Developmental Biology 322 (2008) 425–434

Contents lists available at ScienceDirect

Developmental Biology

j ourna l homepage: www.e lsev ie r.com/deve lopmenta lb io logy

Genomes & Developmental Control

The surprising complexity of the transcriptional regulation of the spdri gene revealsthe existence of new linkages inside sea urchin's PMC and Oral Ectoderm GeneRegulatory Networks

Abdullah Al Mahmud, Gabriele Amore ⁎Molecular Evolution Group, Stazione Zoologica Anton Dohrn, Napoli, Villa Comunale Napoli 80121, Italy

⁎ Corresponding author. Fax: +39 081 7641355.E-mail address: gabriele.amore@szn.it (G. Amore).

0012-1606/$ – see front matter © 2008 Elsevier Inc. Aldoi:10.1016/j.ydbio.2008.07.036

a b s t r a c t

a r t i c l e i n f o

Article history:

During sea urchin embryoge Received for publication 23 May 2008Revised 29 July 2008Accepted 30 July 2008Available online 7 August 2008

Keywords:SpdeadringerspdriSea urchin embryocis-regulationEndomesodermPMCsOral EctodermGene Regulatory Networks

nesis the spdri gene participates in two separateGeneRegulatoryNetworks (GRNs):the PrimaryMesenchymeCells' (PMCs) and theOral Ectoderm's one. In both cases, activation of the gene followsinitial specification events [Amore, G., Yavrouian, R., Peterson, K., Ransick, A., McClay, D., Davidson, E., 2003.Spdeadringer, a sea urchin embryo gene required separately in skeletogenic and oral ectoderm gene regulatorynetworks. Dev. Biol. 261, 55–81.]. We identified a portion of genomic DNA (“4.7IL” − 3456;+389) which issufficient to replicate sdpri's expression pattern in experiments of transgenesis, using a GFP reporter. In ourexperiments, the activation kinetic of 4.7IL-GFP was similar to that of the endogenous gene and the reporterresponded to known spdri's transcriptional regulators (Ets1, Alx1, Gsc and Dri). Here we present a dissection ofthis regulatory region and a description of the modules involved in spdri's transcriptional regulation. Both inthe PMCs' and Oral Ectoderm's expression phases, activation of spdri is obtained through the integration ofthree kinds of inputs: positive and globally distributed ones; negative ones (that prevent ectopic expression);positive and tissue-specific ones. Our results allow to expand the map of the regulatory connections at thespdri node, both in the PMCs and in the Oral Ectoderm Gene Regulatory Networks (GRNs).

© 2008 Elsevier Inc. All rights reserved.

Introduction

The spdri gene is an eARID (Wilsker et al., 2002; Wilsker et al.,2005) transcription factor family member, expressed zygotically andin a biphasic way during sea urchin embryogenesis. Activation of thegene begins in the primary mesenchyme cells (PMCs, the cells thatsecrete the embryonic skeleton) at a time in which these areembedded in the wall of the blastula (13–15 h) and continues untiltheir complete ingression in the blastocoel (22–24 h). Expression ofthe gene in these cells is necessary for the execution of signalingcapabilities and proper patterning of the skeleton. At the onset ofgastrulation, spdri's transcription stops in PMCs and its mRNAs start toaccumulate in the Oral Ectoderm. Here spdri participates to regionalspecification processes and expression of the gene will continue untillate gastrula stage (Amore et al., 2003). At pluteus stage, spdri'stranscription is restricted to the ciliated band (Amore G. unpublished).

PMCs' specification is obtained through the interpretation ofmaternal anisotropies that result in the tissue-specific activation ofthe transcriptional repressor pmar1 (Oliveri et al., 2002, 2003). Thisfactor prevents the expression in PMCs of a second repressor, hesC

l rights reserved.

(Revilla-i-Domingo et al., 2007), otherwise ubiquitously expressed. Adouble repression gate is established which allows the zygotic PMC-restricted activation of (among others) two transcription factor genes:alx1 (Ettensohn et al., 2003) and ets1 (Consales and Arnone, 2002;Martin et al., 2001; Oliveri et al., 2002). As previous perturbationanalyses have shown, Ets1 and Alx1 provide necessary positive inputsfor the PMC-specific activation of spdri (Oliveri et al., 2008).

Specification of the Oral Ectoderm begins with the asymmetricaldistribution of redox states along the prospective Oral–Aboral axis ofthe fertilized egg (Coffman and Denegre, 2007; Coffman et al., 2004).At the blastula stage this initial asymmetry is reflected by the orallyrestricted activation of p38 phosphokinase, which is required for thelater localized expression of the Nodal ligand (Bradham and McClay,2006; Duboc and Lepage, 2006; Duboc et al., 2004; Nam et al., 2007).Eventually oral transcription of gsc (Angerer et al., 2001) is achieved,and the presence of Gsc transcription factor is necessary for theactivation of spdri in this territory (Amore et al., 2003). As Gsc is anobligate repressor, a double repression circuit is established, so that inthe Oral Ectoderm Gsc represses “Repressor A” (otherwise active inthe rest of the embryo). As a consequence, spdri is transcribed in thisterritory (Amore et al., 2003). A positive input is also provided by theHnf6 transcription factor, whose expression is restricted in the OralEctoderm at mesenchyme blastula stage. This either inputs spdri

426 A.A. Mahmud, G. Amore / Developmental Biology 322 (2008) 425–434

directly or through gsc (Otim et al., 2004). Recently (http://sugp.caltech.edu/endomes/#EctoNetworkDiagram) two additional spdriinputs have been recognized: a positive one Otxb1/2, which isexpressed in post-invagination embryos in Oral Ectoderm andendoderm (Yuh et al., 2002); a negative one, Fox G, expressed in theOral Ectoderm from blastula stage on (Tu et al., 2006). In post-gastrular embryos, spdri promotes its own activation either directly orby sustaining the activation of gsc (Amore et al., 2003).

Therefore, spdri participates to two separate GRNs: the PMCs' andthe Oral Ectoderm's one. In both cases the gene operates downstreamof early specification events and two separate sets of regulators arerequired to obtain its activation. Based on this knowledge, wehypothesized the existence of at least two separate portions ofregulatory DNA, required to integrate the inputs provided by spdri'sknown regulators. As we show here, the reality of spdri's regulationproved to be surprisingly more complex than anticipated and even inthe PMCs the integration of multiple inputs is necessary for theactivation of the gene. Our results support the existence of newlinkages in the upstream regulatory map of spdri, in the PMCs as wellas in the Oral Ectoderm GRN.

Materials and methods

Identification of spdri BACs

S. purpuratus BAC libraries were screened with a cDNA probe(clone 174B22), containing the entire eARID domain (Amore et al.,2003). Filters were hybridized in 5×SSPE, 5% SDS and 0.1% NaPPi at65 °C and washed to a final concentration of 1×SSPE, 0.1% SDS.Positive clones were identified using the BioArray Software (Brown etal., 2002) and further confirmed by PCR and genomic DNA blots. Eachclone was also mapped to determine the distance of the spdri genefrom the vector. Mapping was done by digesting each BAC with Not I,which releases the insert, and either Bgl II, Xho I or Pst I. Genomic DNAblots were hybridized with combinations of probes corresponding tothe vector (T7 and SP6), and the 174B22 probe. Sp BAC clone 118J14 (inwhich the spdri gene was better centred in the vector) was sequencedat the Joint Genome Institute (Seattle, WA).

Reporter constructs and PCR primers

Because of a mistakemade in the initial annotation of the spdri BACclone, the gene's first exon was named “Exon0” and the second exon,“Exon1”. Primers and constructs are named with numbers thatreflected the distance of their 5′ extremity from the beginning ofthe second exon. Here and in the rest of this paper however, actualdistance coordinates are given using the 5′ of the actual first exon as 0and are indicated in parenthesis. 4.7IL-GFP construct was obtained byfusion PCR (Hobert, 2002; Yon and Fried, 1989) of the (−3456;+389)portion of spdri genomic DNA to a GFP cassette coding sequence. Theresulting product was used for microinjection (after purification),cloned into pBS vector so that it could be sequenced and the deletedversion of 4.7IL used in this study could be obtained.

Primers at the extremities of the 4.7IL fragment were:

4.7up: TGACTCCCCTGGCTGTTTACDriEx1Up(RC): CGGCGCTGCTCTTCTACTAT

For the GFP cassette:

DriEx1Up:ATCATTGAGGAACAGAGGAGGATAGTAGAAGAGCAGCGCCGGAGGATGAGCAAGGGCGAGGAACTGFP3′R:GCTGCAGGAATTCATCGGT

Also, versionof the 4.7IL constructmissing thefirst exon (E0L) or partof it (E0L3) or the first intron (I0L) were produced by fusion PCR. In this

case the following primers were designed close to the 5′-terminus or atthe 3′-terminus of the first exon or the intron:

DriDownEx0Less: CTATCCTCCTCTGTTCCTCAATGATTGTGATGACTGCGAGCTTCTDriDownIntron1Less: CTATCCTCCTCTGTTCCTCAATGATCCCATCCCATAACAGAACCDriE0L3down:AAATCACTGGTTGCAAAGTCG

Primers used to remove portions at the 5′-terminus of 4.7IL were asfollows:Dri-4.6up: TGAACCAGGTGAAGAAAGAGGDri-3.8up: ATTATTTATCATTGTCTATGDri-3.7up: GCTTTCACATTTTGCCCTGTDri-3.4up:AAGGGGCATGGGATTAAAACDri-3.15up: TTCTTCACAAGCCCTCTGGTDri-3.0up: AGGCAACTGAAAAADri-2.9up: CACACTTTCCGAGCAAAACADri-2.7up: CTCACTATTCATTCGCCCTGTDri2.2up: TATGATGCTTTCGTCCCCTTTDri1.8up: CCCTTCATGACCCAAAGAAC

To obtain construct OEE-GFP (and its derivatives) the OEE fragmentwas cloned into Ep-GFP plasmid (Cameron et al., 2004). Primers usedto amplify the OEE were as follows:

Dri4Kbup: CGCTGTACCATGTGDri3Kbdown: TTTTTCAGTTGCCTCCATCC

All primers used for cloning bore appropriate restriction sites attheir extremities (Kpn1 an AatII).

Removal of Ets1 and Alx1 putative binding sites

Putative Ets1 and Alx1 binding sites were identified by using theMat-Inspector and the JASPAR software tools (available online), usingdefault settings, the only exception being the choice of a threshold of95% identity when using JASPAR to search for the extra ETS1 site. Thesequences of Ets1 putative binding sites were as follows:

Ets1 site 1 and 2 are two overlapping sites: CGAGGAAGAGAAAG.The sequence of the first is CGAGGAAG. This is almost a perfect matchto the sequence indicated by Consales and Arnone (2002): AGAGGAAG(underlined nucleotides are those of the core sequence; boldnucleotides denote nucleotides in functionally relevant positions,according to these authors). The second site, AGAGAAAG overlaps thefirst one by two nucleotides and presents a mismatch in the core GGA.As mutation in the core sequence however do not necessarily predictnon-functionality of the site (Amore and Davidson, 2006) we decidedto remove this site as well. Ets1 site 3: CTTTCTCT and Ets1 site 4:CTTTCTCT present the same sequence: this is the reverse comple-mentary of site 2. The sequence of the extra Ets1 site is GACGGAAG;this conforms to the consensus in the JASPAR and Mat-Inspectordatabases: c/a/t GGA a/t g/a.

The two Alx1 sites as predicted by the in silico analysis performedusing both JASPAR and Mat-inspector were as follows:

Alx1 site 1: TTTAATCTCATTAATCT; Alx1 site 2: CGTAATGTGGT-TACGGG. Of these, the first conforms to the palindromic consensussequence TAATnnnATTA indicated by Cai (1998), while the secondpresent a point mutation.

Since elimination of Ets1 and Alx1 putative binding sites proved tobe harder than anticipated, three different strategies were followed. Inall cases amplicons were obtained using as template a plasmid (dri-IntronLess:GFP) that contained a genomic DNA fragment thatextended 4.7IL of 1 Kb upstream [where the dri(kpn)up primerbinds, see below]. All constructs obtained were sequence-checkedbefore microinjection.

427A.A. Mahmud, G. Amore / Developmental Biology 322 (2008) 425–434

Starting from the 5′-end of the module, the first and second Etssites (these are two overlapping sites) were removed by producingtwo amplicons, one endowed with Kpn1 and ApaL1 and the otherwith ApaL1 and AatII restriction sites. After digestion with thecorresponding restriction enzymes, they were ligated and clonedinto a pBS-GFP vector.

Primers used were as follows:

4.7Ku: ACTGGGTACCTGACTCCCCTGGCTGTTTACE12dR: ATGCGTGCACCTGCAGCGTAAATATTTTTC

for the first amplicon, and

AfEL: ATGCGTGCACACCACGTAATGAGTAATAATAATAGI0LAat: AGTCGACGTCCCCATCCCATAACAGAACC

for the second.

The third and fourth Ets sites, were removed by a fusion PCRstrategy. Also in this case two amplicons were produced that werethen fused and cloned.

Primers utilized were as follows:

Dri(kpn)up: ACTGGGTACCCCCTGCCAACACGAATATCTFUEtR: GATATGGAGAGAGATACAGACAGAGGACAGACAGACATTT-CAACAG

for the first amplicon and

FUEtL: CTGTTGAAATGTCTGTCTGTCCTCTGTCTGTATCTCTCT-CCATATCI0LAat: AGTCGACGTCCCCATCCCATAACAGAACC

for the second. The two amplicons were fused using 4.7Ku and I0LAat,the PCR product digested with Kpn1 and AatII restriction enzymes andcloned in pBS-GFP plasmid.

The fifth Ets site (“Extra Ets site” in Fig. 2C) was removed using thereagents in the Quick change II XL site directed mutagenesis kit(Stratagene) following manufacturer's instructions. Primers weredesigned to delete the core binding site using the available onlinesoftware tool provided by Stratagene (http://www.stratagene.com/qcprimerdesign.).

Primers were as follows:

dEt3s: TCTATATTGAGTGCCGATCGATGAGAAATAACCGACCCCTdEt3a: AGGGGTCGGTTATTTCTCATCGATCGGCACTCAATAATATAGA

The first and second Alx sites where removed in two separatesteps. Also in this case a deletion strategy was applied.

Primers utilized were as follows:

For Alx site 1

DAlxL:ATAACAATATGATGCTTTCGTCCCCTTTATTATCTTCTGTTCATCTAACTTCTTCAGDAlxR:CTGAAGAAGTTAGATGAACAGAAGATAATAAAGGGGACGAAAGCATCATATTGTTAT

For Alx site2

DAl2s: GTAACGATTATGTTGTATTAAACACGCGGGTCAGTAGTACAGTGTACTAGATDAl2a: ATCTAGTACACTGTACTACTGACCCGCGTGTTTAATACAACATAATCGTTAC

Embryo culture, microinjection and whole-mount in situ hybridizations

Fertilized eggs were injected with 1–2 pl of a solution containing250 molecules of reporter construct/pl, following described micro-injection and embryo culture procedures (McMahon et al., 1985).Double Whole-Mount In Situ Hybridizations (DWMISH) on injectedembryos, were performed as described (Minokawa et al., 2005). In allthe microinjection experiments presented, at least two batches ofembryos were utilized.

RNA extraction, cDNA production, qPCR data analysis and computation

At the appropriate time point 100–150 embryoswere collected andprocessed using the reagents in the Quiagen “All prep DNA/RNA minikit” (Qiagen Inc., Valencia, CA), which allows the simultaneousextraction of DNA and RNA from the same sample. RNA was elutedin 50 μl of water, concentrated to 12 μl and used to obtain cDNA withthe reagent contained in the “QuantiTect Reverse Transcription kit”(Quiagen). For quantitative PCR, “Fast Start Sybr Green Master”(Roche) was used. Reactions were run on an MJ Research-BioradChromo 4 machine, equipped with “Opticon Monitor” analysissoftware. Each replicate reaction was performed in a total volume of10 μl using the equivalent amount of 2–3 embryos. GFP mRNAquantitation was performed correcting for the amount of constructincorporation (Revilla-i-Domingo et al., 2004). In order to comparemRNA amounts from two different samples, an arbitrary thresholdwas set in the linear phase of amplification. The difference in thenumber of cycles necessary to reach the same amplification level (atthe threshold) in the two samples is converted in the correspondingratio in the amount of mRNA. This is given by 1.94ΔCt where ΔCt is thedifference in the number of cycles needed to reach the thresholdbetween control and experimental sample, after correction for theamount of total mRNA contained in each sample (Amore et al., 2003).Meaningful changes in the mRNA level measured are those whereΔCt=N |1.7|. This corresponds to a time-fold change of 3.1.

Results

Structure of the spdri genomic locus

Spdri's gene structure was obtained by aligning the spdri cDNAsequence (AY130972) to that of the S. purpuratus BAC clone 118J14.The gene consists of 8 exons (indicated by the red boxes in Fig. 1A)spanning a total length of 21.5 Kb. The eARID DNA binding domain isencoded in the third, fourth and fifth exons. Sea Urchin Genome An-notation Resource software, SUGAR (Brown et al., 2002), was used topredict the locations of the genes flanking spdri. The nearest upstreampredicted coding sequence, was 12.6 kb away from the transcriptionalstart site, matching a sea urchin sodium phosphate co-transporterencoding gene (GenBank Accession AAF21135; BLASTn probabilityscore, 5e-68; in purple in Fig. 1A). The nearest downstream geneencodes for a predicted TRP cation channel (GenBank AccessionCAD01139; score 1e-18; in golden in Fig. 1A), 27.4 kb 3′ of spdri's stopcodon. A third gene encoding a reverse transcriptase (GenBankAccession CAD32263.1; score 3e-55; in blue in Fig. 1A) was alsopredicted 18.8 Kb downstream of the transcriptional start site. Theassembled sequence of the S. purpuratus genome (Sodergren et al.,2006) indicated that spdri is a single-copy gene.

4.7IL-GFP recapitulates spdri's expression pattern

Trough a strategy of excerption, progressive deletion and test weidentified a DNA fragment (called “4.7IL”) which was sufficient toreproduce the complete spdri's expression pattern. This fragmentincludes a portion of the genomic DNA from 3.456 Kb upstream of thetranscriptional start site to 389 bp downstream (fully including the

Fig. 1. 4.7IL contains spdri's cis-regulatory region. (A) Diagrammatic representation of the spdri's genomic locus and construct 4.7IL GFP. Genomic DNA is indicated with a blackhorizontal line; red boxes represent spri's exons; bent arrow identify spdri's transcriptional start site. Inside the spdri locus, the purple box indicate sea urchin sodium phosphate co-transporter gene's exon; orange box: TRP cation channel's exon; blue box: reverse transcriptase's exon. Coding directions are indicated by the arrows below each gene. In the 4.7ILconstruct a green box is used for the GFP coding sequence. (B–G) Double whole-mount in situ displays showing the co-localization of expression of the endogenous spdri (stained ingold) and 4.7IL-GFP construct (dark brown). Developmental times are indicated. Expression of the trans-gene coincides with that of the endogenous gene at all the stages examined:at blastula stage (B) early and late mesenchyme blastula stage (C–F) mRNAs from both genes are present in PMCs. In this study we also noticed that expression of the gene ismaintained in post-ingression PMCs for a longer time than previously reported by Amore et al. (2003). This difference is due to the higher sensitivity of theWMISH procedure utilizedhere (Minokawa et al., 2005). At the onset of gastrulation expression of the endogenous gene as well as that of the trans-gene is switched off in PMCs and starts in the Oral Ectoderm(G). Because of mosaic incorporation, expression of the transcript is observed only in a portion of the whole spdri's territory. Past gastrula stage, expression of the trans-gene ismaintained in the Oral Ectoderm. (H) 4.7IL-driven GFP transcription is compared to that of spdri in the 13–48 h period by real-time quantitative PCR (qPCR). GFP mRNA content ineach sample was normalized (Revilla-i-Domingo et al., 2004). Accumulation of the endogenous spdri transcripts per embryo exceeds that of GFPmRNA by about 10 fold. However, therelative kinetics of construct and endogenous gene transcript accumulation are similar. (I) 4.7IL responds to the same regulators of spdri. GFPmRNA levels were measured in embryosinjected with 4.7IL alone, together with a randomized control morpholino antisense oligo-nucleotide (MASO), or with MASOs against each of the spdri's regulators and at thedevelopmental times indicated in the figure. Measurements were performed in two independent batches and averaged (standard deviations were below significance). MessengerRNA abundance was normalized to construct incorporation to allow comparison. No differences were observed between 4.7IL alone or 4.7IL and control MASO injected embryos (notshown). GFP mRNA levels are compared taking the level measured in control embryos as 1. A dashed line indicates the threshold of significance. Effects of the MASO injection areconsidered meaningful if GFP level is below 0.31.

428 A.A. Mahmud, G. Amore / Developmental Biology 322 (2008) 425–434

first exon; Fig.1A).Whenplaced in front of aGFP coding sequence, 4.7ILdrives transcription in the same territories where spdri's expression isnormally observed, while expression at ectopic locations is belowsignificance (5–10%). This is shown in Figs. 1B–G, where expression ofthe trans-gene and that of the endogenous gene is compared directlyby way of Double Whole-Mount In Situ Hybridization (DWMISH).

Expression of the trans-gene is never seen in fertilized eggs or inembryos before 13 h. From 15 h to 24 h the trans-gene is expressed inthe PMCs just as the endogenous gene is (Figs. 1B–F). Around the timeof gastrulation, transcripts from both the endogenous spdri gene andthe trans-gene disappear from PMCs and begin to accumulate in theprospectiveOral Ectoderm (Fig.1G). HereGFP expression ismaintained

Fig. 2. The PMCs' modules. (A) A selection of the constructs utilized in this study and alive mesenchyme blastula embryo showing fluorescence in the PMCs. Here and in Fig. 3the GFP cassette is omitted. (B) Expression of GFP in live embryos was scored at 24 h.Percentages of expression in PMCs (blue bars) or in ectopic locations (purple bars) areindicated. Number of embryos scored is indicated in parenthesis. Percentage of embryosexpressing in the PMCs decreases and that of embryos expressing ectopically increasesas progressive deletion of 3.0IL are tested. (C) Modules responsible for PMCs' expressionare mapped onto 4.7IL. The name of each module is given and the size (in nts) isindicated in parenthesis. Black arrows on the “PMCs+/Ectop−” module indicate the 5′boundaries of construct 2.9IL and 2.2IL. Deletions at these sites, progressively removesputative binding sites for activators. These are annotated and color coded as indicated inthe figure. Note that upstream of 2.9 two partially overlapping Ets sites are found. All thesites indicated were detected with both the “Mat-Inspector” and the “JASPAR” softwaretool, except for the “Extra Ets site” (blue arrow) which was only detected using“JASPAR”. (D) The effect of removing putative Ets1 and Alx1 sites from the 3.0–1.8module inside the 4.7IL, is assayed by scoring GFP expression in live embryos. Scoringresults are reported as in panel B. Binding sites are annotated as in panel C. Forsimplicity only the 3.0–18 portion is indicated. However embryos were injected withthe full 4.7IL construct, or versions of it that were missing the Ets1 sites and/or the Alx1sites as indicated in the panels E-G, representative embryos showing GFP fluorescenceonly in PMCs (E); in PMCs and in ectopic positions (F); or only ectopically (G). Theselatter were observed only upon injection of construct 4.7 E−A−.

429A.A. Mahmud, G. Amore / Developmental Biology 322 (2008) 425–434

until pluteus stage. These results show that 4.7IL can reproduce thespatial expression pattern of the spdri gene.

The ability of 4.7IL to reproduce the quantitative aspects of spdriexpression patternwas assayed by mean of real-time quantitative PCR(qPCR). The level of GFP mRNA transcripts accumulation in injectedembryos was comparedwith that of the endogenous spdri gene at fourdevelopmental stages (no expression of the construct was measuredat times earlier than 13 h) and in two batch of embryos (with nosignificant variations). These results are shown in Fig. 1H. As it isevident, the accumulation kinetic of the 4.7IL construct is similar tothat of the endogenous spdri gene. The level of this accumulationhowever differs quantitatively by a factor of about 10. A similar resultwas also obtained when the accumulation of the genes cyclophillin(Amore and Davidson, 2006) and delta (Revilla-i-Domingo et al.,2004) was compared to that of the GFP constructs that contained theirrelevant regulatory modules.

Finally we tested whether 4.7IL was responsive to some knownspdri's trans-activators: Ets1 (Oliveri and Davidson, 2004), Alx1(Ettensohn et al., 2003), Dri and Gsc (Amore et al., 2003). This wasdone by microinjecting zygotes with the trans-gene together withMorpholino Anti-Sense Oligonucleotides (MASOs) that specificallyprevented translation of each one of these transcription factors. Theabundance of GFP mRNA was measured at 20 h (in Ets1-MASO andAlx1-MASO injected embryos) and at 48 h (in Dri-MASO and Gsc-MASO injected embryos). This was compared with what found incontrol embryos (injected solelywith the trans-gene, or the trans-geneand a randomizedMASO), by RT-PCR. The results of Fig.1I report on theeffect recorded in two batches of embryos (with standard deviationsbelow significance) and clearly show thatMASOs against each of theseregulators depress expression of 4.7IL. In the case of Alx-MASOhowever, the effect observed is somewhat reduced if compared withother MASOs and barely below the significance threshold. In all caseswe confirmed that the effect of the MASOs injection on the expressionof the endogenous spdriwas according to published data (not shown).

Taken together the results shown in Fig. 1 demonstrate that 4.7IL issufficient to recapitulate spdri's expression pattern as the trans-geneexpresses in the same territories and at the same time, follows thesame kinetics and responds to the same regulators of the spdri gene.

The modules responsible for PMCs' expression

To define what portions of 4.7IL are responsible for spdri's earlyexpression in PMCs, we produced a series of deletion constructs, themost representative of which are shown in Fig. 2A. These constructswere injected in zygotes and GFP expression was observed in liveembryos at times between 20 h and 28 h of development (from lateblastula to early gastrula stage). The results of the scoring performedat 24 h (mesenchyme blastula stage) are reported in Fig. 2B. In theseembryos expression of GFP was scored as “PMCs” or “Ectopic” (non-PMC), given that when expression outside the PMCs was observed nopreference toward a specific territory could be noticed. Consistentresults were obtained at earlier or later stages (not shown). Ourinterpretation of the results is presented in Fig. 2C and it is as follows:correct spdri's expression in PMCs results from the integration ofpositive and negative inputs. Processing of these inputs happens at thefollowing three separate regions of the regulatory DNA:

1- A distal repressor, which prevents expression outside the PMCs'domain.2- A module that processes positive PMCs-specific inputs andwhich is needed to prevent expression in the rest of the embryo.3- A proximal module that responds to inputs distributed through-out the embryo.

1-The existence of a distal repressor is demonstrated by theconsequence of removing 100 bp from the 5′ extremity of 4.7IL.

Expression of the resulting construct (4.6IL) is observed in the samepercentage of the cases (more than 90%) in PMCs; however asignificantly higher percentage of embryos show ectopic expression(about 30% vs. 5–10%). This reveals the existence of a repressormodulelocated between the 5′-terminus of 4.7IL and the 5′-terminus of 4.6IL(“Ectop-4.7–4.6”; Fig. 2C). A search for putative repressor bindinginside this module was performed using the available online tools

Fig. 3. (A–C) The Oral Ectodermmodules. (A) A selection of the constructs utilized in thisstudy and a live gastrula embryo showing fluorescence in the Oral Ectoderm. (B)Expression of GFP in live embryos at 48 h of development. Scoring results are presentedin a table form for an easier identification of the functions identified inside 4.0IL.Percent of embryos expressing in the indicated territories and injected with theindicated constructs are given. Number of embryos scored is indicated in parenthesis.Note that we do not report expression in secondary mesenchyme cells, given that suchexpression was always below significant levels (5–10% at the most). (C) Modulesresponsible for Oral Ectoderm expression are mapped onto 4.0IL. On the left thefunction assigned to each module is indicated by the name (explained in the text). Theposition coordinates are indicated by numbers and the size of each module (in basepairs) is indicated in parenthesis.

430 A.A. Mahmud, G. Amore / Developmental Biology 322 (2008) 425–434

“JAPSPAR” and “Mat-Inspector” (see Materials and methods). How-ever this did not yield a reliable prediction, as the only binding sitesrecognized by both programs were for the E4BP4 transcriptionalrepressor (Cowell and Hurst, 1994), which is not expressed during seaurchin embryogenesis.

2-When deleting larger DNA portions from the 5′-terminus of the4.6IL construct, the same level of PMCs' and Ectopic expression ismaintained. This is until the 5′ extremity of construct 3.0IL is reached.Further removal of genomic DNA from the 5′-terminus of 3.0ILreduces expression in the PMCs territory and increases expression atectopic locations (constructs 3.0IL to 1.8IL). We believe that thismodule is needed to interpret PMC-specific inputs as well as toprevent ectopic expression, therefore we named it “PMCs+/Ectop−(3.0–1.8)”. Initially an in silico analysis of this DNA portion wasperformed using the “Mat-Inspector” software. This revealed thepresence of four and two putative binding sites for the transcriptionalactivator Ets1 (Consales and Arnone, 2002) and Alx1 (Ettensohn et al.,2003) respectively (Fig. 2C). Therefore we proceeded to the removal ofthese binding sites (see Materials and methods) and observed howsuch manipulation affected the expression pattern of our cis-regulatory sequence in 20–24 h old embryos (Fig. 2D). To our surprise,whenwe compared the expression of 4.7IL to that of constructs whereeither all the Ets1 sites (4.7 E−A+) or all the Alx1 sites (4.7 E+A−) or evenboth the Ets1 and Alx1 sites were removed (4.7 E−A−), no change inPMCs expression was observed. In all cases the totality of theexpressing embryos observed displayed fluorescence in these cells.However when both the Ets1 and Alx1 sites where eliminated, aconspicuous portion of the injected embryos displayed fluorescence inPMCs and at ectopic locations as well (three times or more comparedto the other constructs; Figs. 2E and F). The level at which this ectopicexpressionwas seenwas similar to that observed upon removal of thedistal repressor “Ectopic-4.7–4.6”. A further analysis of the sequenceof the module, performed using the “JASPAR” software, revealed thepresence of an additional Ets site just upstream of the 3′-end of themodule (indicated as “Extra Ets site” in Fig. 2D). Upon removal of thissite (construct 4.7 E−−A−) we observed some decrease in the number ofembryos expressing GFP in the PMCs (85% vs 100% observed with allthe other constructs). Removal of this site also produced a smallincrease in the level of ectopic expression. This is probably onlyapparent and it is due to the decrease of PMCs expression. Uponinjection of this construct we could also observe embryos thatdisplayed fluorescence only at ectopic locations (Fig. 2G): these werealmost never seen when injecting any of the other four constructs. Inall cases in which ectopic expression was observed, no bias toward aspecific territory was observed. When searching the sequence of the3.0–1.8 module, no reasonable prediction for putative repressorbinding sites was obtained. This is because, once again, the bindingsites identifiedwere for putative repressor factors not expressed in seaurchin embryo. Given that repression of ectopic expression could beaccounted for by removal of putative Ets1 and Alx1 sites, we decidednot to proceed further in our search.

3-Finally as the size of trans-gene is reduced to that of 1.8IL,expression at ectopic locations supersedes that in PMCs and theconstruct is expressed throughout the embryo with no clear biastoward a specific territory. Quantitatively the activity of 1.8IL resultedlower than that of the 3.0IL construct. We concluded that construct1.8IL receives the positive input of activators distributed in the wholeembryo and it is endowed with the properties of an ubiquitousenhancer (“Ubiq+ 1.8”; Fig. 2C).

The modules responsible for Oral Ectoderm expression

Through a similar analysis, we have determined how theexquisitely Oral Ectoderm activity of the 4.7IL construct, is achievedin post-invagination embryos. The positioning and size of the differentconstructs utilized, the live embryos' GFP-scoring analysis data and

our interpretation of the results are presented in Figs. 3A, B and Crespectively. The constructs shown in the figure, are part of a largercollection and only those useful to illustrate our conclusions areshown.

In this case, four different functions are integrated, which can beidentified as follows:

1- Oral Ectoderm-restricted expression driven by tissue-specificinputs.

2- Prevention of ectopic expression in Aboral Ectoderm and Gut(with no obvious bias toward one or the other tissue).

Fig. 4. Network architecture upstream of the spdri node in a “view from the genome”where all regulatory interactions are presented at once (Davidson, 2006). For the sakeof simplicity, only spdri's upstream connections are shown. In panels A and B arrowsare used for activation, barred lines for repression. The spdri gene is in purple or ingreen, similarly to what can be found in the current versions of the endomesodermand Oral Ectoderm GRNs respectively. In B the auto-activation of spdri is non-indicated. In panels A and B, all the inputs known before this study are indicated with ablack lettering. Those suggested by our results, with a red lettering. (A) Regulatoryinteractions at 15–24 h. Conservatively, only one “PMC-” input is shown acting on thedistal repressor [“Ectopic-” (4.7− 4–6)]. The “Ubiq+” input impinges on the proximalmodule [“Ubiq+”(1.8)]. (B) Regulatory interactions in post-invagination embryos. Wesuggest that hnf6 and/or otxb1/2 provide the oral-specific activation of spdri, throughthe “OE+” portion of the OEE module. However, for hnf6 the possibility exists that thisgene inputs spdri through gsc and not directly (Otim et al., 2004). Two separate“General+” inputs are presented, one operating through the proximal module and theother through the OEE module. This latter should not be present in the PMCscompartment [“General+ (non-PMCs)”]. The identity of the activator(s) present in theAboral Ectoderm and Gut remain to be defined. However Otxb1/2 might participate inactivation of spdri in the endoderm since it is expressed also in this territory (Yuh et al.,2002). We assign the function of repressor in the Aboral Ectoderm/Gut compartmentto “Repressor A”. Finally two separate “PMC off” inputs are presented to the genomicDNA: “PMC off A” (operating inside the OEE) and “PMC off B” (operating at the E0L3module), which are integrated through a AND logic.

431A.A. Mahmud, G. Amore / Developmental Biology 322 (2008) 425–434

3- Switch-off of PMCs' expression in post-invagination embryos.4- General (yet not ubiquitous) enhancer activity.

In the table of Fig. 3B, scoring results are presented so that thesefour functions can be easily distinguished. During this study, theactivity of the 4.7IL construct and that of a construct obtained bydeleting 833 nt at its 5′ extremity (construct 4.0IL) were found to beidentical at 48 h. Therefore in the following we compare the activity ofall the constructs tested to that of 4.0ILwhich is used here as reference.

1-We first identified a DNA fragment of 847 nt (position: −2623;−1776) that when cloned in Ep-GFP plasmid bearing a sea urchin basalpromoter (Cameron et al., 2004), was able to drive expressionexclusively in the Oral Ectoderm. We named this fragment OEE (OralEctoderm Enhancer). As it can be seen (Fig. 3B; activity of the OEE-GFPconstruct) minimal or no expression of this module was detected inthe PMCs or in the Aboral Ecotderm/Gut compartments of the embryo.GFP expression driven by this module started only after 24 h and itwas severely depressed when the construct was microinjectedtogether with Gsc-MASO (not shown). When portions at the 5′ ofthe OEEwere deleted expression in the Oral Ectodermwasmaintainedclose to 90%, until position 3.4 inside the module was reached. Afurther deletion (3.15OEE) resulted in a complete abolishment ofexpression in the Oral Ectoderm. Therefore we could localize OralEctoderm inputs inside the 278 nt between position 3.4 and 3.15 in theOEE (“OE+” module; Fig. 3C). When the OEE portion was removedfrom4.0IL and construct 3.0IL was obtained, the activity of the latter inthe Oral Ectoderm was reduced from more than 90%, to 60%.

2-When 100 bp were removed between position 3.8 and 3.7 insidethe OEE or inside the larger constructs 3.8IL, a significant ectopicexpression in Aboral Ectoderm and Gut was observed (30–40%;activity of 3.7OEE and 3.7IL constructs; Fig. 3B). Expression in thesetwo territories was observed without an obvious bias toward one orthe other. This indicates the existence of a repressor module locatedbetween positions 3.8 and 3.7 (“AE/G−”; Fig. 3C) required to preventectopic expression in Aboral Ectoderm (AE) and Gut (G).

3-Construct 3.8IL shows a level of GFP expression in PMCs belowsignificance (b10%; Fig. 3B). Instead, a deletion that results in the 3.0ILconstruct, maintains expression in PMCs at significant levels (about40%). A similar result is obtained when 156 nt at the 3′ terminus of thefirst exon are removed to obtain construct 4.0E0L3. Therefore afterinvagination of the archenteron, spdri's expression in PMCs isextinguished through a repression mechanism operated at twodistinct portions of the genomic regulatory DNA (“PMC− 3.8–3.0”and “PMC− E0L3”; Fig. 3C).

4-The observation that construct 3.7OEE expresses in AboralEctoderm and Gut reveals that the 3.7–3.0 DNA fragment can respondto inputs present also in these two territories. Similarly, whenfragment 2.2E0L was tested, GFP expression was observed in thesame tissues (in both cases some expression in the SMCs wasobserved, but always at levels below significance). These twofragments are therefore endowed with the properties of non-tissue-specific enhancers. However two important differences betweenthese constructs exist: I- while 3.7OEE is able to respond to oral-specific inputs and therefore to drive expression in the oral territory inalmost the totality of the embryos in which it is injected (not shownfor simplicity: oral expression data are identical to those obtainedwith 3.4OEE), that is not the case for 2.2E0Lwhich drives expression inthe Oral Ectoderm only in 60% of the injected embryos. II-Embryosinjected with construct 2.2E0L maintain expression in the PMCs at48 h, while this activity is absent from the OEE.

Discussion

In this paper we have presented an initial characterization of thecis-regulatory region of the sea urchin gene spdri. We have shownthat this portion of genomic DNA can reproduce both the qualitative

and quantitative aspects of the endogenous gene's expression pattern.In the followingwe discuss its structure and how this is relevant in thecontext of sea urchin PMCs' and Oral Ectoderm's GRNs.

Elements of spdri's cis-regulatory system

The proximal moduleEven when reduced to the size of the 1.8IL (at 24 h) or 2.2E0L (at

48 h) fragments, our trans-gene would drive GFP expression.However GFP fluorescence was observed throughout the embryowith no obvious bias toward a particular territory. Therefore wepropose that the region from 2.2–1.8 down to the transcriptional startsite functions as a proximal, non-tissue-specific, enhancer responsiveto globally distributed positive inputs (“Ubiq+” in Fig. 4A; “General+”in Fig. 4B).

The PMCs' module(s)Spdri activation in PMCs requires the positive input of ets1 and

alx1, expression of which is already restricted in that territory atleast 2 h before the onset of spdri's transcription. Therefore thelocalized expression of these two regulatorswas thought to be enoughto explain spdri tissue-specific expression and even in the most recentversion of the PMCs' GRN, spdri only receives the inputs of these two

432 A.A. Mahmud, G. Amore / Developmental Biology 322 (2008) 425–434

activators. By isolating spdri's cis-regulatory regionwe have confirmedthat these factors regulate its expression (Fig. 1I).

The results of the experiments presented in Fig. 2, suggest that (atleast some of) the PMC-specific inputs are located inside the 3.0–1.8module. This because while expression of 3.0IL construct is observedin about 100% of the cases in PMCs, this level of expression drops toabout 50% in the case of 1.8IL. However, when all the putative Ets1 andAlx1 binding sites inside this module were removed, the greatmajority of the GFP-positive embryos maintained expression in thosecells. Therefore we believe that other Ets1 and Alx1 binding sitesmight be present in the 4.7IL cis-regulatory region, that sustainexpression of the trans-gene, even in the absence of the sites insidethe “3.0–1.8” module. It is also likely that other transcriptionalactivators, input the gene in the PMCs territory. The inputs processedat these sites (the ones we identified and those that escaped ouranalysis) might be processed through an OR logic (Istrail et al., 2007)so that partial elimination of them reduces but does not abolish thetranscriptional output in the PMCs.

Although removal of Ets1 and Alx1 sites inside the 3.0–1.8 moduleaffects expression in the PMCs only marginally (Fig. 2D; construct 4.7E−−A−), deletion of these sites produces a significant increase inectopic expression of our constructs. It is possible that repression ofectopic expression operated at these sites works through a cycling ofthe 3.0–1.8 module. This would bring it in proximity of the basalpromoter, “closing” the regulatory DNA in a configuration that wouldnot allow the activity of the proximal module; this may happen ifeither the functionality of the Ets1 or that of the Alx1 sites wasmaintained. The absence of both sites would destroy this mechanism.Therefore the inputs presented at these sites are integrated followingan OR logic (Istrail et al., 2007). It is possible that Ets1 proteinparticipates to this repression mechanism as maternal Ets1 is presentubiquitously early on and the protein might remain active at laterstages (Rizzo et al., 2006); furthermore it has been shown that Etsprotein can act both as an activator or a repressor, depending on thetranscriptional context in which it operates (Goldberg et al., 1994). Onthe other hand no ubiquitous Alx1 expression has been reported,therefore some other unknown factor must bind these putative sitesoutside the PMCs. As it can be observed in Fig. 2B, progressivedeletions of the module produce an apparent increase of ectopicexpression (compare constructs 3.0IL, 2.9IL, 2.2IL and 1.8IL); this isprobably only an effect of the loss of activity of the constructs in PMCs.Consistent with this is the fact that we were unable to obtain areasonable prediction of sites for putative repressors, as all thoseidentified in silico were either for factors that are not expressed at allin embryogenesis, or that are not expressed in a way consistent with arepressor function outside the PMCs territory.

Finally, spatial restriction of spdri expression requires the activityof the distal repressor “Ectop− (4.7–4.6)”. This module is solelydedicated to repression of ectopic spdri's activation in its early phaseof expression and it is physically separated from the 3.0–1.8module bymore than 1 Kb of genomic DNA. Interestingly the level of ectopicexpression observed upon removal of this module is similar to whatobserved upon removal of Ets1 and Alx1 putative sites from the 3.0–1.8 module. Together with the results discussed above, this suggests arepression mechanism where the functionality of the Ets1 and Alx1sites inside “3.0–1.8” is necessary to mediate a contact between thismodule and other regions of the genomic DNA. As a result theregulatory DNA would loop, bringing the distal repressor close to thebasal promoter, repressing transcription. More functional tests arehowever needed to fully understand how the integration of positiveand negative inputs happens inside and between these modules sothat precise expression in the PMCs can be obtained. Nonetheless, ourobservations allow us to propose the existence of at least one negativeinput acting in the whole embryo but the PMCs (“non-PMC− ”).Thedistal repressor “Ectop− (4.7–4.6)” would be the recipient of such ainput (Fig. 4A).

The oral module(s)According to a previous perturbation analysis study (Amore et al.,

2003), spdri onset of expression in the Oral Ectoderm is obtainedthrough the integration of two distinct inputs. The first is a positiveone dubbed “Oral activator” which is supposed to be provided by anorally restricted transcriptional activator. Such an input could be infact the combination of hnf6 and otxb1/2 inputs as both genes activatespdri, as indicated in the recently made available version of the OralEctoderm Gene Regulatory Network (http://sugp.caltech.edu/endomes/#EctoNetworkDiagram). The second was the result of thedouble repression circuit involving gsc and “Repressor A” (Fig. 4B). Inthe present study, we identified two distinct portions inside the OEEmodule: one endowed with an activation function which allows spdrioral-specific expression (“OE+”), which could receive the input of otxb1/2 and hnf6; another featuring a repression functionwhich preventsactivation of the gene in the Aboral Ectoderm/Gut compartment (“AE/G−”), which might be the recipient of the “Repressor A” input. Theexistence of the repression operated by this fragment also indicatesthat a generic yet non-ubiquitous (non-PMC) enhancer activity isintrinsic to the OEE: this becomes evident upon removal of therepressor element. A complete picture of spdri upstream regulatoryconnection map should therefore also include a “General+(non-PMC)” input into the OEE.

A fourth function also present in the OEE module, is required toextinguish expression in the PMCs after ingression is completed [PMC−(3.8–3.0)]. In the absence of this function, continued expression inPMCs in the post-gastrular embryos is observed. Most likely this is dueto the activity of the “proximal module” and not of the “PMC+/Ectopic−(3.0–1.8)”module. This because the percentage of embryos that expressthe trans-gene in the PMCs is similar when either the 3.0IL fragment orthe 2.2E0L are assayed: in both cases far from100% (see table in Fig. 3B).Therefore putting off of spdri expression in PMCs is due to the activerepression operated by the OEE on the proximal module. Thisrepression is obtained through the binding of factors that operate inconcert with those binding the E0L3 segment, at the 3′-terminus of thefirst exon: none of the two “PMC off” functions alone is sufficient as thepercentage of embryos thatmaintain expression in these cells is similarwhen either (or both) are eliminated. Therefore the inputs processedthrough these two genomic DNA segments are most likely integratedthrough an AND kind of logic (Istrail et al., 2007). We summarize allthese hypotheses in the regulatory map proposed in Fig. 4B.

Features of spdri's cis-regulatory region and relationship to the gene'sposition in the GRNs in which it operates

A first look at spdri's cis-regulatory DNA conveys the idea that afairly complex apparatus is in place to ensure proper expression ofthe gene. The question then arises of how such a level ofcomplexity reflects the gene's position inside the GRNs in whichit operates.

Both in the PMCs and in the Oral Ectoderm, expression of spdrifollows initial specification events and expression of the gene isnecessary for cell differentiation. In PMCs Spdri is required for theexpression of signaling capabilities and the protein plays an importantrole during skeletogenesis (Amore et al., 2003). Elaboration of thecalcareous skeleton is a complexmulti-step process: after ingression inthe blastocoel, PMCs emit phylopodia and contact themselves; theycontact the cells in the ectodermalwall to receive patterning cues; theyarrange in a ring-like pattern, with two clusters facing the vegetal–oralside of the ectoderm; theyestablish a network of syncitial cables;finallythey secrete the skeletal spicules (Wilt, 1999). Spdri participate in twoways to the entire process: PMCs require Spdri activity to correctlyinterpret patterning cues (Amore et al., 2003). Spdri also directlyactivates at least two PMCs' differentiation product encoding genes:spcyclo (Amore and Davidson, 2006) and sm50 (http://sugp.caltech.edu/endomes/). The activity of the protein is also necessary for the

433A.A. Mahmud, G. Amore / Developmental Biology 322 (2008) 425–434

expression of sm30 in these cells, probably through indirect mechan-isms (Amore et al., 2003).

Specification of the Oral Ectoderm also proceeds in steps and froma seemingly homogeneous territory, sub-domain soon emerge withwell established differential gene expression patterns. Activation ofthe gene is necessary for the expression of regulators in sub-regions ofthe oral field (e.g. nk1, nk2.1). Furthermore, activation of sm30 in PMCsdepends on the oral expression of spdri (Amore et al., 2003).

Along the path that leads from initial specification to differentia-tion, a critical step is the one that sees the locking of the specificationstate by installment of regulatory feed-back loops. These are used toensure maintenance of the specification state by freeing it from itsinitial dependence upon transient (maternal) anisotropies. In PMCs,loops of such a kind are established between the genes erg, hex andtgif (Oliveri et al., 2008); in the Oral Ectoderm spdri itself engages ina regulatory embrace with the gene gsc (Amore et al., 2003). Both inPMCs and in Oral Ectoderm, expression of the spdri gene begins beforesuch loops are established and it is maintained throughout: the onsetand continued expression of spdri happens contemporaneously to theprogression of the cells from an un-committed state to a fullycommitted condition. This might be reflected by the quality of theinputs presented to spdri's cis-regulatory region, as the combinationof global activators and general (non-PMC or non-Oral Ectoderm)repressors on one hand, and the set of tissue-specific activators on theother, might act on spdri cis-regulatory DNA at separate timesparalleling such progression. Therefore the complexity of spdri cis-regulation might be necessary simply to accommodate the changingregulatory state of the cells in which it is expressed.

Acknowledgments

We would like to express a special thanks to Dr. E. H. Davidson(Caltech, Pasadena, CA, USA) and Dr. M. I. Arnone (Stazione ZoologicaNapoli, SZN, Italy) for critical reading of the initial version of thismanuscript and toMrs. L. Bellavia, Mrs. F. Parveen andMrs. C. Garofalofor constant encouragement; to Dr. E. H. Davidson for support at thebeginning of this project and to Prof. G. Bernardi (SZN) for supportthroughout; to Dr. E. Brown, Dr. M.I. Arnone and Mr. S. Bocchetti forhelp in the initial phase of this project; to the technical staff of SZN forhelp and assistance throughout.

This work was funded in part by the Marie Curie MIRG-CT-2006-036543 Grant.

References

Amore, G., Davidson, E., 2006. cis-Regulatory control of cyclophilin, a member of the ETS-DRI skeletogenic gene battery in the sea urchin embryo. Dev. Biol. 293, 555–564.

Amore, G., Yavrouian, R., Peterson, K., Ransick, A., McClay, D., Davidson, E., 2003.Spdeadringer, a sea urchin embryo gene required separately in skeletogenic andoral ectoderm gene regulatory networks. Dev. Biol. 261, 55–81.

Angerer, L., Oleksyn, D., Levine, A., Li, X., Klein, W., Angerer, R., 2001. Sea urchingoosecoid function links fate specification along the animal–vegetal and oral–aboral embryonic axes. Development 128, 4393–4404.

Bradham, C., McClay, D., 2006. p38 MAPK is essential for secondary axis specificationand patterning in sea urchin embryos. Development 133, 21–32.

Brown, C., Rust, A., Clarke, P., Pan, Z., Schilstra, M., De Buysscher, T., Griffin, G., Wold, B.,Cameron, R., Davidson, E., Bolouri, H., 2002. New computational approaches foranalysis of cis-regulatory networks. Dev. Biol. 246, 86–102.

Cai, R.,1998. Human CART1, a paired-class homeodomain protein, activates transcriptionthrough palindromic binding sites. Biochem. Biophys. Res. Commun. 250, 305–311.

Cameron, R., Oliveri, P., Wyllie, J., Davidson, E., 2004. cis-Regulatory activity of randomlychosen genomic fragments from the sea urchin. Gene. Expr. Patterns 4, 205–213.

Coffman, J., Denegre, J., 2007. Mitochondria, redox signaling and axis specification inmetazoan embryos. Dev. Biol. 308, 266–280.

Coffman, J., McCarthy, J., Dickey-Sims, C., Robertson, A., 2004. Oral–aboral axisspecification in the sea urchin embryo II. Mitochondrial distribution and redoxstate contribute to establishing polarity in Strongylocentrotus purpuratus. Dev. Biol.273, 160–171.

Consales, C., Arnone, M., 2002. Functional characterization of Ets-binding sites in the seaurchin embryo: three base pair conversions redirect expression from mesoderm toectoderm and endoderm. Gene 287, 75–81.

Cowell, I., Hurst, H., 1994. Transcriptional repression by the human bZIP factor E4BP4:definition of a minimal repression domain. Nucleic Acids Res. 22, 59–65.

Davidson, E., 2006. The regulatory genome. Gene Regulatory Networks in Developmentand Evolution. Elsevier-Academic Press.

Duboc, V., Lepage, T., 2006. A conserved role for the nodal signaling pathway in theestablishment of dorso-ventral and left–right axes in deuterostomes. J. Exp. Zoolog.B. Mol. Dev. Evol.

Duboc, V., Röttinger, E., Besnardeau, L., Lepage, T., 2004. Nodal and BMP2/4 signalingorganizes the oral–aboral axis of the sea urchin embryo. Dev Cell 6, 397–410.

Ettensohn, C., Illies, M., Oliveri, P., De Jong, D., 2003. Alx1, a member of the Cart1/Alx3/Alx4 subfamily of Paired-class homeodomain proteins, is an essential component ofthe gene network controlling skeletogenic fate specification in the sea urchinembryo. Development 130, 2917–2928.

Goldberg, Y., Treier, M., Ghysdael, J., Bohmann, D., 1994. Repression of AP-1-stimulatedtranscription by c-Ets-1. J. Biol. Chem. 269, 16566–16573.

Hobert, O., 2002. PCR fusion-based approach to create reporter gene constructs forexpression analysis in transgenic C. elegans. Biotechniques 32, 728–730.

Istrail, S., De-Leon, S., Davidson, E., 2007. The regulatory genome and the computer. Dev.Biol. 310, 187–195.

Martin, E., Consales, C., Davidson, E., Arnone, M., 2001. Evidence for a mesodermalembryonic regulator of the sea urchin CyIIa gene. Dev. Biol. 236, 46–63.

McMahon, A., Flytzanis, C., Hough-Evans, B., Katula, K., Britten, R., Davidson, E., 1985.Introduction of cloned DNA into sea urchin egg cytoplasm: replication andpersistence during embryogenesis. Dev. Biol. 108, 420–430.

Minokawa, T., Wikramanayake, A., Davidson, E., 2005. cis-Regulatory inputs of the wnt8gene in the sea urchin endomesoderm network. Dev. Biol. 288, 545–558.

Nam, J., Su, Y., Lee, P., Robertson, A., Coffman, J., Davidson, E., 2007. Cis-regulatorycontrol of the nodal gene, initiator of the sea urchin oral ectoderm gene network.Dev. Biol. 306, 860–869.

Oliveri, P., Davidson, E., 2004. Gene regulatory network analysis in sea urchin embryos.Methods Cell Biol. 74, 775–794.

Oliveri, P., Carrick, D., Davidson, E., 2002. A regulatory gene network that directsmicromere specification in the sea urchin embryo. Dev. Biol. 246, 209–228.

Oliveri, P., Davidson, E., McClay, D., 2003. Activation of pmar1 controls specification ofmicromeres in the sea urchin embryo. Dev. Biol. 258, 32–43.

Oliveri, P., Tu, Q., Davidson, E., 2008. Global regulatory logic for specification of anembryonic cell lineage. Proc. Natl. Acad. Sci. U. S. A. 105, 5955–5962.

Otim, O., Amore, G., Minokawa, T., McClay, D., Davidson, E., 2004. SpHnf6, atranscription factor that executes multiple functions in sea urchin embryogenesis.Dev. Biol. 273, 226–243.

Revilla-i-Domingo, R., Minokawa, T., Davidson, E., 2004. R11: a cis-regulatory node ofthe sea urchin embryo gene network that controls early expression of SpDelta inmicromeres. Dev. Biol. 274, 438–451.

Revilla-i-Domingo, R., Oliveri, P., Davidson, E., 2007. A missing link in the sea urchinembryo gene regulatory network: hesC and the double-negative specification ofmicromeres. Proc. Natl. Acad. Sci. U. S. A. 104, 12383–12388.

Rizzo, F., Fernandez-Serra, M., Squarzoni, P., Archimandritis, A., Arnone, M., 2006.Identification and developmental expression of the ets gene family in the seaurchin (Strongylocentrotus purpuratus). Dev. Biol. 300, 35–48.

Sodergren, E., Weinstock, G., Davidson, E., Cameron, R., Gibbs, R., Angerer, R., Angerer, L.,Arnone, M., Burgess, D., Burke, R., Coffman, J., Dean, M., Elphick, M., Ettensohn, C.,Foltz, K., Hamdoun, A., Hynes, R., Klein, W., Marzluff, W., McClay, D., Morris, R.,Mushegian, A., Rast, J., Smith, L., Thorndyke, M., Vacquier, V., GM, W., G, W., Zhang,L., Elsik, C., Ermolaeva, O., Hlavina, W., Hofmann, G., Kitts, P., Landrum, M., Mackey,A., Maglott, D., Panopoulou, G., Poustka, A., Pruitt, K., Sapojnikov, V., Song, X.,Souvorov, A., Solovyev, V., Wei, Z., Whittaker, C., Worley, K., Durbin, K., Shen, Y.,Fedrigo, O., Garfield, D., Haygood, R., Primus, A., Satija, R., Severson, T., Gonzalez-Garay, M., Jackson, A., Milosavljevic, A., Tong, M., Killian, C., Livingston, B., Wilt, F.,Adams, N., Belle, R., Carbonneau, S., Cheung, R., Cormier, P., Cosson, B., Croce, J.,Fernandez-Guerra, A., Geneviere, A., Goel, M., Kelkar, H., Morales, J., Mulner-Lorillon, O., Robertson, A., Goldstone, J., Cole, B., Epel, D., Gold, B., Hahn, M., Howard-Ashby, M., Scally, M., Stegeman, J., Allgood, E., Cool, J., Judkins, K., McCafferty, S.,Musante, A., Obar, R., Rawson, A., Rossetti, B., Gibbons, I., Hoffman, M., Leone, A.,Istrail, S., Materna, S., Samanta, M., Stolc, V., Tongprasit, W., Tu, Q., Bergeron, K.,Brandhorst, B., Whittle, J., Berney, K., Bottjer, D., Calestani, C., Peterson, K., Chow, E.,Yuan, Q., Elhaik, E., Graur, D., Reese, J., Bosdet, I., Heesun, S., Marra, M., Schein, J.,Anderson, M., Brockton, V., Buckley, K., Cohen, A., Fugmann, S., Hibino, T., Loza-Coll,M., Majeske, A., Messier, C., Nair, S., Pancer, Z., Terwilliger, D., Agca, C., Arboleda, E.,Chen, N., Churcher, A., Hallbook, F., Humphrey, G., Idris, M., Kiyama, T., Liang, S.,Mellott, D., Mu, X., Murray, G., Olinski, R., Raible, F., Rowe, M., Taylor, J., Tessmar-Raible, K., Wang, D., Wilson, K., Yaguchi, S., Gaasterland, T., Galindo, B., Gunaratne,H., Juliano, C., Kinukawa, M., Moy, G., Neill, A., Nomura, M., Raisch, M., Reade, A.,Roux, M., Song, J., Su, Y., Townley, I., Voronina, E., Wong, J., Amore, G., Branno, M.,Brown, E., Cavalieri, V., Duboc, V., Duloquin, L., Flytzanis, C., Gache, C., Lapraz, F.,Lepage, T., Locascio, A., Martinez, P., Matassi, G., Matranga, V., Range, R., Rizzo, F.,Rottinger, E., Beane, W., Bradham, C., Byrum, C., Glenn, T., Hussain, S., Manning, F.,Miranda, E., Thomason, R., Walton, K., Wikramanayke, A., Wu, S., Xu, R., Brown, C.,Chen, L., Gray, R., Lee, P., Nam, J., Oliveri, P., Smith, J., Muzny, D., Bell, S., Chacko, J.,Cree, A., Curry, S., Davis, C., Dinh, H., Dugan-Rocha, S., Fowler, J., Gill, R., Hamilton, C.,Hernandez, J., Hines, S., Hume, J., Jackson, L., Jolivet, A., Kovar, C., Lee, S., Lewis, L.,Miner, G., Morgan, M., Nazareth, L., Okwuonu, G., Parker, D., Pu, L., Thorn, R., Wright,R., 2006. The genome of the sea urchin Strongylocentrotus purpuratus. Science 314,941–952.

Tu, Q., Brown, C., Davidson, E., Oliveri, P., 2006. Sea urchin Forkhead gene family:phylogeny and embryonic expression. Dev. Biol. 300, 49–62.

434 A.A. Mahmud, G. Amore / Developmental Biology 322 (2008) 425–434

Wilsker, D., Patsialou, A., Dallas, P., Moran, E., 2002. ARID proteins: a diverse family ofDNA binding proteins implicated in the control of cell growth, differentiation, anddevelopment. Cell Growth Differ. 13, 95–106.

Wilsker, D., Probst, L., Wain, H., Maltais, L., Tucker, P., Moran, E., 2005. Nomenclature ofthe ARID family of DNA-binding proteins. Genomics 86, 242–251.

Wilt, F.,1999.Matrix andmineral in the sea urchin larval skeleton. J. Struct. Biol.126, 216–226.Yon, J., Fried, M., 1989. Precise gene fusion by PCR. Nucleic Acids Res. 17, 4895.Yuh, C., Brown, C., Livi, C., Rowen, L., Clarke, P., Davidson, E., 2002. Patchy interspecific

sequence similarities efficiently identify positive cis-regulatory elements in the seaurchin. Dev. Biol. 246, 148–161.