the role of oxidative stress on neural trpc3, …...the role of oxidative stress on neural trpc3,...

The Role of Oxidative Stress on Neural TRPC3, TRPC5, TRPC6 Expression and/or Function and Relevance to

Bipolar Disorder

by

Steven Yi Sheng Tong

A thesis submitted in conformity with the requirements for the degree of Masters of Science

Department of Pharmacology and Toxicology University of Toronto

© Copyright by Steven Tong 2012

ii

The Role of Neural TRPC3, TRPC5, and TRPC6 Expression

and/or Function and Relevance to Bipolar Disorder

Steven Yi Sheng Tong

Masters of Science

Department of Pharmacology and Toxicology University of Toronto

2012

Abstract

The etiology of bipolar disorder (BD) is multidimensional and thought to involve several

factors that increase neuronal oxidative stress and disrupt intracellular calcium

homeostasis. As calcium-permeable canonical transient receptor potential channels

(TRPC) have been linked to bipolar pathophysiology, I sought to determine whether

oxidative stress affects TRPC3/TRPC5/TRPC6 expression and/or function. Chronic (4-

day) but not acute (24-hour) rotenone-induced oxidative stress dose-dependently

reduced TRPC5 and TRPC6 protein levels in primary rat cortical neurons. A decrease in

TRPC5 mRNA levels was only found following acute but not chronic rotenone whereas

TRPC6 mRNA levels did not change significantly with either treatment. Reduced

TRPC3 function was seen after chronic stress when stimulated by TRPC3/6 activator, 1-

oleoyl-2-acetyl-sn-glycerol. Lithium pre-treatment attenuated the rotenone-induced

reduction in TRPC3 but not TRPC6 protein levels. These results suggest TRPC

subtypes are differentially regulated by oxidative stress and support a potential

mechanistic link between oxidative stress and calcium dyshomeostasis in BD.

iii

Acknowledgments

The completion of this thesis and research project would not be possible without the

unwavering support of several people. First and foremost, I would like to express my

gratitude to my supervisor, Dr. Jerry Warsh, who provided me with this opportunity and

at every turn, provided sound advice. He not only taught and guided me but challenged

me to learn, to grow, and to think critically.

I would also like to acknowledge my fellow colleagues that have helped me

acquire the technical skills needed to collect the data presented here. Many thanks to

Angela Roedding for sharing your expertise in primary rat cortical neurons and

answering any and all questions I had about it; Marty Green for teaching me the

intricacies PCR; Wynne Au-Yeung for showing me the immunoblotting process; Dr.

Takuji Uemura for helping me perfect my techniques as well as some great guidance;

Dharshini Ganeshan for your expertise in handling cell cultures; and Dr. Michael Tseng

for sharing your knowledge of live cell calcium kinetics imaging assays.

Lastly, the morale support and love I received from my family, partner, and

friends were invaluable and have been a constant source of strength and

encouragement. Thank you everyone and I feel blessed to have each and every one of

you in my life.

iv

Table of Contents

Acknowledgments ........................................................................................................... iii

Table of Contents ............................................................................................................ iii

List of Tables................................................................................................................. viii

List of Figures ................................................................................................................. ix

1 Introduction .................................................................................................................. 1

1.1 Bipolar Disorder .................................................................................................... 2

1.1.1 Classification .............................................................................................. 2

1.1.2 Epidemiology .............................................................................................. 2

1.1.3 Burden of Disease ...................................................................................... 3

1.1.4 Treatment ................................................................................................... 4

1.1.5 Etiology ....................................................................................................... 5

1.2 Evidence of Neuropathology in BD ....................................................................... 7

1.2.1 Structural Abnormalities in the Brain .......................................................... 7

1.2.2 Cellular Disturbances in BD ........................................................................ 8

1.2.3 Genetic Associations with BD ................................................................... 10

1.2.4 Irregularities in Signal Transduction in BD ................................................ 12

1.2.5 Alterations in Intracellular Ca2+ ................................................................. 20

1.3 Oxidative Stress in BD ........................................................................................ 23

1.3.1 Overview of Oxidative Stress.................................................................... 23

1.3.2 Evidence of Oxidative Stress in BD .......................................................... 24

1.4 Lithium and BD .................................................................................................... 28

1.4.1 Overview of Lithium and Lithium Treatment in BD.................................... 28

1.4.2 Evidence of Neuroprotective and Anti-oxidative Effects of Lithium ........... 29

v

1.5 TRP Channels ..................................................................................................... 31

1.5.1 Overview of TRP Channels ...................................................................... 31

1.5.2 Molecular Structure of TRP Channels ...................................................... 32

1.5.3 Structural Aspects of TRP Channels ........................................................ 33

1.6 The Canonical TRP Subfamily of TRP Channels ................................................ 35

1.6.1 Overview and Distribution of TRPC Channels .......................................... 35

1.6.2 Biophysical Characteristics of TRPC Channels Pores .............................. 37

1.6.3 Activation Mechanisms of TRPC Channels .............................................. 38

1.6.4 Pharmacological Properties of TRPC Channels ....................................... 39

1.6.5 Physiological Role of TRPC Channels ..................................................... 40

1.7 Main Objectives and Hypothesis ......................................................................... 41

2 Materials and Methods .............................................................................................. 43

2.1 Materials .............................................................................................................. 44

2.1.1 Chemicals, Reagents, and Drugs ............................................................. 44

2.1.2 Animals ..................................................................................................... 44

2.1.3 Cell Culture Reagents .............................................................................. 45

2.1.4 Antibodies ................................................................................................. 45

2.1.5 Analytical Kits ........................................................................................... 46

2.1.6 Calcium Kinetic Assay Solutions .............................................................. 46

2.2 Primary Rat Cortical Neuronal Cell Culture and Drug Treatment ........................ 47

2.2.1 Preparation of Cell Culture Plastics .......................................................... 47

2.2.2 Fetal Rat Cortical Dissection .................................................................... 47

2.2.3 Establishment of Primary Rat Cortical Neuronal Cultures ........................ 48

2.2.4 Maintenance of Cell Cultures ................................................................... 48

2.2.5 Drug Treatment ........................................................................................ 49

2.3 Immunocytochemistry ......................................................................................... 52

vi

2.4 Measurement of Cell Viability .............................................................................. 53

2.5 Immunoblotting .................................................................................................... 54

2.5.1 Preparation of Cell Lysates for Immunoblotting ........................................ 54

2.5.2 SDS-PAGE and Transfer .......................................................................... 54

2.5.3 Probing and Development ........................................................................ 55

2.6 Quantitative Real-time PCR ................................................................................ 58

2.6.1 RNA Extraction ......................................................................................... 58

2.6.2 First Strand Synthesis .............................................................................. 58

2.6.3 Primer Design and Optimization ............................................................... 58

2.6.4 Polymerase Chain Reaction ..................................................................... 59

2.7 Live Cell Calcium Kinetics Imaging ..................................................................... 62

2.7.1 Preparation of cells ................................................................................... 62

2.7.2 Imaging ..................................................................................................... 62

2.8 Data Analysis ...................................................................................................... 64

3 Results ....................................................................................................................... 65

3.1 Optimal conditions for real-time RT-PCR ............................................................ 66

3.2 Detection of TRPC5 and TRPC6 protein levels in Primary Rat Cortical Neurons ............................................................................................................... 73

3.3 Effect of Oxidative Stress on Primary Rat Cortical Neurons ................................ 75

3.4 The Effect of Acute and Chronic Oxidative Stress on TRPC5 and TRPC6 ......... 79

3.5 OAG Induces a TRPC3-mediated Response in Primary Rat Cortical Neurons ... 84

3.6 The Effect of Chronic Rotenone Induced Oxidative Stress on the Mobilization of Calcium in Primary Rat Cortical Neurons ........................................................ 88

3.7 Effect of Chronic Lithium on the Levels of TRPC3, TRPC5, and TRPC6 Protein and mRNA under Chronic Rotenone-induced Oxidative Stress .............. 91

4 Discussion ................................................................................................................. 97

4.1 Acute and Chronic Oxidative Stress on TRPC5 and TRPC6 .............................. 99

vii

4.2 The Functional Significance of Chronic Oxidative Stress on TRPC3/6 ............. 104

4.3 The Effect of Chronic Lithium Treatment on Chronic Rotenone-induced Changes in TRPC3, TRPC5, and TRPC6 ......................................................... 107

4.4 Methodological Considerations and Limitations ................................................ 110

4.4.1 Cell Model and Stressor ......................................................................... 110

4.4.2 mRNA Quantification: Real-time RT-PCR .............................................. 111

4.4.3 Protein Quantification: Western Blot ....................................................... 111

4.4.4 Functional Assay: Calcium Kinetics ........................................................ 113

4.5 Future Studies ................................................................................................... 116

4.6 Conclusions ....................................................................................................... 120

References................................................................................................................... 122

viii

List of Tables

Table 1.1 Commonly prescribed treatments to BD episodes ………………………….6

Table 1.2 Disturbances in G-protein signaling in BD ……………………………. …...18

Table 1.3 Disturbances in cAMP-pathway in BD ………………………………… …...19

Table 2.1 Immunoblotting conditions for TRPC3, TRPC5, TRPC6, α-tubulin, and β-

actin ……………………………………………………………………….. …...56

Table 2.2 Accession number, sequence, and expected product length of primer pairs

used for TRPC3, TRPC5, TRPC6, HO-1, and GAPDH.…………………..59

Table 3.1 Optimal primer concentration and template concentration for the

amplification of TRPC3, TRPC5, TRPC6, HO-1 and GAPDH .…………..70

ix

List of Figures

Figure 1.1 The phosphoinositide (PI) signal cascade ………………………………….17

Figure 1.2 Detoxification of Reactive Oxygen Species in the body …………………..26

Figure 2.1 Schedule of oxidative stress and lithium of rat cortical neurons …………50

Figure 3.1 Gel electrophoresis of RNA extracted from RCN and BLCL ……………..66

Figure 3.2 Dissociation curves of TRPC3, TRPC5, TRPC6, HO-1 and GAPH primers

…………………………………………………………………………………...67

Figure 3.3 Agarose gel electrophoresis of TRPC5, TRPC6 and GAPDH amplicons 68

Figure 3.4 Relative efficiency curves of TRPC5 and TRPC6 primers ………………..69

Figure 3.5 Western blot assay and linearity of detection vs lysate protein

concentration of TRPC3, TRPC5, and TRPC6 in primary rat cortical

neurons …………………………………………………………………………72

Figure 3.6 Representative dual labelled immunocytochemistry images of primary rat

cortical neuron cultures ……………………………………………………….74

Figure 3.7 Representative phase contrast microscopy images of primary rat cortical

neuron cultures over 4 day rotenone-induced oxidative stress treatment 75

Figure 3.8 Effects of rotenone on HO-1 expression and cell viability in primary rat

cortical neurons ………………………………………………………………..76

Figure 3.9 The effect of acute and chronic rotenone treatment on TRPC3 protein and

mRNA levels in rat primary cortical neurons ……………………………….79


mRNA levels in rat primary cortical neurons ……………………………….80

x


mRNA levels …………………………………………………………………...81

Figure 3.12 Pry3 has a significant effect on mean normalized maximal intensity, rate of

rise, and area under the curve but not the percentage of OAG activated

responding ROIs in primary rat cortical neurons …………………………..84

Figure 3.13 OAG induced a Ca2+ response in rat primary cortical neurons is mediated

in part by TRPC3 ……………………………………………………………...85

Figure 3.14 Chronic rotenone treatment reduces OAG-induced Ca2+ response in

primary rat cortical neurons ………………………………………………….87

Figure 3.15 Rotenone treatment significantly attenuates calcium responses in rat

primary cortical neurones stimulated with OAG …………………………...88

Figure 3.16 The effect of lithium pretreatment on the downregulation of TRPC5 by

chronic rotenone treatment ………………………………………………….92





1

1 Introduction

2

1.1 Bipolar Disorder

1.1.1 Classification

Bipolar disorder (BD) is a chronic and recurrent mood disorder best characterized by

cycling episodes of manic and depression between periods of euthymia. The Diagnostic

and Statistical Manual IV – Text Revision (DSM IV-TR) defined symptoms and signs for

manic episodes include inflated self-esteem or grandiosity, decreased need for sleep,

over activity, decreased attention span, distractibility, and increased engagement in

pleasurable and risky activities. Symptoms of depression, in contrast, are described as

diminished interest in previously pleasurable activities, weight loss, insomnia, fatigue,

diminished ability to focus, feelings of worthiness and suicidal ideation. There are

currently four subtypes of BD recognized by the DSM IV-TR – BD type I, BD, type II,

cyclothymia and BD- Not Otherwise Specified (BD-NOS), which are distinguished based

on clinical symptom severity, duration of mania or hypomania, and symptom complexes.

1.1.2 Epidemiology

Epidemiological data show that BD can develop at any stage of life but most commonly

during late adolescence and early adulthood. One study found that most patients were

diagnosed with BD before the age of 25 [1]. The ratio of BD prevalence in men and

women is generally accepted as about equal [2]. However, women are more likely than

men to experience depressive episodes and rapid cycling BD, characterized by four or

more major mood shifts within one year [3, 4]. The overall lifetime prevalence of BD in

its broadest definition (includes bipolar spectrum disorders) is estimated to be between

3

3% and 10% in the U.S. [5]. A more recent report estimated an overall prevalence of 9%

in the European Union [6].

1.1.3 Burden of Disease

With regard to the burden of disease, BD was ranked sixth among the top ten most

disabling conditions in the world [7]. A significant contributor to this burden is the noted

increase in comorbidities associated with BD, with an estimated rate reported to range

from 30% to 75% [8]. In an adult population of BD type I and II patients, it was found

that over two thirds of the patients were diagnosed with substance use disorders,

anxiety disorders (panic disorder, obsessive compulsive disorder) and eating disorders

during their lifetime [9]. Axis I psychiatric disorders such as substance abuse and

anxiety disorders were equally prevalent and accounted for the majority of concurrent

diagnoses [8, 10-12]. Outside the realm of psychiatric disorders, BD patients are more

likely to develop cardiovascular disease, hypertension, respiratory diseases, illnesses

from musculoskeletal system, endocrine system, and nervous system, diabetes, and

obesity [13-18]. Lastly, the frequency of suicide is dramatically increased in BD patients

[19]. It has been estimated that mood disorders are responsible for 70% of all suicides

[20, 21]. While there is currently no consensus on whether comorbidity is a result of BD

or secondary to the adverse effects of medication and treatment, comorbid diseases

negatively impact functionality, quality of life, response to mood stabilizers and

prognosis [11, 16, 22].

In addition, patients suffering from BD have demonstrated impairment in mental

and social function. Multiple studies have established that BD patients performed worse

than demographically-matched healthy controls on neuropsychological tests in areas of

4

attention span and memory [23, 24]. Further studies showed that these functional

impairments persisted during periods of normal moods highlighting the fact that

deficiencies are independent of the episodic nature of BD [24-27]. Symptoms of BD

also significantly impact the social daily activities and productivity of BD patients.

The combined factors of comorbidity and functional decline result in a state of

significantly increased health care costs but reduced productivity which creates a heavy

burden on the patient, the caregivers and society at large. Indeed, in 2011 it was

estimated that the combined cost of BD type I and II was a staggering 151 billion dollars

in the United States in 2009 [28]. The author noted that this study only took into account

32.3% to 47.7% of the bipolar spectrum and the entire economic burden of BD would

greatly exceed that number.

1.1.4 Treatment

Although there are non-pharmaceutical treatments to BD such as electroconvulsive

therapy (ECT), currently, treatment with lithium and anticonvulsant mood stabilizers,

antipsychotics and antidepressants are the most common approaches [29]. Due to the

episodic nature of BD, the course and nature of treatment depends on the current state

(i.e. mania or depression) that the patient is experiencing. However, a common first-line

of treatment is mood stabilizers, most notably lithium [30]. Placebo-controlled trials have

shown that 50% of patients treated with lithium had a partial reduction of mania and

36% of patients treated with lithium have a strong response in treatment for depression

[31]. In addition, anticonvulsants, lamotrigine, carbamazepine, and valproate, are often

used as alternatives or adjunctive to lithium treatment and can act as mood stabilizers

[32-35]. Table 1.1 provides a summary on the efficacy of commonly prescribed

5

psychotropic medications for mood episodes in BD. While antipsychotics have been

reported to be less efficacious than lithium and anticonvulsants, these interventions still

demonstrate effectiveness in the treatment of BD symptoms [36-38]. Patients with acute

depression are also prescribed antidepressants [39] but most often under the cover of a

mood stabilizer. Unfortunately, although there are a number of pharmacological agents

for treatment of BD, there is still a dire need to develop more efficacious and tolerable

interventions as the degree of improvement in BD symptoms have not correlated to a

similar improvement in functionality [40].

1.1.5 Etiology

The ethiopathogenesis of BD has been recognized to be complex involving

disturbances in neurobiological function as a result of both environmental and genetic

factors. Multiple studies have reported traumatic life events and lack of social support to

adversely affect mental health and play a role in the development and progression of

BD [41, 42]. On the other hand, BD is considered a heritable disease and it has been

found that children with parents or siblings suffering from BD are 4 to 6 times more likely

to develop the illness [43]. Interestingly, anomalies associated with BD have been well-

documented at all levels: tissue, cellular, molecular and genetic, of physiology. While it

remains unclear whether these abnormalities are causal or consequential, they provide

valuable insight into the physiopathology of BD and will be reviewed in the next section.

6

Table 1.1 Commonly prescribed treatments to BD mood episodes [44].

Episode Available Treatments

Mania or Hypomania Lithium

Carbamazepine

Valproate

Atypical antipsychotic

Benzodiazepines

Depression Lithium

Lamotrigine

Antidepressants

Atypical antipsychotics

Euthymic Maintenance treatments –Mood Stabilizers with or without atypicals

7

1.2 Evidence of Neuropathology in BD

1.2.1 Structural Abnormalities in the Brain

Irregularities in brain structure are often studied by means of powerful imaging

techniques such as magnetic resonance imaging (MRI) and computed tomography (CT)

which allow the measurement of brain volume and morphometry. Currently, MRI is the

preferred method as it exposes patients to less radiation and produces images at higher

resolutions [45]. Overall, numerous studies have linked reductions in grey matter

volume and density with BD in the prefrontal cortex, hippocampus, parietal lobe,

cingulate, and temporal lobe [46-50]. Two longitudinal studies reported greater

volumetric decline in the subgenual cingulate gyrus and hippocampus in BD patients

relative to healthy controls [47, 51]. Similar to grey matter, imaging studies have

revealed significant decreases in white matter volume in the inferior cingulate cortex,

frontal, parietal, and temporal lobes of BD patients relative to healthy controls [52-54].

Interestingly, a reduction in white matter volume, albeit modest, was seen in patients

experiencing their first manic episode compared to healthy controls [55]. In addition,

total cerebral white matter was found to be reduced in euthymic BD males compared to

healthy controls [56].

Another aspect of white matter of interest is the presence of white matter

hyperintensities (WMH), seen as intense bright spots in T2-weighted MRI images [57].

While no consensus was reached in the association of white matter with BD in the early

2000s, a recent meta-analysis of 98 independent neuroimaging studies has reported a

significant increase in WMH in BD patients compared to controls [58]. Furthermore,

escalation in WMH has been demonstrated to be positively correlated to the frequency

8

of manic episodes and number of relapses requiring hospitalization and recovery from

mania or depression and length of euthymia are negatively correlated to WMH

frequency [59-61]. In summary, volumetric and densometric decreases in brain regions

and increases in WMH are correlated with BD and most likely represents physiological

changes at the cellular level.

1.2.2 Cellular Disturbances in BD

Evidence of structural abnormalities also directly implicates changes at the neurocellular

level. Indeed, studies using post-mortem brain samples found lower glial density in the

subgenual prefrontal cortex of patients with a familial history of BD relative to healthy

controls [62]. Glial density was also observed to be reduced in the dorsolateral

prefrontal cortex in BD patients [63]. Other studies using magnetic resonance

spectroscopy (MRS) and microscopic morphometry have corroborated these results

[64-66]. In addition, observations of reductions in neuronal soma size were also found

in the lateral amygdaloid nucleus and the accessory basal parvocellular nucleus within

the specific amygdaloid nuclei in BD patients [67]. Patients with BD also demonstrated a

significant decrease in neuronal cell density in the anterior cingulate cortex compared to

healthy controls [68]. Similar observations were also reported in the dorsolateral

prefrontal cortex and the anterior cingulate [63, 66]. Therefore, based on evidence from

these post-mortem studies, it has been hypothesized that loss of neuronal integrity and

atrophy are involved in the pathogenesis of BD.

Interestingly, a reduction in the concentration of amino acid derivative N-

acetylaspartate (NAA), found at high levels in neurons, can be used as a marker of loss

of neuronal function [69, 70]. In a proton MRS study, male patients suffering from

9

chronic BD showed lower NAA to creatine levels within the prefrontal cortex compared

to healthy controls [71]. These results supported findings from an older 1H-MRS study

also reporting a decrease in the ratio of NAA to creatine levels in the dorsolateral

prefrontal cortex [72]. In addition, lower NAA ratios were seen in the hippocampus of BD

type I patients compared to age, age of onset, and duration of illness matched healthy

controls [73]. A more recent study found that NAA/creatine ratios were lower in

euthymic BD type I patients compared to healthy controls implying that this change is

state-independent [74]. Furthermore, lower NAA/creatine ratios were detected in the left

dorsolateral prefrontal cortex of a mixed sample of young patients but in the right

dorsolateral prefrontal cortex of a sample of paediatric patients with a family history of

BD, acting as evidence of a difference in the pathobiology of different subtypes of BD

[75, 76]. In summary, reports of lower NAA levels combined with evidence of changes in

neuromorphology strongly suggest the loss of neuronal function and cell loss as a major

component of BD.

These changes in neuronal densities and function are postulated to be

associated with a decrease in cellular resilience [77]. In one study, changes in gene

expression in response to glucose deprivation induced stress were compared between

B lymphocyte cell lines (BLCLs) from BD patients and healthy controls. It was found that

at normal glucose concentrations, no differences between the two groups were

detected. However, an upregulation of mitochondrion and electron transport chain

related genes were found in lymphocytes from healthy controls while lymphocytes from

BD patients demonstrated a downregulation in electron transport chain related genes

[78]. This differential response supports anomalies in cellular response to stress which

may contribute to BD. Additionally, significant increases in cell death were observed in

10

differentiated neuronal cultures of biopsied olfactory mucosa from BD type I patients

relative to health controls [79]. The same study also discovered lower levels of

enzymatic gene expression, including inositol-1,4,5-triphosphate kinase A (IP3KA) in

inositol phosphate metabolism and phosphatidyl inositol signalling pathways. Such a

decrease in IP3KA levels could adversely affect neuronal adaptation as this enzyme has

been demonstrated to be involved in intracellular calcium homeostasis and regulation

by terminating IP3 signalling and neuronal structural plasticity by bundling actin [80, 81].

Further consideration of the irregularities in the cellular signalling pathways will be

discussed in Section 1.2.4. Nonetheless, a growing body of evidence strongly

implicates the involvement of neural impairment in function, size and response to

cellular stress to BD pathogenesis.

1.2.3 Genetic Associations with BD

Accumulated evidence from the past 4 decades, demonstrating a correlation between

risk of BD and relatedness to BD patients within families, strongly supports a genetic

predisposition to BD through numerous family, twin and adoption studies [82, 83]. Using

linkage analysis, a locus on chromosome 21q22.3 demonstrated significant association

with BD [84]. Interestingly, this region contained the C21ORF29/TSPEAR and transient

receptor potential melastatin subtype 2 (TRPM2) genes. TRPM2 is a member of larger

family of TRP channels which are Ca2+ permeable ion channels and will be discussed

more in depth in section 1.5. TRPM2 is highly expressed in the brain and several

studies have implicated an association between the genetic variants of TRPM2 and BD

[85, 86]. In addition, two regions, 6q21-q25 and 8q24, were reported to show

significance in a genome wide scan analysis of 11 bipolar linkage [87]. An earlier meta-

11

analysis of 7 bipolar linkage studies found evidence for BD susceptibility on

chromosomes 13q and 22q [88]. While linkage studies have provided some insight into

the genetics of BD, the findings have not revealed any particular gene(s) to explain

most cases of BD.

Candidate gene association studies have classically investigated polymorphisms

focusing on neurotransmitter systems such as dopamine, serotonin and noradrenaline.

More recently, more interest has been placed in candidate genes that are associated

with schizophrenia, implicated from linkage studies or predicted from models of

pathogenesis [82]. Currently, two schizophrenia genes, D-amino acid oxidase activator

(DAOA) and neuregulin1 (NRG1), have also been associated with BD [89-93]. While

evidence for the DAOA association with BD has been reaffirmed by multiple studies,

these studies have identified different single nucleotide polymorphisms (SNPs) and

haplotypes showing this association. Of note, the DAOA gene is located on

chromosome 13q33 which was implicated in earlier linkage studies in BD [89, 90]. The

gene product of NRG1 has broad biological functions and thus, it is not clear which one

is of major importance to pathogenesis [94]. Lastly, brain-derived neurotrophoic factor

(BDNF) has also been reported to be associated with BD in candidate gene screens

[95].

With coming of the genomic age, high-throughput genotyping allows countless

DNA polymorphisms over the entire genome can be assayed in genome-wide

association studies (GWAS) [96]. This powerful method is able to examine prospective

disease-related gene variations over the genome. GWAS is appealing for studying

complex diseases because it is able to investigate multiple loci and provide candidate

genes for further study [97]. In four published studies of GWAS in bipolar disorder,

12

associations with BD have been found in SNPs in the diacylglycerol kinase eta gene

(DGKH), a gene-rich locus including BRCA2, NADH dehydrogenase 1 (NDU-FAB1),

and dynactin 5 (DCTN5), a single SNP in myosin 5B (MYO5B), and Src kinase-

associated phosphoprotein 1 (SKAP1) [98-101]. A meta-analysis of 3 of the 4 GWAS

studies above identified two very strong SNPs associated with BD – one in the Ankyrin-

G gene (ANK3) and another within the gene encoding the α-1C subunit of the L-type

voltage-gated Ca2+ channel (CACNA1C) [102]. Ankyrin-G links integral membrane

proteins to the cytoskeleton and affects proliferation, activation, maintenance of

membrane domains and cell motility [103]. Therefore, both genes identified by the meta-

analysis are likely to be involved in neuronal excitability which implicates the importance

of ion channels in bipolar disorder.

1.2.4 Irregularities in Signal Transduction in BD

Given the amount of evidence connecting cellular function and response to BD, it is not

surprising that irregularities in multiple signalling pathways have been reported in

association with BD. As signalling systems are responsible for the conversion of

extracellular stimuli into intracellular response, an appropriate cellular response to the

environment is heavily dependent on the integrity of these mechanisms.

1.2.4.1 B Cell Lymphoma 2

The Bcl-2 (B cell lymphoma 2) protein family, identified by the presence of Bcl-2-

homology (BH) domains, is known for its role in cell death and regulation [104]. It is

divided into three subfamilies: the anti-apoptotic Bcl-2 subfamily, the pro-apoptotic Bax

subfamily, and the Bax-activating subfamily [105]. In the cell, anti-apoptotic Bcl-2 family

13

members promote cell survival by binding to and inhibiting the activity of pro-apoptotic

Bcl-2 family members and reducing ER-to-mitochondria Ca2+ flux [105]. Within the

context of BD, it is suspected that Bcl-2, by interacting with IP3R, plays an important role

in modulating IP3-evoked Ca2+ elevation [106]. Interestingly, mood stabilizers such as

lithium have been shown to attenuate Ca2+ abnormalities and increase Bcl-2 levels in

the brain in animal models [107]. Also, a post-mortem study found reduced levels of bcl-

2 mRNA and protein levels in the frontal cortex of BD patients [108]. A more recent

study has found that a genetic polymorphism in the Bcl-2 gene increased both basal

cytosolic Ca2+ and IP3R-mediated Ca2+ elevations in lymphocytes from BD patients

[109].

1.2.4.2 Serine/Threonine Kinases – GSK3 and MAPK

Glycogen synthase kinase 3 (GSK3) is a serine/threonine kinase that is widely

expressed in the brain and appears in 2 isoforms, α and β, in humans. In the cell, GSK3

modulates important cellular signalling pathways including insulin, neurotrophic factors,

and the Wnt pathway and is in term regulated by signals from the Wnt pathway,

phosphoinositide 3-kinase (PI3K) pathway, PKA, and PKC among others [110]. While it

is considered to be a major regulator of inflammation, dysfunctions of this enzyme have

also been implicated in diabetes, cancer, Alzheimer’s disease, and psychiatric mood

disorders [111]. Indeed, lithium and other mood stabilizers such as valproate have

been shown to reduce GSK-3 activity either through direct inhibition via competitive

inhibition for Mg2+ ions or indirectly by reducing GSK3 expression and increasing GSK3

protein phosphorylation [112-114]. Therefore, it is suspected that mood stabilizers such

14

as lithium, by inhibiting GSK3, result in changed cellular processes which promote

neuroplasticity, neurogenesis, and survival [115].

Similar to GSK3, mitogen-activated protein kinases (MAPKs) are

serine/threonine-specific protein kinases with the most well known being the classical

MAPKs, extracellular signal-regulation kinases (ERK) 1 and 2. Among others, the

MAPK pathways have been shown to modulate neuronal survival and long-term

neuroplasticity [116]. As treatment with mood stabilizers such as lithium and valproate

reverse or attenuate structural changes in the brain, it is thought that the efficacy of

these therapeutics may lie, at least partially, in their ability to activate the MAPK

pathway through ERK2 [117, 118]. In support of this hypothesis, it has been found that

treatment of rodent neuronal cultures with mood stabilizers resulted in increased

phosphorylation of ERK2 [119-121].

1.2.4.3 G-protein Coupled Signaling Pathways

A classical model of the phosphoinositide (PI) pathway is activated by the binding of

specific ligands to the extracellular ligand-binding domains of heteromeric G-protein

coupled receptors (GPCRs) (Figure 1.1). GPCRs are so named for the tight association

of the receptor to a G protein complex consisting of Gα bound to guanine diphosphate

(GDP), Gβ and Gγ, in the resting state. Ligand binding induces a conformation change

in the protein complex resulting in an exchange of GDP for guanine triphosphate (GTP)

and the dissociation of Gα-GTP and Gβγ subunits. These subunits then interact with

further downstream effectors. The PI signalling cascade is initiated by the activation of

phospholipase C-β (PLC-β) by Gq/11, resulting in enzymatic hydrolysis of

phosphatidylinositol-4,5-biphosphate (PIP2) into inositol-1,4,5-triphosphate (IP3) and

15

diacylglycerol (DAG) [122] . The formation of IP3 and DAG is also possible through

tyrosine kinase activation of PLC-γ and GPCR induction of PLC-ε [123, 124]. IP3 is

involved with the release of Ca2+ from the ER by binding to IP3 receptors (IP3R) on the

ER membrane [125]. DAG activates protein kinase C as well as some subtypes of

canonical transient receptor potential (TRPCs) channels (to be discussed further in

section 1.6) [126]. It has been reported that increased concentration of PIP2 in platelets

was found to be associated with BD patients in both the manic and depressed state

relative to controls. This suggests higher levels of PIP2 may be a state or active illness-

dependent characteristic of BD [127, 128]. In addition, increased PKC activity has been

found in platelets and post-mortem brain studies comparing BD patients to

demographically-matched control subjects [129, 130]. Furthermore, chronic lithium

therapy has been demonstrated to reduced PIP2 levels in euthymic BD patients relative

to controls [131]. Thus, irregularities in the PI signal transduction mechanism such as

increased PIP2 and PKC activity levels are associated with BD.

In addition, studies of peripheral blood cells and post-mortem brain tissue have

suggested irregularities in G protein signalling, which may affect downstream signal

transduction cascade and have further implications on cellular function and response.

These studies are summarized in Table 1.2. Another major intracellular signalling

pathway implicated in BD is the cyclic adenosine monophosphate (cAMP) pathway.

Briefly, the cAMP – generating pathway, as the name implies, is characterized by the

conversion of adenosine triphosphate (ATP) into cAMP by the action of adenyl cyclase

[132]. Adenyl cyclase is regulated by α-subunits of G-protein coupled receptors

(GPCRs). Within the cell, cAMP acts as a second messenger and plays an important

role in regulation of cellular functions though the activation of protein kinase A (PKA).

16

PKA is responsible for the phosphorylation of other cellular proteins including

transcription factors such as cAMP-response element-binding protein (CREB). The

activation of transcription factors by PKA represents the essential link between

signalling pathways and a cellular response to external stimuli through the expression of

relevant genes, including the neuroprotective growth factor, BDNF[133]. A summary of

disturbances within this pathway linked to BD is summarized in Table 1.3.

In general, alterations in signal transduction cascades such as the PI and cAMP

pathways may have strong implications for downstream signalling and subsequent

cellular response to external stimulus. These consequences then could be critical in the

pathogenesis of disease and are of significant interest.

17

Figure 1.1 The phosphoinositide (PI) signal transduction cascade. Similar to The cAMP signalling

system, the PI pathway is activated by the ligand-binding of G protein coupled receptor (GPCR) resulting

in unbound G protein alpha subunit (Gα). Gαq/11 activates phospholipase C-β (PLC-β) hydrolyzes

phosphatidylinositol-4,5-biphosphate (PIP2) into intoinositol-1,4,5-triphosphate (IP3) and diacylglycerol

(DAG). IP3 is involved with the release of Ca2+

from the ER by binding to IP3 receptors on the ER

membrane. DAG activates protein kinase C (PKC) as well as some subtypes of canonical transient

receptors.

18

Table 1.2 Disturbances in G-protein signaling in BD

Model Observation Study

Post-mortem cerebral

cortex

↑Gαs levels, ≈ Gβ levels [134, 135]

≈ Gαs mRNA levels [136]

↓Gαs in Li-treated patients [137]

Leukocytes and Platelets ↑Gαs and Gαi levels in depressed patients [138]

↑Gαs levels in Li-treated depressed

patients

[139]

↑Gαs levels in BD patients [140]

↑Gαs levels in BD type I and II patients,

regardless of treatment

[141]

↓Gαs levels in Li-treated patients [142]

≈ Gαs levels in Li-treated BD patients [143]

19

Table 1.3 Disturbances in the cAMP-pathway in BD

Model Observation Study

Post-mortem cerebral cortex ↑Forskolin-stimulated cAMP production [134, 135]

↓ cAMP binding [144]

≈ AC levels [145]

↑ Maximal and basal cAMP-dependent PKA

activity

[146]

↓Forskolin-stimulated AC [137]

Leukocytes and Platelets ↑cAMP-stimulated PKA activity, ↓ cAMP binding

in euthymic patients

[147, 148]

↑PKA activity, PKA catalytic subunit, pCREB [149]

↓PGE1-stimulated cAMP in depressed BD

patients

[150]

↓Isoproterenol-stimulated cAMP production in

depressed BD patients

[151, 152]

↓Forskolin-stimulated AC activity after Li

treatment

[153]

↓Basal and stimulated AC activity in Li-treated

patients

[154]

↑cAMP dependent protein phosphorylation after

Li treatment

[155]

↑Basal and cAMP-stimulated protein

phosphorylation after Li treatment

[156]

↑PKA catalytic subunit levels compared to

untreated BD and control subjects

[157]

20

1.2.5 Alterations in Intracellular Ca2+

Based on the disturbances seen in intracellular signalling cascades, it should not be

surprising that changes in Ca2+, an important second messenger, are also linked with

BD. Aside from synaptic transmission and neurotransmitter release, Ca2+ are critical in

the cellular regulation of a diverse range of functions including neuronal survival, death,

exocytosis, axon outgrowth, development, and synaptic plasticity [158]. Thus,

intracellular Ca2+ concentration ([Ca2+]i) is tightly controlled. It has been found that

alterations in [Ca2+]i can lead to physiological changes that affect neuronal functions

over time periods from milliseconds to days or longer [159]. Interestingly, the amplitude,

frequency and duration of the change in [Ca2+]i are important in the physiological

function of the signal, providing this cascade with enormous diversity and flexibility. For

instance, resting [Ca2+]i is on the order of 100 nM but increased sustained

concentrations of 200-300 nM can lead to apoptosis. [160, 161]. Inside the cell, Ca2+

also binds to effector proteins, including calmodulin, resulting in activation of

downstream kinases, phosphorylation of transcriptional factors such as CREB, and

subsequent regulation of gene expression [162]. Although the role of calmodulin has

been considerably studied, the effects of other proteins known to bind Ca2+ such as

neuronal Ca2+ sensory (NCS) family of proteins and Ca2+ -binding protein

(CaBP)/calneuron are not so well elucidated [162]. Despite this, disturbances in the

regulation of intracellular Ca2+ and Ca2+-dependent signalling could result in a

phenotype characterised by aberrant response and function such as that seen in BD.

Indeed, growing evidence from studies investigating signal transduction systems

in peripheral blood cells support the idea of Ca2+ aberrations in association with BD.

21

The link between Ca2+ and BD first germinated in the early 1920s when it was found

that manic patients had significantly decreased levels of Ca2+ in their cerebral spinal

fluid compared to depressed patients [163]. It was not until the discovery that red blood

cells (RBC) from bipolar patients demonstrated more variable Ca2+ ATPase activity than

matched controls from multiple investigations that the field expanded [164-167]. The

notion of disrupted intracellular Ca2+ homeostasis in BD began to blossom when

evidence of elevated basal [Ca2+]i was found in platelets of BD patients relative to

controls, although only significantly different between manic patients and healthy

controls [168]. In addition, it was reported that higher levels of basal and agonist-

stimulated (platelet activating factor, thrombin and 5-HT) [Ca2+]i in platelets and

leukocytes of BD patients compared to such blood cells from healthy volunteers [169-

171]. Interestingly, when ultrafiltrates of plasma from BD patients were incubated with

platelets from health patients , the [Ca2+]i of the platelets did not change [172]. These

results hint that the change in [Ca2+]i is a result of intrinsic and not circulating factors.

Subsequent studies further substantiated this hypothesis by detecting higher levels of

basal Ca2+ in cellular models, such as white blood cells, and elevated [Ca2+]i in

response to thapsigargin in BD patients relative to controls [173-175]. In euthymic

patients undergoing lithium therapy, serum Ca2+ levels were reported to be higher than

healthy controls [176]. Although there are conflicting reports with regards to the direction

of change of [Ca2+]i, mounting evidence supports that disruptions of intracellular Ca2+

homeostasis is linked with BD.

Another line of evidence associating BD with Ca2+ disturbances stems from

observations of the effect of mood stabilizing agents on signal transduction cascades

such as the G proteins, PI and importantly, Ca2+. Indeed, studies in various rat neuronal

22

subtypes, including astrocytes and pituitary GH3 cells, have demonstrated a

suppression of [Ca2+]i by long-term treatment of lithium [177, 178]. Chronic lithium

therapy also attenuated norepinephrine, thyrotropin-releasing hormone, 5-HT, thrombin

and NMDA receptor stimulated increases in [Ca2+]i [177-181]. Clinical studies have

found that chronic lithium treatment is able to reduce the higher levels of [Ca2+]i in

untreated depressed BD patients to levels of treated euthymic controls [182].

In BLCLs, it was found that BD patients exhibited greater Ca2+ responses to the

bioactive lipid, 1-oleoyl-lysophosphatidic acid (LPA), relative to cell lines from healthy

controls [183]. BD patients had higher levels of basal [Ca2+]i and more rapid LPA and

thapsigargin-induced increase in [Ca2+]i [184]. The implication of an irregular

thapisgargin response is the disturbance of store-operated Ca2+ (SOC) flux from ER

stores. As mentioned earlier, B lymphoblasts from BD patients demonstrated greater

Ca2+ response to thapsigargin mediated store depletion [171, 175]. Thapsigargin was

also used to experimentally approximate the size of ER stores and the magnitude of

SOC entry. Data suggests that BD patients have elevated ER Ca2+ stores and [Ca2+]i

following SOC entry [185]. The increased LPA kinetics may be in part mediated by

canonical TRP channels such as TRPC3 which have been linked to BD. It was reported

that TRPC3 levels were reduced after chronic, but not acute lithium treatment in

lymphoblast cell lines from BD patients [186]. As the TRPC subfamily will be a major

point of focus in this dissertation, TRPC channels will be discussed more in dept in

section 1.6. In summary, the substantial body of evidence of abnormalities in

intracellular Ca2+ homeostasis strongly suggest that the cellular regulation of Ca2+ is an

important component of the physiopathology of BD.

23

1.3 Oxidative Stress in BD

1.3.1 Overview of Oxidative Stress

Aerobic organisms produce reactive oxygen species (ROS), such as hydrogen peroxide

(H2O2), superoxide (O2-) and hydroxyl radicals (OH-), under physiological conditions as

part of respiration within the mitochondria [187-189]. While low levels of these partially

reduced oxygen species are required for cellular activities such as protein folding,

activation of kinases and phosphatases, gene expression and general maintenance of

intracellular redox environments, situations where the generation of ROS exceeds the

capacity of antioxidant mechanisms, damage to cellular macromolecules including

lipids, nucleic acid and proteins can result [190-192]. Within the body, O2- radicals are

generated at the complexes I and III of the mitochondria by the donation of an electron

to O2 [193]. Being highly reactive, it is inactivated through the activity of the enzyme

superoxide dismutase (SOD) into H2O2 and then subsequently into water through the

glutathione detoxification system (Figure 1.2) [194]. The presence of ferrous iron (Fe2+)

can also catalyze the Fenton reaction resulting in the production of OH- radicals from

H2O2 [195]. Cellular mechanisms to counteract reactive radicals include ROS

neutralizing compounds, like thiols, ascorbic acid, and α-tocopherol, and

aforementioned enzymes, such as SOD, catalase (CAT), glutathione enzymes,

peroxidases, and reductases [191, 196]. With the brain metabolizing 20% of total

oxygen consumed in the body and having limited antioxidant capacity, it is not

surprising that oxidative stress has come to be implicated in the physiopathology

neurodegenerative diseases and of neuropsychiatric disorders [197, 198].

24

In addition to ROS, nitric oxide (NO-), a reactive nitrogen species (RNS), is

generated by the nitric oxide synthase (NOS) enzyme family in neurons [199]. NO- is an

important signaling molecule and can activate guanylate cyclase and transduce

signaling cascades through cyclic guanine monophosphate (cGMP) [200]. Thus,

excessive NO- concentrations and associated glutamate-receptor activation is

correlated to several brain pathologies [201]. Further, NO- is able to undergo a chemical

reaction with O2- to form the peroxynitrite anion (ONOO-). While ONOO- readily breaks

down into OH- and nitrogen dioxide, it can create function-altering abducts with tyrosine

residues in proteins through nitration [202]. Indeed, the role of excess ONOO- in the

pathogenesis of amyotrophic lateral sclerosis (ALS) is well documented [203]. Aside

from proteins, ROS and RNS are able to interact with other cellular constituents such as

nucleic acids, lipids, and thiols, leading to neuronal damage and dysfunction [204-206].

1.3.2 Evidence of Oxidative Stress in BD

At present, there is a strong body of evidence that oxidative stress contributes to the

pathogenesis of BD [207-209]. In comparing BD and control post-mortem anterior

cingulate cortex, it was found that there was a 59% increase in 4-hydroxynonenal

levels, a marker of lipid peroxidation [210]. In studies of peripheral blood, several groups

have reported increased levels of thiobarbituric acid reactive substances (TBARS),

another marker of lipid peroxidation, [207, 211-214]. Finally, a meta-analysis conducted

in 2008 demonstrated that TBARS levels are increased in patients suffering from BD,

providing strong evidence of oxidative damage in BD [215].

At the molecular level, another marker for oxidative stress is DNA damage in the

form of chemical and structural modifications to nitrogenous bases or DNA strand

25

breaks [216, 217]. Interestingly, it has been reported that the frequency of DNA damage

was not only increased in BD compared to controls but also that the amount of DNA

damage correlated with severity of mania or depression episodes [212]. In a

monozygotic twin study, bipolar twins were found to have a greater degree of DNA

damage compared to the healthy control. Moreover, even after 6 weeks of mood

stabilization, DNA damage still remained altered [218]. In a study investigating post-

mortem anterior cingulate cortex, non-GABAergic neurons from bipolar patients

displayed higher levels of DNA fragmentation compared to healthy controls [219].

Another post-mortem study found significant increases in protein carbonylation and

reduced mitochondrial complex I activity in the bipolar group but not depressed or

schizophrenic groups compared to healthy controls [220].

Not surprisingly, innate antioxidant defence systems can be a target for ROS.

While it has been thought that BD is associated with increased levels of SOD, a recent

study demonstrated that SOD levels were increased in the peripheral blood of patients

only in the acute phases of BD and not in the euthymic phase or in healthy controls

[207, 213, 221]. A separate study, however, reported reduced CAT and SOD levels in

BD patients compared to healthy controls [208]. With regards to the glutathione system,

it has been found that there are increased levels of glutathione enzymes, including

glutathione S-transferase (GST) and glutathione reductase in BD patients [222]. Multiple

studies have also demonstrated that GST may mediate the neuroprotective effects of

lithium, valproate, lamotrigine or olanzapine, against oxidative stress [222-225]. These

findings suggest that the anti-oxidant glutathione system could contribute significantly to

the therapeutic effects of mood stabilizing drugs in BD [226] and support the

pathophysiological relevance of oxidative stress and antioxidant defences in BD.

27

Figure 1.2 Detoxification of reactive oxygen species in the body. Highly reactive superoxide ions (O2-

) are reduced into less reactive hydrogen peroxide (H2O2) and oxygen by superoxide dismutase (SOD).

Catalase and glutathione peroxidase (GPx) are responsible for the conversion of hydrogen peroxide into

water. Glutathione (GSH) is an important co-factor for the activity of GPx and is oxidized into glutathione

disulfide (GSSG).

28

1.4 Lithium and BD

1.4.1 Overview of Lithium and Lithium Treatment in BD

The first reported use of lithium in the treatment of mania was by Cade in 1949 and then

established as evidence-based by work done by Schou and Braastrup in the 1960s

[227, 228]. Shortly afterwards, it was approved by the FDA for treatment of mania in

1970 and for BD in 1974 [229]. Since then, it has remained as a primary agent in the

treatment of BD [230]. The typical maintenance dose of lithium is 900 mg/day to 1200

mg/day, usually starting at 300 mg [231, 232]. The target drug blood level is 0.8 meq/L

to 1.2 meq/L for management of acute phase symptoms and 0.6 meq/L to 0.8 meq/L for

maintenance therapy [233]. Unfortunately, lithium has a low therapeutic index and

patients undergoing lithium treatment must be monitored closely to minimize toxicity

[234]. Cognitive side effects, tremors, weight gain, polyuria, and loose stool are

common side effects of lithium therapy while long-term complications include

hypothyroidism, disturbances in cardiac rhythm, and renal impairment [30].

Although the exact mechanism through which lithium operates is unclear, there is

accumulating evidence of enhanced neuroresilient effects of lithium, mediated though

altering signalling pathways in the CNS. As alluded to in earlier sections, lithium is also

able to ameliorate alterations in Ca2+ homeostasis in BD. Lithium has also been noted

to inhibit GSK-3, a major pro-apoptotic enzyme involved in cell death due to neuronal

insults including glutamate-induced excitotoxicity [113, 235, 236]. Finally, lithium is

reported to upregulate the expression of cytoprotective or survival molecules such as

Bcl-2, BDNF, and VEGF, induce autophagy by reducing IP3 levels, and induce

neurogenesis in cultured neurons or brain [118, 237-240].

29

1.4.2 Evidence of Neuroprotective and Anti-oxidative Effects of Lithium

Due to the increasing body of evidence of disturbances at the neurocellular level and

the altered response profiles of neurons and glial cells to stress, it has been postulated

that neuroprotection mediated by mood stabilizers are a major component of the

therapeutic efficacy of these drugs. The in vitro neurotoxicity of inhibitors of respiration,

ROS or ROS-generating compounds, deprivation of cell culture media components,

NMDA receptor agonists, ethanol and even β-amyloid have been reduced by treatment

with lithium [240-244]. In addition, lithium attenuated levels of neuronal damage by

kainate, and ischemia has been reported in vivo [245]. Moreover, lithium has also been

implicated to be involved with several signalling pathways including stress-induced

kinases, transcription factors for stress responses and inhibition of apoptosis [246-251].

Interestingly, the neuronal death induced by stressors used in several of the

above studies implicates oxidative stress as a major insult. For example, decreased

levels of oxidatiave stress markers, lipid peroxidation, protein carbonyl formation, and

malondialdehyde, were found in cultured primary rat cortical neurons [252, 253]. The

lack of oxidant specificity in the attenuation of oxidative stress-induced cell death further

implies an anti-oxidant relevant role of lithium. In in vivo models, pre-treatment with

lithium in amphetamine-induced hyperactivity in rodents, an animal model of manic

behaviour, resulted in reduced levels of amphetamine-induced TBARS formation and

DNA damage [254-256]. With regards to BD patients, higher TBARS levels were found

in unmedicated patients compared to medicated patients in a cross-sectional study

[257]. In a longitudinal study, patients were treated with lithium and olanzapine. At the

end of the study, patients had lower levels of TBARS and increased antioxidant enzyme

activities compared to baseline [258]. Evidence collected from in vitro, in vivo and

30

clinical studies strongly support a link between lithium’s neuroprotection and anti-

oxidant properties.

31

1.5 TRP Channels

Increased neuronal oxidative stress and alterations in intracellular Ca2+ homeostasis are

implicated in the pathology of BD. As these two processes are interwoven at the

molecular level, Ca2+ channels which regulate intracellular Ca2+ and are modulated by

oxidative stress are an important interface for investigation. In this regard, the transient

receptor potential family represents one such candidate.

1.5.1 Overview of TRP Channels

The Transient Receptor Potential (TRP) superfamily consists of channel proteins that

share a common six transmembrane (TM) motif, sequence homology and permeability

to cations such as Ca2+, Mg2+, and Na+. TRP channels also possess a remarkably wide

range of activation mechanisms and cation selectivity, an unusual trait among known

families of ion channels. Most interestingly, many TRPs function as signal integrators

single TRP channels can be activated by seemingly distinct mechanisms and the

response to one input can be modulated by another [259-261]. It should not be

surprising that mutations in and dysregulation of channel function or expression can

lead to altered physiological states and cellular responses culminating in pathologies

[262-264]. Indeed, there are currently twelve recognized channelopathies, diseases

arising due to mutations in TRP channel-encoding genes [265]. Further, as TRPs are

critical in various sensory responses, hormone secretion, organ and bone function, and

neuronal cell death, they are implicated in a wide variety of diseases and disorders.

The first TRP channel was identified in Drosophila as a spontaneous mutation

which resulted in a specific phenotype of the visual system where prolonged exposure

32

to light caused visual excitation currents to drop to baseline levels [266, 267]. It was

then found that TRPs are widely expressed amongst multicellular organisms including

worms, fruit flies, zebrafish, mice and humans due to the essential role of ion channels

in cellular function [3]. In mammals, the TRP superfamily encompasses seven

subfamilies which are divided into two groups, group 1 and group 2 [268]. Group 1

consists of the TRPC (canonical), TRPV (vallinoid), TRPM (melastatin), TRPA (ankyrin),

and TRPN (no mechanopotential) subfamilies and group 2 is comprised of TRPP

(polycystin), and TRPML (mucolipin). The separation of the two groups of TRPs is

largely based on sequence homology and topological differences [269]. In this sense,

group 1 TRPs display the greatest sequence homology to the founding member of the

TRP superfamily, Drosophila Trp [270]. The subfamily most related to the Drosophila

Trp is referred to as the canonical or classical TRPs (TRPC). All other group 1 TRPs are

named based on the first described member of each subfamily [271]. The TRPP and

TRPML subfamilies are more distantly related to the group 1 TRPs. Similar to group 1

TRPs, group 2 TRPs are also named after their founding member [8].

1.5.2 Molecular Structure of TRP Channels

Being of significant physiological importance, it is not surprising that the TRP membrane

topology bears strong resemblance to voltage-gated K+, Na+, and Ca2+ channels. TRP

channel subunits contain six TM domains and a pore forming region between the last

two membrane spanning segments. Functional TRP channels are composed of the

polymerization of four subunits in which residues between the fifth and sixth TM

domains line and create the pore[272]. The tetramerization, like other ion channels,

provides an additional level of regulation, diversity and specificity in function among cell

33

types and across species. Unlike voltage-dependent ion channels, TRPs do not have a

classic voltage sensor present in the S4 domain as described by the pioneering work of

MacKinnon et al. in voltage-gated potassium channels [273, 274]. However, this does

not mean that TRP channels have no voltage sensing capability. TRPM8, for example,

does have voltage gating potential possibly due to positive residues at the end of the

fourth TM domain and in the putative loop between the fourth and fifth TM domains

[275].

As the molecular mechanisms of TRP channels have not been fully elucidated,

the current model is heavily based on the voltage-gated K+ channels under the

assumption that the structure-based functional arrangement is conserved [276]. In the

voltage-gated K+ channels, there are two main domains – the voltage sensor on S4 and

the pore-forming loop comprised by S5 and S6 domains. Under this hypothesis, the

TM1-4 domains of TRPs would function as sensors and regulators of the gating ability

of the TM5-TM6 pore. Since TRPs can be activated by many agonists, it would mean

that the TM1-4 region could function as chemical receptors and the site of action of

agonists, such as diacylglycerol (DAG) in the case of TRPC3/6/7. In addition, the

mechanism behind temperature sensitivity of TRP channels may follow a similar

paradigm or a completely different one. In either case, extensive experimentation is

required to understand the sensory capabilities of the TRP channels.

1.5.3 Structural Aspects of TRP Channels

In contrast to classical ion channel types, many of the TRP proteins were discovered

only after their encoding genes were overexpressed in heterologous cellular systems.

As a result, this provided the field with a better understanding of the structural aspects

34

of these channels. In the group 1 TRPs, the six transmembrane domains represent the

region of greatest sequence homology, including the pore-forming loop between TM5

and TM6 [269, 277]. Following the sixth TM domain is a TRP domain shared by TRPC,

TRPM and TRPN channels. The TRP domain is a highly conserved region of

approximately 23-25 amino acids with the greatest homology in the two regions known

as TRP box 1 and TRP box 2. The TRPs in group 1, with the exception of TRPM, have

multiple ankyrin repeats at the N-terminus. Furthermore, three TRPM proteins possess

C-terminal enzyme domains and are known as chanzymes [278]. The group 2

subfamilies, TRPP and TRPML, are more distantly related to the group 1 TRPs. The

most striking aspect is that the two subfamilies contain an extracellular loop between

TM1 and TM2. Similarly to the group 1 TRPs, the group 2 TRPs demonstrate a high

degree of sequence homology over the transmembrane segments [269, 277].

35

1.6 The Canonical TRP Subfamily of TRP Channels

1.6.1 Overview and Distribution of TRPC Channels

Members of the TRPC subfamily were the first described mammalian homologs of

Drosophila Trp [279]. Although initially only three homologs were identified, TRPC1,

TRPC2 and TRPC3, there are seven recognized mammalian TRPC proteins today

[280-282]. However, only six are expressed in humans as human TRPC2 is a

pseudogene [281]. In terms of relatedness, the seven TRPCs share with each other and

Drosophila Trp over 70% amino acid identity over the 750-900 N-terminal residues [280,

281]. The members of the TRPC subfamily can be further divided into four phylogenetic

groups or subsets: TRPC1, TRPC2, TRPC3/6/7, and TRPC4/5 [271, 283, 284].

The functional nature of TRPC1, while being the first described member of the

TRPC subfamily, is still widely debated in the field. There have been reports of

homomeric TRPC1 acting as store-operated, receptor-operated, IP3R-gated cation

channels, or even a non-functional subunit [285]. However, within heteromeric systems,

TRPC1 complexes with TRPC3, TRPC4, or TRPC5 as part of G-protein mediated

receptor-operated cation channels [286]. This heterogeneity in tetramerization highlights

a major hurdle in discerning individual TRPC protein function and the role of TRPCs as

subunits within a heterotetramerized unit. hTRPC1 has been found to be widely

distributed throughout the body but with expression higher within the central nervous

system (CNS) [287]. In the CNS, the cerebellum represents the region with greatest

TRPC1 expression, by a factor of almost 2 compared to other regions. Outside the

CNS, TRPC1 is seen in many tissues including the muscle, pancreas, prostate, kidney,

and lung but is most common in the heart and pituitary gland.

36

In humans, the gene encoding TRPC2 contains a premature stop codon resulting in a

non-functional truncated protein [288]. However, rodent clones of TRPC2 have been

investigated and may be activated by DAG [289]. Furthermore, TRPC2 appears to be

required for neuronal excitability in pheromone signal transduction [290].

The TRPC4 and TRPC5 share 64% homology and are the group most closely

related with TRPC1 [285]. These channels act as non-selective cation channels that

function as downstream effectors of GPCRs [291]. Under homomeric expression,

TRPC4 and TRPC5 both exhibit currents with an unusual double rectifying current-

voltage (I-V) relationship [286, 292]. There is currently some speculation that the

complexity of the outward TRPC5 current could be due in part to voltage-dependent

Mg2+ block at an intracellular site [293]. However, heteromeric TRPC1+C4 and

TRPC1+5 channels generate currents with a gentle negative slope at negative

potentials and smooth outward rectification [286]. Single channel conductance for

homomeric TRPC5 channels is significantly greater than TRPC1+C5 heteromers [286].

The hTRPC4 is distributed ubiquitously throughout the CNS and largely in the bone and

less so in the heart, prostate, placenta, and pancreas [287]. On the other hand,

hTRPC5 demonstrates the greatest CNS specificity of all the TRPCs with expression in

the CNS over ten-times greater than the peripheral tissues [287]. Despite this, hTRPC5

has been detected in other tissues such as the heart, muscle, liver and pituitary gland.

The final subset of TRPC channels, the TRPC3, TRPC6, and TRPC7 group,

exhibit between 65% and 78% homology [285]. These TRPCs are non-selective and

generate similar double-rectifying I-V curves when activated by GPCRs or DAG either

as homomeric or heteromeric units [126]. The mechanism of receptor-mediated channel

activity for this group of TRPCs is still mostly unclear. However, TRPC6 has been found

37

to be highly cooperative with muscarinic receptors and synergize with DAG [294]. In

terms of distribution, hTRPC3 is found in all regions of the CNS with the highest levels

concentrated in the cerebellum, caudate nucleus, putamen, and striatum [287]. In

peripheral tissues, there is generally low expression of TRPC3 with the exception of the

vascular epithelium [295]. In contrast, hTRPC6 had the highest expression in the CNS,

specifically the caudate nucleus, nucleus accumbens, striatum, cingulate gyrus, and

superior frontal lobe but is also highly expressed in the placenta and lung [287].

hTRPC7 showed broad expression within the CNS, with highest levels in the nucleus

accumbens, hypothalamus, putamen, striatum, caudate nucleus and locus coereleus

[287].

1.6.2 Biophysical Characteristics of TRPC Channels Pores

The physiological functions of an ion channel are defined by the characteristics of its

opening and closing (gating) and its ability to passage specific ion species (selectivity).

Unfortunately, insight into the permeation and pore structure of the TRP superfamily is

exceptionally limited, especially in comparison to the well studied voltage-gated ion

channel families. While being one of first TRP subfamilies to be identified, few studies

have described the pore properties and the pore region of TRPCs. Functional data is

often difficult to interpret due to a background of other endogenous store-operated or G-

protein activated channels. Moreover, as the TRPCs do not share significant sequence

homology to currently well described ion channel pore regions such as the bacterial K+

channels, it is difficult to make theoretical predictions about the pore elements [296].

Jung et al. were able to shed light onto TRPC pore characteristics through

studies of La3+ potentiation of TRPC5 [297]. Systematic mutagenesis was performed on

38

all negatively charged amino acids in the extracellular loops of TRPC5. It was found that

neutralization of amino acids in the loop between TM5 and TM6 resulted in a loss of

potentiation whereas no obvious effects were detected in the other regions. Mutations

localized to the distal parts of the loop had the most profound effect in contrast to

mutations localized in the central part of the loop which did not have any effect on

channel properties. A later study on TRPC1 revealed similar results, pointing to the fact

that the pore properties of TRPC5 and TRPC1 seem to be located in the distal parts of

the putative pore entrance [298].

1.6.3 Activation Mechanisms of TRPC Channels

In general, subfamily assignment is not a reliable way to predict the activation

mechanisms of a given TRP channel. Fortunately, in the case of TRPCs, all channels

are activated by the stimulation of phospholipase C (PLC) and pathways coupled to it.

Receptor stimulation that activates PLC, most commonly through the GPCR/Gq/11

pathway leads to activation of the IP3 receptor (IP3R) and the TRPC channels [277].

This mechanism has been well documented in the field by monitoring intracellular

calcium concentrations ([Ca2+]i) through the use of Ca2+ indicator dyes. The observation

that treatment with U73122, an inhibitor of PLC, eliminates ROCE provides strong

experimental data to the importance of PLC in the activation of TRPCs [276].

It is also thought that activation of the IP3R may result in a conformational

coupling between the IP3R and TRPC leading to TRPC activation. Evidence from co-

immunopreciptiation experiments showing TRPCs and IP3R interaction both in vitro and

in intact cells strongly support this hypothesis [299]. Furthermore, it was noted that IP3R

peptides contained sequences that interact with the TRPC proteins which affected

39

SOCE development and duration. In contrast, the non-interacting regions had no effect

on SOCE [300].

In addition to PLC and IP3R, DAG and its derivatives, OAG (oleyl-acetyl-glycerol)

and SAG (stearoyl-arachidonoyl-glycerol), are known to experimentally induce TRPC3,

TRPC6, and TRPC7 activation [126, 294]. However, the physiologic importance of this

mechanism is uncertain. Manoeuvres that stimulate endogenous DAG formation in

response to agonist activation of the GPCR-Gq-PLC pathway fail to activate TRPC3

whereas under the same conditions, exogenous OAG creates a TRPC3 response [301].

In contrast, provided that protein kinase is inhibited, TRPC4 and TRPC5 activation by

DAG produced from the GPCR-Gq-PLC pathway is observed [302]. Finally, a second

lipid, lysophosphatidylcholine (LysoPC), is known to activate TRPC5. The effects of

LysoPC on other TRPCs have not yet been reported [303].

1.6.4 Pharmacological Properties of TRPC Channels

Elucidation of the mechanism of pharmacological action on TRPC channels is heavily

dependent on their structural makeup. As discussed earlier, the heteromerization of

TRPs veil the specific effects of each subunit and thus, insight into which TRPCs

operate as homomers and heteromers and the impact of tissue-dependent

polymerization is still limited [304]. Drug development targeting specific TRP tetramers

(including TRPCs) could prove to be both challenging and rewarding.

Despite this, published data reports the use of a few compounds which target

TRPCs presumably by direct interaction. As none of these compounds are specific,

there is still debate and conflicting reports on the effects of pharmacological agents on

TRPCs [276].

40

1.6.5 Physiological Role of TRPC Channels

At the molecular level, TRPC channels are well documented to play important roles in

both receptor-operated Ca2+ entry as well as store-operated Ca2+ entry. As a result of

their importance in maintaining calcium concentration within the cell, they are also

implicated in a wide range of physiological processes. Within a neuroscience context,

there is a body of evidence implicating the TRPCs in cell death, regulation of

neurotransmitter release, plasticity, axonal regeneration, growth cone development,

dendritic morphology and even responses to fear [305].

41

1.7 Main Objectives and Hypothesis

Several disturbances have been characterized in the pathophysiology of BD, notably

altered intracellular Ca2+ homeostasis and increased markers of oxidative stress.

Investigations into the disrupted intracellular Ca2+ signaling in BD have suggested a

potential role of some TRP channels, such as TRPC3, in these disturbances which have

been separately noted to be potentially modulated by oxidative stress. As such, certain

TRP channels represent a potential cellular interface between Ca2+ signaling dynamics

and ROS signaling. Given this, I sought to examine the properties of several other

canonical TRP channels with regards to oxidative stress to expand the current

understanding of the mechanistic pathways behind TRP signaling and how this process

may contribute to BD pathology.

Previous work by Roedding et al. (2011, under review and in press), reported

that chronic treatment of primary rat cortical neurons (RCN) by oxidative stressor,

rotenone, resulted in dose-dependent reductions in TRPC3 protein and mRNA levels.

Following on these interesting findings, I sought to evaluate if two other canonical TRP

channels possessed similar rotenone-regulated properties, specifically TRPC6, a

subtype highly related to TRPC3, and TRPC5, a subtype reported to be modulated by

ROS [306]. Based on the results of the aforementioned TRPC3 investigations, I

hypothesized that:

Chronic (4 day) but not acute (24 hour) rotenone treatment of primary rat cortical

neuron cultures will result in a significant dose-dependent reduction in TRPC5

and TRPC6 protein and mRNA levels.

42

After examining expression, another objective of this work would be to investigate

whether there is also functional impairment in TRPC3 and TRPC6 as a result of chronic

oxidative stress. Unfortunately, due to a lack of specific pharmacological modulators, I

was only able to evaluate TRPC3 function. Based on the previously observed reduction

of TRPC3 mRNA and proteins levels after chronic rotenone treatment I hypothesized

that:

Chronic rotenone exposure will result in a dose-dependent reduction in TRPC3

function.

Finally, lithium, the standard pharmaceutical intervention for BD, has been shown to

possess neuroprotective properties which may be linked to ameliorating the effects of

oxidative stress through alternate cellular signalling mechanisms. As such, I

hypothesized that:

Pre-treatment with therapeutically relevant concentrations of lithium would result

in a rescue of the effects caused by chronic rotenone exposure in TRPC3,

TRPC5, and TRPC6 expression.

43

2 Materials and Methods

44

2.1 Materials

2.1.1 Chemicals, Reagents, and Drugs

Rotenone, dimethylsulfoxide (DMSO), lithium chloride, magnesium chloride,

probenecid, 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), sodium

dodecyl sulphate (SDS), Ethyl-1-(4-(2,3,3-trichloroacrylamide)phenyl)-5-

(trifluoromethyl)-1H-pyrazole-4-carboxylate (Pyr3), β-mercaptoethanol, egg white

albumin, formaldehyde and DNase, RNase-free water were purchased from Sigma-

Aldrich (Oakville, ON). Invitrogen (Burlington, ON) supplied ImageEnchancer, ProLong

Gold antifade reagent, fura-2 acetoxymethyl ester (fura-2 AM) and goat serum.

Tris(hydroxymethyl)aminomethane (Tris), Tween 20, skimmed milk powder, glyercol,

agarose, and sucrose were obtained from BioShop (Burlington, ON). LI-COR blocking

buffer was obtained from LI-COR Biosciences (Lincoln, NE). Benson Life Technologies

(Markham, ON) provided the Isoflurane. Bromophenol blue was purchased from Bio-

Rad (Mississauga, ON). Triton X-100 was obtained from J.T. Baker (Mississauga, ON).

Calbiochem (La Jolla, CA) supplied 1-Oleoyl-2-acetyl-sn-glycerol (OAG).

2.1.2 Animals

Timed pregnant Sprague-Dawley rats were obtained from Charles River Laboratories.

The animals arrived at the CAMH animal facilities at gestation day 12 and were

maintained on a 12-hour light-dark cycle at 23C with chow and water provided ad

libitum.

45

2.1.3 Cell Culture Reagents

Horse serum, Hank’s balanced salt solution (HBSS), Dulbecco’s phosphate buffered

saline (DPBS), trypan blue dye, B27 supplement with and without antioxidants, and

neurobasal media were obtained from Gibco/Invitrogen (Burlington, ON).

Polyethyleneimine (PEI), penicillin/streptomycin, L-glutamine, and cytosine arabinoside

(ara-c) were purchased from Sigma-Aldrich (Oakville, ON). Serum-based media was

composed of 10% horse serum, 1% penicillin/streptomycin, and 1% L-glutamine and

88% neurobasal media. Serum-free media consisted of 2% B27 supplement with or

without antioxidants, 1% penicillin/streptomycin, 1% L-glutamine, and 96% neurobasal

media. All media solutions were warmed to 37C prior to feeding.

2.1.4 Antibodies

The antibodies raised in rabbit against TRPC3, TRPC5, and TRPC6 were obtained from

Alomone Labs Ltd (Jerusalem, Israel). Rabbit polyclonal anti-β-actin antibodies and

Mouse anti-α-tubulin were purchased from Cell Signalling Technologies and Sigma-

Aldrich (Oakville, ON), respectively. Horseradish peroxidise conjugated to protein A

antibodies were obtained from Bio-Rad (Mississauga, ON). LI-COR Biosciences

supplied the goat anti-rabbit IRDye 800CW and goat anti-mouse IRDye 680CW

polyclonal antibodies. Polyclonal antibodies against microtubule-associated protein 2

(MAP2), glial fibrillary acidic protein (GFAP), and 2’3’-cyclic nucleotide 3’-

phosphodiesterase (CNPase) were obtained from Abcam (Cambridge, MA).

Flourescent Alexa-conjugated antibodies were purchased from Invitrogen (Burlington,

ON).

46

2.1.5 Analytical Kits

ThermoFisher (Nepean, ON) supplied the bicinchoninic acid (BCA) protein assay kits

which were used to determine the protein concentrations in homogenized cell lysates.

RNA was extracted from cultured neurons using the RNeasy Plus Mini kits obtained

from Qiagen (Mississauga, ON). The SuperScript III RT kit and the Quant-iT High-

Sensitivity DNA assay kits purchased from Invitrogen (Burlington, ON) were used for

first strand synthesis and to determine DNA concentration, respectively. The ECLPlus

kit for detecting secondary antibodies crosslinked with horseradish peroxide (HRP)

during immunoblotting was supplied by GE Life Sciences (England).

2.1.6 Calcium Kinetic Assay Solutions

A fura-2 AM 1 mM stock solution was prepared by adding 1 ml of DMSO to 1 mg of

Fura-2 AM ester which was then aliquoted in volumes of 100 ul. The fura-2 AM stock

solutions were stored in an opaque-container at -30C. The fura-2 AM assay buffer was

composed of 1.25 mM probenecid and 5 mM HEPES in HBSS.

47

2.2 Primary Rat Cortical Neuronal Culture and Drug Treatment

2.2.1 Preparation of Cell Culture Plastics

Prior to animal dissection, cell culture plastics were coated with polyethyleneimine

(PEI). A working 0.25 mg/ml PEI solution was freshly prepared from a 25 mg/ml stock

PEI solution. Both solutions were prepared in DPBS with 0.901 mM CaCl2 and 0.493

mM MgCl2. The stock solution was stored at 4C for 1 month before it was discarded

and a new stock solution was prepared. Untreated 96-well plates, 6 cm Petri dishes and

coverslips were incubated for 1 hour at 37C in a 5% CO2/95% air atmosphere with the

0.25 mg/ml PEI solution. Following incubation, the PEI solution was removed and

replaced with serum-based media. The cell culture plastics were then incubated at 37C

with 5% CO2/95% air until seeding.

2.2.2 Fetal Rat Cortical Dissection

Pregnant Sprague-Dawley rats at gestation day 18 were anaesthetized using isoflurane

in an airtight chamber and sacrificed by cervical dislocation. An incision was made in

the lower abdominal region and the uterine horns and gestational sacs containing the

embryos were collected and placed on a Petri dish containing cold sterile HBSS with

1.26 mM CaCl2 and 1mM MgCl2. The embryos were removed from the sacs and

decapitated. Fetal brains were dissected from the skull and placed in a separate Petri

dish containing cold HBSS. Next, the cortical regions were isolated by excising the

hippocampi and striata, and removing the meninges under a stereomicroscope in cold

48

HBSS. The dissected cortices were placed in a 15 ml conical tube containing cold

HBSS.

2.2.3 Establishment of Primary Rat Cortical Neuronal Cultures

The resected cortices were then triturated 30 times using a fire-polished Pasteur pipette

to create a single suspension. The solution was then allowed to settle for 10 minutes

and the supernatant was collected in a separate 50 ml conical tube. The final cell

suspension was centrifuged at 800 x g for 10 minutes. The pellet was then resuspended

in HBSS at room temperature and the supernatant was discarded. An estimate of viable

cell number was determined using trypan blue staining and a hemocytometer. Finally,

the cells were plated at densities of 6 x 104 cells per well of 96-well plates, 6 x 105 cells

per cover slip and 3.5 x 106 cells per 6 cm Petri dish or at a density of approximately 1.5

x 105 cells/cm2.

2.2.4 Maintenance of Cell Cultures

The seeded cells were incubated at 37C with 5% CO2/95% air. On the day following

dissection and seeding or the first day in vitro (1st DIV), half of the media was replaced

with serum-free media supplemented with B27 with antioxidants (cocktail comprising of

vitamin E, vitamin E acetate, superoxide dismutase, catalase, and glutathione). An

additional component of 5 uM of cytosine arabinoside (ara-c), a mitotic inhibitor, was

included with the media change on the 3rd DIV in order to inhibit the proliferation of non-

neuronal cells. After 24 hours of ara-c treatment (4th DIV), media with ara-c was

replaced with fresh serum-free media supplemented with B27 with antioxidants. From

the 7th DIV and onwards, serum-free media supplemented with B27 without antioxidants

49

(less previous supplements listed) was used for feeding. Media was then replenished

every other day. The feed and treatment schedule is illustrated in Figure 2.1. In

addition, immunocytochemistry was performed on the 10th DIV to assess the cell

phenotype composition of the cultures.

2.2.5 Drug Treatment

2.2.5.1 Rotenone

Rat cortical neurons were treated with 15 nM (low dose) or 30 nM (high dose) rotenone

or vehicle for 24 hours (acute) and 4 days (chronic) starting on the 10th and 7th DIV,

respectively. For 'chronic' samples, media was refreshed and stressor re-added on the

9th DIV to maintain levels of oxidative stress throughout the 4-day period. On the 11th

DIV, the neurons were harvested for PCR or immunoblotting or imaged for functional

assays. Cell viability and morphology were monitored through phase contrast images

and viability assays.

2.2.5.2 Rotenone with Lithium

Lithium drug treatment was initiated on the 7th DIV. Cultures were fed with serum-free

media supplemented with B27 without antioxidants containing lithium chloride on the 7th,

9th, 11th and 13th DIV. Over the course of treatment, a therapeutically relevant

concentration of 1 mM lithium was maintained in the culture media [307].

Lithium treated rat cortical neurons were incubated with rotenone (15 nM or 30

nM) or vehicle for 4 days (chronic) starting on the 11th DIV. Media was refreshed and

stressor re-added on the 13th DIV to maintain levels of oxidative stress throughout the 4-

50

day period. On the 15th DIV, the neurons were harvested for PCR or immunoblotting.

Due to the additional numbers of neurons required, cell viability was not monitored for

lithium treated rat cortical neurons.

51

Figure 2.1 Schedule of oxidative stress and lithium treatment of rat cortical neurons. Primary rat

cortical neurons were cultured until the 7th DIV then subjected to oxidative stress treatment (0nM, 15nM or

30nM rotenone for 24 hours or 4 days) or lithium and oxidative stress treatment (1mM lithium for 8 days

and 0nM, 15nM or 30nM rotenone for 4 days). Solid triangles (▲) denote addition of rotenone and solid

circles (●) denote addition of lithium. On the 15th DIV, the cells were harvested for protein and RNA

samples or used in live cell calcium kinetics experiments.

52

2.3 Immunocytochemistry

The following protocol was adapted from that previously described by Marchenko and

Flanagan [308]. Rat cortical neuron (RCN) cultures grown on coverslips in 6-well plates

were incubated in a 4% paraformaldehyde fixative solution (4% paraformaldehyde, 4%

sucrose, 2% Triton X-100, 5 mM magnesium chloride, and 10 mM EGTA in PBS) pre-

warmed to 37C for 15 minutes. The coverslips were then washed 3 times with PBS for

5 minutes each. Following washing, the coverslips were coated with ImageEnchancer

and allowed to stand for 30 minutes at room temperature. Afterwards, the coverslips

were immersed in blocking solution (5% w/v skimmed milk, 2% goat serum in PBS) for 1

hour at room temperature. Primary antibodies to neural marker MAP2 (1:300 in blocking

solution), astrocytic marker, GFAP (1:100 in blocking solution), and oligodendrocyte

marker, CNPase (1:200 in blocking solution) were then added to the coverslips. The

coverslips were then sealed in parafilm overnight at 4C. After 3 washes at 5 minutes

each with PBS, the coverslips were incubated with secondary antibodies conjugated to

Alexa-488 (excitation 488nm, emission 519nm) and Alexa-594 (excitation 594nm,

emission 617nm) (both antibodies at 1:400 in PBS) for 2 hours at room temperature in

the dark. Another series of 3 washes at 5 minutes each with PBS was performed and

then the coverslips were mounted onto glass slides with ProLong Gold antifade reagent

and allowed to cure overnight at room temperature in the dark. The fixed cells were then

visualized using a LSM510 Zeiss confocal microscope with a 20x objective (Zeiss,

Munich, Germany).

53

2.4 Measurement of Cell Viability

Propidium iodide (PI) is a DNA binding dye that fluoresces (excitation maximum 535

nm, emission maximum 617 nm) upon intercalating with DNA. As the plasma

membrane of viable cells is impermeable to the dye, an increase in PI fluorescence is

correlated to an increase of dead or damaged cells. Hence, PI fluorescence was used

as a measurement and indicator of cell death [309]. Cell viability and death was

monitored on the 8th, 9th, 10th and 11th DIV, or every 24 hours after exposure to

rotenone-induced oxidative stress. Half the media was replaced with a 50 uM PI

solution in HBSS and the cells were incubated with the dye for 15 minutes at 37C with

5% CO2/95% air. Following incubation, the fluorescence was detected (excitation

485nm, emission 519nM) using the Fluoroskan Ascent microplate reader

(ThermoScientific, Fremont, CA). This protocol was performed according to the

manufacturer’s recommendations and optimized for the microplate reader by Angela

Roedding.

54

2.5 Immunoblotting

2.5.1 Preparation of Cell Lysates for Immunoblotting

A modified standard immunoblotting protocol using commercially available antibodies

was used to quantify the amounts of TRPC’s of interest in RCN. Protein lysates were

prepared using the hot SDS method [310]. Media was aspirated from 60 mm Petri

dishes and replaced with SDS pre-warmed to 100C and a cell scraper was employed

to collect the sample. The solution was then transferred to a 1.5 ml microcentrifuge tube

and sonicated (Vibra Cell Sonicator) 3 times for 10 seconds with 2 second pulses at

30% intensity. Following sonication, the suspension was placed in a heating block at

100C for 3 min. The sonication and heating steps were then repeated. The lysate was

aliquoted and stored at -80C. Quantification of the protein lysate concentration was

determined using the BCA (bicinchoninic acid) protein assay kit with bovine serum

albumin (BSA) as the standard. Absorbance at 562 nm was measured and subsequent

analyses were carried out using the UVMax microplate reader and SOFTmax PRO

analysis software (Molecular Devices, Sunnyvale, CA).

2.5.2 SDS-PAGE and Transfer

Prior to electrophoresis, protein lysates were diluted in sample buffer (62.5mM Tris, 3%

SDS, 10% glycerol, 5% mercaptoethanol, 0.01% bromophenol blue, pH 6.8) and placed

in a 100C heating block for 3 minutes. The samples, (10-40 μg) were loaded into 7.5%

resolving and 4% stacking polyacrylamide gels. Separation was carried out at 100V for

2 hours or until the dye front reached the end of the gel. Following electrophoresis,

55

proteins were then transferred electrophoretically onto a 0.45 µM nitrocellulose

membrane submerged in transfer buffer overnight at 150 mA.

2.5.3 Probing and Development

Membranes were strategically sectioned to allow for simultaneous probing of multiple

proteins, usually the TRPC subtypes (top portion) and the control protein, β-actin or α-

tubulin (bottom portion). For TRPC3 detection, membranes were blocked with 0.5%

EWA in PBS with 1% Tween (PBST), whereas membranes probed for TRPC5 and

TRPC6 were blocked with LI-CORTM blocking buffer and β-actin and α-tubulin

membranes were blocked with 5% skimmed milk in PBST on a shaker for 1 hour at

room temperature. After blocking, the membranes were incubated with primary

antibodies at 1:500 in their respective blocking solution for TRPC3, TRPC5 and TRPC6,

1:1000 in 5% skimmed milk for β-actin, and 1:15 000 in 5% skimmed milk for α-tubulin,

on a shaker at 4C overnight. Following incubation with primary antibody, the

membranes were rinsed 3 times and washed 3 times for 5 minutes in PBST. The

membranes were then incubated with secondary antibodies, 1:1000 HRP-conjugated

with protein A in PBST for TRPC3, 1:5000 goat anti-rabbit IRDye 800CW antibody in

PBST with 0.1% SDS for TRPC5 and TRPC6, 1:7500 goat anti-mouse IRDye 680CW

antibody in PBST with 0.1% SDS for β-actin and 1:35 000 anti-mouse antibody in PBST

for α-tubulin, on a shaker for 1 hour at room temperature. The membranes were then

rinsed 3 times and washed 3 times for 5 minutes in PBST. At this point, the TRPC5,

TRPC6 and β-actin membranes were visualized using the Odyssey Infrared Imaging

System and quantified using the accompanying Odyssey V3.0 software (LI-COR

Biosciences, Lincoln, NE). Enhanced chemiluminesence by ECLPlus kits was used to

56

visualize the TRPC3 and α-tubulin on blots detected using a STORM 860

phosphoimager system using LED (excitation 450nm, emission 520nm) and quantified

using ImageQuant 5.2 (Amersham/GE Life Sciences, England). The optimal

immunoblotting conditions of each target protein are summarized in Table 2.1.

57

Table 2.1 Immunoblotting conditions for TRPC3, TRPC5, TRPC6, α-tubulin and β-actin.

Protein of

Interest

Blocking Solution

1 Antibody 2 Antibody Imaging Method

TRPC3 0.5% EWA in PBST

1:500 in blocking solution

1:1000 HRP-protein A

ECL detected by Storm 860

TRPC5 LI-COR blocking buffer


1:5000 goat anti rabbit IRDye 800CW

IR800 detected by LI-COR Odyssey

TRPC6 LI-COR blocking buffer




α-tubulin 5% skimmed milk


1:15000 HRP-anti-mouse

ECL detected by Storm 860

β-actin 5% skimmed milk




58

2.6 Quantitative Real-time PCR

2.6.1 RNA Extraction

RNA was isolated from RCN cultures, approximately 3.5 x 106 cells, using the RNeasy

Plus Mini kit. As per the manufacturer’s recommended protocol, an on-column DNA

digestion was performed using deoxyribonuclease (DNase I) (Qiagen, Mississauga,

ON). Subsequent RNA purity and quality was confirmed using the NanoDrop

Spectrophotometer (ThermoScientific, Wilmington, DE) (ratio absorbance at 260 and

280, A260/280, is approximately 2) and RNA gel electrophoresis.

2.6.2 First Strand Synthesis

cDNA was synthesized by reverse transcription of total RNA extracted as above.

Synthesis was carried out using the SuperScript III RT kit. All incubations were

performed using the MyCycler Thermal Cycler (Bio-Rad, Mississauga, ON). The

reaction products were aliquoted and stored at -30C. Quantification of cDNA was

conducted using the Quant-iT High-Sensitivity DNA Assay kit. Fluorescence (excitation

502 nm, emission 523 nm) was detected and quantified using the Fluoroskan Ascent

microplate reader (ThermoScientific, Fremont, CA).

2.6.3 Primer Design and Optimization

Gene-specific forward and reverse primer pairs for rat TRPC5 and TRPC6 were

designed using PrimerExpress 3.0 (Applied Biosystems, Streetsville, ON). Sequences

for primer pairs for rat TRPC3, heme oxygenase-1 (HO-1), and glyceraldehydes 3-

phosphate dehydrogenase (GAPDH) were obtained from Angela Roedding. Prior to

59

synthesis, the primer specificity was verified by a nBLAST search of the National Centre

for Biotechnology Information (NCBI) and the primer products to cross intron-exon

junctions was confirmed by a Primer-BLAST search of the NCBI. All primer pairs were

synthesized by ATCG (Toronto, ON) and subsequently reconstituted in DNase, RNase-

free water to a stock concentration of 100 µM. Primers were stored at -30C. Table 2.2

lists the accession numbers, primer sequences and predicted amplicon size of each

target gene.

A set of preliminary experiments were performed to confirm primer specificity,

optimal primer concentration, and efficiency of primer pairs. Primer specificity was

ensured by conducting a dissociation curve using the ABI7300 Real-Time PCR systems

(Applied Biosystems, Streetsville, ON) and an agarose gel electrophoresis of the qrt-

PCR product. Optimal primer concentration and efficiency of primers were tested by

performing reactions at a range of primer and cDNA template concentrations,

respectively.

2.6.4 Polymerase Chain Reaction

Quantitative real-time polymerase chain reaction using the SYBR green method was

performed to measure relative gene expression using the ABI7300 Real-Time PCR

systems (Applied Biosystems, Streetsville, ON). SYBR green is a fluorescent dye which

binds to double stranded DNA. A reaction mixture of 25 µl consisted of 12.5 ul of SYBR

dye mixture (Applied Biosystems, Streetsville, ON), 1.5 µl of each primer (forward and

reverse), 5 µl of template cDNA, and 4.5 µl of DNase, RNase-free water. The reactions

underwent the following thermal cycling conditions: 95C for 10 minutes and 40 cycles

60

of 95C for 15 seconds and 60C for 1 minute. The expression levels of TRPC3,

TRPC5, TRPC6, and HO-1 were quantified relative to GAPDH using the comparative

threshold (CT) method [311].

61

Table 2.2 Accession number, sequence and expected product length of primer pairs used for

TRPC3, TRPC5, TRPC6, HO-1, and GAPDH

Gene Accession No.

Sequence (5' to 3') Fragment Length

TRPC3 NM_021771 (F) CTGGATTGCACCTTGTACCAGG 98

(R) GCAGACCCAGGAAGATGATGAA

TRPC5 NM_080898 (F) GGCAATCAAATATCACCAGAAAGA 84

(R) GGGAAGCCATCGTACCACAA

TRPC6 NM_053559 (F) TCGCTGTCGCCATTGGA 74

(R) CTGCAAGGAGCACACCAGTATATG

HO-1 NM_012580 (F) GCCTGCTAGCCTGGTTCAAG 87

(R) AGCGGTGTCTGGGATGAACTA

GAPDH NM_017008 (F) GACTCTACCCACGGCAAGTTCA 93

(R) TCGCTCCTGGAAGATGGTGAT

62

2.7 Live Cell Calcium Kinetics Imaging

2.7.1 Preparation of cells

On the 11th DIV, media was gently aspirated from cultures grown in 96-well optical

imaging microplate wells and washed 3 times with Fura-2 assay buffer. The neurons

were then incubated in Fura-2 dye solution (5 uM Fura-2 AM in Fura-2 assay buffer)

following the manufacturer’s recommendations for 30 minutes at 37C with 5%

CO2/95% air. After incubation, the cells were washed 3 times with loading assay buffer

alone and incubated in assay buffer for another 30 minutes at 37C in a 5% CO2/95%

air humidified atmosphere to allow for hydrolysis of the Fura-2 AM ester. To minimize

dye degradation and photobleaching, all steps were done in the dark. Plates were then

transferred to the bioimager system (Pathway 855 Bioimager, BD Biosciences,

Mississauga, ON) for fluorescence image acquisition and analysis.

2.7.2 Imaging

All live cell calcium kinetic assays were performed in a temperature controlled

environmental chamber at 37C under subdued ambient light. Images of 50 to 200 cell

bodies or regions of interest (ROIs) were acquired through a 10x objective. Manual and

laser-automated focusing mechanisms were used to obtain optimally resolved images.

Segmentation of ROIs was based on basal Fura-2 fluorescence (excitation 340/380 nm,

emission 510 nm) using the whole cell polygon algorithm within the BD Attovision

software. An exposure setting of 0.07s for the numerator (340 nm) and 0.15s for the

denominator (380 nm) was used. The same settings were used for all experiments. To

63

monitor OAG activation of Ca2+ mobilization in the neurons, a baseline was determined

by using the fluorescence ratio from 5 images in approximately 10 seconds prior to

adding drug. OAG and vehicle controls were then manually added to the well in a 0.5µl

injection volume using a P10 micropipette and mixed 6 times using the same pipette

and volume. Fura-2 fluorescence ratio intensities were monitored for 4 minutes after

drug injection with images captured at 1.9 seconds intervals. For Pyr3 inhibition

experiments, Pyr3 was added to the wells at the desired concentration at least 10

minutes prior to imaging and stimulation with OAG. Fluorescence ratiometric data,

including the maximum intensity, average intensity, rate of rise, and area under the

curve, were analyzed using the BD Attovision and the BD IDE (Image Data Explorer)

software provideing the data output for mean normalized relative intensity, percentage

of responding regions of interest (ROIs), rate of rise, and area under the curve (BD

Biosciences, Mississauga, ON).

64

2.8 Data Analysis

Statistical analysis was conducted using SPSS 17.0 software (IBM, New York, USA).

Differences in mRNA levels and immunoreactivity of TRPC subtypes following chronic

rotenone and/or lithium treatment were tested by repeated measures one-way analysis

of variance (ANOVA). Post hoc comparisons were carried out using the Bonferroni

pairwise test. Quantitative real-time RT-PCR results were analyzed using ΔCT values

where ΔCT = CT (target) – CT (GAPDH) and protein levels were tested after normalizing

to a loading control (β-actin or α-tubulin) or against the vehicle treatment [311].

Fluorescence data from live cell calcium assays were normalized to baseline,

calculated from 5 images taken prior to drug addition, using the BD IDE program.

Values for mean maximal intensity, area under the curve (AUC), rate of rise, and

percentage of responding ROIs were obtained using the same program. The

percentage of responding cells was determined based on the ratio of ROIs with maximal

intensities within two standard deviations of the mean maximal intensity of vehicle

treated wells. Differences in these four parameters defining “responding cells” between

treatment conditions were tested using repeated measures one-way ANOVA with

Tukey’s HSD test for post hoc comparison. Differences with p ≤ 0.5 were considered

statistically significant.

65

3 Results

66

3.1 Optimal conditions for real-time RT-PCR

Optimal conditions for real-time RT-PCR was established by a series of initial

experiments designed to measure the quality of extracted RNA, the specificity and

efficiency of primers used, and to determine optimal primer concentration and template

cDNA.

The quality of RNA extracted was confirmed based on the criterion of 260nm to

280nm (A260/280) absorbance ratio >1.8 and well resolved ribosomal 28S and 16S bands

on 1% agarose gels (Figure 3.1).

The specificity of primers for the genes of interest was confirmed by dissociation

analyses and electrophoresis of PCR products. Figure 3.2 displays the derivative

melting curves of TRPC3, TRPC5, TRPC6, HO-1 and GAPDH. The single sharp peak in

the dissociation curve represents the amplification of only one species which signifies

the specificity of the primer pairs. Moreover, DNA gel electrophoresis of amplicons

revealed the presence of respective single dense bands at the expected sizes (Figure

3.3) further supporting the specificity of the primer pairs used.

The efficiency and dynamic ranges of the primers were determined. The

similarity of the dynamic range between the gene of interest (TRPC5 or TRPC6) and the

reference gene (GAPDH) was determined by comparing their amplification efficiencies

at a range of template concentrations and is demonstrated by a horizontal line with

absolute slope of < 0.1. Both TRPC5 and TRPC6 primers demonstrated amplification

efficiencies similar to GAPDH (Figure 3.4).

67

Finally, through a series of amplification experiments, the optimal primer

concentration was determined by using concentrations of primer from 250 nM to 750

nM. Similarly, a range of template concentrations from 0.1 ng and 1 ng was used to

determine the optimal cDNA concentration for the PCR reaction. A summary of optimal

primer and template concentrations are listed in Table 3.1.

68

Figure 3.1 Gel electrophoresis of RNA extracted from RCN and BLCL. The presence of two crisp

bands representing the 28S and 16S rRNA is indicative of high RNA quality. RNA was extracted using the

RNeasy Plus Mini kit from Invitrogen with an on column DNA digestion using DNase I. Following

extraction 15 ng of RNA in 15 μL of RNA loading buffer was pipetted into wells of a 1% agarose gel. The

gel was visualized under UV light with the ChemDoc gel imaging system. BLCL – B-lymphocyte cell line,

RCN – rat cortical neuron.

69

Figure 3.2 Dissociation curves of TRPC3, TRPC5, TRPC6, HO-1 and GAPH primers. Real time PCR

melting point analysis of amplicons derived from respective primer sets yielded single sharp peaks in the

derivative melting curves in all cases under the optimized PCR conditions determined. The average

melting point temperature for (a) TRPC3, (b) TRPC5, (c) TRPC6, (d) HO-1, and (e) GAPDH was

determined to be 79.4C, 78.1C, 77.4C, 79.7C, and 80.4C, respectively.

70

Figure 3.3 Agarose gel electrophoresis of TRPC5, TRPC6 and GAPDH amplicons. Reaction

products were prepared in DNA loading buffer and run on a 1% agarose gel. The gel was visualized with

the ChemDoc gel imaging system. Single bands migrating at the predicted sizes (refer to Table 2.2)

denoting primer specificity were found for each respective cDNA species.

100 bp

71

Figure 3.4 Relative efficiency curves of TRPC5 and TRPC6 primers. To ensure similar dynamic

ranges between TRPC5 and TRPC6 and the reference gene, GAPDH, the amplification efficiencies of the

TRPC primers were compared to the amplification efficiencies of the GAPDH primers. Similar dynamic

range was demonstrated by a horizontal line with absolute slope <0.1.

72

Table 3.1 Optimal primer concentration and template concentration for the amplification of TRPC3,

TRPC5, TRPC6, HO-1 and GAPDH

Gene Primer Concentration Template Concentration

TRPC5 600nM 3ng

TRPC6 300nM 3ng

GAPDH 600nM 3ng

*TRPC3 600nM 3ng

*HO-1 600nM 3ng

* Optimal conditions for TRPC3 and HO-1 amplification were determined by Angela Roedding (in

preparation 2012)

73

3.2 Detection of TRPC5 and TRPC6 protein levels in RCN

Using standard immunoblotting techniques (refer to section 2.5), all three TPRC

subtypes, TRPC3, TRPC5 and TRPC6 were detected in the primary rat cortical neurons

migrating at the expected masses of 97 kDa, 108 kDa, and 122 kDa, respectively

(Figure 3.5a, 3.5c, 3.5e). Interestingly, TRPC6 appeared as a double band. Specificity

of TRPC6 antibodies was confirmed by the presence of bands of similar molecular

weight in positive control sample, rat brain lysates, and the absence of immunoreactive

species in negative control, BLCL. While the TRPC5 specificity was determined

similarly, no suitable negative control was found due to its ubiquitous expression [287].

In addition, a standard curve was generated to determine the linear dynamic range of

detection (Figure 3.5b, 3.5d, 3.5f). These experiments were replicated thrice, with

coefficient of variations less than 0.2, to ensure reproducibility.

74

Figure 3.5 Western blot assay and linearity of detection vs lysate protein concentration of TRPC3,

TRPC5, and TRPC6 in primary rat cortical neurons. Representative immunoblots of (a) TRPC3, (c)

TRPC5, and (e) TRPC6 are shown with the amount of protein sample loaded per lane noted. Standard

curves of (b) TRPC3, (d) TRPC5, and (f) TRPC6 immunolabeling versus lysate protein concentration

were determined using pooled lysate samples. In each case, linear regression analysis demonstrated

strong linear relationships with R2 > 0.90.

TRPC

3

TRPC

6

TRPC

5

75

3.3 Effect of Oxidative Stress on Primary Rat Cortical Neurons

The neuronal enrichment of rat primary cortical cultures was achieved using cytosine

arabinoside, a mitotic inhibitor, initiated cultures for 24 hours and confirmed by

immunocytochemistry. For this purpose, MAP2, CNPase and GFAP were used as

immunocytological markers for neurons, oligodendrocytes, and astrocytes, respectively.

As shown in Figure 3.6, dual labelling with either MAP2 and CNPase or MAP and

GFAP, revealed that over 90% of the total population possessed neuronal phenotype

with little or no contaminating oligodendritic or astroglial populations.

The effect of rotenone-induced oxidative stress was evaluated in several

capacities over the time course of oxidative stress treatment including visual monitoring

of gross cell morphology using phase-contrast microscopy. Images were taken every 24

hours for each of the treatment groups, 0 nM, 15 nM or 30 nM of rotenone (Figure 3.7).

It was observed that oxidative stress resulted in the truncation and reduction of neuronal

projections and cell bodies over time, in a dose-dependent manner.

In addition, transcript levels of HO-1, an oxidative stress response gene

measured to confirm the induction of oxidative stress in the RCN preparations

(Roedding et al., under review 2011), increased significantly in a dose-dependent

manner with rotenone treatment (Figure 3.8a) [F(2,7) = 14.43, p < 0.001]. Moreover the

viability of RCN after chronic oxidative stress treatment decreased in a dose-dependent

manner to approximately 50% in cultures treated with 15nM rotenone and 25% in

cultures treated with 30nM rotenone (Figure 3.8b). Cell viability was determined every

24 hours of the 4 day stress treatment period using propidium iodide staining.

76

Figure 3.6 Representative dual labelled immunocytochemistry images of primary rat cortical

neuron cultures. (a) Staining with anti-MAP2, a marker for neurons, revealed a prominent neural

population within rat cortical neuronal cultures. Labelling cultures with only secondary anti-bodies, (b) α-

rabbit and (c) α-mouse, served as negative controls. Further double immunocytochemistry with (d, e, f)

MAP2 and CNPase, a marker for oligodendrocytes and (g, h, i) MAP2 and GFAP, a marker for astrocytes,

revealed primary rat cortical neuron cultures to be highly enriched in cells of a neuronal phenotype.

77

Figure 3.7 Representative phase contrast microscopy images of primary rat cortical neuron

cultures over 4 day rotenone-induced oxidative stress treatment. Images were acquired 10x

magnification before and every 24 hours during 4 day rotenone treatment (images taken after 48 hours

and 72 hours not shown) at 0 nM, 15 nM and 30 nM. Neuronal cultures show reductions in the densities

of projections and cell bodies over time in a dose-dependent manner.

78

Figure 3.8 Effects of rotenone on HO-1 expression and cell viability in primary rat cortical

neurons. (a) HO-1 mRNA levels were measured using relative quantitative RT-PCR after 24 hour or 4

day treatment with rotenone at 0 nM (vehicle), 15 nM and 30 nM. Levels of HO-1 mRNA were significantly

higher in the 30nM treatment group compared to 0 nM and 15 nM (n=7, *p < 0.05). (b) Cell viability was

determined using propidium iodide assay every 24 hours during 4 day rotenone treatment (n=11). Data

are expressed as mean ±SD. All data shown in this figure was acquired and compiled by Angela

Roedding and reprinted with her permission.

*

79

3.4 The Effect of Acute and Chronic Oxidative Stress on TRPC5 and TRPC6

Previous work by Roedding et al. (under review 2011) has shown that TRPC3 protein (p

< 0.001) and mRNA (p < 0.001) are significantly reduced in cultures undergoing

rotenone induced oxidative stress compared to vehicle treated samples in a dose-

dependent manner after 4 days, but not 24 hours, of stressor exposure (Figure 3.9).

Based on these findings, TRPC5 and TRPC6 protein and mRNA transcript levels were

examined in primary rat cortical neuron preparations exposed to oxidative stress

inducing agent, rotenone, for 24 hours (acute) and 4 days (chronic). TRPC protein and

mRNA levels were quantified as described in section 2.5 and 2.6, respectively.

After 24 hours of rotenone treatment, no differences were found in the protein

levels of TRPC5 in 15 nM and 30 nM groups compared to vehicle as tested by repeated

measure ANOVA [F (2,8) = 1.148, n = 5, p = 0.345] (Figure 3.10a). However, rotenone

dose-dependently reduced the levels of TRPC5 mRNA at 24 hours [F (2,8) = 17.498, n

= 5, p < 0.001]; transcript levels showed a 1.87 fold reduction in the 30 nM rotenone

treatment group compared to vehicle controls (p < 0.05 Bonferroni pairwise test)

(Figure 3.10b). Although an approximately 15% reduction inTRPC5 mRNA was seen in

the 15 nM rotenone treatment group, this did not reach significance, likely due to small

sample size and large variance. After 4 days, rotenone significantly lowered the protein

levels of TRPC5 [F (2,6) = 19.044, n =4, p = 0.003] in the 15 nM groups, 69% relative to

controls (p < 0.01), and reduction was also found in the 30 nM group, 45% compared to

vehicle treatment (p < 0.05) (Figure 3.10c). Interestingly, no statistically significant

80

differences were found in the mRNA levels of the TRPC5 transcript after 4 day

treatment with rotenone [F (2, 8) = 2.528, n = 5, p = 0.185] (Figure 3.10d).

In regards to TRPC6 expression, as shown in Figure 3.11a and 3.11b, no

significant changes were found in either the protein levels [F (2,8) = 3.061, n = 5, p =

0.103] or the mRNA levels [F (2,8) = 1.687, n = 5, p = 0.245] in primary rat cortical

neurons exposed to 15nM and 30nM of rotenone for 24 hours compared to vehicle

treated controls. In contrast, 4 day stressor treatment significantly decreased TRPC6

protein levels [F (2, 8) = 14.728, n = 5, p = 0.002]. At 15 nM, rotenone decreased

TRPC6 protein levels by 55%, whereas the protein levels were decreased by 76% at 30

nM (Figure 3.11c). In the low concentration (15nM) group, rotenone reduced protein

levels by 55% compared to healthy controls (p < 0.05). Similar to TRPC5, no differences

were found in TRPC6 mRNA levels [F (2, 8) = 1.691, n = 5, p = 0.244] in rotenone

treated samples after 4 days of oxidative stress treatment (Figure 3.11d).

81

Figure 3.9 The effect of acute and chronic rotenone treatment on TRPC3 protein and mRNA levels

in rat primary cortical neurons. When neurons were exposed to 0 nM, 15 nM and 30 nM of rotenone for

24 hours, no significant differences in (a) protein [n = 3] or (b) mRNA [n = 3] levels were detected. In

contrast, a statistically significant dose-dependent decreases in TRPC3 (c) protein (60% ±28, Friedman

statistic=16.22, p<0.001, n=9) and (d) mRNA [31% ±12, F(2,7)=25.18, p<0.001] were observed upon

chronic rotenone treatment. Error bars represent SD. * denotes p < 0.05 and • denotes outliers. From

Roedding et al, under review 2012.

82

Figure 3.10 The effect of acute and chronic rotenone treatment on TRPC5 protein and mRNA

levels in rat primary cortical neurons. Neurons exposed to 0 nM, 15 nM and 30 nM of rotenone for 24

hours showed no significant differences in (a) protein levels [n = 5] but (b) mRNA levels decreased [F (2,

8) = 17.498, n = 5, p < 0.001], with a marked reduction at 30 nM rotenone relative to 0 nM controls (p <

0.05, Bonferroni test). After 4 days of rotenone treatment, there were also a significant effect on protein

levels (c) [F (2, 8) = 19.044, n= 4, p = 0.003] which were reduced at both 15 nM (p < 0.01) and 30 nM (p <

0.05) compared to vehicle controls. No changes were detected in the (d) mRNA levels [n = 5] of

chronically treated primary rat cortical neurons. Data are expressed as the means (bars) + SD for n=5

independent cell culture preparations. * denotes p < 0.05 relative to vehicle treated controls.

83

Figure 3.11 The effect of acute and chronic rotenone treatment on TRPC6 protein and mRNA

levels. Rat primary cortical neurons were exposed to 0 nM, 15 nM and 30 nM of rotenone for 24 hours or

4 days. Rotenone exposure did not affect (a) protein or (b) mRNA levels at 24 hours but significantly

reduced (c) TRPC6 protein level [F(2,8) = 14.728, n= 5, p = 0.002] at 15 nM (p < 0.05, Bonferroni test)

and 30 nM (p < 0.05) rotenone compared to vehicle controls but not mRNA levels after 4 days treatment.

Data are expressed as the means ± SD for n = 5 independent cell culture preparations. * denotes p <

0.05 relative to vehicle treated controls.

84

3.5 OAG Induces a TRPC3-mediated Ca2+

Response in Primary Rat Cortical Neurons

Given the profound effects of chronic oxidative stress on the mRNA and/or protein

levels of the TRPC channels examined, I next explored whether there were likely to be

associated reductions in the function of these channels. To this end, I assessed the

functionality of TRPC3 channels as a representative of the diacyglyerol activated TRPC

channels subgroup and for which there is a known agonist, 1-oleoyl-2-acetyl-sn-

glycerol (OAG) and an established specific antagonist, ethyl-1-(4-(2,3,3-

trichloroacrylamide)phenyl)-5-(trifluoromethyl)-1H-pyrazole-4-carboxylate (pyr3) [312].

To confirm functional activation of TRPC3 channels in rat primary cortical neuron

cultures, representative cultures were loaded with 1 µM fura-2, cultures and stimulated

with OAG. Although the OAG dose-response was highly variable for what was identified

as technical solvation problems because of its hydrophobicity, it was found that

response was maximized at 100 μM as has been reported in a number of studies [313-

317] and increasing the concentration did not result in a corresponding increase in

response. As such, a stimulatory concentration of 100 µM was used. To confirm the

OAG stimulated Ca2+ response was mediated at least in part by TRPC3, the inhibition of

the response by the specific TRPC3 inhibitor, pyr3 was examined. Comparison of the

effects of pretreatment with increasing concentrations of pyr3 (vehicle, 0.5, 1, 2.5, or 5

μM for 10 minutes) on the OAG activated Ca2+ response showed a maximal inhibitory

effect at 2.5 µM pyr 3 (Figure 3.12). One-way repeated measures ANOVA revealed

statistically significant differences in the mean maximum intensities (normalized to

85

baseline) [F (4, 12) = 3.895, n = 4, p = 0.029] (Figure 3.12a), rate of rise [F (4, 12) =

4.133, n = 4, p = 0.024] (Figure 3.12c), and area under the curve [F (4, 12) = 6.121, n =

4, p = 0.006] (Figure 3.12d) in the different pyr3 treatments. Tukey post-hoc

comparisons indicated that 2.5 mM pyr3 treatment had significantly lower mean

maximum intensity, rate of rise, and area under the curve of the OAG-activated Ca2+

response, p < 0.05, relative to vehicle controls. The area under the curve of 1 mM pyr3

inhibition treatment was also significantly lower than that of vehicle controls (p < 0.05).

The percentage of responding ROIs, defined as ROIs with a maximum intensity which

were within 2 standard deviations of the mean maximum intensity of vehicle treated

OAG-induced cultures, was not significantly affected by pyr3 treatment [F (4, 12) =

2.185, n = 4, p = 0.132] (Figure 3.12b) supporting that the inhibitory effect of pyr3 was

generalized to all cells in the imaged field. For the purposes of clarity, Figure 3.13

presents a representative OAG induced Ca2+ response in RCN compared with vehicle

(0.5% DMSO) and 2.5 µM pyr3 inhibition curves. There was over 60% reduction of the

magnitude of the OAG-induced response by 2.5 µM of pyr3 pretreatment compared with

the vehicle.

86

Figure 3.12 Pry3 has a significant effect on mean normalized maximal intensity, rate of rise, and

area under the curve but not the percentage of OAG activated responding ROIs in primary rat

cortical neurons. (a) Repeated measures one way ANOVA revealed that pyr3 treatment had a

statistically significant effect on the mean normalized (to baseline) maximal intensity [F (4, 12) = 3.895, n

= 4, p = 0.029]. Tukey post-hoc analysis found that mean normalized maximal intensity was reduced after

2.5 mM (1.963, 95% CI [1.482-2.045]) pyr3 treatment compared to 0 nM (3.171, 95% CI [1.822-4.520])

but not at other concentrations. (b) There were no statistically significant differences in the percentage of

responding ROIs between pyr3 treatment groups. (c) Pyr3 attenuated the rate of rise [F (4, 12) = 4.133, n

= 4, p = 0.024] in the 2.5 mM (2.952 x 10-3

, 95% CI [2.284 x 10-3

-3.620 x 10-3

]) pyr3 treatment group

compared to 0 nM treated controls (7.315 x 10-3

, 95% CI [3.425 x 10-3

-11.21 x 10-3

]). (d) The area under

the curve was also significantly reduced by pyr3 treatment [F (4, 12) = 6.121, n = 4, p = 0.006] and was

significantly less in the 1 mM (77.34, 95% CI [33.32-121.4]) and 2.5mM (85.46, 95% [38.07-132.8]) pyr3

treatment groups compared to vehicle controls (225.9, 95% CI [108.9-343.0]). Data are expressed as the

means (bars) + SD for n = 4 independent cell culture preparations. *p < 0.05 vs. vehicle control. D –

DMSO.

87

Figure 3.13 OAG induced a Ca2+

response in rat primary cortical neurons is mediated in part by

TRPC3. Primary rat cortical neurons were cultured and loaded with 1µM fura-2. Cultures were treated

with 2.5nM pyr3, a specific inhibitor of TRPC3, or vehicle control for ten minutes before imaging. Baseline

340/380 ratio was determined by 5 data points measured prior agonist stimulation. When treated with

DMSO vehicle (grey), neurons did not demonstrate any response with or without pyr3. In comparison, a

strong Ca2+ response was observed when cultures were stimulated with OAG (blue). Treatment with

2.5nM pyr3 for 10 minutes resulted in a substantial decrease in response in primary rat cortical cultures

(red).

88

3.6 The Effect of Chronic Rotenone Induced Oxidative Stress on the Mobilization of Calcium in Primary Rat Cortical Neurons

In light of the differences found in TRPC3 protein and mRNA levels due to oxidative

stress, we sought to determine if chronic rotenone treatment also had an impact on the

regulation of Ca2+ flux through TRPC3. After 4 days of rotenone exposure, primary rat

cortical neurons were loaded with 1µM fura-2 and stimulated with 100 µM OAG.

As shown in Figure 3.14 rotenone reduced the magnitude of OAG-induced Ca2+

response in a dose-dependent manner. Further, repeated measures, one-way ANOVA

found that there were significant main effect of rotenone on the mean maximum

intensity [F (2, 6) = 31.787, n = 4, p = 0.001] (Figure 3.15a), percentage of responding

ROIs [F (2, 6) = 47.895, n = 4, p = 0.011] (Figure 3.15b), rate of rise [F (2, 6) = 31.645,

n = 4, p = 0.001] (Figure 3.15c), and area under the curve [F (2, 6) = 16.395, n = 4, p =

0.004] (Figure 3.15d). Post-hoc analysis using Tukey’s test for multiple comparisons

found that 15nM and 30nM of rotenone decreased the mean maximum response by

20% and 40%, percentage of responding ROIs by 34% and 64%, rate of rise by 55%

and 76%, and area under the curve by 70% and 84% in primary rat cortical neurons

relative to vehicle treated samples (p’s < 0.05).

89

Figure 3.14 Chronic rotenone treatment reduces OAG-induced Ca2+

response in primary rat

cortical neurons. Primary rat cortical neurons were treated with 0nM, 15nM, or 30nM of rotenone for 4

days before loaded with 1µM Fura-2. Baseline 340/380 ratio was determined by 5 data points measured

over 10 seconds prior OAG stimulation. A very robust Ca2+

response was observed in vehicle-control

cultures stimulated with OAG (blue). In comparison, the magnitude of OAG-induced Ca2+ response was

attenuated in a dose-dependent manner by rotenone (green - low dose, red – high dose).

90

Figure 3.15 Rotenone treatment significantly attenuates calcium responses in rat primary cortical

neurones stimulated with OAG. (a) Repeated measures one way ANOVA revealed that rotenone

treatment had a statistically significant effect on the mean normalized (to baseline) maximal intensity [F

(2, 6) = 31.787, n = 4, p = 0.011]. Tukey post-hoc analysis found that mean normalized maximal intensity

was decreased after 15nM (20% reduction) and 30nM (40% reduction) rotenone treatment compared to

0nM. (b) The percentage of responding ROIs was significantly reduced [F (2, 6) = 47.895, n = 4, p =

0.011] in the low dose (34%) and the high dose (64%) relative to vehicle controls. (c) Rotenone similarly

attenuated the rate of rise [F (2, 6) = 31.645, n = 4, p = 0.001] in 15nM (55%) and 30nM (76%) treatment

groups compared to 0nM treated controls. (d) The area under the curve was also significantly reduced by

rotenone treatment [F (2, 6) = 16.395, n = 4, p = 0.004]. Post-hoc analysis reveal that the area under the

curve was significantly less in the low dose (70%) and high dose (84%) rotenone treatment groups

relative to vehicle controls. Data are expressed as the means (bars) + SD for n = 4 independent cell

culture preparations. *p < 0.05 relative to vehicle control.

91

3.7 Effect of Chronic Lithium on the Levels of TRPC3, TRPC5, and TRPC6 Protein and mRNA under Chronic Rotenone-induced Oxidative Stress

Following evidence of oxidative modulation on these TRPC channels, the effect of

lithium, a prototypical mood stabilizer with neuroprotective properties, on rotenone-

mediated regulation of TRPC3, TRPC5, and TRPC6 was investigated (reviewed in

Section 1.4, page 27). Protein and mRNA levels of TRPC subtypes were measured in

primary rat cortical neurons pre-treated with 1 mM of lithium for 8 days and exposed to

15nM or 30nM rotenone or vehicle together with lithium for 4 days. Protein levels were

quantified by immunoreactivity levels and normalized to loading control (β-actin).

Transcript levels were analyzed using the comparative ΔCt method using GAPDH as a

housekeeping gene and mRNA levels are displayed as a fold change of the vehicle

control.

Repeated measures two-way ANOVA with lithium treatment and rotenone

treatment concentration as factors revealed a statistically significant main effect of

rotenone [F (2, 6) = 5.881, n = 4, p = 0.039] but not lithium [F (1, 3) = 0.418, n = 4, p =

0.564] on TRPC5 protein levels (Figure 3.16a). A trend interaction [F (2, 6) = 4.141, n =

4, p = 0.074] was also detected between these two factors. In contrast, TRPC5

transcript levels were not affected by rotenone treatment [F (2, 8) = 2.507, n = 5, p =

0.143] or lithium treatments [F (1, 4) = 0.539, n = 5, p = 0.504], nor was there an

interaction between rotenone and lithium [F (2, 8) = 3.613, n = 5, p = 0.076] on TRPC5

mRNA levels (Figure 3.16b).

92

Examination of TRPC6 protein levels (Figure 3.17a) also showed a significant

effect of rotenone [F (2, 6) = 9.560, n = 4, p = 0. 014]. Further statistical analysis

revealed that 30nM rotenone groups showed a trend in the reduction (51% in no lithium

and 42% in lithium treated groups) of TRPC6 protein levels compared to respective

vehicle controls (p = 0.073, Bonferroni pairwise test). However, there was no significant

effect of lithium treatment [F (1, 3) = 0.296, n = 4, p = 0.624], on TRPC6 protein levels

(Figure 3.17a) or an interaction effect [F (2, 6) = 0.989, n = 4, p = 0.425] between the

two treatment factors. There also were no significant effects of these treatments on

TRPC6 mRNA levels (Figure 3.17b) (rotenone [F (2, 8) = 1.512, n = 5, p = 0.277],

lithium [F (1, 4) = 1.757, n = 5, p = 0.256], lithium x rotenone [F (2, 8) = 3.103, n = 5, p =

0.437]).

Based on earlier work, under review, demonstrating rotenone-induced alterations

in TRPC3 expression, the effect of lithium on the TRPC3 subtype within this framework

was also examined. To reduce the effect of inter-animal variation, immunoreactivity

measurements for TRPC3 were normalized to the respective vehicle treatment groups

(0nM Li and 0nM rotenone treatments) as it was found that normalizing to a loading

control increased variance. As such, a repeated measure two-way ANOVA conducted

on TRPC3 protein levels (Figure 3.18a) only compared the low-dose rotenone and high

dose rotenone groups. It was shown that both rotenone [F(1, 4) = 14.607, n = 5, p =

0.019] and lithium [F(1, 4) = 75.949, n=5, p < 0.001] had a significant main effect on

protein levels, however, there was no significant interaction between these treatment

factors on protein levels [F(1, 4) = 0.687, n = 5, p=0.687]. Post hoc pairwise

comparisons revealed a statistically significantly decrease in protein levels between

15nM and 30nM rotenone treatment groups (p < 0.05, Bonferroni test) and a statistically

93

significant increase in protein levels between 0mM and 1mM lithium treatment groups (p

< 0.001). To determine whether there was an effect of lithium in the rotenone vehicle

treatment condition, rotenone vehicle immunoreactivity levels were normalized against

the 15nM rotenone, lithium vehicle group to control for inter-blot variability. No

statistically significant differences were found between the two groups (t = 0.367, df = 4,

p = 0.732, paired t-test). With regards to TRPC3 mRNA levels (Figure 3.18b), there

was a statistically significant effect of rotenone [F (2, 6) = 5.720, n = 4, p = 0.41] but not

lithium [F (1, 3) = 0.807, n = 4, p = 0.435] on TRPC3 transcript levels and no statistically

significant interaction between the two [F (2, 6) = 0.737, n = 4, p = 0.517]. Investigation

of TRPC3 protein and mRNA levels were initiated by Angela Roedding and Masoumeh

Emamghoreishi and completed by me thus representing a collaborative effort.

Masoumeh Emamghoreishi contributed an n of 3 to the quantification of TRPC3 mRNA

levels and Lydia Zhou contributed to an n of 3 to the quantification of TRPC3 protein

and I contributed an n of 1 to the quantification of both TRPC3 protein and TRPC3

mRNA, and did all of the analyses of the effect of lithium on TRPC5 and 6 as presented

above.

94

Figure 3.16 The effect of lithium pretreatment on the downregulation of TRPC5 by chronic

rotenone treatment. (a) Rat primary cortical neuron cultures were pretreated with lithium (1 mM) for 8

days and exposed to 4 day oxidative stress in the continued presence of lithium. Repeated measures

two-way ANOVA found a statistically significant main effect of rotenone [F (2, 6) = 5.881, n = 4, p = 0.039]

but no statistically significant effect of lithium or an interaction between lithium and rotenone were found.

(b) No significant effects of rotenone, lithium or an interaction of lithium and rotenone was found in

TRPC5 transcript levels. Data are expressed as the means (bars) ± SD of four cell cultures treated in

independent experiments.

95

Figure 3.17. The effect of lithium pretreatment on the downregulation of TRPC6 by chronic



two-way ANOVA found a statistically significant main effect of rotenone [F (2, 6) = 9.560, n = 4, p = 0.

014]. Bonferroni post-hoc tests revealed that groups treated with 30 nM of rotenone had a trend of

reduced levels of TRPC6 protein compared to vehicle controls (• p = 0.073). However, no statistically

significant effect of lithium or an interaction between lithium and rotenone were found. (b) No significant

effects of rotenone, lithium or an interaction of lithium and rotenone was found in TRPC6 transcript levels.

Data are expressed as the means (bars) ± SD of 4 cell cultures treated in independent experiments.

96

Figure 3.18 The effect of lithium pretreatment on the downregulation of TRPC3 by chronic



two-way ANOVA comparing the 15 mM to the 30m M rotenone groups found a statistically significant

main effect of rotenone [F(1, 4) = 14.607, n = 5, p = 0.019] and lithium [F(1, 4) = 75.949, n=5, p < 0.001]

but not an interaction between the two factors. Bonferroni post-hoc tests revealed that the groups treated

with 30 nM of rotenone had reduced levels of TRPC3 protein compared to 15 nM groups (p < 0.05) and

that both groups had increased protein levels when treated with lithium compared to non-lithium treated

groups (p < 0.001). However, no statistically significant effect of an interaction between lithium and

rotenone was found. (b) With regards to TRPC3 transcript, rotenone had a statistically significant main

effect on mRNA levels [F (2, 6) = 5.720, n = 4, p = 0.41] although no effect of lithium or an interaction of

lithium and rotenone was found. Data are expressed as the means (bars) ± SD of 4 cell cultures treated in

independent experiments.

97

4 Discussion

98

The principal objectives of this study were to investigate the effects of oxidative stress

on the expression and/or functionality of TRPC3, TRPC5 and TRPC6 in primary rat

cortical neurons. As such, the effects of acute and chronic oxidative stress on mRNA

and protein levels of TRPC5 and TRPC6 were examined. Based on Roedding et al’s.

finding on the effects of chronic rotenone treatment on TRPC3, that is, downregulation

of its expression and protein levels, I hypothesized that TRPC5 and TRPC6 mRNA and

protein levels would also be decreased after chronic but not acute oxidative stress.

Additionally, I hypothesized that such reductions in TRPC3 expression or protein levels

would lead to a corresponding decrease in TRPC3 function, which had not been

examined by Roedding et al. The results revealed that while TRPC5 and TRPC6 protein

levels were decreased significantly, TRPC5 and TRPC6 mRNA levels did not seem to

be affected by chronic oxidative stress. The reduction of TRPC3-mediated Ca2+ flux in

neurons exposed to oxidative stress corroborates a functionally significant effect of

oxidative stress on the TRPC3 channels in rat primary cortical neuron cells.

While the obtained results suggest that TRPC3, TRPC5, and TRPC6 are

regulated, in part, by chronic oxidative stress, the degree and level of regulation

(expression, protein turnover and function) seem to vary between subtypes indicating a

complex regulatory system which may have important physiological implications in

cellular Ca2+ homeostasis linked to the pathogenesis of bipolar disorder.

99

4.1 Acute and Chronic Oxidative Stress on TRPC5 and TRPC6

Based on the observed levels of TRPC3, TRPC5, and TRPC6 mRNA and protein levels

following chronic or acute oxidative stress, the primary findings of this study are first,

that the expression or protein levels of this group of TRPC channels is affected by

oxidative stress and, second, that there are differences in the regulation of TRPC3,

TRPC5 and TRPC6 by oxidative stress, both acutely and/or chronically. As the effects

of rotenone on the mRNA and/or protein levels of these TRPC channels were time

dependent, these changes are likely to reflect the effect of other mechanisms linked to

the redox state of the cell that govern their expression and/or turnover.

At the transcriptional level, compared to vehicle controls there was a marked

reduction in TRPC3 mRNA after 4 day treatment (Roedding et al. 2011, submitted) and

in TRPC5 mRNA after 24 hours in rotenone treated samples, but no changes were

detected in TRPC6 mRNA levels. The decreased TRPC3 and TRPC5 mRNA levels are

unlikely to represent a global reduction in mRNA stability or expression as expression of

TRPC6 and the housekeeping gene, GAPDH, were constant across treatment groups.

More likely, the changes in TRPC3 and TRPC5 mRNA levels reflect the influence of

ROS on the expression and/or mRNA stability of these two channel transcripts. As the

structure of the TRPC3 and TRPC5 promoters are not well elucidated, the exact

mechanisms and pathways involved in regulating TRPC gene expression are currently

unclear. For instance, the transcription of multiple antioxidant genes is activated through

sequences known as antioxidant response elements (ARE) mediated by transcription

factors Nrf1 and Nrf2. However, there is as yet no published evidence to support the

existence of ARE in the promoters of TRPC channels [318]. In one study, the

100

involvement of mitogen-activated protein kinases (MAPKs), extracellular signal

regulated kinase (ERK) and c-Jun NH2-terminal kinase (JNK) as well as the ubiquitously

expressed transcription factor, nuclear factor-κB (NF-κB) have been implicated at least

in the case of thrombin-mediated upregulation of TRPC3 in astrocytes [319]. However,

conflicting reports demonstrate both dependence and independence of MAPK activation

on Ca2+ signalling, suggesting that molecular pathways modulating TRPC3 expression

may be more complicated [320-322]. In addition, erythropoiethin, known to initiate

signalling pathways including MAPK, has been demonstrated to upregulate TRPC5

mRNA in cultured endothelial cells after 24 hours [323]. The ERK pathway, on the other

hand, has been shown to increase TRPC1 expression following stimulation by TNF-α

[324]. Most importantly, these intracellular cascades are known to be involved in

physiological responses to a variety of stimuli including ROS and thus may provide

possible links between oxidative stress and TRPC gene regulation.

Another line of evidence implicates the involvement of TRPC subtypes 3 and 6 in

the activation of calcineurin-nuclear factor activated T cells (NFAT) signalling cascade in

cardiac models, permitting the possibility of biological feedback of NFAT on TRPC

channel expression [325-327]. Indeed, Kuwahara et al. found that in mice TRPC6 was

upregulated in response to calcineurin and that the promoter of mice TRPC6 contained

two conserved NFAT consensus sequences [328]. Activation of PKC signalling, another

intricate intracellular pathway linked to both ROS and NFAT, has been shown to down-

regulate TRPC6 expression after 2 days in cultured mesangial cells [329]. Therefore, it

is possible that a reduction in TRPC channel functionality leading to decreased NFAT-

mediated Ca2+ signalling could result in the further downregulation of TRPC3 through

feedback inhibition. Taken together, available data suggest that the regulation of TRPC

101

gene expression by rotenone is the product of complex interactions between several

intracellular signalling pathways which could vary among cell types, mechanism of ROS

production, and duration of stress.

At the protein level, all three channels, TRPC3, TRPC5 and TRPC6,

demonstrated significant dose-dependent decreases to rotenone-induced oxidative

stress treatment after 4 days but not 24 hours. Similar to TRPC gene expression, there

is currently not a clear understanding of the modulation of TRPC protein level by

oxidative stress. However, the differential changes in TRPC channel expression at the

transcriptional and translation level hint that these channels may be regulated through

different mechanisms. In the case of TRPC3, the reduction in protein levels most likely

reflects the significant decrease in mRNA levels after 4 day rotenone exposure.

Although TRPC5 mRNA was not reduced significantly following chronic rotenone

treatment, a decrease in its mRNA levels was seen in the acute treatment group

suggesting that TRPC5 gene expression may be affected by ROS, at least acutely.

However, as TRPC6 mRNA levels did not show any response to either acute or chronic

rotenone treatment, a different mechanism of regulation must exist in its case. For

instance, ROS may regulate these channels through post-translational modifications

that alter the protein turnover [330]. Protein oxidation can result in protein aggregation,

fragmentation, loss of function and increased degradation through mechanisms such as

the ubiquitin-proteasome pathway and lysosomes [331, 332]. It is important to note that

while TRPC3 and TRPC5 may be affected by a downregulation in expression, these

channels may also be susceptible to post-translational modification/degradation.

Interestingly, as TRPC3 and TRPC6 are very closely related, the different non-

homologous coded regions of these two proteins may encapsulate the targeted post-

102

translation modification or proteolytic sites. As currently knowledge in this area is very

limited, further work into the structural motifs of TRPC channels, by means of proteomic

bioinformatics for example, are necessary to better understand the differential regulation

observed.

In addition, safeguards and controls were implemented to ensure the validity of

the findings observed. First, although TRPC5 and TRPC6 expression were only

measured within the context of rotenone-induced oxidative stress, Roedding et al 2012

(under review) found that TRPC3 expression was reduced using both rotenone and

paraquat, another inhibitor of complex I of the mitochondria, suggesting that the

decrease in TRPC3 channel expression is not a result of chemical specific effects of

rotenone. Moreover, the consistent expression of the housekeeping gene GAPDH and

loading control β-actin across vehicle and rotenone treatment groups implied that the

reductions in TRPC channel expression and protein levels are not attributable to global

impairments in gene transcription and protein synthesis mechanisms caused by

oxidative stress. Lastly, though these changes occur against the backdrop of cell death,

the differential pattern of changes in expression and protein levels of these TRPC

species and the control housekeeping proteins is inconsistent with an explanation that

the observed TRPC changes can be simply ascribed to cell death.

A survey of the literature revealed a range of TRPC channel responses to

oxidative stress in several different models and using different mechanisms of ROS

generation. For example, Graham et al. found a significant decrease in TRPC6 protein

levels in cultured mesangial cells after treatment with high glucose and H2O2 after 2

days and 6 hours, respectively [329]. In contrast, Wuensch et al. found an increase in

TRPC1, TRPC3, TRPC5 and TRPC6 in monocytes after 4 hours in response to high

103

glucose [333]. In platelets, Liu et al. found that high glucose treatment also increased

TRPC6 protein levels [334]. Interestingly, both TRPC3 and TRPC5 channels have been

shown to be activated by reactive oxygen species [335]. However, the effects of long-

term oxidative stress on their expression were largely unknown until now. These

findings of a strong reduction in TRPC3, TRPC5 and TRPC6 protein levels after chronic

but not acute oxidative stress highlight the importance of cell-type specific and channel

subtype specific responses to ROS and the temporal aspect of oxidative regulation on

these channels.

Overall, this study found, for the first time, that chronic but not acute oxidative

stress significantly reduces TRPC5 protein, and TRPC6 protein levels, and confirmed

TRPC3 mRNA and protein reductions, although acute stress seems to decrease

TRPC5 mRNA. Most importantly, this study highlights the importance of the duration of

oxidative stress in the regulation of these channels.

104

4.2 The Functional Significance of Chronic Oxidative Stress on TRPC3/6

As there are few known specific, direct acting agonists and antagonists to assess the

function of TRPC3 and 6 individually. Within these limitations, the best characterized

agonist of these two channels, OAG, an analogue of endogenous DAG, has been

widely used and shown to directly gate these channels and stimulate Ca2+ entry (see

Section 1.6.3, page 37). Thus, OAG was used in this study to stimulate both TRPC3

and TRPC6 to evaluate whether the reduced levels were accompanied by a net

reduction in their function. A pharmacological strategy was then applied in order to

estimate at least that fraction of the total OAG stimulated response (TRPC3 and 6) Ca2+

response attributable to TRPC3. This was accomplished by measuring the OAG

stimulated response in the presence and absence of the TRPC3 specific inhibitor pyr3

in the RCN preparation [312]. In preliminary dose ranging inhibition experiments,

interestingly, a concentration of 2.5mM pyr3 was found to give the greatest inhibition

across the range of concentrations tested (0.5 - 5 μM). Thus, the inhibition curve was U-

shaped. Regardless of the complex inhibition curve, pyr3 pretreatment significantly

reduced the levels of OAG-activated Ca2+ flux, maximally to 62% above basal (a 38%

reduction) (Figure 3.13), compared to non-inhibited vehicle controls. These results are

consistent with the findings of Kiyonaka et al. that pyr3 inhibits TRPC3 specifically in the

low µM range (IC50 value of 0.8 µM) and support that TRPC3 mediates a significant

fraction of the OAG activated response [312]. Moreover, they are in agreement with

reports of inhibition of TRPC3 by pyr3 through the ranges from 1 µM to 10 µM with

maximal inhibition at ≈3 µM depending on the cell model studied [313, 336-340].

105

Although it remains to be tested directly, the fraction of the OAG response that was

uninhibited by pyr3 may represent the contribution by TRPC6.

In the absence of TRPC6 specific inhibitor the degree of contribution of TRPC6

to the OAG-mediated response could not be discerned using a similar pharmacological

strategy. Although aminoethoxydiphenyl borate (2-APB) and N-(p-amylcinnamoyl)

anthranilic acid (ACA) inhibit TRPC6, these compounds lack specificity for TRPC6 and

have been reported to block the activity of members of the TRPC and TRPM families,

calcium release-activated calcium modulator channels (CRACM), and TRPV1 channels

[341-343]. An alternative approach to evaluating TRPC6 functionality would have been

contingent on the availability of a specific agonist to determine the effect of rotenone on

the agonist induced Ca2+ flux rather than the reduction in agonist induced activation.

Hyperforin, a bicyclic polyprenylated acylphloroglucinol derivative and the main active

ingredient in St. John’s Wort extracts, is a direct activator of TRPC6 [343]. Studies in

keratinocytes, however, question its specificity to TRPC6 as hyperforin was reported to

activate TRPC1, TRPC3, TRPC4, TRPC5 and TRPC7 [344]. Therefore, the lack at this

time of pharmacological modulators of established specificity to TRPC6 indicates

alternative strategies, such as TRPC6 knockdown models or direct electrophysiological

methodologies, must be used to study its function. As these techniques were not

available to be used in this thesis research, the effect of chronic oxidative stress on

TRPC6 function was not examined further.

Following chronic rotenone treatment, it was observed that there were significant

dose-dependent reductions in OAG-mediated Ca2+ flux. Rotenone-treated cultures

stimulated with OAG were not pretreated with pyr3 due to the cytotoxic properties of

DMSO, which solvated both OAG and pyr3. However, preliminary pyr3 inhibition

106

experiments support a major role of TRPC3 in OAG-mediated Ca2+ flux. Thus, these

results indicate that there is a significant decline in TRPC3 functionality following

oxidative stress. Moreover, as there were statistically significant reductions in TRPC3

and TRPC6 protein levels and TRPC3 mRNA levels after chronic oxidative stress, the

dramatic reduction in expression may be the basis of the decreased functionality

observed.

The physiological importance of the observed reduced TRPC3 function and

whether it represents a cellular response to chronic oxidative stress or a consequence

of increased ROS, however, is not well understood. While data on TRPC3 function in a

neuronal context is sparse, based on earlier work by Jia et al., TRPC3 and TRPC6

channels have been recognized to possess neural protective properties through BDNF-

induced Ca2+ elevations [345]. On the other hand, at least two studies have found

reduced TRPC3 expression and TRP-mediated Ca2+ influx to promote cellular survival

[346, 347]. While these reports seem contradictory, the observation that TRPC3 can

function in a store-dependent or independent manner depending on the expression

system and protein expression levels may suggest that the physiological role of TRPC3

is cell-type specific [348, 349]. Although evidence is sparse, a reduction in TRPC3 could

be a cellular response to control NFAT-mediated genes, as discussed earlier, and

possibly other Ca2+ dependent expression profiles. Therefore, further knowledge of the

physiological roles of TRPC3 and TRPC6 channels and the consequences of their

altered expression and function is necessary to appreciate the molecular mechanism(s)

which induce the observed functional decline and how it may contribute to pathogenesis

of bipolar disorder. Despite this, this study found, for the first time, a significant

107

reduction of OAG-induced TRPC3/6-mediated Ca2+ flux following chronic rotenone

treatment.

4.3 The Effect of Chronic Lithium Treatment on Chronic Rotenone-induced Changes in TRPC3, TRPC5, and TRPC6

If the effect of chronic oxidative stress to downregulate TRPC3, TRPC5, and TRPC6 is

relevant to the pathophysiology of bipolar disorder, it would be expected that mood

stabilizer pretreatment of RCN would prevent or minimize the effect chronic rotenone

treatment. In this regard, lithium’s neuroprotective effects have been linked to its ability

to abrogate oxidant damage in both clinical and pre-clinical trials (refer to Section 1.4,

page 27) [256, 258]. Of note, chronic lithium treatment of rat primary cortical neuron

cultures at a therapeutically relevant concentration of 1 mM partially rescued the effect

of rotenone to downregulate TRPC3 protein but not mRNA levels. In contrast, there was

no appreciable effect of lithium to mitigate the effects of chronic rotenone on TRPC5

and 6, either mRNA or protein levels.

The observation that there was no difference in the levels of TRPC3 mRNA and

the protein levels of the other related TRPC channels, TRPC5 and TRPC6, with and

without lithium treatment implies that the effect of lithium was specific for TRPC3

degradation and/or clearance. Lithium is considered the standard pharmacological

treatment for BD and has been shown to possess neuroprotective properties in various

cellular and animal models [111]. Lithium’s neuroprotective effects have been

associated with several actions including the induction of survival molecules in brain

(i.e. Bcl-2, BDNF, and VEGF), induction of autophagy and induction of neurogenesis

[239, 240, 249, 350, 351]. In fact, findings by Jia et al. implicate TRPC3 and TRPC6 as

mediators of BDNF-induced Ca2+ elevation and subsequent signalling in neuronal

108

survival [345]. Therefore, lithium may regulate TRPC channel expression indirectly

through molecular targets such as BDNF. However, if this were the case, then a

separate mechanism must exist to target specifically TRPC3 over TRPC5 and TRPC6

based on the findings of this study.

The rescue like effect of chronic lithium treatment on the rotenone induced

reduction in TRPC3 protein levels in the RCN contrasts with the effect of chronic lithium

at similar therapeutic concentrations to reduce TRPC3 immunoreactivity (but not

mRNA) levels in BLCLs from bipolar and healthy subjects [307] and to reduce TRPC3

mediated Ca2+ responses in human astroglial cell lines (U87) (Takuji 2011, unpublished

data). While the directionality of the changes is discrepant between these cell models,

the confinement to the TRPC3 protein levels is the same. This suggests a common

effect of lithium on the disposition and clearance of the TRPC3 at the protein level. The

simplest explanation for the divergence of TRPC3 protein modulation by lithium among

these cell models is that they are cell-type dependent, RCN being an excitable cell type

whereas U87 and BLCLs are non-excitable. Not to be excluded is the possibility of

species differences in the cell models, rat versus human. Another explanation may

reside with the fact that RCN are primary cell lines whereas BLCLs and U 87 cells lines

are transformed and immortalized by viruses. Notwithstanding these possibilities, a

more interesting question arising from these cell model discrepancies is whether they

reflect responses of unique physiological significance within the excitable as compared

to the non-excitable cell type. Knowledge of the cell physiology of TRPC3 in many

respects is still rudimentary.

The specificity of an effect by lithium to TRPC3 and not TRPC6 is surprising.

Unlike TRPC5, TRPC6 sequence homology and response to DAG and its analogues

109

places it in the TRPC3/6/7subfamily grouping. Thus, one would have expected similar

effects of lithium on it as for TRPC3. In fact, given the greater reduction in TRPC6 as

compared with TRPC3 in the same cells exposed to chronic rotenone treatment, a more

prominent lithium rescue effect was anticipated. That this did not occur may reflect that

in primary rat cortical neurons, modulation of TRPC6 is more sensitive to intracellular

ROS production than TRPC3. Coupled with the caveat that rotenone treatment likely

resulted in a highly oxidative environment relative to ROS generated under

physiological conditions, lithium treatment at therapeutic levels may not have been able

to rescue TRPC6 protein expression in comparison to TRPC3. TRPC5, on the other

hand, falls into the TRPC4/5 grouping of TRPC channels, therefore, the dissimilarity to

TRPC3 in response to lithium again could be related to difference in mechanisms that

regulate the former. Though the exact explanation for the effect of chronic lithium on

TRPC3 remains to be elucidated, the fact that it exerts effects across several different

cell models and in human cell lines argues that the observed effects of lithium on

TRPC3 may still be relevant to its therapeutic spectrum of action.

110

4.4 Methodological Considerations and Limitations

4.4.1 Cell Model and Stressor

In the investigation of the effect of oxidative stress on canonical TRP expression and

function and its relevance to BD pathogenesis, the translational potential hinges on the

cell model and stressor used. In general, findings from in vitro models may be cell-type

and species specific and they may not fully represent a true physiological state where

cells are exposed to numerous regulatory signals and cell-cell interactions. Additionally,

being primary cell lines, inter-litter or inter-batch variation may increase the range of

responses seen to drug treatment and must be taken into consideration in interpreting

these results. However, such models serve hypothesis-generating roles in respect to

extrapolating to an in vivo state. Therefore, while there are limitations in using primary

rat cortical neuron and further work needs to be done in human cells and models, they

are cell-type relevant and relatively easy to acquire.

Rotenone was chosen for its ability to generate ROS intracellularlly by inhibiting

the complex I of the electron transport chain within the mitochondria. However, the

degree of cell death seen implies that concentrations used in this study were likely

supraphysiological. Although a low dose rotenone treatment was included to represent

a condition with a limited or milder degree of cell death, there was a significant reduction

in cell viability at both 15nM and 30nM rotenone treatment groups, approximately 25%

and 50%, respectively, compared to vehicle treatment controls. However, the differential

reductions in expression and function between TRPC subtypes support that these

findings are unlikely to be simply artifacts of cell death. Future studies using more

physiologically relevant intracellular stressors of ROS, such as mercaptosuccinate, an

111

inhibitor of glutathione peroxidase, may provide insight into the cellular response to

oxidative stress in the context of TRPC channels [352, 353].

4.4.2 mRNA Quantification: Real-time RT-PCR

Messenger RNA levels were determined by real-time RT-PCR using SYBR green

fluorescence using the comparative CT method for relative quantitation [311]. Amongst

the different fluorescence monitoring systems available, the SYBR green method is

relatively simple technologically and inexpensive, and as such was used in this study.

The disadvantages of this system are the requirement for extensive optimization and an

additional dissociation follow-up analysis to ensure amplicon specificity. As the

comparative Ct method eliminates the need for a standard by quantifying relative

expression, the dynamic range of both the target and the reference gene (GAPDH)

must to be similar. A nearly horizontal line (slope < 0.1) in the plot of log input versus

ΔCt (Figure 3.4) demonstrates that the efficiencies of the two amplicons are

approximately equal. While TRPC6 fulfilled this requirement, TRPC5 showed a slight

deviation from this slope value. The TRPC5 primers were still used because previous

responses to oxidative stress in TRPC3 mRNA levels were so large that it was expected

that an effect would still be detectable despite a small decrease in efficiency. As show in

Figure 3.2, the appearance of a single strong peak at the corresponding melting point

demonstrates the specificity of the reactions.

4.4.3 Protein Quantification: Western Blot

Immunoblotting, being the current standard for protein detection, was used to visualize

and quantify levels of TRPC subtypes. Prior to experimentation, significant optimization

112

was performed to maximize the accuracy of the procedure, including ensuring the

reproducibility of the procedure for each TRPC subtype and establishing a linear

dynamic range of detection by a 6 point standard curve. All samples were analyzed in

triplicate and the amount of protein homogenates loaded were within the linear range of

the standard. Despite this, the data presented must be taken within consideration of

logistical and procedural limitations. First, while BLCL lysates were used as a negative

control for TRPC6, no similar controls for TRPC5 were available. However, in rat frontal

cortex, a control tissue, homogenates and rat primary cortical neurons, for both TRPC5

and TRPC6 were distinct, well resolved immunoreactive bands that migrated with the

expected molecular mass. Second, it was logistically difficult to include all treatment

groups on one acrylamide gel and thus controls were required to adjust for inter-gel/blot

variance. Although TRPC5 and TRPC6 were normalized to loading control β-actin to

account for this, TRPC3 was not as Roedding (2010) found normalizing against β-actin

increased variance of TRPC3 relative immunoreactivity. Third, TRPC3 protein levels

were quantified using chemifluorescence detection with horseradish peroxidise tagged

secondary antibodies whereas TRPC5 and TRPC6 were detected with a more

contemporary near infrared scanning system. The near infrared system was adopted in

TRPC5 and TRPC6 experiments as it became available since it afforded higher

sensitivity and wider linear dynamic assay range than the STORM detection platform.

Lastly, immunoblotting using whole cell lysates does not provide insight into the

disposition of the protein within the cell. Given that ROS significantly reduces TRPC

protein levels, localization of these channels, by fractionating the preparations, before

and after chronic stress could provide insight into the mechanism of the oxidative

regulation such as through increased protein degradation or decreased expression.

113

4.4.4 Functional Assay: Calcium Kinetics

The function of TRPC3 and TRPC6 channels were assessed by measuring Ca2+

mobilization after agonist stimulation using ratiometric Ca2+ dye, fura-2 AM in primary rat

cortical neurons after chronic rotenone treatment. Intracellular Ca2+ flux was measured

in lieu of electrophysiological assays, which is the gold standard for evaluating TRP ion

channel function, because of the lack of equipment and technical expertise to perform

such procedures during the course of this work. In general, techniques such as patch-

clamping allow direct measurements of channel activity, resolution of the opening of

single ion channels, and detection of current signals spanning three orders of

magnitude. However, these procedures require physical contact with the tissue/cells

and standard techniques cannot be used to quantify multiple cells simultaneously.

Imaging techniques, on the other hand, do not interfere with neuronal function, provide

spatial resolution, and are able to simultaneously measure responses in multiple cells.

That said, Ca2+ imaging assays which are based on the use of Ca2+ binding dyes are

subject to such factors as dye loading efficiencies, compartmentalization and

photobleaching that can impact quantification.

For this study, the ratiometric fura-2 Ca2+ indicator was preferred over single

wave-length dyes such as fluo-4. In general, ratiometric dyes provide a number of

advantages including minimizing the effects of uneven dye distribution (i.e. dye loading

variations) and photobleaching since these factors would affect both measurements. To

prevent effects such as partial AM ester hydrolysis, the dye was loaded according to

manufacturer’s recommendations in regards to concentration, duration and time

required to hydrolyze. To minimize dye compartmentalization, assays were performed

within 60 minutes following dye loading. However, other factors that are difficult to

114

control for include uneven illumination intensity and optical path length, which may vary

across the field of view.

Another important aspect of OAG was its hydrophobicity, requiring solvation in

organic solvents with limited aqueous solubility in their own right and potential cytotoxic

effects at concentrations greater than 0.5 to 1%, such as the case for DMSO, which has

been widely used for this purpose. Although DMSO-vehicle controls were included to

account for any DMSO-mediated responses, difficulties in the delivery of hydrophobic

molecule such as OAG into aqueous medium are well known [354]. Moreover, OAG

undergoing micelle formation in aqueous solutions may result in lower than expected

free OAG concentrations to stimulate TRPC3 channels of cultured cells under assay. To

mitigate this characteristic of OAG, a standardized methodology was employed over all

treatment conditions.

In addition, there were several limitations and technical difficulties that were

encountered with the BD Pathway imaging system. First, although using a 20x objective

allowed for greater resolution, images were acquired using a 10x lens to ensure

approximately 100 cells or regions of interest (ROIs) were captured within the field of

view in control wells. Despite maximizing the field of view, cultures exposed to rotenone

exhibited significant cell death resulting in fewer ROIs per imaged field. Further, the

segmentation algorithm in the BD Attovision software used to define ROIs, the whole

cell polygon algorithm, captured only the neuronal soma and not the axonal or dendritic

projections. Lastly, due to the cytotoxic properties of DMSO, OAG was added at high

concentrations but low volumes. However, the robotics system of the Pathway does not

allow for accurate delivery of volumes less than 2μl into 96-well plates. As a result,

manual addition and mixing of OAG or DMSO was performed.

116

4.5 Future Studies

The results of this study provides evidence of ROS-mediated regulation of intracellular

Ca2+ signalling dynamics through TRPC channels which have been implicated in BD in

other work.

Within the scope of the current model, further replication of drug treatment would

be valuable in increasing the sample size and in turn statistical power of the study,

especially within the context of variables that are difficult to control such as inter-animal

variation. As mentioned in the previous section, use of a perturbation agent that induces

ROS at more physiologically relevant levels would be helpful to further understanding

the effect of chronic ROS on TRPC channel regulation and support the findings in this

study. Although inhibitors of mitochondrial complexes may be more suitable for long-

term studies compared to short lived species such as H2O2, these compounds are often

toxic and induce cell death in cell cultures. Additionally, testing a greater range of drug

concentrations could yield further insight into any concentration-dependent alterations in

expression and function. For instance, the findings in this study show a dose-dependent

reduction in TRPC channel protein expression and function. Similarly, expanding the

range of treatment duration could result in a better understanding of time-dependent

drug effects although it is limited by the toxic effects of ROS generation. Indeed, the

significant reductions in TRPC3, TRPC5, and TRPC6 protein levels after chronic but not

acute rotenone treatment support a model of time-dependent responses to oxidative

stress which aligns with the hypothesis that BD is a chronic relapsing illness involving

cellular pathophysiology developed over long periods of time.

117

The availability of RNAi procedures have also created an opportunity to generate

transient siRNA-mediated knockdown in cell lines which may compensate for a lack of

TRPC channel specific inhibitors and agonists. For example, transient TRPC6

knockdowns provide a potentially useful strategy to dissect the extent to which TRPC6

contributes to the rotenone induced changes in OAG activated Ca2+ influx. Despite the

flexibility in experimental design provided by RNAi strategies, they do not represent a

panacea and have several limitations including off-target effects, inefficacy, instability,

and may alter the physiological state of cells. However, in light of the lack of suitable

and specific pharmaceutical modulators, knockdown models provide a means to

circumvent this limitation. All together, primary rat cortical neuronal models can still

provide insight into possible pathways, targets of interaction, mechanisms, and impact

on cellular functions of chronic ROS exposure. Subsequently, greater understanding of

intricate cellular process may be useful in dissecting the underlying process in BD

pathophysiology.

In addition to primary rat cortical neurons, other potential human cellular models

can be explored within an oxidative stress environment. In the past, the non-invasive

procedures and relative ease in obtaining peripheral blood cells, and subsequent

transformed cell lines such as BLCLs, from patients and healthy controls made these

models preferable to post-mortem tissue. The obvious advantage to using BLCLs is the

ability to compare cells reporting aspects of the disease phenotype to cells from healthy

controls and further stratification of BD lines based on treatment response or various

cellular measurements can reduce the inherent disease heterogeneity. With huge

developments in the field of stem cell research, differentiated human neuronal lineages

such as olfactory-derived neural epithelial cells (ONes) or induced pluripotent stem cells

118

(iPS) are prospective models that may possess the greatest translational value due to

their species and cell-type relevance. Examining the expression profile and function of

TRPC channels after chronic oxidative stress in these models may provide further

insight into the mechanisms on the regulation of these channels by ROS in a cell and

disease relevant context. As suggested above, this can be achieved through the single

candidate approach, like in this study, or via high-throughput methodologies.

Beyond the expression and functional changes presented, a logical next step

would be to examine the mechanisms underlying regulation of TRPC gene expression,

especially TRPC3 and TRPC5 whose mRNA levels were found to be modulated by

ROS exposure in this study. One approach to this would be analyzing regions within

TRPC promoters for potential binding sites of known transcriptional factors that may be

responsive to ROS such as NF-κB and intracellular Ca2+ concentration including NFAT

in silico. Follow up assays utilizing partial promoter deletions, transfecting neurons with

promoter-reporter constructs and/or ChIP may confirm these results. A greater

understanding of these signal transduction cascades may shed light on the mechanisms

underlying the changes observed.

The question of the relationship between regulation of TRPC function and

expression should also be explored. For instance, is the reduced response to OAG after

chronic rotenone treatment a result of the decrease in TRPC3 and TRPC6 protein levels

or are the two alterations independent? Indeed, the findings that long-term oxidative

stress exposure modulates TRPC3 mRNA levels but not TRPC5 and TRPC6 levels may

imply that ROS-mediated regulation occurs at several levels and/or is TRPC subtype

dependent. The importance of de novo protein synthesis in contribution to the OAG

induced response can be assessed by inhibiting global protein synthesis. Protein

119

turnover is also another process that can be studied to understand the mechanism of

ROS regulation.

Finally, the idea of neuroprotective properties of TRPC3 and TRPC6 could be

further addressed in subsequent studies. As described earlier, TRPC knockdown and

overexpression systems can be a model to evaluate these properties. For instance,

comparing cell viability after oxidative stress among cell lines with a specific TRPC

subtype knockdown or overexpressed to control cell lines would be a simple way to

determine if TRPC channels impact cell viability. Concurrently, functional and

expression assays such as Ca2+ influx and immunoblotting can confirm the genetically

engineered state of these cell lines. However, these results must be taken into account

with limitations of RNAi approach such as possible alterations in the physiological state

of the cell.

120

4.6 Conclusions

The results of this study provide some novel insights into the regulation by chronic

oxidative stress of several TRPC channels thought to be involved in Ca2+

dyshomeostasis implicated in the pathophysiology of BD. It was found that chronic

rotenone treatment of primary rat cortical neurons resulted in differential regulation of

TRPC3, TRPC5 and TRPC6 at the mRNA level while significant dose-dependent

reductions in the protein levels were seen for all three subtypes. The observation of

downregulation of TRPC3 and TRPC6 protein levels following chronic but not acute

oxidative stress implies that a sequence of molecular events, possible adaptive to

increased ROS production, are activated from the transcriptional level that then reduces

expression in the case of TRPC3 or activates the expression of proteins involved in

protein degradation like in TRPC6. The reduction of TRPC3 and TRPC6 protein levels

was confirmed to impact the function of these channels when the functionality of at least

TRPC3 was found to be significantly reduced in a similar dose-dependent manner

following chronic rotenone treatment. Overall, these findings highlight a role of oxidative

stress on the regulation and/or function of these channels and that this regulation is

dependent on the duration of exposure to oxidative stressors. Finally, it was found that

a therapeutically relevant concentration of lithium was able to partially and selectively

rescue the rotenone-induced reductions in TRPC3 protein levels after chronic exposure

by lithium treatment. Whether this contributes to the therapeutic effect of lithium or is

simply an epiphenomenon side effect of lithium is largely unknown. Despite this, the

effect of lithium on TRPC3 protein levels following chronic rotenone treatment is a novel

121

finding and adds to the breadth of cellular actions of lithium and may be relevant to its

spectrum of action in the treatment of mood disorders.

In summary, the findings of this work support an important mechanistic link

between abnormal oxidative stress in neurons, these TRPC channels and the disruption

of Ca2+ homeostasis implicated in the pathophysiology of BD.

122

References

1. Kessler, R.C., et al., Lifetime prevalence and age-of-onset distributions of DSM-IV

disorders in the National Comorbidity Survey Replication. Arch Gen Psychiatry, 2005.

62(6): p. 593-602.

2. Fogarty, F., et al., Epidemiology of psychiatric disorders in Edmonton. Mania. Acta

Psychiatr Scand Suppl, 1994. 376: p. 16-23.

3. Bland, R.C., Epidemiology of affective disorders: a review. Can J Psychiatry, 1997.

42(4): p. 367-77.

4. Schneck, C.D., et al., Phenomenology of rapid-cycling bipolar disorder: data from the

first 500 participants in the Systematic Treatment Enhancement Program. Am J

Psychiatry, 2004. 161(10): p. 1902-8.

5. Grant, B.F., et al., Prevalence, correlates, and comorbidity of bipolar I disorder and axis

I and II disorders: results from the National Epidemiologic Survey on Alcohol and

Related Conditions. J Clin Psychiatry, 2005. 66(10): p. 1205-15.

6. Wittchen, H.U., et al., The size and burden of mental disorders and other disorders of the

brain in Europe 2010. Eur Neuropsychopharmacol. 21(9): p. 655-79.

7. Lopez, A.D. and C.C. Murray, The global burden of disease, 1990-2020. Nat Med, 1998.

4(11): p. 1241-3.

8. Fajutrao, L., et al., A systematic review of the evidence of the burden of bipolar disorder

in Europe. Clin Pract Epidemiol Ment Health, 2009. 5: p. 3.

9. McElroy, S.L., et al., Axis I psychiatric comorbidity and its relationship to historical

illness variables in 288 patients with bipolar disorder. Am J Psychiatry, 2001. 158(3): p.

420-6.

10. Kupfer, D.J., The increasing medical burden in bipolar disorder. JAMA, 2005. 293(20):

p. 2528-30.

11. Krishnan, K.R., Psychiatric and medical comorbidities of bipolar disorder. Psychosom

Med, 2005. 67(1): p. 1-8.

12. Kilbourne, A.M., et al., Concurrent psychiatric diagnoses by age and race among

persons with bipolar disorder. Psychiatr Serv, 2004. 55(8): p. 931-3.

13. Beyer, J.L., et al., Gray and white matter brain volumes in older adults with bipolar

disorder. Int J Geriatr Psychiatry, 2009. 24(12): p. 1445-52.

14. Goldstein, B.I., et al., Cardiovascular disease and hypertension among adults with

bipolar I disorder in the United States. Bipolar Disord, 2009. 11(6): p. 657-62.

123

15. Beyer, J.L., et al., Cortical white matter microstructural abnormalities in bipolar

disorder. Neuropsychopharmacology, 2005. 30(12): p. 2225-9.

16. Kemp, D.E., et al., Medical and substance use comorbidity in bipolar disorder. J Affect

Disord, 2009. 116(1-2): p. 64-9.

17. Beyer, J., et al., Medical comorbidity in a bipolar outpatient clinical population.

Neuropsychopharmacology, 2005. 30(2): p. 401-4.

18. Kodesh, A., et al., Epidemiology and comorbidity of severe mental illnesses in the

community: findings from a computerized mental health registry in a large Israeli health

organization. Soc Psychiatry Psychiatr Epidemiol.

19. Angst, F., et al., Mortality of patients with mood disorders: follow-up over 34-38 years. J

Affect Disord, 2002. 68(2-3): p. 167-81.

20. Paykel, E.S. and P. Freeling, Treatment of depression in primary care. BMJ, 1992.

304(6838): p. 1380-1.

21. Paykel, E.S. and R.G. Priest, Recognition and management of depression in general

practice: consensus statement. BMJ, 1992. 305(6863): p. 1198-202.

22. Thompson, W.K., et al., Prevalence and clinical correlates of medical comorbidities in

patients with bipolar I disorder: analysis of acute-phase data from a randomized

controlled trial. J Clin Psychiatry, 2006. 67(5): p. 783-8.

23. Malhi, G.S., et al., Neuropsychological deficits and functional impairment in bipolar

depression, hypomania and euthymia. Bipolar Disord, 2007. 9(1-2): p. 114-25.

24. Martinez-Aran, A., et al., Cognitive function across manic or hypomanic, depressed, and

euthymic states in bipolar disorder. Am J Psychiatry, 2004. 161(2): p. 262-70.

25. Sanchez-Morla, E.M., et al., Comparative study of neurocognitive function in euthymic

bipolar patients and stabilized schizophrenic patients. Psychiatry Res, 2009. 169(3): p.

220-8.

26. Schretlen, D.J., et al., Neuropsychological functioning in bipolar disorder and

schizophrenia. Biol Psychiatry, 2007. 62(2): p. 179-86.

27. Mur, M., et al., Persistent neuropsychological deficit in euthymic bipolar patients:

executive function as a core deficit. J Clin Psychiatry, 2007. 68(7): p. 1078-86.

28. Dilsaver, S.C., An estimate of the minimum economic burden of bipolar I and II disorders

in the United States: 2009. J Affect Disord. 129(1-3): p. 79-83.

29. Yatham, L.N., et al., Canadian Network for Mood and Anxiety Treatments (CANMAT)

guidelines for the management of patients with bipolar disorder: consensus and

controversies. Bipolar Disord, 2005. 7 Suppl 3: p. 5-69.

124

30. Freeman, M.P. and S.A. Freeman, Lithium: clinical considerations in internal medicine.

Am J Med, 2006. 119(6): p. 478-81.

31. Bowden, C.L., et al., Efficacy of divalproex vs lithium and placebo in the treatment of

mania. The Depakote Mania Study Group. JAMA, 1994. 271(12): p. 918-24.

32. Malhi, G.S., D. Adams, and M. Berk, Medicating mood with maintenance in mind:

bipolar depression pharmacotherapy. Bipolar Disord, 2009. 11 Suppl 2: p. 55-76.

33. Macritchie, K., et al., Valproate for acute mood episodes in bipolar disorder. Cochrane

Database Syst Rev, 2003(1): p. CD004052.

34. Rzany, B., et al., Risk of Stevens-Johnson syndrome and toxic epidermal necrolysis

during first weeks of antiepileptic therapy: a case-control study. Study Group of the

International Case Control Study on Severe Cutaneous Adverse Reactions. Lancet, 1999.

353(9171): p. 2190-4.

35. Vasudev, K., et al., Topiramate for acute affective episodes in bipolar disorder. Cochrane

Database Syst Rev, 2006(1): p. CD003384.

36. Calabrese, J.R., et al., A randomized, double-blind, placebo-controlled trial of quetiapine

in the treatment of bipolar I or II depression. Am J Psychiatry, 2005. 162(7): p. 1351-60.

37. Tohen, M., et al., Efficacy of olanzapine and olanzapine-fluoxetine combination in the

treatment of bipolar I depression. Arch Gen Psychiatry, 2003. 60(11): p. 1079-88.

38. Corya, S.A., et al., A randomized, double-blind comparison of olanzapine/fluoxetine

combination, olanzapine, fluoxetine, and venlafaxine in treatment-resistant depression.

Depress Anxiety, 2006. 23(6): p. 364-72.

39. Sachs, G.S., et al., Effectiveness of adjunctive antidepressant treatment for bipolar

depression. N Engl J Med, 2007. 356(17): p. 1711-22.

40. Tohen, M., et al., A 12-week, double-blind comparison of olanzapine vs haloperidol in

the treatment of acute mania. Arch Gen Psychiatry, 2003. 60(12): p. 1218-26.

41. Agid, O., et al., Environment and vulnerability to major psychiatric illness: a case

control study of early parental loss in major depression, bipolar disorder and

schizophrenia. Mol Psychiatry, 1999. 4(2): p. 163-72.

42. Alloy, L.B., et al., The psychosocial context of bipolar disorder: environmental,

cognitive, and developmental risk factors. Clin Psychol Rev, 2005. 25(8): p. 1043-75.

43. Nurnberger, J.I., Jr. and T. Foroud, Genetics of bipolar affective disorder. Curr

Psychiatry Rep, 2000. 2(2): p. 147-57.

44. Sachs, G.S., J.M. Dupuy, and C.W. Wittmann, The pharmacologic treatment of bipolar

disorder. J Clin Psychiatry. 72(5): p. 704-15.

125

45. Konarski, J.Z., et al., Neuroimaging approaches in mood disorders: technique and

clinical implications. Ann Clin Psychiatry, 2007. 19(4): p. 265-77.

46. Brooks, J.O., 3rd, et al., Dorsolateral and dorsomedial prefrontal gray matter density

changes associated with bipolar depression. Psychiatry Res, 2009. 172(3): p. 200-4.

47. Moorhead, T.W., et al., Progressive gray matter loss in patients with bipolar disorder.

Biol Psychiatry, 2007. 62(8): p. 894-900.

48. Ha, T.H., et al., Regional brain gray matter abnormalities in patients with bipolar II

disorder: a comparison study with bipolar I patients and healthy controls. Neurosci Lett,

2009. 456(1): p. 44-8.

49. Nugent, A.C., et al., Cortical abnormalities in bipolar disorder investigated with MRI

and voxel-based morphometry. Neuroimage, 2006. 30(2): p. 485-97.

50. Lyoo, I.K., et al., Frontal lobe gray matter density decreases in bipolar I disorder. Biol

Psychiatry, 2004. 55(6): p. 648-51.

51. Koo, M.S., et al., A cross-sectional and longitudinal magnetic resonance imaging study

of cingulate gyrus gray matter volume abnormalities in first-episode schizophrenia and

first-episode affective psychosis. Arch Gen Psychiatry, 2008. 65(7): p. 746-60.

52. Haznedar, M.M., et al., Fronto-thalamo-striatal gray and white matter volumes and

anisotropy of their connections in bipolar spectrum illnesses. Biol Psychiatry, 2005.

57(7): p. 733-42.

53. McDonald, C., et al., Regional volume deviations of brain structure in schizophrenia and

psychotic bipolar disorder: computational morphometry study. Br J Psychiatry, 2005.

186: p. 369-77.

54. Chen, H.H., et al., Abnormal left superior temporal gyrus volumes in children and

adolescents with bipolar disorder: a magnetic resonance imaging study. Neurosci Lett,

2004. 363(1): p. 65-8.

55. Rosso, I.M., et al., Reduced amygdala volumes in first-episode bipolar disorder and

correlation with cerebral white matter. Biol Psychiatry, 2007. 61(6): p. 743-9.

56. Davis, K.A., et al., Decreased cortical gray and cerebral white matter in male patients

with familial bipolar I disorder. J Affect Disord, 2004. 82(3): p. 475-85.

57. Jeerakathil, T., et al., Stroke risk profile predicts white matter hyperintensity volume: the

Framingham Study. Stroke, 2004. 35(8): p. 1857-61.

58. Kempton, M.J., et al., Meta-analysis, database, and meta-regression of 98 structural

imaging studies in bipolar disorder. Arch Gen Psychiatry, 2008. 65(9): p. 1017-32.

59. Moore, P.B., et al., Cerebral white matter lesions in bipolar affective disorder:

relationship to outcome. Br J Psychiatry, 2001. 178: p. 172-6.

126

60. Gulseren, S., et al., T2 hyperintensities in bipolar patients and their healthy siblings.

Arch Med Res, 2006. 37(1): p. 79-85.

61. Regenold, W.T., et al., Relationship of cerebrospinal fluid glucose metabolites to MRI

deep white matter hyperintensities and treatment resistance in bipolar disorder patients.

Bipolar Disord, 2008. 10(7): p. 753-64.

62. Ongur, D., W.C. Drevets, and J.L. Price, Glial reduction in the subgenual prefrontal

cortex in mood disorders. Proc Natl Acad Sci U S A, 1998. 95(22): p. 13290-5.

63. Rajkowska, G., A. Halaris, and L.D. Selemon, Reductions in neuronal and glial density

characterize the dorsolateral prefrontal cortex in bipolar disorder. Biol Psychiatry,

2001. 49(9): p. 741-52.

64. Rajkowska, G., Cell pathology in bipolar disorder. Bipolar Disord, 2002. 4(2): p. 105-16.

65. Manji, H.K., et al., Neuroplasticity and cellular resilience in mood disorders. Mol

Psychiatry, 2000. 5(6): p. 578-593.

66. Benes, F.M., S.L. Vincent, and M. Todtenkopf, The density of pyramidal and

nonpyramidal neurons in anterior cingulate cortex of schizophrenic and bipolar subjects.


67. Bezchlibnyk, Y.B., et al., Neuron somal size is decreased in the lateral amygdalar

nucleus of subjects with bipolar disorder. J Psychiatry Neurosci, 2007. 32(3): p. 203-10.

68. Chana, G., et al., Two-dimensional assessment of cytoarchitecture in the anterior

cingulate cortex in major depressive disorder, bipolar disorder, and schizophrenia:

evidence for decreased neuronal somal size and increased neuronal density. Biol

Psychiatry, 2003. 53(12): p. 1086-98.

69. Guimaraes, A.R., et al., Quantitative in vivo 1H nuclear magnetic resonance

spectroscopic imaging of neuronal loss in rat brain. Neuroscience, 1995. 69(4): p. 1095-

1101.

70. Urenjak, J., et al., Proton nuclear magnetic resonance spectroscopy unambiguously

identifies different neural cell types. J Neurosci, 1993. 13(3): p. 981-9.

71. Molina, V., et al., Dorsolateral prefrontal N-acetyl-aspartate concentration in male

patients with chronic schizophrenia and with chronic bipolar disorder. Eur Psychiatry,

2007. 22(8): p. 505-12.

72. Winsberg, M.E., et al., Decreased dorsolateral prefrontal N-acetyl aspartate in bipolar

disorder. Biol Psychiatry, 2000. 47(6): p. 475-81.

73. Atmaca, M., et al., Hippocampal 1H MRS in first-episode bipolar I patients. Prog

Neuropsychopharmacol Biol Psychiatry, 2006. 30(7): p. 1235-9.

127

74. Scherk, H., et al., Neurochemical pathology in hippocampus in euthymic patients with

bipolar I disorder. Acta Psychiatr Scand, 2008. 117(4): p. 283-8.

75. Chang, K., et al., Decreased N-acetylaspartate in children with familial bipolar disorder.


76. Olvera, R.L., et al., Low levels of N-acetyl aspartate in the left dorsolateral prefrontal

cortex of pediatric bipolar patients. J Child Adolesc Psychopharmacol, 2007. 17(4): p.

461-73.

77. Schloesser, R.J., et al., Cellular plasticity cascades in the pathophysiology and treatment

of bipolar disorder. Neuropsychopharmacology, 2008. 33(1): p. 110-33.

78. Naydenov, A.V., et al., Differences in lymphocyte electron transport gene expression

levels between subjects with bipolar disorder and normal controls in response to glucose

deprivation stress. Arch Gen Psychiatry, 2007. 64(5): p. 555-64.

79. McCurdy, R.D., et al., Cell cycle alterations in biopsied olfactory neuroepithelium in

schizophrenia and bipolar I disorder using cell culture and gene expression analyses.

Schizophr Res, 2006. 82(2-3): p. 163-73.

80. Irvine, R.F., et al., The regulation and function of inositol 1,4,5-trisphosphate 3-kinases.

Adv Enzyme Regul, 2006. 46: p. 314-23.

81. Johnson, H.W. and M.J. Schell, Neuronal IP3 3-kinase is an F-actin-bundling protein:

role in dendritic targeting and regulation of spine morphology. Mol Biol Cell, 2009.

20(24): p. 5166-80.

82. Craddock, N. and P. Sklar, Genetics of bipolar disorder: successful start to a long

journey. Trends Genet, 2009. 25(2): p. 99-105.

83. Craddock, N. and I. Jones, Genetics of bipolar disorder. J Med Genet, 1999. 36(8): p.

585-94.

84. McQuillin, A., et al., Fine mapping of a susceptibility locus for bipolar and genetically

related unipolar affective disorders, to a region containing the C21ORF29 and TRPM2

genes on chromosome 21q22.3. Mol Psychiatry, 2006. 11(2): p. 134-42.

85. Xu, C., et al., Association of the putative susceptibility gene, transient receptor potential

protein melastatin type 2, with bipolar disorder. Am J Med Genet B Neuropsychiatr

Genet, 2006. 141B(1): p. 36-43.

86. Xu, C., et al., TRPM2 variants and bipolar disorder risk: confirmation in a family-based

association study. Bipolar Disord, 2009. 11(1): p. 1-10.

87. McQueen, M.B., et al., Combined analysis from eleven linkage studies of bipolar

disorder provides strong evidence of susceptibility loci on chromosomes 6q and 8q. Am J

Hum Genet, 2005. 77(4): p. 582-95.

128

88. Badner, J.A. and E.S. Gershon, Meta-analysis of whole-genome linkage scans of bipolar

disorder and schizophrenia. Mol Psychiatry, 2002. 7(4): p. 405-11.

89. Hattori, E., et al., Polymorphisms at the G72/G30 gene locus, on 13q33, are associated

with bipolar disorder in two independent pedigree series. Am J Hum Genet, 2003. 72(5):

p. 1131-40.

90. Chen, Y.S., et al., Findings in an independent sample support an association between

bipolar affective disorder and the G72/G30 locus on chromosome 13q33. Mol

Psychiatry, 2004. 9(1): p. 87-92; image 5.

91. Schumacher, J., et al., Examination of G72 and D-amino-acid oxidase as genetic risk

factors for schizophrenia and bipolar affective disorder. Mol Psychiatry, 2004. 9(2): p.

203-7.

92. Shi, J., et al., Allelic association of G72/G30 with schizophrenia and bipolar disorder: a

comprehensive meta-analysis. Schizophr Res, 2008. 98(1-3): p. 89-97.

93. Thomson, P.A., et al., Association of Neuregulin 1 with schizophrenia and bipolar

disorder in a second cohort from the Scottish population. Mol Psychiatry, 2007. 12(1): p.

94-104.

94. Munafo, M.R., A.S. Attwood, and J. Flint, Neuregulin 1 genotype and schizophrenia.

Schizophr Bull, 2008. 34(1): p. 9-12.

95. Sklar, P., et al., Family-based association study of 76 candidate genes in bipolar

disorder: BDNF is a potential risk locus. Brain-derived neutrophic factor. Mol

Psychiatry, 2002. 7(6): p. 579-93.

96. Hirschhorn, J.N., Genetic approaches to studying common diseases and complex traits.

Pediatr Res, 2005. 57(5 Pt 2): p. 74R-77R.

97. McCarthy, M.I., et al., Genome-wide association studies for complex traits: consensus,

uncertainty and challenges. Nat Rev Genet, 2008. 9(5): p. 356-69.

98. Ferreira, M.A., et al., Collaborative genome-wide association analysis supports a role for

ANK3 and CACNA1C in bipolar disorder. Nat Genet, 2008. 40(9): p. 1056-8.

99. Baum, A.E., et al., A genome-wide association study implicates diacylglycerol kinase eta

(DGKH) and several other genes in the etiology of bipolar disorder. Mol Psychiatry,

2008. 13(2): p. 197-207.

100. Sklar, P., et al., Whole-genome association study of bipolar disorder. Mol Psychiatry,

2008. 13(6): p. 558-69.

101. Genome-wide association study of 14,000 cases of seven common diseases and 3,000

shared controls. Nature, 2007. 447(7145): p. 661-78.

129

102. Baum, A.E., et al., Meta-analysis of two genome-wide association studies of bipolar

disorder reveals important points of agreement. Mol Psychiatry, 2008. 13(5): p. 466-7.

103. Gargus, J.J., Ion channel functional candidate genes in multigenic neuropsychiatric

disease. Biol Psychiatry, 2006. 60(2): p. 177-85.

104. Distelhorst, C.W. and M.D. Bootman, Bcl-2 interaction with the inositol 1,4,5-

trisphosphate receptor: role in Ca(2+) signaling and disease. Cell Calcium. 50(3): p.

234-41.

105. Chipuk, J.E., et al., The BCL-2 family reunion. Mol Cell. 37(3): p. 299-310.

106. Chen, R., et al., Bcl-2 functionally interacts with inositol 1,4,5-trisphosphate receptors to

regulate calcium release from the ER in response to inositol 1,4,5-trisphosphate. J Cell

Biol, 2004. 166(2): p. 193-203.

107. Rapoport, S.I., et al., Bipolar disorder and mechanisms of action of mood stabilizers.

Brain Res Rev, 2009. 61(2): p. 185-209.

108. Kim, H.W., S.I. Rapoport, and J.S. Rao, Altered expression of apoptotic factors and

synaptic markers in postmortem brain from bipolar disorder patients. Neurobiol Dis.

37(3): p. 596-603.

109. Machado-Vieira, R., et al., The Bcl-2 gene polymorphism rs956572AA increases inositol

1,4,5-trisphosphate receptor-mediated endoplasmic reticulum calcium release in subjects

with bipolar disorder. Biol Psychiatry. 69(4): p. 344-52.

110. Fisar, Z. and J. Hroudova, Intracellular signalling pathways and mood disorders. Folia

Biol (Praha). 56(4): p. 135-48.

111. Chiu, C.T. and D.M. Chuang, Neuroprotective action of lithium in disorders of the

central nervous system. Zhong Nan Da Xue Xue Bao Yi Xue Ban. 36(6): p. 461-76.

112. Zhang, F., et al., Inhibitory phosphorylation of glycogen synthase kinase-3 (GSK-3) in

response to lithium. Evidence for autoregulation of GSK-3. J Biol Chem, 2003. 278(35):

p. 33067-77.

113. Klein, P.S. and D.A. Melton, A molecular mechanism for the effect of lithium on

development. Proc Natl Acad Sci U S A, 1996. 93(16): p. 8455-9.

114. O'Brien, W.T. and P.S. Klein, Validating GSK3 as an in vivo target of lithium action.

Biochem Soc Trans, 2009. 37(Pt 5): p. 1133-8.

115. Gould, T.D. and H.K. Manji, Glycogen synthase kinase-3: a putative molecular target for

lithium mimetic drugs. Neuropsychopharmacology, 2005. 30(7): p. 1223-1237.

116. Wada, T. and J.M. Penninger, Mitogen-activated protein kinases in apoptosis regulation.

Oncogene, 2004. 23(16): p. 2838-49.

130

117. Fukumoto, T., et al., Chronic lithium treatment increases the expression of brain-derived

neurotrophic factor in the rat brain. Psychopharmacology (Berl), 2001. 158(1): p. 100-6.

118. Chen, G., et al., The mood-stabilizing agents lithium and valproate robustly increase the

levels of the neuroprotective protein bcl-2 in the CNS. J Neurochem, 1999. 72(2): p. 879-

82.

119. Einat, H., et al., Possible involvement of the ERK signaling cascade in bipolar disorder:

behavioral leads from the study of mutant mice. Drug News Perspect, 2003. 16(7): p.

453-63.

120. Einat, H., et al., The role of the extracellular signal-regulated kinase signaling pathway

in mood modulation. J Neurosci, 2003. 23(19): p. 7311-6.

121. Yuan, P.X., et al., The mood stabilizer valproic acid activates mitogen-activated protein

kinases and promotes neurite growth. J Biol Chem, 2001. 276(34): p. 31674-83.

122. Langan, C. and C. McDonald, Neurobiological trait abnormalities in bipolar disorder.

Mol Psychiatry, 2009. 14(9): p. 833-846.

123. Rhee, S.G., Regulation of phosphoinositide-specific phospholipase C. Annu Rev

Biochem, 2001. 70: p. 281-312.

124. Wing, M.R., et al., Direct activation of phospholipase C-epsilon by Rho. J Biol Chem,

2003. 278(42): p. 41253-8.

125. Bezchlibnyk, Y. and L.T. Young, The neurobiology of bipolar disorder: focus on signal

transduction pathways and the regulation of gene expression. Can J Psychiatry, 2002.

47(2): p. 135-48.

126. Hofmann, T., et al., Direct activation of human TRPC6 and TRPC3 channels by

diacylglycerol. Nature, 1999. 397(6716): p. 259-263.

127. Brown, A.S., A.G. Mallinger, and L.C. Renbaum, Elevated platelet membrane

phosphatidylinositol-4,5-bisphosphate in bipolar mania. Am J Psychiatry, 1993. 150(8):

p. 1252-4.

128. Soares, J.C., et al., Increased platelet membrane phosphatidylinositol-4,5-bisphosphate in

drug-free depressed bipolar patients. Neurosci Lett, 2001. 299(1-2): p. 150-2.

129. Friedman, E., et al., Altered platelet protein kinase C activity in bipolar affective

disorder, manic episode. Biol Psychiatry, 1993. 33(7): p. 520-5.

130. Wang, H.Y. and E. Friedman, Enhanced protein kinase C activity and translocation in

bipolar affective disorder brains. Biol Psychiatry, 1996. 40(7): p. 568-75.

131. Soares, J.C., et al., Effects of lithium on platelet membrane phosphoinositides in bipolar

disorder patients: a pilot study. Psychopharmacology (Berl), 2000. 149(1): p. 12-6.

131

132. Quiroz, J.A., et al., Emerging experimental therapeutics for bipolar disorder: clues from

the molecular pathophysiology. Mol Psychiatry, 2004. 9(8): p. 756-776.

133. Young, L.T., D. Bakish, and S. Beaulieu, The neurobiology of treatment response to

antidepressants and mood stabilizing medications. J Psychiatry Neurosci, 2002. 27(4): p.

260-5.

134. Young, L.T., et al., Postmortem cerebral cortex Gs alpha-subunit levels are elevated in

bipolar affective disorder. Brain Res, 1991. 553(2): p. 323-6.

135. Young, L.T., et al., Cerebral cortex Gs alpha protein levels and forskolin-stimulated

cyclic AMP formation are increased in bipolar affective disorder. J Neurochem, 1993.

61(3): p. 890-8.

136. Young, L.T., et al., Stimulatory G-protein alpha-subunit mRNA levels are not increased

in autopsied cerebral cortex from patients with bipolar disorder. Brain Res Mol Brain

Res, 1996. 42(1): p. 45-50.

137. Dowlatshahi, D., et al., G Protein-coupled cyclic AMP signaling in postmortem brain of

subjects with mood disorders: effects of diagnosis, suicide, and treatment at the time of

death. J Neurochem, 1999. 73(3): p. 1121-6.

138. Young, L.T., et al., Cerebral cortex beta-adrenoceptor binding in bipolar affective

disorder. J Affect Disord, 1994. 30(2): p. 89-92.

139. Spleiss, O., et al., Abnormal G protein alpha(s) - and alpha(i2)-subunit mRNA expression

in bipolar affective disorder. Mol Psychiatry, 1998. 3(6): p. 512-20.

140. Manji, H.K., et al., Guanine nucleotide-binding proteins in bipolar affective disorder.

Effects of long-term lithium treatment. Arch Gen Psychiatry, 1995. 52(2): p. 135-44.

141. Mitchell, P.B., et al., High levels of Gs alpha in platelets of euthymic patients with

bipolar affective disorder. Am J Psychiatry, 1997. 154(2): p. 218-23.

142. Karege, F., et al., Lithium and haloperidol treatments differently affect the mononuclear

leukocyte Galphas protein levels in bipolar affective disorder. Neuropsychobiology,

1999. 39(4): p. 181-6.

143. Alda, M., et al., Is lithium response related to G(s)alpha levels in transformed

lymphoblasts from subjects with bipolar disorder? J Affect Disord, 2001. 65(2): p. 117-

22.

144. Rahman, S., et al., Reduced [3H]cyclic AMP binding in postmortem brain from subjects

with bipolar affective disorder. J Neurochem, 1997. 68(1): p. 297-304.

145. Reiach, J.S., et al., Reduced adenylyl cyclase immunolabeling and activity in postmortem

temporal cortex of depressed suicide victims. J Affect Disord, 1999. 56(2-3): p. 141-51.

132

146. Fields, A., et al., Increased cyclic AMP-dependent protein kinase activity in postmortem

brain from patients with bipolar affective disorder. J Neurochem, 1999. 73(4): p. 1704-

10.

147. Tardito, D., et al., Protein kinase A activity in platelets from patients with bipolar

disorder. J Affect Disord, 2003. 76(1-3): p. 249-53.

148. Karege, F., et al., The cAMP-dependent protein kinase A and brain-derived neurotrophic

factor expression in lymphoblast cells of bipolar affective disorder. J Affect Disord,

2004. 79(1-3): p. 187-92.

149. Karege, F., M. Schwald, and R. El Kouaissi, Drug-induced decrease of protein kinase a

activity reveals alteration in BDNF expression of bipolar affective disorder.

Neuropsychopharmacology, 2004. 29(4): p. 805-12.

150. Siever, L.J., et al., Platelet alpha-adrenergic binding and biochemical responsiveness in

depressed patients and controls. Psychiatry Res, 1984. 11(4): p. 287-302.

151. Mann, J.J., et al., Reduced sensitivity of lymphocyte beta-adrenergic receptors in patients

with endogenous depression and psychomotor agitation. N Engl J Med, 1985. 313(12): p.

715-20.

152. Halper, J.P., et al., Blunted beta-adrenergic responsivity of peripheral blood

mononuclear cells in endogenous depression. Isoproterenol dose-response studies. Arch

Gen Psychiatry, 1988. 45(3): p. 241-4.

153. Ebstein, R.P., et al., Effect of lithium in vitro and after chronic treatment on human

platelet adenylate cyclase activity: postreceptor modification of second messenger signal

amplification. Psychiatry Res, 1987. 21(3): p. 221-8.

154. Ebstein, R.P., et al., Cyclic AMP second-messenger signal amplification in depression. Br

J Psychiatry, 1988. 152: p. 665-9.

155. Schreiber, G., et al., Hyperfunctional G proteins in mononuclear leukocytes of patients

with mania. Biol Psychiatry, 1991. 29(3): p. 273-80.

156. Zanardi, R., et al., Differential effects of lithium on platelet protein phosphorylation in

bipolar patients and healthy subjects. Psychopharmacology (Berl), 1997. 129(1): p. 44-7.

157. Perez, J., et al., Abnormalities of cyclic adenosine monophosphate signaling in platelets

from untreated patients with bipolar disorder. Arch Gen Psychiatry, 1999. 56(3): p. 248-

53.

158. Spitzer, N.C., Electrical activity in early neuronal development. Nature, 2006.

444(7120): p. 707-12.

159. Berridge, M.J., Neuronal calcium signaling. Neuron, 1998. 21(1): p. 13-26.

133

160. Mattson, M.P. and S.L. Chan, Calcium orchestrates apoptosis. Nat Cell Biol, 2003.

5(12): p. 1041-3.

161. Carafoli, E., Calcium signaling: a tale for all seasons. Proc Natl Acad Sci U S A, 2002.

99(3): p. 1115-22.

162. McCue, H.V., L.P. Haynes, and R.D. Burgoyne, The diversity of calcium sensor proteins

in the regulation of neuronal function. Cold Spring Harb Perspect Biol. 2(8): p. a004085.

163. Weston, P.G., Howard M.Q., The determination of Na, J, Ca, and MG in the blood and

spinal fluid of patients suffering from manic-depressive insanity. Arch Neurol Psychiatry,

1922. 8.

164. Meltzer, H.L., et al., Calmodulin-activated calcium ATPase in bipolar illness.

Neuropsychobiology, 1988. 20(4): p. 169-73.

165. Linnoila, M., et al., RBC membrane adenosine triphosphatase activities in patients with

major affective disorders. Arch Gen Psychiatry, 1983. 40(9): p. 1021-6.

166. MacDonald, E., D. Rubinow, and M. Linnoila, Sensitivity of RBC membrane Ca2+-

adenosine triphosphatase to calmodulin stimulation. Variations in patients with bipolar

affective disorders. Arch Gen Psychiatry, 1984. 41(5): p. 487-93.

167. Bowden, C.L., et al., Calcium function in affective disorders and healthy controls. Biol

Psychiatry, 1988. 23(4): p. 367-76.

168. Dubovsky, S.L., et al., Increased platelet intracellular calcium concentration in patients

with bipolar affective disorders. Arch Gen Psychiatry, 1989. 46(7): p. 632-8.

169. Tan, C.H., et al., Effects of lithium on platelet ionic intracellular calcium concentration

in patients with bipolar (manic-depressive) disorder and healthy controls. Life Sci, 1990.

46(16): p. 1175-80.

170. Berk, B.C., et al., Protein kinases as mediators of fluid shear stress stimulated signal

transduction in endothelial cells: a hypothesis for calcium-dependent and calcium-

independent events activated by flow. J Biomech, 1995. 28(12): p. 1439-50.

171. Hough, C., et al., Elevated basal and thapsigargin-stimulated intracellular calcium of

platelets and lymphocytes from bipolar affective disorder patients measured by a

fluorometric microassay. Biol Psychiatry, 1999. 46(2): p. 247-55.

172. Dubovsky, S.L., et al., Intracellular calcium signalling in peripheral cells of patients with

bipolar affective disorder. Eur Arch Psychiatry Clin Neurosci, 1994. 243(5): p. 229-34.

173. Eckert, A., et al., Platelet and lymphocyte free intracellular calcium in affective

disorders. Eur Arch Psychiatry Clin Neurosci, 1994. 243(5): p. 235-9.

134

174. Emamghoreishi, M., et al., High intracellular calcium concentrations in transformed

lymphoblasts from subjects with bipolar I disorder. Am J Psychiatry, 1997. 154(7): p.

976-82.

175. Kato, T., et al., Mechanisms of altered Ca2+ signalling in transformed lymphoblastoid

cells from patients with bipolar disorder. Int J Neuropsychopharmacol, 2003. 6(4): p.

379-89.

176. El Khoury, A., et al., Calcium homeostasis in long-term lithium-treated women with

bipolar affective disorder. Prog Neuropsychopharmacol Biol Psychiatry, 2002. 26(6): p.

1063-9.

177. Chen, Y. and L. Hertz, Inhibition of noradrenaline stimulated increase in [Ca2+]i in

cultured astrocytes by chronic treatment with a therapeutically relevant lithium

concentration. Brain Res, 1996. 711(1-2): p. 245-8.

178. Varney, M.A., et al., Chronic lithium treatment inhibits basal and agonist-stimulated

responses in rat cerebral cortex and GH3 pituitary cells. Mol Pharmacol, 1992. 42(4): p.

671-8.

179. Yamaji, T., et al., Chronic treatment with antidepressants, verapamil, or lithium inhibits

the serotonin-induced intracellular calcium response in individual C6 rat glioma cells.

Life Sci, 1997. 60(11): p. 817-23.

180. Kagaya, A., et al., Lithium chloride inhibits thrombin-induced intracellular calcium

mobilization in C6 rat glioma cells. Prog Neuropsychopharmacol Biol Psychiatry, 2000.

24(1): p. 85-95.

181. Nonaka, S., C.J. Hough, and D.M. Chuang, Chronic lithium treatment robustly protects

neurons in the central nervous system against excitotoxicity by inhibiting N-methyl-D-

aspartate receptor-mediated calcium influx. Proc Natl Acad Sci U S A, 1998. 95(5): p.

2642-7.

182. Dubovsky, S.L., et al., Elevated platelet intracellular calcium concentration in bipolar

depression. Biol Psychiatry, 1991. 29(5): p. 441-50.

183. Wasserman, M., Warsh, J., Hyperactive intracellular calcium mobilization in B

lymphoblasts from patients with bipolar I disorder. Biol Psychiatry, 2003. 53 (Suppl).

184. Perova, T., et al., Hyperactive intracellular calcium dynamics in B lymphoblasts from

patients with bipolar I disorder. Int J Neuropsychopharmacol, 2008. 11(2): p. 185-96.

185. Wasserman, M.J., et al., Chronic lithium treatment attenuates intracellular calcium

mobilization. Neuropsychopharmacology, 2004. 29(4): p. 759-69.

186. Andreopoulos, S., Wasserman, M.J., Li, P.P., Warsh, J.J., Bipolar disorder-specific

reduction of transient receptor potential channel-3 levels in B-lymphocytes exposed to

chronically to lithium. Bipolar Disord, 2003. 5.

135

187. Adam-Vizi, V., Production of reactive oxygen species in brain mitochondria:

contribution by electron transport chain and non-electron transport chain sources.

Antioxid Redox Signal, 2005. 7(9-10): p. 1140-9.

188. Taylor, J.M. and P.J. Crack, Impact of oxidative stress on neuronal survival. Clin Exp

Pharmacol Physiol, 2004. 31(7): p. 397-406.

189. Chance, B., H. Sies, and A. Boveris, Hydroperoxide metabolism in mammalian organs.

Physiol Rev, 1979. 59(3): p. 527-605.

190. Maher, P., Redox control of neural function: background, mechanisms, and significance.

Antioxid Redox Signal, 2006. 8(11-12): p. 1941-70.

191. Cochrane, C.G., Mechanisms of oxidant injury of cells. Mol Aspects Med, 1991. 12(2): p.

137-47.

192. de Vasconcelos, A.P., et al., Role of nitric oxide in cerebral blood flow changes during

kainate seizures in mice: genetic and pharmacological approaches. Neurobiol Dis, 2005.

18(2): p. 270-81.

193. Murphy, M.P., How mitochondria produce reactive oxygen species. Biochem J, 2009.

417(1): p. 1-13.

194. Fernandez-Fernandez, S., A. Almeida, and J.P. Bolanos, Antioxidant and bioenergetic

coupling between neurons and astrocytes. Biochem J. 443(1): p. 3-11.

195. Halliwell, B., Oxidative stress and neurodegeneration: where are we now? J Neurochem,

2006. 97(6): p. 1634-58.

196. Kapczinski, F., et al., Increased oxidative stress as a mechanism for decreased BDNF

levels in acute manic episodes. Rev Bras Psiquiatr, 2008. 30(3): p. 243-5.

197. Floyd, R.A., Antioxidants, oxidative stress, and degenerative neurological disorders.

Proc Soc Exp Biol Med, 1999. 222(3): p. 236-45.

198. Zaleska, M.M. and R.A. Floyd, Regional lipid peroxidation in rat brain in vitro: possible

role of endogenous iron. Neurochem Res, 1985. 10(3): p. 397-410.

199. Thomsen, L.L., et al., Nitric oxide synthase activity in human gynecological cancer.

Cancer Res, 1994. 54(5): p. 1352-4.

200. Garthwaite, J., S.L. Charles, and R. Chess-Williams, Endothelium-derived relaxing factor

release on activation of NMDA receptors suggests role as intercellular messenger in the

brain. Nature, 1988. 336(6197): p. 385-8.

201. Schulz, J.B., R.T. Matthews, and M.F. Beal, Role of nitric oxide in neurodegenerative

diseases. Curr Opin Neurol, 1995. 8(6): p. 480-6.

136

202. Beckman, J.S., et al., Apparent hydroxyl radical production by peroxynitrite:

implications for endothelial injury from nitric oxide and superoxide. Proc Natl Acad Sci

U S A, 1990. 87(4): p. 1620-4.

203. Beckman, J.S., et al., ALS, SOD and peroxynitrite. Nature, 1993. 364(6438): p. 584.

204. Zhang, J., et al., Nitric oxide activation of poly(ADP-ribose) synthetase in neurotoxicity.

Science, 1994. 263(5147): p. 687-9.

205. Radi, R., et al., Peroxynitrite-induced membrane lipid peroxidation: the cytotoxic

potential of superoxide and nitric oxide. Arch Biochem Biophys, 1991. 288(2): p. 481-7.

206. Radi, R., et al., Peroxynitrite oxidation of sulfhydryls. The cytotoxic potential of

superoxide and nitric oxide. J Biol Chem, 1991. 266(7): p. 4244-50.

207. Kuloglu, M., et al., Lipid peroxidation and antioxidant enzyme levels in patients with

schizophrenia and bipolar disorder. Cell Biochem Funct, 2002. 20(2): p. 171-5.

208. Ranjekar, P.K., et al., Decreased antioxidant enzymes and membrane essential

polyunsaturated fatty acids in schizophrenic and bipolar mood disorder patients.

Psychiatry Res, 2003. 121(2): p. 109-22.

209. Ozcan, M.E., et al., Antioxidant enzyme activities and oxidative stress in affective

disorders. Int Clin Psychopharmacol, 2004. 19(2): p. 89-95.

210. Wang, J.F., et al., Increased oxidative stress in the anterior cingulate cortex of subjects

with bipolar disorder and schizophrenia. Bipolar Disord, 2009. 11(5): p. 523-9.

211. Andreazza, A.C., et al., Serum S100B and antioxidant enzymes in bipolar patients. J

Psychiatr Res, 2007. 41(6): p. 523-9.

212. Andreazza, A.C., et al., DNA damage in bipolar disorder. Psychiatry Res, 2007. 153(1):

p. 27-32.

213. Kunz, M., et al., Elevated serum superoxide dismutase and thiobarbituric acid reactive

substances in different phases of bipolar disorder and in schizophrenia. Prog

Neuropsychopharmacol Biol Psychiatry, 2008. 32(7): p. 1677-81.

214. Machado-Vieira, R., et al., Decreased plasma brain derived neurotrophic factor levels in

unmedicated bipolar patients during manic episode. Biol Psychiatry, 2007. 61(2): p. 142-

4.

215. Andreazza, A.C., et al., Oxidative stress markers in bipolar disorder: a meta-analysis. J

Affect Disord, 2008. 111(2-3): p. 135-44.

216. Emerit, I., Reactive oxygen species, chromosome mutation, and cancer: possible role of

clastogenic factors in carcinogenesis. Free Radic Biol Med, 1994. 16(1): p. 99-109.

137

217. el-Khamisy, S.F. and K.W. Caldecott, DNA single-strand break repair and

spinocerebellar ataxia with axonal neuropathy-1. Neuroscience, 2007. 145(4): p. 1260-6.

218. Frey, B.N., et al., Increased oxidative stress and DNA damage in bipolar disorder: a

twin-case report. Prog Neuropsychopharmacol Biol Psychiatry, 2007. 31(1): p. 283-5.

219. Buttner, N., et al., DNA fragmentation is increased in non-GABAergic neurons in bipolar

disorder but not in schizophrenia. Schizophr Res, 2007. 93(1-3): p. 33-41.

220. Andreazza, A.C., et al., Mitochondrial complex I activity and oxidative damage to

mitochondrial proteins in the prefrontal cortex of patients with bipolar disorder. Arch

Gen Psychiatry. 67(4): p. 360-8.

221. Abdalla, D.S., et al., Activities of superoxide dismutase and glutathione peroxidase in

schizophrenic and manic-depressive patients. Clin Chem, 1986. 32(5): p. 805-7.

222. Andreazza, A.C., et al., 3-Nitrotyrosine and glutathione antioxidant system in patients in

the early and late stages of bipolar disorder. J Psychiatry Neurosci, 2009. 34(4): p. 263-

71.

223. Cui, J., et al., Role of glutathione in neuroprotective effects of mood stabilizing drugs

lithium and valproate. Neuroscience, 2007. 144(4): p. 1447-53.

224. Shao, L., et al., The effect of mood stabilizer lithium on expression and activity of

glutathione s-transferase isoenzymes. Neuroscience, 2008. 151(2): p. 518-24.

225. Bakare, A., et al., Mood stabilizing drugs lamotrigine and olanzapine increase expression

and activity of glutathione S-transferase in primary cultured rat cerebral cortical cells.

Neurosci Lett, 2009. 455(1): p. 70-3.

226. Steckert, A.V., et al., Role of oxidative stress in the pathophysiology of bipolar disorder.

Neurochem Res. 35(9): p. 1295-301.

227. Cade, J.F., Lithium salts in the treatment of psychotic excitement. Med J Aust, 1949.

2(10): p. 349-52.

228. Baastrup, P.C., et al., Prophylactic lithium: double blind discontinuation in manic-

depressive and recurrent-depressive disorders. Lancet, 1970. 2(7668): p. 326-30.

229. Hirschowitz, J., A. Kolevzon, and A. Garakani, The pharmacological treatment of

bipolar disorder: the question of modern advances. Harv Rev Psychiatry. 18(5): p. 266-

78.

230. Grunze, H., et al., The World Federation of Societies of Biological Psychiatry (WFSBP)

guidelines for the biological treatment of bipolar disorders, part III: maintenance

treatment. World J Biol Psychiatry, 2004. 5(3): p. 120-35.

231. Griswold, K.S. and L.F. Pessar, Management of bipolar disorder. Am Fam Physician,

2000. 62(6): p. 1343-53, 1357-8.

138

232. Sachs, G.S. and M.E. Thase, Bipolar disorder therapeutics: maintenance treatment. Biol

Psychiatry, 2000. 48(6): p. 573-81.

233. Glick, I.D., et al., Psychopharmacologic treatment strategies for depression, bipolar

disorder, and schizophrenia. Ann Intern Med, 2001. 134(1): p. 47-60.

234. Chen, K.P., W.W. Shen, and M.L. Lu, Implication of serum concentration monitoring in

patients with lithium intoxication. Psychiatry Clin Neurosci, 2004. 58(1): p. 25-9.

235. Grimes, C.A. and R.S. Jope, The multifaceted roles of glycogen synthase kinase 3beta in

cellular signaling. Prog Neurobiol, 2001. 65(4): p. 391-426.

236. Stambolic, V., L. Ruel, and J.R. Woodgett, Lithium inhibits glycogen synthase kinase-3

activity and mimics wingless signalling in intact cells. Curr Biol, 1996. 6(12): p. 1664-8.

237. Hashimoto, R., et al., Lithium induces brain-derived neurotrophic factor and activates

TrkB in rodent cortical neurons: an essential step for neuroprotection against glutamate

excitotoxicity. Neuropharmacology, 2002. 43(7): p. 1173-9.

238. Silva, R., et al., Lithium prevents stress-induced reduction of vascular endothelium

growth factor levels. Neurosci Lett, 2007. 429(1): p. 33-8.

239. Sarkar, S., et al., Lithium induces autophagy by inhibiting inositol monophosphatase. J

Cell Biol, 2005. 170(7): p. 1101-11.

240. Hashimoto, R., et al., Lithium stimulates progenitor proliferation in cultured brain

neurons. Neuroscience, 2003. 117(1): p. 55-61.

241. Lai, J.S., et al., Cytoprotection by lithium and valproate varies between cell types and

cellular stresses. Eur J Pharmacol, 2006. 539(1-2): p. 18-26.

242. Senatorov, V.V., et al., Short-term lithium treatment promotes neuronal survival and

proliferation in rat striatum infused with quinolinic acid, an excitotoxic model of

Huntington's disease. Mol Psychiatry, 2004. 9(4): p. 371-85.

243. Jin, N., et al., Opposite effects of lithium and valproic acid on trophic factor deprivation-

induced glycogen synthase kinase-3 activation, c-Jun expression and neuronal cell death.

Neuropharmacology, 2005. 48(4): p. 576-83.

244. Costa, C., et al., Multiple mechanisms underlying the neuroprotective effects of

antiepileptic drugs against in vitro ischemia. Stroke, 2006. 37(5): p. 1319-26.

245. Caldero, J., et al., Lithium prevents excitotoxic cell death of motoneurons in organotypic

slice cultures of spinal cord. Neuroscience. 165(4): p. 1353-69.

246. Straiko, M.M., et al., Lithium protects against anesthesia-induced developmental

neuroapoptosis. Anesthesiology, 2009. 110(4): p. 862-8.

139

247. Aubry, J.M., et al., Early effects of mood stabilizers on the Akt/GSK-3beta signaling

pathway and on cell survival and proliferation. Psychopharmacology (Berl), 2009.

205(3): p. 419-29.

248. Hongisto, V., et al., Lithium blocks the c-Jun stress response and protects neurons via its

action on glycogen synthase kinase 3. Mol Cell Biol, 2003. 23(17): p. 6027-36.

249. Yasuda, S., et al., The mood stabilizers lithium and valproate selectively activate the

promoter IV of brain-derived neurotrophic factor in neurons. Mol Psychiatry, 2009.

14(1): p. 51-9.

250. Omata, N., et al., Neuroprotective effect of chronic lithium treatment against hypoxia in

specific brain regions with upregulation of cAMP response element binding protein and

brain-derived neurotrophic factor but not nerve growth factor: comparison with acute

lithium treatment. Bipolar Disord, 2008. 10(3): p. 360-8.

251. Bachmann, R.F., et al., Common effects of lithium and valproate on mitochondrial

functions: protection against methamphetamine-induced mitochondrial damage. Int J

Neuropsychopharmacol, 2009. 12(6): p. 805-22.

252. Shao, L., L.T. Young, and J.F. Wang, Chronic treatment with mood stabilizers lithium

and valproate prevents excitotoxicity by inhibiting oxidative stress in rat cerebral

cortical cells. Biol Psychiatry, 2005. 58(11): p. 879-84.

253. Wang, J.F., J.E. Azzam, and L.T. Young, Valproate inhibits oxidative damage to lipid

and protein in primary cultured rat cerebrocortical cells. Neuroscience, 2003. 116(2): p.

485-9.

254. Walz, J.C., et al., Effects of lithium and valproate on serum and hippocampal

neurotrophin-3 levels in an animal model of mania. J Psychiatr Res, 2008. 42(5): p. 416-

21.

255. Andreazza, A.C., et al., Effects of mood stabilizers on DNA damage in an animal model

of mania. J Psychiatry Neurosci, 2008. 33(6): p. 516-24.

256. Frey, B.N., et al., Effects of lithium and valproate on amphetamine-induced oxidative

stress generation in an animal model of mania. J Psychiatry Neurosci, 2006. 31(5): p.

326-32.

257. Machado-Vieira, R., et al., Oxidative stress parameters in unmedicated and treated

bipolar subjects during initial manic episode: a possible role for lithium antioxidant

effects. Neurosci Lett, 2007. 421(1): p. 33-6.

258. Aliyazicioglu, R., et al., Treatment with lithium, alone or in combination with olanzapine,

relieves oxidative stress but increases atherogenic lipids in bipolar disorder. Tohoku J

Exp Med, 2007. 213(1): p. 79-87.

259. Clapham, D.E., L.W. Runnels, and C. Strubing, The TRP ion channel family. Nat Rev

Neurosci, 2001. 2(6): p. 387-96.

140

260. Nilius, B., TRP channels in disease. Biochim Biophys Acta, 2007. 1772(8): p. 805-12.

261. Abramowitz, J. and L. Birnbaumer, Physiology and pathophysiology of canonical

transient receptor potential channels. FASEB J, 2009. 23(2): p. 297-328.

262. Kiselyov, K., A. Soyombo, and S. Muallem, TRPpathies. J Physiol, 2007. 578(Pt 3): p.

641-53.

263. Nilius, B., T. Voets, and J. Peters, TRP channels in disease. Sci STKE, 2005. 2005(295):

p. re8.

264. Nilius, B., et al., Transient receptor potential cation channels in disease. Physiol Rev,

2007. 87(1): p. 165-217.

265. Everett, K.V., Transient receptor potential genes and human inherited disease. Adv Exp

Med Biol. 704: p. 1011-32.

266. Minke, B., C. Wu, and W.L. Pak, Induction of photoreceptor voltage noise in the dark in

Drosophila mutant. Nature, 1975. 258(5530): p. 84-7.

267. Montell, C., TRP trapped in fly signaling web. Curr Opin Neurobiol, 1998. 8(3): p. 389-

97.

268. Montell, C., The TRP superfamily of cation channels. Sci STKE, 2005. 2005(272): p. re3.

269. Birnbaumer, L., E. Yildirim, and J. Abramowitz, A comparison of the genes coding for

canonical TRP channels and their M, V and P relatives. Cell Calcium, 2003. 33(5-6): p.

419-32.

270. Montell, C. and G.M. Rubin, Molecular characterization of the Drosophila trp locus: a

putative integral membrane protein required for phototransduction. Neuron, 1989. 2(4):

p. 1313-23.

271. Clapham, D.E., et al., International Union of Pharmacology. XLIII. Compendium of

voltage-gated ion channels: transient receptor potential channels. Pharmacol Rev, 2003.

55(4): p. 591-6.

272. Vannier, B., et al., The membrane topology of human transient receptor potential 3 as

inferred from glycosylation-scanning mutagenesis and epitope immunocytochemistry. J

Biol Chem, 1998. 273(15): p. 8675-9.

273. Lee, S.Y., et al., Structure of the KvAP voltage-dependent K+ channel and its

dependence on the lipid membrane. Proc Natl Acad Sci U S A, 2005. 102(43): p. 15441-

6.

274. Long, S.B., et al., Atomic structure of a voltage-dependent K+ channel in a lipid

membrane-like environment. Nature, 2007. 450(7168): p. 376-82.

141

275. Voets, T., et al., TRPM8 voltage sensor mutants reveal a mechanism for integrating

thermal and chemical stimuli. Nat Chem Biol, 2007. 3(3): p. 174-82.

276. Birnbaumer, L., The TRPC class of ion channels: a critical review of their roles in slow,

sustained increases in intracellular Ca(2+) concentrations. Annu Rev Pharmacol

Toxicol, 2009. 49: p. 395-426.

277. Venkatachalam, K. and C. Montell, TRP channels. Annu Rev Biochem, 2007. 76: p. 387-

417.

278. Montell, C., L. Birnbaumer, and V. Flockerzi, The TRP channels, a remarkably

functional family. Cell, 2002. 108(5): p. 595-8.

279. Zhu, X., et al., trp, a novel mammalian gene family essential for agonist-activated

capacitative Ca2+ entry. Cell, 1996. 85(5): p. 661-71.

280. Zhu, X., et al., Molecular cloning of a widely expressed human homologue for the

Drosophila trp gene. FEBS Lett, 1995. 373(3): p. 193-8.

281. Wes, P.D., et al., TRPC1, a human homolog of a Drosophila store-operated channel.

Proc Natl Acad Sci U S A, 1995. 92(21): p. 9652-6.

282. Montell, C., et al., A unified nomenclature for the superfamily of TRP cation channels.

Mol Cell, 2002. 9(2): p. 229-31.

283. Plant, T.D. and M. Schaefer, Receptor-operated cation channels formed by TRPC4 and

TRPC5. Naunyn Schmiedebergs Arch Pharmacol, 2005. 371(4): p. 266-76.

284. Clapham, D.E., TRP channels as cellular sensors. Nature, 2003. 426(6966): p. 517-24.

285. Ramsey, I.S., M. Delling, and D.E. Clapham, An introduction to TRP channels. Annu

Rev Physiol, 2006. 68: p. 619-47.

286. Strubing, C., et al., TRPC1 and TRPC5 form a novel cation channel in mammalian brain.

Neuron, 2001. 29(3): p. 645-55.

287. Riccio, A., et al., mRNA distribution analysis of human TRPC family in CNS and

peripheral tissues. Brain Res Mol Brain Res, 2002. 109(1-2): p. 95-104.

288. Vannier, B., et al., Mouse trp2, the homologue of the human trpc2 pseudogene, encodes

mTrp2, a store depletion-activated capacitative Ca2+ entry channel. Proc Natl Acad Sci

U S A, 1999. 96(5): p. 2060-4.

289. Lucas, P., et al., A diacylglycerol-gated cation channel in vomeronasal neuron dendrites

is impaired in TRPC2 mutant mice: mechanism of pheromone transduction. Neuron,

2003. 40(3): p. 551-61.

142

290. Liman, E.R., D.P. Corey, and C. Dulac, TRP2: a candidate transduction channel for

mammalian pheromone sensory signaling. Proc Natl Acad Sci U S A, 1999. 96(10): p.

5791-6.

291. Okada, T., et al., Molecular cloning and functional characterization of a novel receptor-

activated TRP Ca2+ channel from mouse brain. J Biol Chem, 1998. 273(17): p. 10279-

87.

292. Schaefer, M., et al., Receptor-mediated regulation of the nonselective cation channels

TRPC4 and TRPC5. J Biol Chem, 2000. 275(23): p. 17517-26.

293. Obukhov, A.G. and M.C. Nowycky, A cytosolic residue mediates Mg2+ block and

regulates inward current amplitude of a transient receptor potential channel. J Neurosci,

2005. 25(5): p. 1234-9.

294. Okada, T., et al., Molecular and functional characterization of a novel mouse transient

receptor potential protein homologue TRP7. Ca(2+)-permeable cation channel that is

constitutively activated and enhanced by stimulation of G protein-coupled receptor. J

Biol Chem, 1999. 274(39): p. 27359-70.

295. Tano, J.Y., K. Smedlund, and G. Vazquez, Endothelial TRPC3/6/7 proteins at the edge of

cardiovascular disease. Cardiovasc Hematol Agents Med Chem. 8(1): p. 76-86.

296. Owsianik, G., et al., Permeation and selectivity of TRP channels. Annu Rev Physiol,

2006. 68: p. 685-717.

297. Jung, S., et al., Lanthanides potentiate TRPC5 currents by an action at extracellular sites

close to the pore mouth. J Biol Chem, 2003. 278(6): p. 3562-71.

298. Liu, X., B.B. Singh, and I.S. Ambudkar, TRPC1 is required for functional store-operated

Ca2+ channels. Role of acidic amino acid residues in the S5-S6 region. J Biol Chem,

2003. 278(13): p. 11337-43.

299. Kiselyov, K., et al., Functional interaction between InsP3 receptors and store-operated

Htrp3 channels. Nature, 1998. 396(6710): p. 478-82.

300. Boulay, G., et al., Modulation of Ca(2+) entry by polypeptides of the inositol 1,4, 5-

trisphosphate receptor (IP3R) that bind transient receptor potential (TRP): evidence for

roles of TRP and IP3R in store depletion-activated Ca(2+) entry. Proc Natl Acad Sci U S

A, 1999. 96(26): p. 14955-60.

301. Ma, H.T., et al., Requirement of the inositol trisphosphate receptor for activation of

store-operated Ca2+ channels. Science, 2000. 287(5458): p. 1647-51.

302. Liao, Y., et al., Orai proteins interact with TRPC channels and confer responsiveness to

store depletion. Proc Natl Acad Sci U S A, 2007. 104(11): p. 4682-7.

303. Lockwich, T., et al., Stabilization of cortical actin induces internalization of transient

receptor potential 3 (Trp3)-associated caveolar Ca2+ signaling complex and loss of

143

Ca2+ influx without disruption of Trp3-inositol trisphosphate receptor association. J

Biol Chem, 2001. 276(45): p. 42401-8.

304. Hofmann, T., et al., Subunit composition of mammalian transient receptor potential

channels in living cells. Proc Natl Acad Sci U S A, 2002. 99(11): p. 7461-6.

305. Selvaraj, S., Y. Sun, and B.B. Singh, TRPC channels and their implication in

neurological diseases. CNS Neurol Disord Drug Targets. 9(1): p. 94-104.

306. Yamamoto, S., N. Takahashi, and Y. Mori, Chemical physiology of oxidative stress-

activated TRPM2 and TRPC5 channels. Prog Biophys Mol Biol. 103(1): p. 18-27.

307. Andreopoulos, S., et al., Chronic lithium treatment of B lymphoblasts from bipolar

disorder patients reduces transient receptor potential channel 3 levels.

Pharmacogenomics J, 2004. 4(6): p. 365-73.

308. Marchenko, S. and L. Flanagan, Immunocytochemistry: human neural stem cells. J Vis

Exp, 2007(7): p. 267.

309. Rudolph, J.G., J.J. Lemasters, and F.T. Crews, Use of a multiwell fluorescence scanner

with propidium iodide to assess NMDA mediated excitotoxicity in rat cortical neuronal

cultures. Neurosci Lett, 1997. 221(2-3): p. 149-52.

310. Roedding, A.S., et al., TRPC3 protein is expressed across the lifespan in human

prefrontal cortex and cerebellum. Brain Res, 2009. 1260: p. 1-6.

311. Livak, K.J. and T.D. Schmittgen, Analysis of relative gene expression data using real-

time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods, 2001. 25(4): p.

402-8.

312. Kiyonaka, S., et al., Selective and direct inhibition of TRPC3 channels underlies

biological activities of a pyrazole compound. Proc Natl Acad Sci U S A, 2009. 106(13):

p. 5400-5.

313. Huang, J.H., et al., TRPC3 channel contributes to nitric oxide release: significance

during normoxia and hypoxia-reoxygenation. Cardiovasc Res. 91(3): p. 472-82.

314. Fuchs, B., et al., Diacylglycerol regulates acute hypoxic pulmonary vasoconstriction via

TRPC6. Respir Res. 12: p. 20.

315. Bardell, T.K. and E.L. Barker, Activation of TRPC6 channels promotes endocannabinoid

biosynthesis in neuronal CAD cells. Neurochem Int. 57(1): p. 76-83.

316. Graham, S., et al., Canonical transient receptor potential 6 (TRPC6), a redox-regulated

cation channel. J Biol Chem. 285(30): p. 23466-76.

317. Zhang, M.F., et al., [TRPC6 mediates the enhancements of pulmonary arterial tone and

intracellular Ca2+ concentration of pulmonary arterial smooth muscle cells in

pulmonary hypertension rats]. Sheng Li Xue Bao. 62(1): p. 55-62.

144

318. Biswas, M. and J.Y. Chan, Role of Nrf1 in antioxidant response element-mediated gene

expression and beyond. Toxicol Appl Pharmacol. 244(1): p. 16-20.

319. Shirakawa, H., et al., Transient receptor potential canonical 3 (TRPC3) mediates

thrombin-induced astrocyte activation and upregulates its own expression in cortical

astrocytes. J Neurosci. 30(39): p. 13116-29.

320. Sorensen, S.D., et al., Common signaling pathways link activation of murine PAR-1,

LPA, and S1P receptors to proliferation of astrocytes. Mol Pharmacol, 2003. 64(5): p.

1199-209.

321. Wang, H. and G. Reiser, Thrombin signaling in the brain: the role of protease-activated

receptors. Biol Chem, 2003. 384(2): p. 193-202.

322. Citro, S., et al., Phospholipase Cepsilon is a nexus for Rho and Rap-mediated G protein-

coupled receptor-induced astrocyte proliferation. Proc Natl Acad Sci U S A, 2007.

104(39): p. 15543-8.

323. Liu, Y., et al., Erythropoietin increases expression and function of transient receptor

potential canonical 5 channels. Hypertension. 58(2): p. 317-24.

324. Paria, B.C., et al., Tumor necrosis factor-alpha induces nuclear factor-kappaB-dependent

TRPC1 expression in endothelial cells. J Biol Chem, 2003. 278(39): p. 37195-203.

325. Kuwahara, K. and K. Nakao, New molecular mechanisms for cardiovascular

disease:transcriptional pathways and novel therapeutic targets in heart failure. J

Pharmacol Sci. 116(4): p. 337-42.

326. Poteser, M., et al., PKC-dependent coupling of calcium permeation through transient

receptor potential canonical 3 (TRPC3) to calcineurin signaling in HL-1 myocytes. Proc

Natl Acad Sci U S A. 108(26): p. 10556-61.

327. Onohara, N., et al., TRPC3 and TRPC6 are essential for angiotensin II-induced cardiac

hypertrophy. EMBO J, 2006. 25(22): p. 5305-5316.

328. Kuwahara, K., et al., TRPC6 fulfills a calcineurin signaling circuit during pathologic

cardiac remodeling. J Clin Invest, 2006. 116(12): p. 3114-26.

329. Graham, S., et al., Abundance of TRPC6 protein in glomerular mesangial cells is

decreased by ROS and PKC in diabetes. Am J Physiol Cell Physiol. 301(2): p. C304-15.

330. Gygi, S.P., et al., Correlation between protein and mRNA abundance in yeast. Mol Cell

Biol, 1999. 19(3): p. 1720-30.

331. Tai, H.C. and E.M. Schuman, Ubiquitin, the proteasome and protein degradation in

neuronal function and dysfunction. Nat Rev Neurosci, 2008. 9(11): p. 826-38.

332. Vogel, C., G.M. Silva, and E.M. Marcotte, Protein expression regulation under oxidative

stress. Mol Cell Proteomics.

145

333. Wuensch, T., et al., High glucose-induced oxidative stress increases transient receptor

potential channel expression in human monocytes. Diabetes. 59(4): p. 844-9.

334. Liu, D., Z. Zhu, and M. Tepel, The role of transient receptor potential channels in

metabolic syndrome. Hypertens Res, 2008. 31(11): p. 1989-95.

335. Groschner, K., C. Rosker, and M. Lukas, Role of TRP channels in oxidative stress.

Novartis Found Symp, 2004. 258: p. 222-30; discussion 231-5, 263-6.

336. Kim, M.S., et al., Genetic and pharmacologic inhibition of the Ca2+ influx channel

TRPC3 protects secretory epithelia from Ca2+-dependent toxicity. Gastroenterology.

140(7): p. 2107-15, 2115 e1-4.

337. Miyano, K., et al., Activation of the neurokinin-1 receptor in rat spinal astrocytes induces

Ca2+ release from IP3-sensitive Ca2+ stores and extracellular Ca2+ influx through

TRPC3. Neurochem Int. 57(8): p. 923-34.

338. Gibon, J., P. Tu, and A. Bouron, Store-depletion and hyperforin activate distinct types of

Ca(2+)-conducting channels in cortical neurons. Cell Calcium. 47(6): p. 538-43.

339. Sabourin, J., E. Robin, and E. Raddatz, A key role of TRPC channels in the regulation of

electromechanical activity of the developing heart. Cardiovasc Res. 92(2): p. 226-36.

340. Kim, B.J., J.H. Nam, and S.J. Kim, Effects of transient receptor potential channel

blockers on pacemaker activity in interstitial cells of Cajal from mouse small intestine.

Mol Cells. 32(2): p. 153-60.

341. Harteneck, C., H. Frenzel, and R. Kraft, N-(p-amylcinnamoyl)anthranilic acid (ACA): a

phospholipase A(2) inhibitor and TRP channel blocker. Cardiovasc Drug Rev, 2007.

25(1): p. 61-75.

342. Kraft, R., et al., Inhibition of TRPM2 cation channels by N-(p-amylcinnamoyl)anthranilic

acid. Br J Pharmacol, 2006. 148(3): p. 264-73.

343. Harteneck, C. and M. Gollasch, Pharmacological modulation of diacylglycerol-sensitive

TRPC3/6/7 channels. Curr Pharm Biotechnol. 12(1): p. 35-41.

344. Cai, S., et al., TRPC channel expression during calcium-induced differentiation of human

gingival keratinocytes. J Dermatol Sci, 2005. 40(1): p. 21-8.

345. Jia, Y., et al., TRPC channels promote cerebellar granule neuron survival. Nat Neurosci,

2007. 10(5): p. 559-567.

346. Balzer, M., B. Lintschinger, and K. Groschner, Evidence for a role of Trp proteins in the

oxidative stress-induced membrane conductances of porcine aortic endothelial cells.

Cardiovasc Res, 1999. 42(2): p. 543-9.

146

347. Crouzin, N., et al., Alpha-tocopherol-mediated long-lasting protection against oxidative

damage involves an attenuation of calcium entry through TRP-like channels in cultured

hippocampal neurons. Free Radic Biol Med, 2007. 42(9): p. 1326-37.

348. Vazquez, G., et al., Human Trp3 forms both inositol trisphosphate receptor-dependent

and receptor-independent store-operated cation channels in DT40 avian B lymphocytes.

Proc Natl Acad Sci U S A, 2001. 98(20): p. 11777-82.

349. Trebak, M., et al., Comparison of human TRPC3 channels in receptor-activated and

store-operated modes. Differential sensitivity to channel blockers suggests fundamental

differences in channel composition. J Biol Chem, 2002. 277(24): p. 21617-23.

350. Hiroi, T., et al., Protracted lithium treatment protects against the ER stress elicited by

thapsigargin in rat PC12 cells: roles of intracellular calcium, GRP78 and Bcl-2.

Pharmacogenomics J, 2005. 5(2): p. 102-11.

351. Guo, S., et al., Lithium upregulates vascular endothelial growth factor in brain

endothelial cells and astrocytes. Stroke, 2009. 40(2): p. 652-5.

352. Speziale, S., et al., Iron spin transition in Earth's mantle. Proc Natl Acad Sci U S A,

2005. 102(50): p. 17918-22.

353. Bai, J.Z. and J. Lipski, Differential expression of TRPM2 and TRPV4 channels and their

potential role in oxidative stress-induced cell death in organotypic hippocampal culture.

Neurotoxicology. 31(2): p. 204-14.

354. Song, O.R., et al., Confocal-based method for quantification of diffusion kinetics in

microwell plates and its application for identifying a rapid mixing method for high-

content/throughput screening. J Biomol Screen. 15(2): p. 138-47.

the role of oxidative stress on neural trpc3, …...the role of oxidative stress on neural trpc3,...

Documents