamB (Roessner and Ihler 1983). This suggests that gpH* associates with the
liposome membrane and forms the channel by which DNA enters the cytoplasm. The tape-
measure protein from phage T5 has also been shown to form a channel in liposomes (Feucht et
al. 1990) indicating this is likely a conserved mechanism for DNA injection for Siphophages.
![Page 14: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/14.jpg)
6
The importance of gpH* in the DNA injection process is also highlighted by studies examining
lambda mutants that can overcome phage-resistant hosts. The E. coli Pel protein, encoded by
manY, is part of the phosphoenolpyruvate transferase system and is required for mannose
utilization (Williams et al. 1986). E. coli pel- mutants allow lambda to bind but do not permit the
DNA injection process to occur (Scandella and Arber 1974). The mutants that can overcome this
obstacle to DNA injection map to gene H and to gene V (Scandella and Arber 1976). Additional
support for the role of a channel in DNA injection comes from the fact that lambda DNA is not
degraded by a periplasmically-located non-specific nuclease while plasmid DNA loses its ability
to transform cells expressing this nuclease (Esquinas-Rychen and Erni 2001). This suggests that
lambda DNA is protected during DNA injection.
1.4 Phage associated PG-hydrolases
The PG layer of Gram-negative bacteria is less of a barrier to the DNA injection process than
that of Gram-positive bacteria, because Gram-negative PG is largely monolayered; however
there are a number of examples of phages that infect Gram-negative bacteria that have phage
particle-associated PG-hydrolytic activity indicating that there is likely an advantage if not a
necessity for phages to employ these enzymes. Using zymograms of caesium-chloride gradient
purified phages Moak and Molineux (2004) were able to detect several phage-associated PG-
hydrolase activities. These zymograms were performed by running purified phage on an SDS-
PAGE gel containing host derived PG, soaking the gel in renaturing conditions after
electrophoresis, staining with methylene blue and destaining with water. The appearance of a
zone of clearing on a stained background is indicative of PG hydrolysis. This assay revealed
clear lytic activity for the E. coli-infecting phages T4 and T5 but strikingly not for lambda or
HK022, a relative of lambda. Both of these phages have tail proteins possessing NlpC/P60
domains (gpK for lambda and a homologue in HK022, gp19) and it would be expected that they
would exhibit hydrolase activity given the function of this protein family. An explanation for the
absence of activity is that the proteins could not be renatured successfully after electrophoresis.
However, in a less stringent assay from the same study where phages were spotted onto
chloroform-killed bacteria clearings could not be observed with lambda and HK022. It is worth
noting here however that Xanthamonas oryzae phage Xp10 was found to exhibit a clearing at
~24 kDa with this assay. Xp10 possesses a ~17 kDa protein, encoded by gene 21R, with weak
![Page 15: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/15.jpg)
7
homology to the NlpC/P60 family (Yuzenkova et al. 2003). As Moak and Molineux noted if this
protein from Xp10 is responsible for this activity it suggests that the protein may be modified
post-translationally. A striking difference between the Xp10 21R protein and gpK is that gpK
contains an N-terminal Mov34 domain also present in the homolog gp19 from HK022. One way
to interpret the above information is that the Mov34 domain of gpK is actually functioning as an
inhibitor of the NlpC/P60 domain until the appropriate time during DNA injection. The fact that
the chloroform-killed cells did not reveal a clearing may indicate that the Mov34 only relieves its
repression when contacting live cells through a sequence of specific host-phage interactions.
Members of the NlpC/P60 family are themselves a subfamily of the CHAP (cysteine, histidine-
dependent amidohydrolyases/peptidases) superfamily (Layec et al. 2008). The tail tip protein
from Staphylococcus aureus phage φMR11 contains a CHAP domain that has been shown to
hydrolyze the PG-layer of its host (Rashel et al. 2008). Another example of this activity is
evident in the zinc-containing endopeptidase gp13 from the Bacillus subtilis phage φ29 (Cohen
et al. 2009). While these are clear examples of tail tip proteins from Gram-positive infecting
phages the evidence that tail associated proteins from phages infecting Gram-negative bacteria
are necessary is less clear. The most well characterized tail tip PG-degrading enzyme is T4
lysozyme. Although some evidence implies that this protein is important for DNA injection
(Kumar Sarkar et al. 2006) it remains to be directly proven that it is essential for this process.
Tape measure proteins themselves possess muralytic activity. In the mycobacteriophage TM4,
although a tape-measure protein associated PG-hydrolase activity is not essential for the viability
of the phage it improves the efficiency of DNA injection in stationary phase cells (Piuri and
Hatfull 2006). It is clear that phages commonly possess proteins capable of PG hydrolysis. I will
now discuss the features of the PG layer in E. coli to provide a clearer picture of the potential
role of the CTD of gpK.
1.5 The peptidoglycan layer of E. coli
The Gram-negative bacterium E. coli contains a layer of peptidoglycan within the periplasm
between the outer and cytoplasmic membranes. This polymer provides structural integrity and
protects against osmotic stress. It is mainly single layered, compared to the multi-layered PG in
Gram-positive species, and composed of repeating disaccharide subunits consisting of N-
![Page 16: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/16.jpg)
8
acetylglucosamine (NAG) and N-acetylmuramic acid (NAM) linked together via β-1,4
glycosidic bonds (Vollmer et al. 2008). It is this bond between these two sugar moieties that is
cleaved by lysozymes (Salton and Ghuysen 1959, Strynadka and James 1991). In E. coli these
disaccharides form chains that are on average 5-10 subunits long (Harz et al. 1990) and are
linked to one another via short peptide cross-bridges, see Figure 4. These cross bridges are
formed by pentapeptides linked to NAM moieties. While PG contains the same glycan chains in
different species the peptide stem can vary between species, in E. coli the sequence of amino
acids joined to the NAM moiety is L-alanine, D-glutamate, meso-diaminopimelic acid (DAP), D-
alanine, and D-alanine (Vollmer et al. 2008). The majority of strands are linked together by D,
D-peptide bonds between D-alanine and DAP while cross-linking increases as cells shift from
logarithmic phase to stationary phase (Glauner et al. 1988). Considering that PG-hydrolysis
activity has been shown to be necessary for efficient DNA injection into stationary phase cells
this suggests that this additional cross-linking poses a real barrier to DNA injection, most likely
by blocking the formation or translocation of the channel.
Figure 4. Schematic of E. coli peptidoglycan.
The blue hexagons represent subunits of the glycan strands. NAG = N-acetylglucosamine
and NAM = N-acetylmuramic acid. The red squares are amino acids. DAP = meso-
diaminopimelic acid. The positions indicated by black arrows are sites of cleavage for 1 =
lysozyme, 2 = N-acetylmuramoyl-L-alanine amidase and 3 = γ-glutamyl meso-
diaminopimelic acid endopeptidase.
![Page 17: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/17.jpg)
9
There is some controversy regarding how the PG layer is organized in living cells. There are
essentially two models of PG organization in Gram-negative bacteria: the classic layered model
and the scaffold model. The classic layered model depicts PG as parallel to the surface of the
outer membrane. The scaffold model supported by Meroueh (2006) suggests that the layer is
oriented in such a way that the glycan chains are perpendicular to the plane of the surface of the
cell. In order to accommodate the average glycan chain length this model predicts a 9 nm thick
PG layer but observations of naturally isolated E. coli sacculi suggest that the layer is 4-6.5 nm
thick (Gan et al. 2008, Matias et al. 2003). The scaffold model was produced from synthetically
produced polymers of PG which does not necessarily reflect the natural state of the PG layer.
The smaller 4-6.5 nm measurements are likely more accurate because they are cell-derived and
support the layered model, which predicts a width of about 4 nm between glycan strands (Gan et
al. 2008). By measuring the penetration of fluorescein-labeled dextrans through PG of E. coli the
upper limit of diffusion for a globular protein was determined to be around 50 kDa (Demchick
and Koch 1996). While the molecular weight of the genome of lambda is substantially greater
than this, the 2.2-2.6 nm width of the double-helix (Mandelkern et al. 1981) would pose no
theoretical limit to translocation. As described previously it appears that some kind of protein
channel is necessary for DNA injection, but since the dimensions of such a channel are not
known it cannot be concluded with certainty that the PG layer prohibits DNA injection.
Regardless, the common appearance of PG hydrolases in phages indicates that it remains
advantageous for a phage to possess one.
1.6 The Mov34 family of proteins
The N-terminus of gpK shares sequence identity with the Mov34 family of proteins. These
proteins are a highly conserved group of peptidases that typically can be found functioning in
large protein complexes. Although some examples of prokaryotic Mov34 domains can be found
on the Pfam database, the only examples characterized so far are from eukaryotic organisms.
A number of proteins containing Mov34 domains have been characterized and shown to exhibit a
deubiquitinating (DUB) activity or isopeptidase activity (McCullough et al. 2004). Homologues
of these proteins can be found in a wide variety of organisms where they affect several cellular
processes including protein turnover, transcription and translation (Aravind and Ponting 1998).
![Page 18: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/18.jpg)
10
Members have been identified as components of the signalosome, proteasome and endosome in
eukaryotic organisms. In the COP9 signalosome of Arabidopsis thaliana knocking down the
Mov34 homologue CSN6 affects multiple cellular functions and causes plants to accumulate
ubiquitinated proteins (Peng et al. 2001). Evidence of Mov34 isopeptidase activity can be found
when Csn5 removes the Nedd8 moiety, an ubiquitin-like protein, from Cul1, an important
component of the E3 ubiquiting ligase complex, in Schizosaccharomyces pombe and this activity
is dependent on a catalytic glutamate shown in Figure
5 displaying the structure of AfJAMM (Ambroggio et
al. 2004). The structure of AfJAMM reveals that the
active site of the metalloprotease consists of an acid-
base catalytic glutamate with a pair of histidine
residues and an aspartate coordinating a zinc ion. A
conserved serine residue is thought to stabilize a
tetrahedral intermediate during catalysis. The motif is
referred to as the JAMM (JAB1/MPN/Mov34) motif
and is characterized by the sequence
EX(n)HSHX(7)SXXD. As shown in the alignment in
Figure 3, gpK and its homologues exhibit this motif suggesting that the NTD of gpK binds a zinc
atom. In contrast to the archael AfJAMM, the crystal structure of the human Mov34 homologue
MPN (Mpr1, Pad1 N-terminal) domain shows that it is a dimer that does not bind metal
suggesting it is non-catalytic (Sanches et al. 2007).
The protein Rpn11, a subunit of the proteasomal lid, possesses a JAMM motif and also has a role
in deubiquitination (Verma et al. 2002). Further examples of this activity are found in the
lysosomal degradation pathway. AMSH exhibits isopeptidase activity and is associated with the
endosome (McCullough et al. 2004). It is hypothesized that this protein plays a critical role in the
sorting of cellular receptors to the lysosome. In Caenorhabditis elegans the COP9 signalosome
complex protein Csn5 interacts with UNC-98 and UNC-96 and affects them by promoting UNC-
98 degradation but stabilizing UNC-96 (Miller et al. 2009). The DUB activity of the Mov34
domain is also evident in the protein BRCC36. This protein contains a JAMM motif and exhibits
activity against lysine 63-ubiquitin. BRCC36 is a component of two identified protein
H69
E22
D80
H67
Figure 5. The active site of AfJAMM.
The aspartate and histidine residues
coordinating a zinc atom (grey sphere)
are visible along with the catalytic
glutamate, E22. Image created using
Pymol. PDB ID: 1R5X.
![Page 19: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/19.jpg)
11
complexes: the DNA damage-responsive BRCA1-RAP80 complex and the cytoplasmic
BRCC36 isopeptidase complex (BRISC), and its DUB activity is dependent on the complex in
which it is present (Patterson-Fortin et al. 2010). Given that the characterized members of the
Mov34 domain family demonstrate peptidase activity it is reasonable to hypothesize that the
NTD of gpK performs a proteolytic function.
1.7 The NlpC/P60 family of proteins
The best characterized NlpC/P60 domains are from bacterial species and of those most are from
Gram-positive bacteria; however, there are examples from eukaryotic cells including C. elegans
and human cells (Estes et al. 2007, Ren et al. 2010). This highlights the conserved nature of this
protein family. The examples in eukaryotes typically resemble the lecithin retinoyl
acyltransferase (LRAT) subfamily of the NlpC/P60 proteins and thus their function more likely
lies in lecithin metabolism rather than cell wall hydrolysis. The structures of several NlpC/P60
proteins have been solved from both Gram-positive
and Gram-negative species. One example is the NMR
structure of the outer membrane lipoprotein Spr
(suppressor of prc) from E. coli. Mutants of spr are
thermosensitive (Hara et al. 1996). Spr exhibits a
papain-like α + β fold and possesses a putative Cys-
His-His catalytic triad where the cysteine acts as a
nucleophile, the first histidine acts as a general base
in catalysis and the second histidine functions to
orient the side chain of the first histidine (Aramini et
al. 2008), Figure 6. However this protein has not been
shown biochemically to metabolize PG or have lytic activity. Crystal structures have also been
solved for the proteins AvPCP and NpPCP from cyanobacteria Anabaena variabilis and Nostoc
punctiforme. These structures also contain a catalytic triad consisting of Cys-His-His residues
and AvPCP has been shown experimentally to hydrolyze the peptide L-Ala-γ-D-Glu-DAP into
free DAP and L-Ala-γ-D-Glu (Xu et al. 2009). An example from Gram-positive species is the
Bacillus cereus protein YkfC, which has been crystallized with its reaction product L-Ala-γ-D-
Glu (Xu et al. 2010).
H119
H131
C68
Figure 6. The active site of Spr.
The Cys-His-His catalytic triad is
visible. Image created using Pymol.
PDB ID: 2K1G.
![Page 20: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/20.jpg)
12
The B. subtilis protein CwlF has a role in cell separation demonstrated by the fact that disruption
of CwlF causes cells to form extended chains (Ishikawa et al. 1998). Similarly, when the
NlpC/P60 homologues cgR_1596 and cgR_2070 are deleted in Corynebacterium glutamicum the
cells form elongated multi-septate cellular structures (Tsuge et al. 2008). Cells that fail to divide
normally are also observed when the genes encoding the NlpC/P60 homologues IipA/B are
disrupted in Mycobacterium tuberculosis (Gao et al. 2006). One NlpC/P60 protein with
demonstrated PG-hydrolase activity is CwlO in B. subtilis where the protein was determined to
be a DL-endopeptidase; however when CwlO was disrupted the cells exhibited no morphological
defects (Yamaguchi et al. 2004). The Lactococcus casei BL23 protein p75, which contains an
NlpC/P60 domain, is secreted and hydrolyzes L. casei muropeptides (Bäuerl et al. 2010). While
NlpC/P60 proteins are clearly involved in PG metabolism they are not all essential to the process
of cell division.
The CHAP and NlpC/P60 domains share the conserved catalytic cysteine and histidine residues.
These proteins are often found as part of multi-domain polypeptides in varying architectures
however there are distinctions between these two families worth noting. The most well
characterized members of the NlpC/P60 are found in Firmicute bacteria. These are
distinguishable from the CHAP domains as they typically appear with domains that are involved
in cell wall binding like SH3b or LysM domains, whereas CHAP domains appear with other cell
wall hydrolases and do not always possess a signal sequence for secretion. Additionally, the
function of NlpC/P60 proteins appears to be cell separating as opposed to the cell lysing capacity
of CHAP domains. The examples of NlpC/P60 domains in the Firmicutes always exist with a
signal sequence for secretion and binding to PG (Layec et al. 2008). This stands in contrast to the
NlpC/P60 from Gram-negative infecting phages like lambda.
The fact that gpK has sequence identity with NlpC/P60 domains suggests that it cleaves the
peptide bond in PG between the D-glutamate and DAP residues, Figure 4. Currently, no
NlpC/P60 from Gram-negative bacteria or phages have been biochemically shown to hydrolyze
intact PG and gpK would be the first example.
![Page 21: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/21.jpg)
13
1.8 Research goals
It is striking that a phage morphogenetic protein would contain two highly conserved domains
that exist in bacteria, archaea and eukaryota, including some examples of human proteins. That
each of these domains exists in such widely diverged biological systems is a testament to their
early emergence during evolution and their utility. The goal of this thesis is to understand the
function of lambda gpK. The fact that it has identity to two different enzymatic protein families
makes it an interesting subject of study. One of the aims of my thesis is to provide evidence for
this two domain architecture and confirm that gpK does indeed possess an Mov34 domain and an
NlpC/P60 domain and that these are biologically relevant to the function of lambda. Given the
functions of known Mov34 domains it is reasonable to expect that the NTD of gpK is a protease
responsible for an important cleavage function during the assembly of the tail or possibly during
the DNA injection process. I believe the CTD is participating in the process of DNA injection by
locally hydrolyzing the PG-layer.
![Page 22: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/22.jpg)
14
Chapter 2 Materials and Methods
2 Materials and Methods
Table 1. Strains used in this work
2.1 Media and Buffers
Luria Broth (LB): 0.5 % (w/v) yeast extract, 1 % (w/v) tryptone, 1 % (w/v) NaCl
Top agar: 0.5 % (w/v) yeast extract, 1 % (w/v) tryptone, 1 % (w/v) NaCl, 0.7 % (w/v) agar
KH media: 19 mM NH4Cl, 22 mM KH2PO4, 42 mM Na2HPO4•7H2O, 8.5 mM NaCl, 2.4 mM
MgSO4•7H20, 12 mM FeCl3, 0.2 % (w/v) glucose, 1.5 % (w/v) casamino acids
Lambda dilution buffer: 10 mM Tris pH 7.5, 10 mM MgSO4•7H2O
Storage Media (SM): 50 mM Tris pH 7.5, 100 mM NaCl, 10 mM MgSO4•7H2O, 0.01 % (w/v)
gelatin
Strain Relevant Genotype Reference
BL21Δtail
F–ompT gal [dcm][lon] hsdSB an E. coli B strain with
DE3 (with the tail portion of DE3 knocked out) Gibbs et al. 2004
594 sup0 Weigle 1966
C600 supE Appleyard 1954
QD5003 supF Yanofsky and Ito 1966
ER2566 lacZ::T7 gene1 [Ion] ompT New England Biolabs
594 Kam892 sup0, λ Kam892 cItI This work
594 Kam768 sup0, λ Kam768 cItI This work
C600 Kam892 supE λ Kam892 cItI Parkinson 1968
C600 Kam768 supE λ Kam768 cItI Parkinson 1968
TC600 Kam755 supE λ Kam755 cItI Parkinson 1968
TC600 Kam702 supE λ Kam702 cItI Parkinson 1968
![Page 23: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/23.jpg)
15
1x PBS (Phosphate-buffered saline): 137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4, 1.47 mM
KH2PO4, pH 7.4
Lysis buffer: 50 mM NaH2PO4 pH 8.0, 300 mM NaCl, 10 mM imidazole
Wash buffer: 50 mM NaH2PO4 pH 8.0, 300 mM NaCl, 40 mM imidazole
Elution buffer: 50 mM NaH2PO4 pH 8.0, 300 mM NaCl, 250 mM imidazole
Dialysis buffer: 50 mM Tris, pH 8.0, 300 mM NaCl, 2 mM dithiothreitol, 0.1 % (v/v) triton X-
100
Transfer buffer: 50 mM Tris pH 7.5, 40 mM glycine, 1.4 mM SDS, 20 % (v/v) methanol
Tris buffered saline tween (TBST): 15 mM Tris pH 7.5, 150 mM NaCl, 0.1 % (v/v) tween-20
Z-buffer complete: 71 mM Na2HPO4, 38 mM NaH2PO4, 10 mM KCl, 1 mM MgSO4•7H2O, 0.28
% (v/v) β-mercaptoethanol
2.2 Preparation of Kam phage lysates and titration of phage
Overnight cultures of the E. coli C600 suppressor strain containing Kam lambda prophages were
grown at 30 °C and used to inoculate 25 mL cultures of LB. Cultures were grown to OD600 = 0.4
at 30 °C, induced by growth at 45 °C for 15 min in a shaking water bath, and grown at 37 °C for
80 min, when lysis was observed, before centrifuging at 1440 x g for 15 min at 4 °C. The
supernatant was retained and to it a few drops of chloroform were added before storage at 4 °C.
The strains used are indicated in Table 1.
Phage samples were serially diluted ten-fold in storage media (SM) and 10 μL was added to 300
μL of logarithmically grown cells and 3 mL of top agar. This was mixed by pipette and poured
on top of LB + 10 mM MgSO4 plates with or without antibiotic where appropriate. Both the
suppressor strains C600 and QD5003 and non-suppressor strain 594 were used to titre Kam
phages to check for recombination.
![Page 24: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/24.jpg)
16
2.3 Cloning of the full-length sequence of gene K
The full-length sequence of bacteriophage lambda gene K (14133 to 14875 bp) was polymerase
chain reaction (PCR) amplified from lambda vir and cloned into pET15b (Novagen) using the
NdeI and BamHI sites. This produced an IPTG-inducible, N-terminally tagged His6 protein that
could be expressed in cells possessing T7 polymerase. The sequence was also cloned into
pAD100 (Davidson and Sauer 1994) using the NcoI and XbaI sites. The construct produces a C-
terminal FLAG epitope and a His6 tag. This plasmid contains an IPTG inducible Ptac-based
promoter and allows for expression in E. coli 594. The resulting construct contained extra N-
terminal methionine and glycine codons and these were deleted using Quikchange mutagenesis
with the primers listed in Table 2. Experiments using gpK in pAD100 were performed with this
construct that had these two N-terminal residues deleted.
Table 2. Primers used in this work.
Name Sequence Purpose
lambdaK-Rev CCAGCCGTCGCTCAGTTTCTGAC sequencing gpK 5’ upstream
lambdaK2-For GCAACTTTGGCGGCTTCCTTTCC sequencing gpK 3’ downstream
LgpK-For ATGACACAGACAGAATCAGCGATTC colony PCR 5’ end of gene K
LgpK-Rev TCACACGAAGGTCGATGCGG colony PCR 3’ end of gene K
LgpKF-6NdeI AGGTCACATATGACACAGACAGAATCAGCG cloning into pET15b
LgpKR-6BamHI AGTACTGGATCCTCACACGAAGGTCGATGC cloning into pET15b
NcoI-fwd AGTCCACCATGGGTATGACACAGACAGAATC cloning into pAD100
XbaI-rev TCATAGTCTAGACCCACGAAGGTCGATGCGGC cloning into pAD100
NcoI-fwd200 AGTCCACCATGGGTGCTGGCCAACACCTGCAC add 200 bases upstream of gpK
pAD100 XbaI-rev200 ATCTAGTCTAGAGCCACCTGACTTGGCCC add 200 bases downstream of gpK
pAD100ΔMG-sense CACACAGGAAACAGACCATGACACAGACAGAATC removal of first two MG residues
pAD100ΔMGantisense GATTCTGTCTGTGTCATGGTCTGTTTCCTGTGTG removal of first two MG residues
K-C121A-sense GCACGGTGTGACGGACGCGTACACACTGTTCCGGG mutate Cys121 to Ala
K-C121A-antisense CCCGGAACAGTGTGTACGCGTCCGTCACACCGTGC mutate Cys121 to Ala
![Page 25: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/25.jpg)
17
K-H187A-sense CTGTTTTGGTTCATCAGTGCCGAATGCCGCCGCAATTTACT mutate His187 to Ala
K-H187A-antisense AGTAAATTGCGGCGGCATTCGGCACTGATGAACCAAAACAG mutate His187 to Ala
K-H199A-sense CGACGGCGAGCTGCTGGCCCATATTCCTGAACAAC mutate His199 to Ala
K-H199A-antisense GTTGTTCAGGAATATGGGCCAGCAGCTCGCCGTCG mutate His199 to Ala
K-H200A-sense GACGGCGAGCTGCTGCACGCCATTCCTGAACAACTGAGC mutate His200 to Ala
K-H200A-antisense GCTCAGTTGTTCAGGAATGGCGTGCAGCAGCTCGCCGTC mutate His200 to Ala
K-H220A-sense GCAGCGACGCACAGCCTCCCTCTGGCGT mutate His220 to Ala
K-H220A-antisense ACGCCAGAGGGAGGCTGTGCGTCGCTGC mutate His220 to Ala
K-H68A-sense GTGGCGCTGGTCGCCAGCCACCCCGG mutate His68 to Ala
K-H68A-antisense CCGGGGTGGCTGGCGACCAGCGCCAC mutate His68 to Ala
K-H70A-sense GCTGGTCCACAGCGCCCCCGGTGGTCTG mutate His70 to Ala
K-H70A-antisense CAGACCACCGGGGGCGCTGTGGACCAGC mutate His70 to Ala
K-D81A-sense GAGTGAGGCCGCCCGGCGGCTGC mutate Asp81 to Ala
K-D81A-antisense GCAGCCGCCGGGCGGCCTCACTC mutate Asp81 to Ala
gpKCTD-FpET CGCGCGGCAGCCATATGGGGACGATTCATAAGTTCCG for LIC cloning into pET15b
gpKCTD-RpET GTTAGCAGCCGGATCCTCACACGAAGGTCGATGC for LIC cloning into pET15b
gpKNTD-FpET CGCGCGGCAGCCATATGATGACACAGACAGAATCAGCG for LIC cloning into pET15b
gpKNTD-RpET GTTAGCAGCCGGATCCCTTATGAATCGTCCCCCG for LIC cloning into pET15b
H225A-sense CACACTCCCTCTGGCGTGCCCGGGCATGG mutate His225 to Ala
H225A-antisense CCATGCCCGGGCACGCCAGAGGGAGTGTG mutate His225 to Ala
S78A-sense GTCTGCCCTGGCTGGCGGAGGCCGACCGGCG mutate Ser78 to Ala
S78A-antisense CGCCGGTCGGCCTCCGCCAGCCAGGGCAGAC mutate Ser78 to Ala
E19A-sense TGCGCCAGCGGCGTCGTGCGGCT mutate Glu19 to Ala
E19A-antisense AGCCGCACGACGCCGCTGGCGCA mutate Glu19 to Ala
R224A-sense CACACTCCCTCTGGGCGCACCGGGCATGGCG mutate Arg224 to Ala
R224A-antisense CGCCATGCCCGGTGCGCCCAGAGGGAGTGTG mutate Arg224 to Ala
K-pCDFfor ACCACCATCACGTGGGTACCATGACACAGACAGAATCAG LIC cloning K into pCDF KpnI
K-pCDFrev TCATCATTCGAACCGGTACCtcaCACGAAGGTCGATGCG LIC cloning K into pCDF KpnI
![Page 26: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/26.jpg)
18
DC78 CACAGGAAACAGACCATGAGTTTTAAATTTGGT T5 lys into pAD100
DC79 GTCCTTGTAGTCTAGAACTAGTTCGACATGACC T5 lys into pAD100
DC80 ACCACCATCACGTGGGTACCATGACACAGACAGAATCA gpK NTD into pCDF
DC81 TCATTCGAACCGGTACCTCACTTATGAATCGTCCCCCG gpK NTD into pCDF
DC82 ACCACCATCACGTGGGTACCGGGACGATTCATAAGTTC gpK CTD into pCDF
DC83 TCATTCGAACCGGTACCTCACACGAAGGTCGATGCGGC gpK CTD into pCDF
SpBADF TTGCCATACGGAATTCAGAAGGA
GATATCATATGCCAGAAAAACATGACCTG
S105 into pBAD33 EcoRI HindIII
SpBADR CAAAACAGCCAAGCTTTTATT
GATTTCTACCATCTTC
S105 into pBAD33 EcoRI HindIII
2.4 PCR amplification of the K locus and cloning of each domain in isolation
Primers identified in Table 2 were used to amplify gene K, and PCR products were sequenced
for each lambda Kam lysogen. The exact boundaries between domains were not clear from a
sequence alignment while BLAST searches indicated a small overlap between domains. Thus
residues 1-102 were cloned into pET15b for the NTD (with a C-terminal extension of Gly, Ser,
Gly, Cys) while residues 98-247 were cloned into pET15b for the CTD. In pCDF-1b (Novagen)
the NTD consisted of residues 1-102, while the CTD residues were 98-247. This vector contains
an N-terminal His6 tag.
2.5 Ligation-independent cloning (LIC)
PCR amplified fragments were incubated with digested plasmid after gel purification (Qiagen).
8.5 μL of the restriction-digested vector (approximately 400 ng of DNA) was used to re-suspend
the pellet from the In-fusion Dry-Down Cloning Kit (Clontech) and 2 μL of the pellet/vector mix
was incubated with 4 μL of the PCR generated insert for 30 min at 28 °C. The mixture was
transformed as described below.
2.6 Generation of lambda lysogens in non-suppressor strains and confirmation of lysogeny
An overnight culture of E. coli 594 cells was diluted 1:100 into LB + 10 mM MgSO4 and 0.2 %
(w/v) maltose, then grown to an OD600 of 0.5 at 37 °C. The cells were then mixed with Kam
![Page 27: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/27.jpg)
19
phage with a multiplicity of infection of 1 and incubated for a further 15 min. The cells were
diluted 10-fold in LB and incubated at 30 °C for 1 h with shaking at 200 rpm. The cells were
then diluted 10-4
and 100 μL were plated onto an LB plate and grown overnight at 30 °C.
Colonies were picked and screened for lysogen formation as described below.
A drop of lambda KH, a clear lambda mutant, was placed at the edge of an LB plate and allowed
to flow across the diameter of the plate. Perpendicular to this candidate lysogenic colonies were
streaked across the plate. The plate was then incubated at 30 °C overnight. Lysogens were
detected by their ability to grow across the KH while non-lysogens were unable to grow beyond
the phage line.
2.7 Preparation and transformation of competent cells
An overnight culture was used to inoculate LB at a 1:100 dilution and incubated at 37 °C until an
OD600 of 0.4-0.6. The cells were transferred to a conical tube and chilled on ice for 30 min. The
cells were pelleted at 2560 x g for 10 min at 4 °C. The medium was decanted and the pellet re-
suspended in 1/25th the volume of 0.1 M calcium chloride and stored for 10 min on ice. The
cells were pelleted as above and the supernatant decanted, the pellet re-suspended in 1/125th the
volume of cell culture of 0.1 M calcium chloride and rotated at 4 °C for 1 h. A final
concentration of 40 % (v/v) glycerol was added to the cells. They were aliquoted and flash
frozen with liquid nitrogen before being stored at -70 °C.
Competent cells were thawed on ice and 4 μL of plasmid was added to 50-100 μL of cells and
incubated for 15 min on ice. Cells were then heat shocked at 42 °C for 1 min, incubated on ice
for 3 min before 500 μL of LB was added for a 1 h recovery at 37 °C. Lysogens were recovered
at 30 °C for 45 min. Cells were centrifuged at 1400 x g for 3 min while 400 μL of the
supernatant was discarded and the cells re-suspended in the remaining 100 μL before being
spread-plated on the appropriate antibiotic selection plate. The plates were incubated overnight at
37 °C or 30 °C for lysogens.
2.8 In vivo complementation assays
BL21Δtail (Gibbs et al. 2004) or ER2566 (NEB) cells, both carrying the T7 polymerase for the
expression of pET plasmids, were transformed with the plasmid of interest and the following
![Page 28: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/28.jpg)
20
morning colonies were used to inoculate 5 mL of LB with appropriate antibiotic and incubated
for ~6 h at 37 °C until an OD600 of ~0.8 was reached. Cells, 300 μL, were then added to 3 mL of
top agar briefly mixed by pipette and poured over plates containing appropriate antibiotic. Ten-
fold serial dilutions of Kam lysates were made in SM and 4 μL of each dilution was spotted onto
the solidified lawn. Plates were then incubated overnight at 37 °C. The BL21Δtail strain was
generated from a BL21(DE3) strain by removing the tail genes in the DE3 prophage, which is a
lambda derivative. This meant the only source of lambda tail proteins would be from a plasmid
or infecting phage.
2.9 Mutagenesis techniques
Site-directed mutagenesis was performed using the Quikchange (Stratagene) method using
primers listed in Table 2. The following conditions were used: denaturing step at 95 °C for 2
min, annealing at 55 °C for 1 min following by 68 °C extension for 1.5 min per kb plasmid. In
order to mutagenize the large pETail plasmid the protocol described by Scott et al. (2002) was
used. The amplification of a large plasmid required an increased quantity of template (~75 ng)
and 400 μM dNTPs. The quantity of pfu DNA polymerase was increased to 3.75 U. The cycling
times were the same as above. DpnI digestion was carried out for 16 h at 37 °C.
2.10 Protein expression and purification
BL21Δtail cells were transformed with the plasmid of interest and an overnight culture was
diluted 1:100 into LB with appropriate antibiotic. This was grown at 37 °C until an OD600 of 0.8-
1.0 was reached. Isopropyl-β-D-thiogalactopyranoside (IPTG) was added to a concentration of
0.8 mM and incubated for 3 h at 37 °C before being centrifuged at 4225 x g for 15 min at 4 °C.
The supernatants were discarded and the pellets re-suspended in 25 mL 1x PBS before being
centrifuged at 1440 x g for 15 min at 4 °C, decanted and stored at -70 °C. Samples were taken of
induced and un-induced fractions.
Proteins were purified by nickel affinity chromatography. Cell pellets were thawed on ice and re-
suspended in 10 mL lysis buffer to which 7 μL of β-mercaptoethanol was added. The cells were
sonicated using 30 s bursts on then 30 s off for a total exposure time of 6 min. The lysate was
clarified by centrifugation at 11952 x g for 15 min at 4 °C. The supernatant was retained and
![Page 29: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/29.jpg)
21
added to 1 mL of nickel-nitriloacetic acid agarose slurry equilibrated with lysis buffer and
incubated at 4 °C for 45 min while rotating. At least 2 washes were performed with wash buffer
and two 5 mL elutions with elution buffer all rotating at 4 °C for 10 min. Elutions were then
pooled and dialyzed against dialysis buffer.
2.11 Determination of protein concentration
The concentration of purified protein was determined using absorbance at 280 nm. The predicted
molar extinction co-efficient was determined by using the protein calculator v3.3 available at:
http://www.scripps.edu/~cdputnam/protcalc.html.
2.12 Circular dichroism spectroscopy
Measurements were performed using an Aviv 62A DS circular dichroism spectrophotometer.
Wavelengths were measured at 25 °C in a 0.1 cm path length cuvette from 260-200 nm.
Averaging was done for 15 s at each wavelength. The values for buffer alone were subtracted
from each sample.
2.13 Purification, visualization and activity of lambda tails from the pETail plasmid
E. coli ER2566 cells were transformed with pETail (Xu 2001) and tails were expressed the same
way as protein expression as above in KH media. Cell pellets were then re-suspended in 1/50th
the volume of original culture, freeze-thawed three times and incubated with 200 μg/mL
lysozyme (Bio-Shop) and 10 μg/mL DNaseI (Sigma) for 1 h at 4 °C. The lysate was clarified by
centrifugation at 21130 x g at 4 °C for 12 min and the supernatant retained.
A Hitachi H-7000 transmission electron microscope was used to visualize samples at an
accelerating voltage of 75 kV. Samples were prepared on glow-discharged, carbon-coated copper
grids and stained with 2 % (w/v) uranyl acetate. The grids are divided into squares and in order
to count the number of tail particles present a single edge of four different squares on the same
grid were counted at 70000 x magnification and averaged to determine the number of tails in one
given sample.
![Page 30: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/30.jpg)
22
In order to test the activity of these tails they were complemented with free lambda heads. A
lysate of 594 Kam892 cIt1 was prepared by thermally inducing a culture, permitting it to lyse and
clarifying it by centrifugation as above. The free heads were stabilized with 20 mM putrescine
and stored at 4 °C. 50 μL each of these free heads and tails from ER2566 pETail crude extracts
were mixed and incubated for 1.5 h at 37 °C. Serial dilutions of the reaction were plated on C600
in order to titre the phage produced. The reactions were also spotted onto 594 to confirm
recombination had not produced phages that were no longer amber mutants.
2.14 SDS-PAGE and Western Blotting
Laemmli (1970) gels were cast using standard protocols. Gels were stained with Coomassie
brilliant blue G-250 or R-250. After SDS-PAGE the gel and nitrocellulose were soaked in
transfer buffer for 15 min. The sandwich was prepared by layering three pieces of whatman
paper soaked in transfer buffer followed by the membrane, the gel and three more pieces of
soaked whatman paper. The transfer was carried out at 10 V on a Bio-Rad TransBlot semi-dry
electrophoretic transfer cell for ~40 min. The membrane was blocked with 5 % (w/v) skim milk
(Bio-Shop) in TBST for one hour at room temperature followed by incubation with primary
antibody, mouse anti-FLAG M2 (SigmaAldrich), in the same solution overnight at 4 °C at the
dilutions indicated. After primary antibody incubation three washes of TBST for 10 min each
were performed followed by secondary antibody, goat anti-mouse IgG-HRP (Santa Cruz
Biotechnology), in 5 % (w/v) milk TBST applied for 1 h at room temperature. Three more
washes were performed as above and developing was performed with an ECL+ detection kit (GE
Health Sciences). Samples for western blotting were prepared by removing 1 mL of log-phage
culture and centrifuging at 8600 x g for 1 min. The supernatant was decanted and the pellet re-
suspended in 200 μL of BugBuster (Novagen) and incubated for 30 min at room temperature.
The resulting lysate was clarified by centrifugation at 21140 x g for 15 min at 4 °C.
2.15 PG hydrolysis assay using chloroform treated E. coli
The purpose of this assay was to evaluate the in vitro lytic activity of lambda gpK. The
preparation of chloroform-treated E. coli cells was as previously described (Roa and Burma
1971). An overnight culture of 594 cells was diluted 1:100 into LB and incubated at 37 °C until
it reached an OD600 of 1.0. The cells were pelleted at 4225 x g for 20 min at 4 °C. The pellet was
![Page 31: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/31.jpg)
23
re-suspended in half the culture volume of chloroform-saturated 10 mM tris pH 8.0 and left at
room temperature for 30 min. The cells were pelleted as above and washed twice with half the
culture volume of 10 mM tris pH 8.0. After the second wash the suspension was split into six 50
mL conical tubes and centrifuged at 2560 x g for 20 min, decanted and the pellets were frozen at
-20 °C. The cells were re-suspended in buffer to yield an OD600 of ~1.0 and the change in OD600
monitored over time after the addition of protein. The T5 Lys protein is an L-alanoyl D-
glutamate peptidase (Mikoulinksaia et al. 2009). This enzyme was chosen as a suitable positive
control because it cleaves the peptide bond one position closer to the NAM moiety on the peptide
stem than the predicted site of cleavage of gpK.
2.16 Cell lysis assay by lambda holin co-expression and release of β-galactosidase
BL21Δtail cells were transformed with lambda holin (S105) in pBAD33 (Guzman et al. 1995)
and the appropriate plasmid under examination. The cells were grown in LB (50 μg/mL
ampicillin and 17 μg/mL chloramphenicol) to an OD595 ~0.8-1 at 37 °C and induced with 420
μM IPTG in a 96-well plate. Growth was continued for 1 h and 0.2 % (w/v) arabinose was added
to induce expression of the lambda holin. OD595 was measured over time to monitor for cell
lysis. As an indirect measure of cell lysis, the activity of the intracellular enzyme β-galactosidase
was measured. Cells were centrifuged at 16000 x g for 5 min and the supernatants retained. 50
μL of complete Z buffer and 20 μL of 0.4 % (w/v) ortho-nitrophenyl galactopyranoside (ONPG)
were added to 100 μL of the supernatant, incubated for 30 min at room temperature and stopped
with 50 μL of 1 M CaCO3 before measuring A420. All absorbance measurements and growth was
performed in an Infinite M200 Tecan.
![Page 32: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/32.jpg)
24
Chapter 3 Results
3 Results
3.1 Correction of the sequence of lambda gene K and the position of Kam mutants
The sequence deposited at NCBI (accession # NC_001416) for lambda gene K from
bacteriophage lambda encodes a protein sequence that consists of 199 amino acids. This gene
was initially cloned into pET15b and used to complement Kam phages. This construct did not
express protein as detected by Coomassie blue staining nor was it able to complement Kam
phages. In an alignment of gpK and its homologues it appeared as if the sequence of gpK was
missing dozens of residues from its N-terminus. After examining the sequence of gene K it was
clear that there was a gap of more than 100 bp between the end of the immediately upstream
gene L and the start of gene K. The protein sequence encoded by this gap shared identity with the
Figure 7. Alignment of current lambda gene K sequence and K from Kam phages.
A - Alignment created using Jalview 6 and the ClustalW algorithm. The positions of the amber
codons are visible by the white notches in the black bar denoting consensus. The red box
indicates the position of the sequencing error. The corrected protein sequence of gpK is
displayed. B - Schematic of the relative positions of the amber codons to the domains of gpK
Mov34 NlpC/P60
Kam892 Kam755 Kam702 Kam768
A
B
MTQTESAILA HARRCAPAES CGFVVSTPEG ERYFPCVNIS GEPEAYFRMS PEDWLQAEMQ 60
GEIVALVHSH PGGLPWLSEA DRRLQVQSDL PWWLVCRGTI HKFRCVPHLT GRRFEHGVTD 120
CYTLFRDAYH LAGIEMPDFH REDDWWRNGQ NLYLDNLEAT GLYQVPLSAA QPGDVLLCCF 180
GSSVPNHAAI YCGDGELLHH IPEQLSKRER YTDKWQRRTH SLWRHRAWRA SAFTGIYNDL 240
VAASTFV
![Page 33: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/33.jpg)
25
N-terminal end of the homologues of gpK like gp19 from phage HK022. It had been noted
previously that this could have represented an evolutionary divergence of lambda from HK022
as a result of a frameshift mutation (Juhala et al. 2000). This turned out to be a sequencing error.
The first start codon after gene L was used as the beginning of gene K and this was cloned into
two separate vectors as described in section 2.3. This new sequence was able to complement
Kam phage lysates. After sequencing this construct and sequencing the PCR products of four
separate Kam phages using the primers identified in Table 2 it was clear that a guanine base was
missing in the current gene K sequence. The location of the Kam mutations had not previously
been identified in these phage mutants; their positions are shown in Figure 7. For Kam892,
Kam768 and Kam755 a transition mutation from C to T has resulted in a glutamine codon being
changed to the amber codon TAG. For Kam702 a transition mutation from G to A has changed
the tryptophan codon TGG into an amber codon. The 3rd
codon of Kam892 is amber, the 56th
codon of Kam755 is amber, the 76th
codon of Kam702 is amber, and the 216th
codon of Kam768
is amber. The sequences of these Kam phages and the current sequence of lambda from 14133 to
14875 bp are displayed in Figure 7. A second mutation in codon 225 of Kam892 is silent.
3.2 Complementation of a Kam phage with plasmid-expressed gpK
In order to confirm the biological activity of gpK an in vivo complementation assay was
employed. In this assay the 744 base pair sequence of gene K was cloned into the pET15b and
pAD100 vectors using standard protocols and the primers described in Table 2. BL21Δtail cells
were transformed with these vectors and leaky expression was relied upon for protein expression.
This strain contains a derivative of a lambda prophage that has had its tail genes knocked out so
that the only source of gene K is from a plasmid. The vector pAD100 contains an IPTG-
inducible Ptac promoter. Cells were grown to log phase and plated as a lawn in top agar. Serial
dilutions of Kam phages were spotted onto these lawns and the ability of gpK from the cells to
complement the Kam phages was assessed by the formation of plaques. This assay confirmed
that gpK cloned into pAD100 (Figure 8a) and pET15b (not shown) was capable of
complementing three separate Kam phages. On the amber suppressor strain C600, Kam892
produced 5.9x109 pfu/mL while BL21Δtail cells expressing gpKpAD100 produced 4.6x10
9
pfu/mL indicating complementation was essentially complete. The empty vector negative control
![Page 34: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/34.jpg)
26
produced plaques at least five orders of magnitude below that observed for gpK in pAD100. This
reduction in plaques indicated no complementation. GpK was purified under native conditions
from BL21Δtail cells transformed with gpK in pAD100 (Figure 8b).
3.3 Identification of important residues for the function of gpK in vivo
In order to test the hypothesis that conserved residues from the active sites of Mov34 and
NlpC/P60 domains are important for the function of gpK point substitutions were made in gpK
and their activity was tested using the assay for complementation of Kam phages with plasmid-
expressed substituted proteins. The alignment in Figure 3 combined with the structural data
regarding the active sites of AfJAM and Spr were used to select conserved residues in gpK for
substitution with alanine. The conserved residues for mutagenesis are identified by arrows in
Figure 3. The catalytic residues of the Mov34 domains consist of a glutamate, two histidine
residues and an aspartate residue needed for coordination of a zinc ion. Using the assay for Kam
complementation described above mutants bearing substitutions of these residues, as shown in
Figure 8. Complementation of Kam phages with gpK and its purification.
A - BL21Δtail cells expressing gpK in pAD100 were plated onto top agar and serial dilutions of
Kam phage were spotted on top of agar when solidified and incubated overnight at 37 °C.
B - SDS-PAGE of natively purified gpK. Lanes: 1, sonicated lysate; 2, broad range molecular
weight marker; 3, lysed supernatant; 4, lysed pellet; 5, unbound lysate; 6, wash 1; 7, wash 2; 8,
elution 1; 9, elution 2; 10, dialyzed gpK. Arrow indicates gpK at ~31 kDa. The total volume of
each fraction was 10 mL except for the elutions which were 5 mL each of which 10 μL was
loaded.
A B
![Page 35: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/35.jpg)
27
Figure 9, complemented poorly. These were E19A, H68A and H70A in gpK. These align with
Glu22, His67 and His69 in the structure of AfJAMM in Figure 5. Additionally, C121A that
aligns with the putative catalytic cysteine residue from Spr, Cys68 in figure 6, was also shown to
complement poorly. The solubility of each protein possessing a point substitution was examined
by western blot and similar quantities of each were found in the soluble fraction of cells
expressing the point substitutions. In addition the E19A and C121A substitutions were examined
by circular dichroism to confirm that the substitutions did not confer a folding defect. Figure 9
shows that both of these proteins have UV-spectra similar to that of gpK. GpK exhibits minima
at 208 and 224 nm, E19A at 210 and 224 nm and C121A at 208 and 226 nm.
Figure 9. Residues of functional importance for gpK.
A - BL21Δtail cells expressing the various point substitutions in gpK were plated in top agar
and serial dilutions of Kam892 phage were spotted after the agar solidified and grown overnight
at 37 °C. C600 is a supE strain of E. coli. All the substitutions are in pAD100 except H187A
and H199A, which are in pET15b. B - A sample of the cells was treated with BugBuster
(Novagen) before plating and probed by western blot using anti-FLAG antibody. C - Purified
gpK, E19A and C121A in pAD100 were subjected to circular dichroism analysis as described
in the Materials and Methods.
C B
A
![Page 36: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/36.jpg)
28
Several conserved residues that were substituted with alanine did not appear to reduce
complementation. These included Ser78, the serine residue suspected of being responsible for
stabilizing a tetrahedral intermediate during catalysis, and the histidine residues in gpK that align
with those of the putative catalytic triad of Spr. These were His187 and His199 in gpK and
His119 and His131 in Spr shown in Figure 6. The fact that alanine substitutions of these residues
did not reduce complementation suggested these may not be part of the catalytic triad of gpK.
Immediately after His199 is another conserved residue: His200. Strikingly, an H200A
substitution complements poorly as shown in Figure 9. The third residue in the NlpC/P60
catalytic triad can be a polar residue and I attempted to identify this residue by substituting
His220, Arg224 and His225 with alanine. None of these showed reduced complementation.
3.4 Lambda gpK consists of two separate domains
The hypothesis that gpK consists of two separate domains was tested by cloning the NTD and
CTD into separate pET15b vectors and into the KpnI site of pCDF-1b (Novagen) using Ligation
Independent Cloning (LIC) as described in the materials and methods. Each vector had separate
origins of replication and was inducible with IPTG allowing for simultaneous co-expression in
the same cell. An in vivo complementation assay was performed using these plasmids and the
Kam phages to determine whether either domain supplied in trans could complement a phage
producing one entire domain of gpK. Kam768, which still encodes the NTD, can be
complemented with a plasmid containing the CTD of gpK (see Figure 10). The greatest
complementation occurs at 84 μM IPTG in the top agar. This is about ten-fold less efficient
complementation than wild-type gpK, which fully complements as indicated above. When both
domains are expressed in separate plasmids they are capable of complementing the Kam892
phage whose amber codon is located in the third codon of the gene. This complementation is
greatest when 84 μM of IPTG is added to the top agar and is about 100-fold less than
complementation with full-length gpK. To determine whether plaques could be formed as a
result of recombination between the plasmid containing the NTD and Kam892, the NTD in
pET15b was transformed with empty pCDF-1b. This complemented poorly.
![Page 37: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/37.jpg)
29
3.5 Assembly of lambda tails from the pETail plasmid
Since gpK is required for the tail assembly process and given that gpK possesses two domains as
identified above I hypothesized that the Mov34 domain in gpK was involved in tail assembly
while the NlpC/P60 domain is responsible for hydrolysis of peptidoglycan during DNA
injection. One prediction from this model would be that inactivating the NTD would prevent tail
assembly whereas inactivation of the CTD would allow morphologically wild-type tails to
assemble that were defective in forming infective phage particles. To test this, both E19A and
C121A point substitutions were separately made in the pETail plasmid and these were expressed
in ER2566 cells and examined by TEM for the appearance of tails. The pETail plasmid contains
all the genes necessary for tail assembly and is capable of producing biologically active tails (Xu
2001). The extracts were assayed for tail activity by mixing them with extracts containing filled
heads and determining the number of infectious phage particles formed. As shown in Figure 11,
the E19A substitution causes a 5.6x104-fold reduction in active tails compared with wild-type
while the C121A substitution causes a 2.9x103-fold reduction in active tails. The E19A
Figure 10. Complementation of Kam phage with domains supplied in trans.
A - BL21Δtail cells expressing the CTD of gpK in pET15b were plated onto top agar with
84 μM IPTG and serial dilutions of Kam768 phage (encoding the NTD of gpK) were spotted
when solidified and grown overnight at 37 °C. The wild-type and point substitutions in the
NTD are shown. B - BL21Δtail cells co-expressing the NTD in pET15b and the CTD in
pCDF-1b. The cells were plated onto top agar with the indicated concentration of IPTG and
serial dilutions of Kam892 phage (encoding no gpK) were spotted when solidified and
grown overnight at 37 °C.
![Page 38: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/38.jpg)
30
substitution exhibits a more severe reduction in complementation and produces only 1.6% of the
number of tails produced by wild-type as observed by TEM. However, the C121A substitution
produces 53.6% of the number of tails as wild-type. There appears to be no discernible
morphological differences between tails produced by the E19A or C121A substitution compared
to that of wild-type by TEM.
Figure 11. Activity (titre) and assembly of tails produced from wild-type (WT) and point
substitutions of gpK.
A - Tails produced by ER2566 cells expressing pETail plasmids with the indicated point
substitutions were purified as indicated in the Materials and Methods and examined by TEM
for the number of tails visible (counts). B - Activity of these tail extracts measured by
complementing with Kam892 heads. C - TEM micrographs of lambda tails produced by the
indicated substitution in the pETail plasmid. Bars are 100 nm.
A C
B
Number of tails
Activity of tails
n = 3
WT
C121A
![Page 39: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/39.jpg)
31
3.6 Evaluation of the function of gpK as a PG-degrading enzyme
The CTD of gpK shows identity to peptidoglycan hydrolases and in order to test whether gpK
has lytic activity two separate assays were employed. The first assay examined the ability of gpK
to lyse E. coli cells treated with chloroform in vitro. Chloroform solubilizes the outer membrane
of bacterial cells exposing the PG layer. Log phase cells are washed with chloroform-saturated
tris pH 8.0. The cells are re-suspended in buffer to yield an OD600 of around 1 and mixed with
purified protein of interest and lysis is measured as a reduction in the optical density of the cell
suspension over time. Since the NlpC/P60 domains hydrolyze the peptide cross-bridge a positive
control that also cleaved this site was needed. Although the protein MpaA from E. coli, which is
involved in PG metabolism, has been identified as a γ-glutamyl-mesodiaminopimelic acid
endopeptidase (Uehara and Park 2003) its activity is specific for free peptides instead of peptides
attached to NAM moieties making it an unsuitable positive control for intact PG lysis. Thus, the
phage T5 Lys endolysin, recently identified as an L-alanoyl D-glutamate peptidase
(Mikoulinksaia et al. 2009), was selected as a positive control for this assay. The site of cleavage
of this enzyme is one peptide bond closer to the NAM moiety and so was considered a suitable
candidate for a positive control. As shown in Figure 12, the lytic activity that is most likely the
Figure 12. Examination of the ability of purified gpK to lyse CHCl3-treated cells.
Chloroform-treated 594 cells exposed to the indicated proteins and monitored for lysis over
time. The protein concentration is 2.0 μM.
B
![Page 40: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/40.jpg)
32
result of PG-degradation by this enzyme is clear after 30 min of incubation of chloroform-treated
cells. The optical density dropped by more than 1.0 OD600 units. When purified gpK was
incubated with this cell suspension there was no significant difference between buffer alone or
lambda gpV, the major tail protein. Various conditions were tested including the presence of 10
mM Mg, Ca, and Zn and pH values of 7.0, 7.5, 8.0 and 8.5 however these did not reveal any
activity of gpK to hydrolyze chloroform-treated cells compared to buffer alone or gpV. Thus,
this assay was unable to identify a lytic function for full-length gpK above negative controls. In
addition to this assay I also attempted to demonstrate PG-degrading activity with gpK using
zymograms to detect zones of clearing. This assay did not demonstrate any PG-degrading
activity for gpK.
A separate assay for PG-degrading activity was employed where the protein of interest was co-
expressed with the lambda holin (S105), which forms holes in the cytoplasmic membrane (White
et al. 2011). The holin is part of the lambda lysis cassette that is required for cell lysis. The holin
functions by making the cytoplasmic membrane permeable to the lambda endolysin R and does
Figure 13. Cell lysis by holin co-expression assay.
BL21Δtail cells transformed with S105 (holin) in pBAD33 and the indicated plasmid were
grown to log phase in LB at 37 °C with appropriate antibiotics and induced with 420 μM
IPTG. After 1 h the holin was induced with the addition of 0.2 % (w/v) arabinose, indicated
by the arrow.
n = 3
![Page 41: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/41.jpg)
33
so with strict timing to allow the phage to replicate before the cell is lysed (Young 1992). Fine-
tuning of the timing function is achieved by a two amino acid residue addition to the N-terminus
of the holin resulting in a protein referred to as the antiholin or S107. This protein delays the
holin from forming a hole that permits the endolysin access into the periplasm to degrade the PG
layer (Bläsi et al. 1990, White et al. 2010). This assay involves expression of the protein of
interest in log phase cells with IPTG for one hour followed by induction of the holin from an
arabinose inducible promoter. Since S107 is the antiholin that opposes the function of the holin,
S105 was cloned so that lysis could be regulated by the addition of arabinose. Lysis is measured
by a decrease in optical density over time. In addition the release of β-galactosidase from the
cytoplasm by cell lysis can be detected by the hydrolysis of the β-galactosidase substrate ortho-
nitrophenyl galactopyranoside (ONPG) to ortho-nitrophenol (ONP). ONP forms a coloured
product with a maximum absorbance at 420 nm and thus β-galactosidase activity can be
measured by measuring the A420 of samples. In this assay cells are spun down and β-
galactosidase activity is examined in the supernatant. Any cells that have been lysed will release
β-galactosidase into the supernatant while intact cells retain the enzyme in their cytoplasm. An
important point to consider here is that the effective upper limit of a globular protein to freely
diffuse through the PG layer is about 50 kDa, as aforementioned. Although the holin may be
allowing β-galactosidase to enter the periplasm, because the monomer of β-galactosidase is
around 116 kDa (Fowler and Zabin 1978) it should not theoretically be capable of passing
through the PG layer.
Figure 14. Cell lysis by release of β-galactosidase assay.
The samples from the cell lysis by holin co-expression assay were removed after 3 hours post-
holin induction, centrifuged and the supernatant treated with complete Z-buffer and ONPG.
The reaction was incubated for 30 min before the absorbance at 420 nm was read.
n = 3
![Page 42: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/42.jpg)
34
Figure 13 shows the results of the cell lysis by holin co-expression assay. The positive control T5
Lys has clear lytic activity. The cells continue to grow after one hour of induction with IPTG and
upon induction of the holin optical density declines to about 0.05 OD595 units. Since C121A was
unable to complement Kam phages it was used as a negative control. This residue is the
predicted nucleophile during catalysis and thus inactivating the protein by substituting this
residue for an alanine should abrogate any lytic activity. This substitution was introduced into
the CTD alone. For cells transformed with pET15b, full-length gpK, and CTD-C121A there is a
clear stabilization of the optical density after holin induction between ~0.35-0.42 OD595 units.
Strikingly, cells expressing the CTD alone continue to grow for about 30 min after induction of
the holin and then begin to decline by about 0.23 OD595 units 3 h post-holin induction. To
confirm that cells are actually lysing the release of β-galactosidase was assessed at the end of the
assay 3 h post-holin induction (also 4 h post-IPTG induction). As evident in Figure 14 there is
little conversion of ONPG to ONP in empty pET15b, gpK, and CTD-C121A. T5 Lys yields 0.81
A420 units three hours after holin induction. The CTD alone reveals 0.30 A420 units 3 h after holin
induction. These data indicate that β-galactosidase is being released in cells expressing the T5
Lys control and the CTD alone and thus cells are lysed under these conditions.
![Page 43: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/43.jpg)
35
Chapter 4 Discussion
4 Discussion
The purpose of this study was to determine the function of lambda gpK. To this end my specific
goals were to provide evidence for the two domain bioinformatic prediction of gpK and that the
NTD is a functional Mov34 domain and the CTD is a functional NlpC/P60 domain. I also aimed
to provide evidence that gpK is required for the assembly of tails and that the CTD is involved in
DNA injection by cleaving the PG layer.
I have confirmed that gpK possesses two domains by showing that the separated domains when
supplied in trans can complement a Kam phage (Kam892) producing no gpK. Complementation
also occurs when the CTD alone is expressed from a plasmid and the NTD is encoded by the
phage (Kam768). I have also shown that the conserved Glu19, His68 and His70 are important for
the function of gpK. Additionally, I have confirmed the predicted nucleophilic cysteine residue
in the NlpC/P60 domain Cys121 is important for biological activity of the protein as measured
by complementation of Kam phage. The fact that each domain can function when supplied in
trans suggests these two domains may physically interact with one another. This is supported by
the fact that Katsura observed a K- particle (a phage particle with the same sedimentation
coefficient as wild-type phage that is non-infectious) produced from Kam768 lysates could be
complemented with free gpK from other tail-defective lysates. It is interesting to note that the
NTD mutants poorly complement the Kam768 phage, which encodes the entire NTD. These
proteins theoretically contain a functional CTD and it might be expected that this should function
to complement the Kam768 phage as the CTD in isolation does. Since this is not observed one
explanation is that the NTD of E19A, H68A, and H70A physically blocks the CTD from
interacting with the NTD from the Kam768 phage. When the CTD alone complements Kam768
the most likely scenario is that the NTD from this phage becomes part of the 15 S initiator
complex and that the CTD associates with this complex. I wanted to show that these two
domains physically interacted by co-expressing these domains in trans in the same cell and then
observing if one domain co-purifies with the other or if they form a single peak in a gel filtration
profile. However, the domains are poorly soluble when expressed in isolation from one another.
Alternatively, it may be possible to detect an interaction using a two-hybrid assay.
![Page 44: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/44.jpg)
36
The fact that Mov34 domains are typically part of protein complexes suggested that the NTD had
a role in tail assembly; therefore I tested whether each domain could form tails. I have shown in
Figure 11 that although both the E19A and C121A substitutions in gpK from pETail cause a
reduction in tail activity, the E19A substitution causes far fewer tails to be observed while the
C121A substitution causes about half the number of tails as the wild-type as determined by
TEM. The C121A substitution may produce tails that are less stable than wild-type which could
account for the reduced number observed. These data indicate that the NTD affects tail assembly
while the activity of the CTD is not essential for tail assembly. The exact function of the NTD is
not clear. Since Mov34 domains are often involved in proteolysis, one possibility is that it
hydrolyzes another lambda tail assembly protein, such as gpH which is known to be cleaved
during assembly. One method of determining whether the Mov34 domain of gpK is responsible
for proteolysis of gpH is to tag gpH in a lysogen that produces no gpK. The lysogen could be
induced and complemented with gpK and the E19A substitution then probed by a western blot
for a shift in the molecular weight of tagged gpH. A 12 kDa shift should be clearly visible. It is
evident that the active site of the NTD is necessary for the efficiency of tail assembly but the fact
that the E19A substitution in the pETail plasmid does not completely abrogate tail formation
indicates that the process is not wholly dependent on the putative active site of the NTD of gpK.
In the CTD the putative nucleophile Cys121 is essential for phage activity. The histidine
residues, His187 and His199, in the catalytic triad that align with those of the Spr structure do
not have reduced activity in the in vivo complementation assay. It seems then that these residues
are not critical for catalysis or do not actually make up the catalytic triad. Since His200 is one
residue away from His199 and is unable to complement in vivo it is certainly a likely candidate
for the triad. It should be noted that the third residue in the catalytic triad of NlpC/P60 domains
in descending frequency is Asn > Glu > Gln > Asp (Aramini et al. 2008). Thus, gpK may have
one of these alternate residues in its third position of the triad. My data suggest that His200
makes up the second residue of the triad but I have not identified the third residue. Since the
most obvious candidates (His187 and His199) from the alignment in Figure 3 appear non-
essential for the catalytic triad, structural data from gpK or one of its homologues would be
helpful in validating my data that His200 is essential and in identifying the third residue in the
triad.
![Page 45: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/45.jpg)
37
I have demonstrated that the CTD of gpK possesses lytic activity as measured by a decline in
optical density and an increase in β-galactosidase activity when the CTD is co-expressed with the
lambda holin. This activity is dependent on the catalytic Cys121 residue since the CTD-C121A
sample does not show a reduction in optical density or an increase in β-galactosidase activity.
This supports the hypothesis that gpK possesses PG hydrolytic activity. The fact that the CTD
shows less activity compared to T5 Lys could be for a couple of reasons. Firstly, the protein is
only partially soluble, which may be remedied by incubation at a lower temperature. Secondly,
the protein T5 Lys is an endolysin whose purpose is to lyse the cell at the end of the infection
cycle, like lambda R, so that progeny phage can enter the environment. It is somewhat
unsurprising that lambda would employ an NlpC/P60 domain, which as aforementioned are
generally cell-separating instead of lysing enzymes, instead of a lysin because the phage requires
a living cell in order to replicate. An enzyme with high activity may jeopardize this by
prematurely hydrolyzing the PG layer before phage replication can be completed. Initially, lytic
activity could not be detected with lambda gpK using chloroform-treated cells. The use of this in
vitro assay has two major caveats. The first is that there is no guarantee that the protein purified
retains any activity. Another drawback is that cells that have had some of their membranes
solubilized with chloroform may lose some protein and lipids that may have an effect on the
ability of the NlpC/P60 domain to target its substrate. Measuring cell lysis by holin co-
expression removes some of the problems associated with the former in vitro assay. The fact that
the proteins are expressed within the cell makes it more likely for proteins to retain their activity
and be folded properly especially given that E. coli is the natural system of expression for
lambda proteins. The assay allows the holin to be induced after arabinose addition and the
protein under examination to be separately induced with IPTG. This allows a buildup of gpK to
form before the holin allows access to the PG. This parallels the situation in lambda where the
phage endolysin accumulates in the cytoplasm prior to holin-induced permeabilization of the
membrane (Young 1992). Importantly, the theoretical limit of PG permeability of around 50 kDa
appears correct because β-galactosidase activity is not detected in the negative controls; although
it is possible the outer membrane itself serves as a barrier to β-galactosidase release.
Additionally, the prediction that disrupting the active site of the CTD would allow fully
assembled but inactive tails to form is supported by the evidence from Figure 11. The C121A
![Page 46: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/46.jpg)
38
substitution appears to forms inactive tails. This is consistent with the role of the CTD in DNA
injection as opposed to tail assembly.
A striking result of the holin co-expression assay is that full-length gpK does not exhibit lytic
activity while the CTD alone does. This indicates that the NTD is in some way inhibiting the
function of the CTD possibly by physically blocking the active site and may explain the absence
of lytic activity detected in the in vitro assay using chloroform treated cells. Since the CTD alone
is poorly soluble I was unable to assay it using this method. As mentioned before Moak and
Molineux (2004) did not detect phage associated PG hydrolase activity with phage lambda and
HK022, which both have an N-terminal Mov34 domain, while the phage Xp10 encodes a
predicted NlpC/P60 domain without an N-terminal Mov34 domain and did have PG hydrolytic
activity. The genomic position of this protein in Xp10 is similar to that of lambda. One
explanation for this is that in lambda the NTD inhibits the activity of the CTD until the tail
interacts with the host and either proteolysis or a conformational change takes place within gpK
such that the NTD permits the CTD to hydrolyze the PG layer facilitating DNA injection. This
NTD-mediated inhibition of the CTD of gpK is a potential mechanism of regulation that prevents
the CTD from prematurely hydrolyzing the PG layer. Since the E. coli PG layer is largely single
layered excessive lytic activity could lead to cell death before the phage has an opportunity to
replicate. One method of testing whether gpK is proteolyzed during the process of DNA
injection would be to produce phage particles with FLAG-tagged copies of gpK and then use
these phages to infect cells. Samples at specific time points could be removed and probed by
western blot to observe bands that correspond to full-length gpK or just single domains.
It would be useful to test the importance of the CTD in the context of a phage infection to
provide stronger evidence for its role in PG degradation. One way to demonstrate that would be
to introduce the C121A point substitution into a lambda prophage using recombination from a
plasmid. The phage can be induced and the C121A substitution should permit assembly of the
phage particle but render it incapable of injecting its DNA. Potassium release has been correlated
with DNA injection (Boulanger and Letellier 1992) and this sample of phage can be added to
cells and the release of potassium can be measured to determine if DNA injection has occurred.
If phages produced with the C121A substitution do not show a release of potassium then it would
![Page 47: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/47.jpg)
39
provide support for the hypothesis that the CTD of gpK is necessary for the DNA injection
process. It would be necessary to confirm here that the phages still absorb to the cell surface and
because the phages containing the C121A substitution would be inactive it may be necessary to
examine this by TEM.
From the data I have presented it is clear that gpK possesses an N-terminal Mov34 domain and a
C-terminal NlpC/P60 domain. The role of each of these domains has been partly elucidated here.
The NTD functions by ensuring efficient assembly of lambda tails, while the CTD exhibits lytic
activity and very likely functions by cleaving the PG layer facilitating DNA injection. What is
less clear is how the NTD is affecting the assembly of tails in addition to inhibiting the activity
of the CTD. It is possible that the NTD performs multiple functions forming part of the initiator
complex to efficiently assemble phage tails while also acting as a regulator of the CTD during
the process of DNA injection and indeed the data presented here suggest that. Proteolysis is very
likely the function of the NTD during assembly. The fact that the E19A substitution only causes
a reduction in the number of tail particles formed instead of no tails indicates that gpK-E19A
may incorporate into the assembling phage tail but that the active site is necessary for proteolysis
Figure 15. Model of peptidoglycan lysis by the CTD of gpK.
In the first step the lambda tail tip (light blue trapezoid) associates with the outer
membrane while the NTD of gpK (orange circle) physically interacts with the CTD (blue
circle) to block its active site (yellow triangle). After the tip associates more closely with
the outer membrane and is exposed to the periplasm and the PG layer the NTD, through
a conformational change or proteolysis event, stops blocking the CTD active site
allowing hydrolysis of the PG layer.
![Page 48: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/48.jpg)
40
of another tail protein leading to efficient tail assembly. Small changes in the tail would be
difficult to observe by TEM, which would explain why tails produced by the E19A substitution
appear morphologically normal. I have already indicated that gpH is a candidate substrate for
gpK but it remains a possibility that another phage tail protein in the initiator such as gpI or gpL
may be subject to gpK-mediated proteolysis. I do not think that auto-proteolysis of gpK during
DNA injection is a likely function for the NTD because inactivating the active site of the NTD
reduces the number of tails produced, which shows it is needed for efficient tail synthesis. My
data also suggests that the NTD has another function in inhibiting the activity of the CTD. In my
model of DNA injection (Figure 15) I propose that when the tail tip associates with the outer
membrane and enters the periplasm gpK undergoes a conformational change or proteolysis
relieving the inhibitory effect of the NTD thus exposing the active site of the CTD and allowing
it to locally hydrolyze the PG layer.
There are a number of outstanding questions regarding the role of gpK. It remains to be
determined whether full-length gpK or simply the CTD is a component of the phage tail tip. This
is essential because the CTD can only have a role in DNA injection if it can be shown to be part
of the mature phage particle. This will provide additional support for the role of gpK in
hydrolyzing the PG layer during lambda DNA injection. Secondly, it would be useful to confirm
that gpK can hydrolyze PG in an in vitro setting and to show that the predicted site of cleavage
(position 3 in Figure 4) is consistent with other NlpC/P60 domains. How the NTD assists in
phage tail assembly and inhibits the activity of the CTD will require further elucidation. If the
NTD is physically blocking the active site of the CTD it may be possible to identify residues
needed for this inhibition and substitute them and observe if this inhibition is relieved using the
assays described in this work. Also, the function of the NTD as a protease needs to be confirmed
and its particular substrate identified. One way to identify possible substrates for the NTD is to
introduce amber mutations into, or delete, genes like I and L in the pETail plasmid bearing
substitutions to the active site of the NTD of gpK. The plasmid could be expressed and
complemented with FLAG-tagged copies of the potential substrate allowing tail assembly to
occur. If gpK is cleaving another tail protein then comparing the molecular weights by western
blot of a wild-type versus the E19A substitution should show a shift in the bands of these
potential tagged substrates.
![Page 49: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/49.jpg)
41
References
Ackermann, H. W. 2009. Phage classification and characterization. Methods in Molecular Biology
(Clifton, N.J.) 501 : 127-40.
Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997.
Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic
Acids Research 25 (17) (Sep 1): 3389-402.
Ambroggio, X. I., D. C. Rees, and R. J. Deshaies. 2004. JAMM: A metalloprotease-like zinc site in the
proteasome and signalosome. PLoS Biology 2 (1) (Jan): E2.
Anantharaman, V., and L. Aravind. 2003. Evolutionary history, structural features and biochemical
diversity of the NlpC/P60 superfamily of enzymes. Genome Biology 4 (2): R11.
Appleyard, R. K. 1954. Segregation of new lysogenic types during growth of a doubly lysogenic strain
derived from escherichia coli K12. Genetics 39 (4) (Jul): 440-52.
Aramini, J. M., P. Rossi, Y. J. Huang, L. Zhao, M. Jiang, M. Maglaqui, R. Xiao, et al.. 2008. Solution
NMR structure of the NlpC/P60 domain of lipoprotein spr from escherichia coli: Structural evidence
for a novel cysteine peptidase catalytic triad. Biochemistry 47 (37) (Sep 16): 9715-7.
Aravind, L., and C. P. Ponting. 1998. Homologues of 26S proteasome subunits are regulators of
transcription and translation. Protein Science : A Publication of the Protein Society 7 (5) (May):
1250-4.
Bauerl, C., G. Perez-Martinez, F. Yan, D. B. Polk, and V. Monedero. 2010. Functional analysis of the p40
and p75 proteins from lactobacillus casei BL23. Journal of Molecular Microbiology and
Biotechnology 19 (4): 231-41.
Blasi, U., C. Y. Chang, M. T. Zagotta, K. B. Nam, and R. Young. 1990. The lethal lambda S gene
encodes its own inhibitor. The EMBO Journal 9 (4) (Apr): 981-9.
Boulanger, P., and L. Letellier. 1992. Ion channels are likely to be involved in the two steps of phage T5
DNA penetration into escherichia coli cells. The Journal of Biological Chemistry 267 (5) (Feb 15):
3168-72.
Casjens, S., and J. King. 1975. Virus assembly. Annual Review of Biochemistry 44 : 555-611.
Cohen, D. N., Y. Y. Sham, G. D. Haugstad, Y. Xiang, M. G. Rossmann, D. L. Anderson, and D. L.
Popham. 2009. Shared catalysis in virus entry and bacterial cell wall depolymerization. Journal of
Molecular Biology 387 (3) (Apr 3): 607-18.
Davidson, A. R., and R. T. Sauer. 1994. Folded proteins occur frequently in libraries of random amino
acid sequences. Proceedings of the National Academy of Sciences of the United States of America 91
(6) (Mar 15): 2146-50.
![Page 50: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/50.jpg)
42
Demchick, P., and A. L. Koch. 1996. The permeability of the wall fabric of escherichia coli and bacillus
subtilis. Journal of Bacteriology 178 (3) (Feb): 768-73.
Esquinas-Rychen, M., and B. Erni. 2001. Facilitation of bacteriophage lambda DNA injection by inner
membrane proteins of the bacterial phosphoenol-pyruvate: Carbohydrate phosphotransferase system
(PTS). Journal of Molecular Microbiology and Biotechnology 3 (3) (Jul): 361-70.
Estes, K. A., R. Kalamegham, and W. Hanna-Rose. 2007. Membrane localization of the NlpC/P60 family
protein EGL-26 correlates with regulation of vulval cell morphogenesis in caenorhabditis elegans.
Developmental Biology 308 (1) (Aug 1): 196-205.
Feucht, A., A. Schmid, R. Benz, H. Schwarz, and K. J. Heller. 1990. Pore formation associated with the
tail-tip protein pb2 of bacteriophage T5. The Journal of Biological Chemistry 265 (30) (Oct 25):
18561-7.
Fowler, A. V., and I. Zabin. 1978. Amino acid sequence of beta-galactosidase. XI. peptide ordering
procedures and the complete sequence. The Journal of Biological Chemistry 253 (15) (Aug 10):
5521-5.
Gan, L., S. Chen, and G. J. Jensen. 2008. Molecular organization of gram-negative peptidoglycan.
Proceedings of the National Academy of Sciences of the United States of America 105 (48) (Dec 2):
18953-7.
Gao, L. Y., M. Pak, R. Kish, K. Kajihara, and E. J. Brown. 2006. A mycobacterial operon essential for
virulence in vivo and invasion and intracellular persistence in macrophages. Infection and Immunity
74 (3) (Mar): 1757-67.
Gibbs, K. A., D. D. Isaac, J. Xu, R. W. Hendrix, T. J. Silhavy, and J. A. Theriot. 2004. Complex spatial
distribution and dynamics of an abundant escherichia coli outer membrane protein, LamB.
Molecular Microbiology 53 (6) (Sep): 1771-83.
Glauner, B., J. V. Holtje, and U. Schwarz. 1988. The composition of the murein of escherichia coli. The
Journal of Biological Chemistry 263 (21) (Jul 25): 10088-95.
Guzman, L. M., D. Belin, M. J. Carson, and J. Beckwith. 1995. Tight regulation, modulation, and high-
level expression by vectors containing the arabinose PBAD promoter. Journal of Bacteriology 177
(14) (Jul): 4121-30.
Hara, H., N. Abe, M. Nakakouji, Y. Nishimura, and K. Horiuchi. 1996. Overproduction of penicillin-
binding protein 7 suppresses thermosensitive growth defect at low osmolarity due to an spr mutation
of escherichia coli. Microbial Drug Resistance (Larchmont, N.Y.) 2 (1) (Spring): 63-72.
Harz, H., K. Burgdorf, and J. V. Holtje. 1990. Isolation and separation of the glycan strands from murein
of escherichia coli by reversed-phase high-performance liquid chromatography. Analytical
Biochemistry 190 (1) (Oct): 120-8.
Ishikawa, S., Y. Hara, R. Ohnishi, and J. Sekiguchi. 1998. Regulation of a new cell wall hydrolase gene,
cwlF, which affects cell separation in bacillus subtilis. Journal of Bacteriology 180 (9) (May): 2549-
55.
![Page 51: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/51.jpg)
43
Juhala, R. J., M. E. Ford, R. L. Duda, A. Youlton, G. F. Hatfull, and R. W. Hendrix. 2000. Genomic
sequences of bacteriophages HK97 and HK022: Pervasive genetic mosaicism in the lambdoid
bacteriophages. Journal of Molecular Biology 299 (1) (May 26): 27-51.
Katsura, I.1976. Morphogenesis of bacteriophage lambda tail. polymorphism in the assembly of the major
tail protein. Journal of Molecular Biology 107 (3) (Nov 5): 307-26.
———. 1983. Tail assembly and injection. In Lambda II (cold spring harbor)., 331-346.
———. 1987. Determination of bacteriophage lambda tail length by a protein ruler. Nature 327 (6117)
(May 7-13): 73-5.
Katsura, I., and P. W. Kuhl. 1975. Morphogenesis of the tail of bacteriophage lambda. III. morphogenetic
pathway. Journal of Molecular Biology 91 (3) (Jan 25): 257-73.
Katsura, I., and A. Tsugita. 1977. Purification and characterization of the major protein and the terminator
protein of the bacteriophage lambda tail. Virology 76 (1) (Jan): 129-45.
Kumar Sarkar, Subodh, Yoko Takeda, Shuji Kanamaru, and Fumio Arisaka. 2006. Association and
dissociation of the cell puncturing complex of bacteriophage T4 is controlled by both pH and
temperature. Biochimica Et Biophysica Acta (BBA) - Proteins & Proteomics 1764 (9) (9): 1487-92.
Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage
T4. Nature 227 (5259) (Aug 15): 680-5.
Layec, S., B. Decaris, and N. Leblond-Bourget. 2008. Characterization of proteins belonging to the
CHAP-related superfamily within the firmicutes. Journal of Molecular Microbiology and
Biotechnology 14 (1-3): 31-40.
Levin, Margaret E., Roger W. Hendrix, and Sherwood R. Casjens. 1993. A programmed translational
frameshift is required for the synthesis of a bacteriophage λ tail assembly protein. Journal of
Molecular Biology 234 (1) (11/5): 124-39.
Mandelkern, M., J. G. Elias, D. Eden, and D. M. Crothers. 1981. The dimensions of DNA in solution.
Journal of Molecular Biology 152 (1) (Oct 15): 153-61.
Matias, V. R., A. Al-Amoudi, J. Dubochet, and T. J. Beveridge. 2003. Cryo-transmission electron
microscopy of frozen-hydrated sections of escherichia coli and pseudomonas aeruginosa. Journal of
Bacteriology 185 (20) (Oct): 6112-8.
McCullough, J., M. J. Clague, and S. Urbe. 2004. AMSH is an endosome-associated ubiquitin
isopeptidase. The Journal of Cell Biology 166 (4) (Aug 16): 487-92.
Meroueh, S. O., K. Z. Bencze, D. Hesek, M. Lee, J. F. Fisher, T. L. Stemmler, and S. Mobashery. 2006.
Three-dimensional structure of the bacterial cell wall peptidoglycan. Proceedings of the National
Academy of Sciences of the United States of America 103 (12) (Mar 21): 4404-9.
![Page 52: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/52.jpg)
44
Mikoulinskaia, G. V., I. V. Odinokova, A. A. Zimin, V. Y. Lysanskaya, S. A. Feofanov, and O. A.
Stepnaya. 2009. Identification and characterization of the metal ion-dependent L-alanoyl-D-
glutamate peptidase encoded by bacteriophage T5. The FEBS Journal 276 (24) (Dec): 7329-42.
Miller, R. K., H. Qadota, T. J. Stark, K. B. Mercer, T. S. Wortham, A. Anyanful, and G. M. Benian. 2009.
CSN-5, a component of the COP9 signalosome complex, regulates the levels of UNC-96 and UNC-
98, two components of M-lines in caenorhabditis elegans muscle. Molecular Biology of the Cell 20
(15) (Aug): 3608-16.
Moak, M., and I. J. Molineux. 2004. Peptidoglycan hydrolytic activities associated with bacteriophage
virions. Molecular Microbiology 51 (4) (Feb): 1169-83.
Murialdo, H., and L. Siminovitch. 1972. The morphogenesis of bacteriophage lambda. IV. identification
of gene products and control of the expression of the morphogenetic information. Virology 48 (3)
(Jun): 785-823.
Parkinson, J. S. 1968. Genetics of the left arm of the chromosome of bacteriophage lambda. Genetics 59
(3) (Jul): 311-25.
Patterson-Fortin, J., G. Shao, H. Bretscher, T. E. Messick, and R. A. Greenberg. 2010. Differential
regulation of JAMM domain deubiquitinating enzyme activity within the RAP80 complex. The
Journal of Biological Chemistry 285 (40) (Oct 1): 30971-81.
Peng, Z., G. Serino, and X. W. Deng. 2001. Molecular characterization of subunit 6 of the COP9
signalosome and its role in multifaceted developmental processes in arabidopsis. The Plant Cell 13
(11) (Nov): 2393-407.
Piuri, M., and G. F. Hatfull. 2006. A peptidoglycan hydrolase motif within the mycobacteriophage TM4
tape measure protein promotes efficient infection of stationary phase cells. Molecular Microbiology
62 (6) (Dec): 1569-85.
Rao, G. R., and D. P. Burma. 1971. Purification and properties of phage P22-induced lysozyme. The
Journal of Biological Chemistry 246 (21) (Nov): 6474-9.
Rashel, M., J. Uchiyama, I. Takemura, H. Hoshiba, T. Ujihara, H. Takatsuji, K. Honke, and S. Matsuzaki.
2008. Tail-associated structural protein gp61 of staphylococcus aureus phage phi MR11 has
bifunctional lytic activity. FEMS Microbiology Letters 284 (1) (Jul): 9-16.
Ren, X., J. Lin, C. Jin, and B. Xia. 2010. Solution structure of the N-terminal catalytic domain of human
H-REV107--a novel circular permutated NlpC/P60 domain. FEBS Letters 584 (19) (Oct 8): 4222-6.
Roessner, C. A., and G. M. Ihler. 1986. Formation of transmembrane channels in liposomes during
injection of lambda DNA. The Journal of Biological Chemistry 261 (1) (Jan 5): 386-90.
Roessner, C. A., D. K. Struck, and G. M. Ihler. 1983. Injection of DNA into liposomes by bacteriophage
lambda. The Journal of Biological Chemistry 258 (1) (Jan 10): 643-8.
![Page 53: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/53.jpg)
45
SALTON, M. R., and J. M. GHUYSEN. 1959. The structure of di- and tetrasaccharides released from cell
walls by lysozyme and streptomyces F 1 enzyme and the beta(1 to 4) N-acetylhexos-aminidase
activity of these enzymes. Biochimica Et Biophysica Acta 36 (Dec): 552-4.
Sampson, L. L., R. W. Hendrix, W. M. Huang, and S. R. Casjens. 1988. Translation initiation controls the
relative rates of expression of the bacteriophage lambda late genes. Proceedings of the National
Academy of Sciences of the United States of America 85 (15) (Aug): 5439-43.
Sanches, M., B. S. Alves, N. I. Zanchin, and B. G. Guimaraes. 2007. The crystal structure of the human
Mov34 MPN domain reveals a metal-free dimer. Journal of Molecular Biology 370 (5) (Jul 27):
846-55.
Scandella, D., and W. Arber. 1976. Phage lambda DNA injection into escherichia coli pel- mutants is
restored by mutations in phage genes V or H. Virology 69 (1) (Jan): 206-15.
———. 1974. An escherichia coli mutant which inhibits the injection of phage lambda DNA. Virology 58
(2) (Apr): 504-13.
Scott, S. P., A. Teh, C. Peng, and M. F. Lavin. 2002. One-step site-directed mutagenesis of ATM cDNA
in large (20kb) plasmid constructs. Human Mutation 20 (4) (Oct): 323.
Strynadka, N. C., and M. N. James. 1991. Lysozyme revisited: Crystallographic evidence for distortion of
an N-acetylmuramic acid residue bound in site D. Journal of Molecular Biology 220 (2) (Jul 20):
401-24.
Tsuge, Y., H. Ogino, H. Teramoto, M. Inui, and H. Yukawa. 2008. Deletion of cgR_1596 and cgR_2070,
encoding NlpC/P60 proteins, causes a defect in cell separation in corynebacterium glutamicum R.
Journal of Bacteriology 190 (24) (Dec): 8204-14.
Tsui, L. C., and R. W. Hendrix. 1983. Proteolytic processing of phage lambda tail protein gpH: Timing of
the cleavage. Virology 125 (2) (Mar): 257-64.
Uehara, T., and J. T. Park. 2003. Identification of MpaA, an amidase in escherichia coli that hydrolyzes
the gamma-D-glutamyl-meso-diaminopimelate bond in murein peptides. Journal of Bacteriology
185 (2) (Jan): 679-82.
Verma, R., L. Aravind, R. Oania, W. H. McDonald, J. R. Yates 3rd, E. V. Koonin, and R. J. Deshaies.
2002. Role of Rpn11 metalloprotease in deubiquitination and degradation by the 26S proteasome.
Science (New York, N.Y.) 298 (5593) (Oct 18): 611-5.
Vollmer, W., D. Blanot, and M. A. de Pedro. 2008. Peptidoglycan structure and architecture. FEMS
Microbiology Reviews 32 (2) (Mar): 149-67.
Walker, J. E., A. D. Auffret, A. Carne, A. Gurnett, P. Hanisch, D. Hill, and M. Saraste. 1982. Solid-phase
sequence analysis of polypeptides eluted from polyacrylamide gels. an aid to interpretation of DNA
sequences exemplified by the escherichia coli unc operon and bacteriophage lambda. European
Journal of Biochemistry / FEBS 123 (2) (Apr 1): 253-60.
![Page 54: The Role of Bacteriophage Lambda gpK in Tail Assembly and ... · The Role of Bacteriophage Lambda gpK in Tail Assembly and Host Cell Entry David Lawson Coburn Master of Science Graduate](https://reader034.vdocuments.net/reader034/viewer/2022042322/5f0c43057e708231d434873a/html5/thumbnails/54.jpg)
46
Wang, J., M. Hofnung, and A. Charbit. 2000. The C-terminal portion of the tail fiber protein of
bacteriophage lambda is responsible for binding to LamB, its receptor at the surface of escherichia
coli K-12. Journal of Bacteriology 182 (2) (Jan): 508-12.
Weigle, J. 1968. Studies on head-tail union in bacteriophage lambda. Journal of Molecular Biology 33 (2)
(Apr 28): 483-9.
———. 1966. Assembly of phage lambda in vitro. Proceedings of the National Academy of Sciences of
the United States of America 55 (6) (Jun): 1462-6.
White, R., S. Chiba, T. Pang, J. S. Dewey, C. G. Savva, A. Holzenburg, K. Pogliano, and R. Young.
2011. Holin triggering in real time. Proceedings of the National Academy of Sciences of the United
States of America 108 (2) (Jan 11): 798-803.
White, R., T. A. Tran, C. A. Dankenbring, J. Deaton, and R. Young. 2010. The N-terminal
transmembrane domain of lambda S is required for holin but not antiholin function. Journal of
Bacteriology 192 (3) (Feb): 725-33.
Williams, N., D. K. Fox, C. Shea, and S. Roseman. 1986. Pel, the protein that permits lambda DNA
penetration of escherichia coli, is encoded by a gene in ptsM and is required for mannose utilization
by the phosphotransferase system. Proceedings of the National Academy of Sciences of the United
States of America 83 (23) (Dec): 8934-8.
Xu, Jun. 2001. A conserved frameshift strategy in dsDNA long tailed bacteriophage. PhD., University of
Pittsburgh.
Xu, Q., P. Abdubek, T. Astakhova, H. L. Axelrod, C. Bakolitsa, X. Cai, D. Carlton, et al.. 2010. Structure
of the gamma-D-glutamyl-L-diamino acid endopeptidase YkfC from bacillus cereus in complex with
L-ala-gamma-D-glu: Insights into substrate recognition by NlpC/P60 cysteine peptidases. Acta
Crystallographica.Section F, Structural Biology and Crystallization Communications 66 (Pt 10)
(Oct 1): 1354-64.
Xu, Q., S. Sudek, D. McMullan, M. D. Miller, B. Geierstanger, D. H. Jones, S. S. Krishna, et al.. 2009.
Structural basis of murein peptide specificity of a gamma-D-glutamyl-l-diamino acid endopeptidase.
Structure (London, England : 1993) 17 (2) (Feb 13): 303-13.
Yamaguchi, H., K. Furuhata, T. Fukushima, H. Yamamoto, and J. Sekiguchi. 2004. Characterization of a
new bacillus subtilis peptidoglycan hydrolase gene, yvcE (named cwlO), and the enzymatic
properties of its encoded protein. Journal of Bioscience and Bioengineering 98 (3): 174-81.
Yanofsky, C., and J. Ito. 1966. Nonsense codons and polarity in the tryptophan operon. Journal of
Molecular Biology 21 (2) (Nov 14): 313-34.
Young, R. 1992. Bacteriophage lysis: Mechanism and regulation. Microbiological Reviews 56 (3) (Sep):
430-81.
Yuzenkova, J., S. Nechaev, J. Berlin, D. Rogulja, K. Kuznedelov, R. Inman, A. Mushegian, and K.
Severinov. 2003. Genome of xanthomonas oryzae bacteriophage Xp10: An odd T-odd phage.
Journal of Molecular Biology 330 (4) (Jul 18): 735-48.