the trehalose synthesis pathway is an integral part of the ... · formation, are controlled by this...

INFECTION AND IMMUNITY, Oct. 2009, p. 4584–4596 Vol. 77, No. 100019-9567/09/$08.00�0 doi:10.1128/IAI.00565-09Copyright © 2009, American Society for Microbiology. All Rights Reserved.

The Trehalose Synthesis Pathway Is an Integral Part of the VirulenceComposite for Cryptococcus gattii�§

Popchai Ngamskulrungroj,1,2,3 Uwe Himmelreich,4 Julia A. Breger,5 Christabel Wilson,6Methee Chayakulkeeree,1,3,6 Mark B. Krockenberger,7 Richard Malik,7

Heide-Marie Daniel,8 Dena Toffaletti,1 Julianne T. Djordjevic,6Eleftherios Mylonakis,5 Wieland Meyer,2 and John R. Perfect1*

Department of Medicine, Duke University Medical Center, Durham, North Carolina1; Molecular Mycology Research Laboratory,Centre for Infectious Diseases and Microbiology, Westmead Millennium Institute, University of Sydney at Westmead Hospital,

Westmead, New South Wales, Australia2; Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand3;Biomedical NMR Unit/MoSAIC, Faculty of Medicine, Katholieke Universiteit Leuven, Leuven, Belgium4;

Massachusetts General Hospital, Boston, Massachusetts5; Fungal Pathogenesis Research Group, Centre forInfectious Diseases and Microbiology, Westmead Millennium Institute, Westmead Hospital,

Westmead, New South Wales, Australia6; Faculty of Veterinary Science, University ofSydney, Camperdown, New South Wales, Australia7; and Mycotheque de

l’Universite Catholique de Louvain, Louvain-la-Neuve, Belgium8

Received 20 May 2009/Returned for modification 20 June 2009/Accepted 29 July 2009

The trehalose pathway is essential for stress tolerance and virulence in fungi. We investigated the importance ofthis pathway for virulence of the pathogenic yeast Cryptococcus gattii using the highly virulent Vancouver Island,Canada, outbreak strain R265. Three genes putatively involved in trehalose biosynthesis, TPS1 (trehalose-6-phosphate [T6P] synthase) and TPS2 (T6P phosphatase), and degradation, NTH1 (neutral trehalose), were deletedin this strain, creating the R265tps1�, R265tps2�, and R265nth1� mutants. As in Cryptococcus neoformans, cellulartrehalose was reduced in the R265tps1� and R265tps2� mutants, which could not grow and died, respectively, at37°C on yeast extract-peptone-dextrose agar, suggesting that T6P accumulation in R265tps2� is directly toxic.Characterizations of the cryptococcal hexokinases and trehalose mutants support their linkage to the control ofglycolysis in this species. However, unlike C. neoformans, the C. gattii R265tps1� mutant demonstrated, in addition,defects in melanin and capsule production, supporting an influence of T6P on these virulence pathways. Attenuatedvirulence of the R265tps1� mutant was not due solely to its 37°C growth defect, as shown in worm studies andconfirmed by suppressor mutants. Furthermore, an intact trehalose pathway controls protein secretion, mating, andcell wall integrity in C. gattii. Thus, the trehalose synthesis pathway plays a central role in the virulence compositesof C. gattii through multiple mechanisms. Deletion of NTH1 had no effect on virulence, but inactivation of thesynthesis genes, TPS1 and TPS2, has profound effects on survival of C. gattii in the invertebrate and mammalianhosts. These results highlight the central importance of this pathway in the virulence composites of both pathogeniccryptococcal species.

Cryptococcus gattii, a member of the Cryptococcus speciescomplex, is a pathogenic basidiomycetous yeast known to causediseases mainly in immunocompetent humans and animals. Itis environmentally associated with a variety of trees in tropicaland subtropical climates (5, 32, 36). Recently, an outbreak ofcryptococcosis occurred among apparently nonimmunocom-promised humans and a variety of animal species on Van-couver Island, western Canada, due to the C. gattii VGIImolecular type that has raised the importance of studyingthe virulence traits of this species. The outbreak strains be-longed to two submolecular types, VGIIa and VGIIb (28). Onestrain of the major population of the outbreak, R265 (typeVGIIa), was found to be the most virulent of several testedstrains (17). In contrast, another member of the Cryptococcus

species complex, Cryptococcus neoformans, is known to be anopportunistic pathogen with a worldwide distribution and amajor cause of fungal meningoencephalitis in immunosup-pressed patients, especially human immunodeficiency virus-positive patients (43).

After a dramatic increase in cases of cryptococcosis as a con-sequence of the AIDS epidemic (6), molecular biological studiesof Cryptococcus species began to prosper, and they became modelyeasts for studies of fungal pathogenesis. A number of virulencefactors of the Cryptococcus species complex have been identi-fied, which include (i) melanin synthesis, (ii) production of apolysaccharide capsule, (iii) urease, (iv) phospholipase produc-tion, and (v) the ability to grow at 37°C (6). Through molecularstudies, dozens of genes have been linked to the virulencecomposites of both pathogenic cryptococcal species (44). Incontrast to those characterizing the virulence of C. neoformans,molecular studies characterizing the virulence of C. gattii aremeager. Only a few genes, such as those for phospholipase B,superoxide dismutase, a transcription factor, and protein ki-nases, have been studied in C. gattii in connection with patho-genesis (19, 23, 35, 38, 48, 54). Despite the close evolutionary

* Corresponding author. Mailing address: Box 102359, Duke Uni-versity Medical Center, Durham, NC 27710. Phone: (919) 684-4016.Fax: (919) 684-8902. E-mail: [email protected].

§ Supplemental material for this article may be found at http://iai.asm.org/.

� Published ahead of print on 3 August 2009.

4584

on May 2, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

relationships of these species, several studies have shown dif-ferences in gene expressions between the two species (25),supporting potential differences in gene regulations and theuse of signaling pathways for virulence gene expression.

The simple ability of pathogenic yeasts to withstand severeenvironmental stresses is mandatory for their survival in humans.For the successful establishment of infection in the mammalianhost, efficient protective high-temperature survival mechanismsare indispensable. The nonreducing disaccharide trehalose hasbeen reported to be a vital protector of proteins and a biologicalmembrane stabilizer under a variety of stresses, including heat,cold, starvation, desiccation, osmotic or oxidative stress, expo-sure to toxicants, and hypoxia in yeasts (10). The disaccharidehas been found in bacteria and certain eukaryotic microorgan-isms, such as fungi, plants, insects, and invertebrates, but not invertebrates (20). This pathway, unique in yeasts compared tomammals, suggests that trehalose and its pathway might be anattractive potential drug target if it is essential to a microbe’ssurvival in the host (15, 52).

In fungi, trehalose has been shown to be rapidly induced toincrease an organism’s resistance to both external and internalstresses (20). Despite consisting of only a few metabolites andsimple enzymatic steps, its regulatory organization and pro-cesses are surprisingly complex (52). Based on studies of Sac-charomyces cerevisiae, at least seven genes are involved in thetrehalose pathway (20). Trehalose is synthesized by two steps,starting from uridine-diphosphoglucose and glucose-6-P (29).The two catalyzing enzymes, trehalose-6-phosphate (T6P) syn-thase and T6P phosphatase, form a complex with two otherproteins, Tsl1 and Tps3, in order to synthesize trehalose. Thelast proteins are associated with the stability of the complexand are highly homologous to each other (1). Trehalose istransported to wherever it is needed within the cell. The neu-tral trehalase, encoded by the NTH1 gene, will then hydrolyzethe utilized trehalose to two molecules of glucose after it istransported back into the cytosol (39).

Studies to determine the connections between trehalose andvirulence have previously been conducted on certain patho-genic fungi, including Candida albicans (51, 55, 57), Magna-porthe grisea (16), and more recently, C. neoformans (37, 46).These studies showed that not only the phenotype of high-temperature growth, but also cell wall integrity and hyphal

formation, are controlled by this pathway. Ultimately, this net-work had an impact on fungal pathogenicity (37, 46).

In the current study, we examined the function of thetrehalose synthesis pathway in the C. gattii strain R265, ahighly virulent strain from the Vancouver Island outbreak(17), through mutations of its synthesizing genes, TPS1 andTPS2, and a degrading enzyme gene, NTH1. Deletions ofthe synthesizing genes in C. gattii revealed a profound defecton high-temperature growth in the generated mutants and,thus, attenuated virulence in the mammalian host. No apparentphenotype was found in the deletion of the hydrolyzing gene.In contrast to that in C. neoformans, melanin synthesis, capsuleproduction, mating, cell wall integrity, and protein secretiondefects were uniquely observed in the tpsl� mutant of C. gattii,demonstrating that this pathway has evolved differently in thetwo closely related cryptococcal species. The knowledge ob-tained from the current study allows for the mapping of aproposed trehalose synthesis pathway in C. gattii (Fig. 1).

MATERIALS AND METHODS

Strains and medium. Strains used in this study are listed in Table 1. Mutantsand complemented strains of the wild-type strain R265, a C. gattii, VGIIa,serotype B, mating type � clinical isolate from the Vancouver Island outbreak(28), and CBS1930, a C. gattii, VGII, serotype B veterinary isolate from Aruba(3), were created by biolistic transformation (50). A wild-type strain of C. neo-formans var. grubii (strain H99) (45) and its mutants (46) were retrieved from theculture collection of the Duke University Mycological Research Unit (Table 1).All strains were maintained on nonselective yeast extract-peptone-dextrose(YPD) agar (1% yeast extract, 2% peptone, 2% glucose, 2% agar).

Nucleic acid isolation. Genomic DNA was extracted according to a previouslydescribed method (47). RNA was extracted by using the TRIzol reagent accord-ing to the manufacturer’s protocol (Invitrogen, CA).

FIG. 1. Trehalose synthesis pathway in C. gattii. Black and dashedarrows represent proven and proposed regulations of the pathway,respectively. � and � represent negative and positive regulation, re-spectively.

TABLE 1. Strains used in this study

Strain Description Source orreference

R265 C. gattii wild-type VGII matingtype �

28

CBS1930 C. gattii wild-type VGII matingtype a

3

H99 C. neoformans var. grubii wild-typemating type �

45

R265tps1� tps1� mutant of R265 This studyR265tps2� tps2� mutant of R265 This studyR265tps2�S tps2� mutant suppressor of R265 This studyR265nth1� nth1� mutant of R265 This studyR265tps1�::TPS1 tps1� reconstituted strain of R265 This studyR265tps2�::TPS2 tps2� reconstituted strain of R265 This studyR265nth1�::NTH1 nth1� reconstituted strain of R265 This studyR265hxk1� hxk1� mutant of R265 This studyR265tps1�hxk1� tps1� and hxk1� mutant of R265 This studyR265tps2�hxk1� tps2� and hxk1� mutant of R265 This studyR265hxk2� hxk2� mutant of R265 This studyR265tps1�hxk2� tps1� and hxk2� mutant of R265 This studyR265tps2�hxk2� tps2� and hxk2� mutant of R265 This studyR265hxk1�::HXK1 hxk1� reconstituted strain of R265 This studyCBS1930tps1� tps1� mutant of CBS1930 This studyCBS1930tps2� tps2� mutant of CBS1930 This studyCBS1930tps2�S tps2� mutant suppressor of

CBS1930This study

CBS1930nth1� nth1� mutant of CBS1930 This studyH99tps1� tps1� mutant of H99 46H99tps2� tps2� mutant of H99 46H99tps2�S tps2� mutant suppressor of H99 This study

VOL. 77, 2009 TREHALOSE SYNTHESIS PATHWAY OF CRYPTOCOCCUS GATTII 4585


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

Identification and characterization of genes TPS1, TPS2, NTH1, HXK1, andHXK2. A BLASTN search of the C. gattii R265 genome database using homol-ogous genes from C. neoformans H99 (26, 46) was performed for the identifica-tion of the genes TPS1, TPS2, NTH1, HXK1, and HXK2 (Cryptococcus gattii,serotype B; Sequencing Project, Center for Genome Research [http://www.broad.mit.edu]). Identification of potential motifs was completed using the Web-basedMOTIF software (Genome Net, Japan [http://motif.genome.jp/]).

Gene disruption and complementation. Nourseothricin (NAT1) and G418(NEO) resistance genes were used as dominant selectable markers in a biolistictransformation protocol with a Bio-Rad model PDS-1000/He biolistic particledelivery system as previously described (50). The PCR constructs for the deletionmutants were created by overlapping PCR (18). Null mutants of the five genes ofeither strain R265 or CBS1390 were created by using the same set of primers tocreate 5� and 3� flanking sequences of each gene (Table 2). The flanking se-quences of each gene were used to generate overlapping PCR products with theNAT1 marker cassette for strain R265 or the NEO marker cassette for CBS1930according to a previously described protocol (9, 18). For the gene disruption, anoverlap PCR construct was introduced into strain R265 or CBS1930 by biolistictransformation. Homologous recombination events were identified by PCR withexternal primers of each gene and confirmed by Southern blot analysis. Anoverlap PCR product with the NEO marker linked to each of the wild-type geneswas generated for complementation of the R265 mutants. The PCR product ofthe entire gene was introduced directly into each mutant. Identification of thetranscript for each gene was confirmed by Northern blot analysis. The doublemutants were created by introducing HXK1 and HXK2 constructs into theR265tps1� and R265tps2� mutants by using the neomycin resistant cassette as aselectable marker.

Isolation of tps2� suppressor mutants. Due to the occurrence of occasionalcolonies with spontaneous recovery from a temperature-sensitive (ts) phenotypefor the trehalose pathway mutants, suppressor mutants of the R265tps2�(R265tps2�S) and H99tps2� mutants (H99tps2�S) were isolated by recovering ayeast colony from the R265tps2� mutant and one from the H99tps2� mutant,respectively, which were able to grow well at 37°C on YPD agar. Both strainswere then subjected to subsequent characterizations along with other mutants ofthe pathway.

In vitro characterization of the tps1�, tps2�, and nth1� mutants and quan-titative measurements of trehalose, T6P, and mannitol with NMR. Metaboliteproduction by the yeast strains was followed by 1H, 13C, and 31P nuclear magneticresonance (NMR) spectroscopy. Levels of trehalose, T6P, and mannitol of H99,R265, and their tps1�, tps2�, and tps2�S mutants grown at temperatures of 30°Cand 37°C were measured by NMR. Each yeast strain was incubated on Sab-ouraud dextrose agar at the two temperatures and harvested at 12 and 28 h forthe NMR measurement as described previously in detail (46). 31P NMR spectrawere used for the quantification of T6P, and 1H, 1H COSY spectra were used forthe estimation of total trehalose. A more detailed analysis of the utilization ofglucose was performed using 13C NMR spectroscopy. Yeasts were initially grownon Sabouraud dextrose agar, harvested, and then incubated for 12 to 24 h attemperatures of 30°C and 37°C in yeast nitrogen base (YNB) broth (Difco)supplemented with 25% deuterated water (D2O) containing 1% [1-13C]glucosebuffered at pH 7.0 with 0.345% (wt/vol) 3-(N-morpholino)propanesulfonic acid(Sigma Chemical, St. Louis, MO).

NMR spectra were acquired at 30°C or 37°C using a Bruker Avance 500-MHzNMR spectrometer (Bruker Biospin, Rheinstetten, Germany) and a 5-mm (1H,13C) inverse-detection dual-frequency probe as well as a 5-mm broadband probeaccording to a previous study (24). Relaxation delays of 5� T1 were typicallyused for the acquisition of all 13C NMR spectra for quantification. Protondecoupling was achieved by inverse gated decoupling (GARP). Signals wereassigned by using 2-D correlation spectra. All NMR spectra were processed andquantified using the Bruker software TopSpin.

Ability to grow at high temperatures and in the presence of cell wall-perturb-ing agents. The growth rates were determined by using equal amounts of cellsfrom the R265, R265tps1�, R265tps2�, and R265nth1� strains, grown withaeration at 30°C and 37°C in YPD broth. The cells were counted at periodicintervals, every 6 h, by plating serially diluted yeast cells with phosphate-bufferedsaline to calculate the number of CFU. Cell growth was plotted against time todetermine the log phase. In addition, the strains R265, R265tps1�, R265tps2�,R265tps2�S, R265nth1�, R265tps1�::TPS1, R265tps2�::TPS2, H99, andH99tps1� were grown in 2 ml of YPD overnight at 30°C with constant shaking.The cells were then counted with a hema cytometer and diluted to 108 CFU/ml.Due to the fact that suppression of the ts phenotype by sugar substitution orsorbitol supplementation was evident from the study of strain H99 (46), 10-foldserial dilutions were made in phosphate-buffered saline (137 mM NaCl, 2.7 mMKCl, 10 mM Na2HPO4, and 2 mM KH2PO4, pH 7.4), and 5 �l of this was plated

onto Sabouraud agar (2% peptone, 2% agar) containing 2% glucose, 2% galac-tose, and YPD agar with or without 1 M sorbitol or 0.5 M mannitol and grownat 30°C and 37°C. The cell integrity of the strains was tested by growing all strainson YPD agar containing 1 mg/ml caffeine, 7 mg/ml calcofluor white, or 7 mg/mlCongo red (21, 42).

Melanin and capsule production test. Niger seed, dopamine, and caffeic acidagars were used to test for melanin production (31). The strains R265,R265tps1�, R265tps2�, R265tps2�S, R265tps1�::TPS1, R265tps2�::TPS2, H99,and H99tps1� were diluted and plated on the selective media and grown at 30°C.The abilities to produce melanin were compared at 72 h by examining for browncolonies. Capsule production was determined by growing each strain in differentcapsule-inducing conditions as follows: Dulbecco’s modified Eagle’s mediumeither with 10% fetal bovine serum or in the presence of 5% CO2 at 37°C. Yeastcell preparations were performed according to a previously described establishedprotocol (22, 56), and capsule production was determined by visually comparingthe capsule sizes at 72 h using light microscopy and India ink staining.

Mating assay. Mating assays were carried out on V8 medium (5% [vol/vol] V8juice, 2 mM KH2PO4, 4% [wt/vol] agar) (33). The ability to mate was testedagainst the C. gattii, VGII, mating type a strain CBS1930. Null mutants of allthree genes were created in strain CBS1930 in order to test for bilateral matingability. Strains were pregrown on YPD agar for 2 days, and yeast cells wereremoved and patched onto solid mating medium either alone or mixed with themating type a tester strain (CBS1930 or its mutants). Plates were incubated atroom temperature in the dark for 3 weeks and examined by light microscopy forfilamentation and basidiospore formation.

Protein secretion quantification. To determine the extracellular protein se-cretion ability, the amount of protein secreted into broth by the strains R265,R265tps1�, R265tps2�, R265tps2�S, R265tps1�::TPS1, R265tps2�::TPS2, H99,and H99tps1� was measured according to a previously described method (12).Briefly, 104 yeast cells/ml of each strain were incubated in 2% glucose YNB broth(49) and grown to saturation at 30°C under constant agitation. Yeast cells werepelleted, and supernatants were used for protein quantification. Supernatantswere dialyzed and stained with Coomassie blue. The protein concentration wasdetermined in triplicate by comparing the optical density of 550 nm to analbumin standard curve.

Transcription analysis of R265, R265tps1�, R265tps2�, and R265tps2�S.Each strain was initially grown in YPD broth at 30°C for 24 h and then pelleted.Supernatant was discarded. The pellet was resuspended with fresh YPD brothand grown at 30 or 37°C for 1 h. The yeast cells were again pelleted and thenlyophilized. RNA was extracted using 0.5-�m glass beads and vortexed in TRIzolreagent (Invitrogen, CA) according to the manufacturer’s instructions. Tran-scription of TPS1, TPS2, HXK1, and HXK2 was determined at 37°C and that ofLAC1, LAC2, and MPK1 was determined at 30°C by real-time PCR as describedpreviously (11), using the primers listed in Table 2. DNA and mRNA sequencesof the TPS1 loci of the strains R265, R265tps2�, and R265tps2�S were deter-mined by using the primers listed in Table 2.

In vitro characterization of the hxk1�, hxk2�, and double-knockout strains.Growth of R265hxk1�, R265tps1�hxk1�, R265tps2�hxk1�, R265hxk2�,R265tps1�hxk2�, R265tps2�hxk2�, and R265hxk1�::HXK1 using glucose or ga-lactose as a sole carbon source was tested on 2% glucose and 2% galactose YNBagar by using the dilution method as described above. Growth rates were deter-mined in 2% glucose and 2% galactose YNB broth at 37°C. Yeast cell concen-trations for each isolate were measured as the optical density at 600 nm at 0, 3,9, 22, 32, 48, and 72 h as described previously (26).

In vivo characterization of the �tps1, �tps2, and �nth1 mutants. (i) Caeno-rhabditis elegans/Cryptococcus gattii model. In vivo characterization of the �tps1,�tps2, and �nth1 mutants using a Caenorhabditis elegans/Cryptococcus gattiimodel was performed as previously described with C. neoformans (46). In brief,approximately 40 to 50 young adults of the standard C. elegans strain N2 Bristol,pregrown on a lawn of Escherichia coli OP50, were transferred to a lawn of eachof the following C. gattii strains studied: R265, R265tps1�, R265tps1�::TPS1,R265tps2�, R265tps2�::TPS2, R265nth1�, and R265nth1�::NTH1. The cocul-tured plates were incubated at 25°C and examined for viability at 24-h inter-vals with a dissecting microscope. Plotting of the killing curves and estimationof differences in survival (log-rank and Wilcoxon tests) with the Kaplan-Meier method were performed using Stata 6 statistical software (Stata, Col-lege Station, TX).

(ii) Murine inhalation model. A/JCr mice were inoculated intranasally with105 yeast cells. The mice were housed and supplied with food and water adlibitum. Groups of 15 mice were inoculated either with strain R265 or theR265tps1�, R265tps2�, and R265nth1� mutants. Quantitative cultures of thelungs and brains were used to compare tissue burden between groups of mice(five animals each) that were sacrificed on days 4, 7, and 14 following inoc-

4586 NGAMSKULRUNGROJ ET AL. INFECT. IMMUN.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

TABLE 2. Primers used in this study

Primer Sequence (5� to 3�) PCR product(s) Source orreference

NatF CATGCAGGATTCGAGTGGCATG Nourseothricin or neomycin resistance cassette 9NatR GGAGCCATGAAGATCCTGAGGA Nourseothricin or neomycin resistance cassette 9RTPS1F1 ACGTCAAAGACCACCTTGGA 5� flanking region of TPS1 in R265 and CBS1930 This studyRTPS1F3 TCCTCAGGATCTTCATGGCTCCAAGACGT

CGTTCATGAGTATGG3� flanking region of TPS1 in R265 and CBS1930 This study

RTPS1R1 TTGGCATGATGCGGTAGATA 3� flanking region of TPS1 in R265 and CBS1930 This studyRTPS1R3 CATGCCACTCGAATCCTGCATGCGTCATG

ATCGTGGTTGTGT5� flanking region of TPS1 in R265 and CBS1930 This study

RTPS1EFa ACCCCAGCAGACTGCATAAC TPS1 amplification for confirming the insertion This studyRTPS1ERa TCTGGAGTCACGAGGGCTAC TPS1 amplification for confirming the insertion This studyRTPS2F1 GGTTGCAAGATAATGGTGAGG 5� flanking region of TPS2 in R265 and CBS1930 This studyRTPS2F3 TCCTCAGGATCTTCATGGCTCCGGCTTGA

AGAGGGGGATTG3� flanking region of TPS2 in R265 and CBS1930 This study

RTPS2R1 CTACTTTCAATCGGCGGTGA 3� flanking region of TPS2 in R265 and CBS1930 This studyRTPS2R3 CATGCCACTCGAATCCTGCATGGATGGTT

GAAAGATGCGAGAG5� flanking region of TPS2 in R265 and CBS1930 This study

RTPS2EFa ACAGCGAAGCAGGAATTGAG TPS2 amplification for confirming the insertion This studyRTPS2ERa CAGGAAGATTGCACCCCTAA TPS2 amplification for confirming the insertion This studyRNTH1F1 ATGGGGTGTTTGTGGAGAAG 5� flanking region of NTH1 in R265 and CBS1930 This studyRNTH1F3 TCCTCAGGATCTTCATGGCTCCGAAAACA

ATCTTGATGGCTGTG3� flanking region of NTH1 in R265 and CBS1930 This study

RNTH1R1 AATGGGCTTGCTTGATTGTC 3� flanking region of NTH1 in R265 and CBS1930 This studyRNTH1R3 CATGCCACTCGAATCCTGCATGGACATGT

GGGCTACTCGGATA5� flanking region of NTH1 in R265 and CBS1930 This study

RNTH1EFa CCAGAGGTGATCAGCAACAA NTH1 amplification for confirming the insertion This studyRNTH1ERa GAGCAGGTGGACCGTATGAT NTH1 amplification for confirming the insertion This studyRHK1F1 GTTAGCGCCATTTGTTCGGTAG 5� flanking region of HXK1 in R265 This studyRHK1F2 TCCTCAGGATCTTCATGGCTCCCGAAAAC

GCGATCAAAAAGTTC3� flanking region of HXK1 in R265 This study

RHK1R1 GGGGTCCACCTTCTGGAGTAAC 3� flanking region of HXK1 in R265 This studyRHK1R2 CATGCCACTCGAATCCTGCATGGAGTGG

AATACTCACGGCGATA5� flanking region of HXK1 in R265 This study

RHK1EFa ATTTTGCGGCTTCAAAAGATGA HXK1 amplification for confirming the insertion This studyRHK2F1 TGGCAACATATTGACAGGCAAC 5� flanking region of HXK2 in R265 This studyRHK2F2 TCCTCAGGATCTTCATGGCTCC AAAATG

AGAGACCGGGCAAT3� flanking region of HXK2 in R265 This study

RHK2R1 AAGATTCTCGAGGGCCGAATAG 3� flanking region of HXK2 in R265 This studyRHK2R2 CATGCCACTCGAATCCTGCATG TGGGGC

TACCTTGAGAATTG5� flanking region of HXK2 in R265 This study

RHK2ERa ACAGTCCCATATCGGCAAAG HXK2 amplification for confirming the insertion This studyRTPS1RC CATGCCACTCGAATCCTGCATG CGTCGC

TGGAAAGAAGAGACLink neomycin resistance cassette to TPS1 This study

RTPS2RC CATGCCACTCGAATCCTGCATG TACAAGACCGGAGGGTATGG

Link neomycin resistance cassette to TPS2 This study

RNTH1RC CATGCCACTCGAATCCTGCATG CTGGGGAACATTGAAAAAGG

Link neomycin resistance cassette to NTH1 This study

RHXK1RTF CTCTTCCGACTCGTCCTTTG RNA quantification of HXK1 This studyRHXK1RTR ATCGAGTGCCAATCAACACA RNA quantification of HXK1 This studyRHXK2RTF CGAGGAGGTGACACAGTTGA RNA quantification of HXK2 This studyRHXK2RTR GGAGGACAATAGCCGCAATA RNA quantification of HXK2 This studyRTPS1RTF TCCCCAGCAGAGGAAGAGTA RNA quantification of TPS1 This studyRTPS1RTR CACAATCCCACCACTCTGTG RNA quantification of TPS1 This studyRTPS2RTF ATGAGCTGGATGAGCGAAGT RNA quantification of TPS2 This studyRTPS2RTR ATCCAAAGCTTGCTTGCACT RNA quantification of TPS2 This studyRLAC1RTF ACCTTCATGGCAACGAGTTC RNA quantification of LAC1 This studyRLAC1RTR ACAACCACAGCCAACTTTCC RNA quantification of LAC1 This studyRLAC2RTF ACCCTTTACTTCGTGTCGTCCA RNA quantification of LAC2 This studyRLAC2RTR TCCACCCTCCATCCAGAAAGTA RNA quantification of LAC2 This studyRMPK1RTF TGGATTTGTTGAGCAAGCTG RNA quantification of MPK1 This studyRMPK1RTR TCCTTACAGGAGGCATGGAG RNA quantification of MPK1 This studyTPS1SF1 AACCACGATCATGACGACAA Sequencing of TPS1 locus This studyTPS1SF2 ATCATCGGTGTTGACCGTTT Sequencing of TPS1 locus This studyTPS1SF3 AGGAGGGTGTGGATGATACG Sequencing of TPS1 locus This studyTPS1SR1 TCATTCCTCCGGCTAATGTC Sequencing of TPS1 locus This studyTPS1SR2 CGGGAAAGGAGTATGCAAAA Sequencing of TPS1 locus This study

a External primers for confirmation of the construct’s insertion.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

ulation. The lungs and brains were homogenized, diluted, and plated ontoYPD with chloramphenicol (100 �g/ml) in order to determine the numberof CFU/g of tissue and then plotted against time to determine the progressionof the infection. The animal studies were repeated with BALB/c mice. Themice were inoculated with the strain R265, its mutants (R265tps1�,R265tps2�, and R265tps2�S), and reconstituted strains (R265tps1�::TPS1 andR265tps2�::TPS2). Mice were sacrificed on days 7 and 14 for quantitative yeastcounts. Mean colony count statistical comparisons were made between groupswith a Student t test, using SPSS15 software (LEAD Technologies, Inc.). Allanimal experiments were conducted in accordance with the approvals of therespective animal ethics committees.

Nucleotide sequence accession numbers. The sequences for genes TPS1,TPS2, and NTH1 have been deposited in GenBank under accession numbersEU399551, EU399552, and EU399553, respectively. The sequences for the genesHXK1 and HXK2 have been deposited in GenBank under the accession numbersFJ716629 and FJ716630, respectively.

RESULTS

Identification and characterization of C. gattii genes TPS1,TPS2, and NTH1. Genes TPS1, TPS2, and NTH1 were identi-fied as putative 2,519-bp, 3,287-bp, and 3,313-bp open readingframes, respectively, with approximately 89% sequence simi-larity to the C. neoformans strain H99 for each gene, encodingpredicted 673-, 990-, and 877-amino acid proteins, respectively.These genes appear to possess multiple intronic structures typicalof cryptococcal genes. Although formal functional studies of thepromoters were not performed, stress response (AGGGG mo-tifs) and heat shock elements (repetitive NGAAN sequences)were noted in the sequences of the upstream area from the startcodon for all three genes. Similar elements had been previouslyobserved in the C. neoformans gene sequences (46).

In vitro characterization of the tps1�, tps2�, tps2�S, andnth1� mutants: quantitative measurement by NMR analysis ofR265 showed a congruent result to those observed for strainH99. To determine the effects of gene disruption on metabo-

lites in the pathway of the targeted genes, metabolite produc-tion from [1-13C]glucose utilization of each mutant and thewild type was quantified and is shown in Fig. 2 and Table 3. Asexpected, trehalose was not detected in both the R265tps1�and R265tps2� mutants. An intermediate product of the path-way, T6P, was detected in the wild-type strain R265, and theconcentration was determined to be �2 �mol/104 cells due toa low level of accuracy at these low concentrations. However,it was not detected in the R265tps1� mutant due to the ab-sence of its synthase gene. On the other hand, the R265tps2�mutant showed a substantial accumulation of T6P due to theabsence of its phosphatase gene (TPS2). These findings repli-cated what had been found in C. neoformans (strain H99) (46).Interestingly, neither trehalose nor T6P could be detected ineither the R265tps2�S or H99tps2�S suppressor at high-tem-perature growth. This demonstrates that a functioning treha-lose pathway is not always essential for the acquisition of ahigh-temperature growth phenotype. Furthermore, differencesbetween the strains H99 and R265 and their mutants were alsodetected in their metabolites. While comparable levels of man-nitol production were evident in strain H99 and its mutants,mannitol production was substantially increased in the mutantsof strain R265 compared to the wild-type strain (Fig. 2; Table3). In addition, the production of trehalose is completelysuppressed in the R265tps1� mutant, but some remainingtraces of trehalose were detectable in the 13C NMR spec-trum of the H99tps1� mutant (Fig. 2; Table 3).

As the trehalose synthesis pathway is known to controlglycolytic flux in other fungi, metabolites of other pathwaysusing glucose as a precursor were measured. 13C labelingwas incorporated into [1,6-13C]mannitol, [1,3-13C]glycerol,and [6-13C]-labeled hexoses (most likely [6-13C]glucose or

FIG. 2. 13C NMR spectrum analysis of the trehalose pathway metabolites in the studied strains after incubation with [1-13C]glucose at 30°C for24 h. The 13C NMR spectra indicate label incorporation with metabolism and catabolism as well as the remaining [1-13C]�- and [1-13C]-glucose.The respective strains of H99 and R265 are wild types and tps1�, tps2�, and tps2�S mutants. 1, [1-13C]trehalose; 2, [2,3,4,5-13C]trehalose; 3,[1-13C]mannitol; 4, [1-13C]-glucose; 5, [1-13C]�-glucose; 6, [1-13C]glycerol; 7, [6-13C]hexose; 8, fatty acid; 9, [2-13C]acetate; 10, [1-13C]T6P. Dueto similarities of the C-6 chemical shift, it was not possible to distinguish between the respective hexoses. The most likely origin of the signal iseither C-6 glucose or C-6 trehalose.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

[6-13C]trehalose). These compounds indicate metabolismand catabolism of [1-13C]glucose after conversion into glyc-eraldehyde-3-P. Interestingly, no changes in [1,3-13C]glyc-erol levels were observed in the mutants compared to thewild type. 13C labeling was also incorporated into acetate,ethanol, and fatty acids (Fig. 2). A marginally increasedincorporation of 13C labeling in fatty acids was observed forthe R265tps1� and H99tps1� mutants. For H99tps2�S andR265tps2�S, most 13C labeling was incorporated in [1,6-13C]mannitol, but in contrast to the other mutants, they didnot show incorporation of the 13C label in glycerol, [6-13C]-labeled hexoses, fatty acids, ethanol, or acetate (Fig. 2).

TPS1 and TPS2 are essential for high-temperature growth ofstrain R265. As the trehalose synthesis pathway is essential forthe high-temperature growth of several yeast species (20, 46),a test for their ability to grow at a human physiological tem-perature (37°C) was conducted. Growth of the wild type, R265,and that of its mutants were compared on YPD medium (2%glucose, 2% peptone, and 1% yeast extract). Similar to the H99mutants (46), the R265tps1� and R265tps2� mutants exposedto 37°C either could not grow (fungistasis) or died, respectively(see Fig. S1 in the supplemental material). On the other hand,a 37°C growth defect was not found in R265nth1�. Further-more, while the R265tps1� mutant showed a slightly slowergrowth rate than the wild type at 30°C (data not shown), nodefective growth rate was observed in the R265tps2� andR265nth1� mutants and in all reconstituted strains of the R265mutants at 30°C (Fig. 3).

In S. cerevisiae, the regulatory molecule T6P controls hexo-kinase II (HXKII) expression, which in turn affects glycolyticflux and produces the ts phenotype (20). For example, bypass-ing HXKII by replacing glucose with other sugars (i.e., galac-tose) in the medium can rescue the ts phenotype of trehalosemutants in S. cerevisiae (20) and C. neoformans (46). Thus, agrowth comparison was performed on Sabouraud agar contain-ing different sugars (2% peptone and 2% agar with 2% glucoseor 2% galactose). In C. gattii, replacement of glucose in themedium by galactose did suppress the high-temperaturegrowth defect of the R265tps2� mutant, but it had no impacton the R265tps1� mutant (Fig. 3).

Moreover, since a correlation between the presence of T6Pand cell wall integrity at high temperatures had previouslybeen reported (4), an osmotic stabilizer, either 1.0 M sorbitolor 0.5 M mannitol, both of which were able to suppress the tsphenotype of C. neoformans cell wall mutants (21), was sup-plemented in the medium. Similar to results with the galactosesubstitution, only the R265tps2� mutant was rescued (Fig. 3).

TPS1 and TPS2 were induced at 37°C. Since TPS1 and TPS2genes were essential for heat tolerance, their transcriptionalregulations at a human physiological temperature were exam-ined. TPS1 and TPS2 genes of the wild-type strain R265 wereinduced approximately twofold (P values of �0.039 and 0.009,respectively) when exposed to 37°C compared to 30°C at a 1-hincubation in YPD (data not shown).

The ts phenotypic suppression of R265tps2�S most likelyoccurs outside the trehalose pathway. The ts suppressor of theR265�tps2 mutant (R265tps2�S) occurred at a rate of 1 to 10per million CFU when grown on glucose-rich medium at 37°C.To elucidate the mechanism of ts phenotypic suppression inthe R265tps2�S strain, sequence and transcriptional compari-

TA

BL

E3.

Am

ountof

trehalose,T6P,and

mannitolfor

thetested

strainsa

Tem

pandtim

e

Concn

(�m

ol/108

cells)for

theindicated

strain

R265

R265tps1�

R265tps2�

R265tps2�

SH

99H

99tps1�H

99tps2�

Trehalose

T6P

Mannitol

Trehalose

T6P

Mannitol

Trehalose

T6P

Mannitol

Trehalose

T6P

Mannitol

Trehalose

T6P

Mannitol

Trehalose

T6P

Mannitol

Trehalose

T6P

Mannitol

30°C12h

62�

220

ND

ND

49N

D69

44N

DN

D43

58�

262

4N

D55

ND

13058

28h

58�

218

ND

ND

50N

D72

49N

DN

D49

50�

272

4.5N

D58

ND

12560

37°C12h

82�

219

ND

ND

52N

D75

b50

bN

DN

D49

75�

270

5.5N

D62

ND

155b

65b

28h

72�

222

ND

ND

58N

D60

b52

bN

DN

D55

69�

281

5N

D69

ND

120b

66b

aN

D,notdetectable.T

hedetectability

thresholdw

asapproxim

ately1

�m

ol/108

cells.Concentrations

oftrehalosew

eredeterm

inedas

describedin

reference46

by13C

NM

Rspectroscopy.M

annitolconcentrationsw

eredeterm

inedby

13C

NM

Rspectroscopy

andT

6Pby

31P

NM

Rspectroscopy.

bN

ogrow

thof

theyeast

cells.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

son studies with the R265tps2� strain were undertaken. ANorthern blot analysis confirmed the loss of the TPS2 tran-script in the R265�tps2S mutant. In addition, the TPS1 genewas sequenced in the suppressor strain and was found to haveno mutations in its open reading frame. Reverse transcrip-tion-PCR for the TPS1 transcript detection in the suppres-sor strain showed that it was similarly expressed as in thewild-type R265. Moreover, mRNA levels of TPS1 and TPS2for several R265tps2�S clones were identical to those forR265tps2�. These results suggested that the high-temperaturegrowth adaptation of the R265tps2�S strain occurred mecha-nistically outside the trehalose pathway. This hypothesis wasfurther supported by our hexokinase transcriptional studies ofthe suppression strain, which revealed a significant suppressionof HXK2 (approximately 15 times less than R265 andR265tps2�, with no significant differences in HXK1 expression)(Fig. 4) and emphasizes the critical importance of glycolyticcontrol during high-temperature growth.

Examination of hexokinase genes in relationship to the tre-halose synthesis pathway and high-temperature growth. Reg-ulation of hexokinase function by the trehalose synthesispathway has been shown in other fungi (20), and two hexokinasegenes, HXK1 and HXK2, were previously characterized in C.neoformans (26). We identified the C. gattii genes HXK1 andHXK2 as putative 2,658-bp and 2,132-bp open reading frames,respectively, with approximately 85% sequence similarity tothe C. neoformans strain H99 for each gene, encoding predicted591-amino acid and 489-amino acid proteins, respectively. Thefollowing mutants were created: R265hxk1�, R265tps1�hxk1�,R265tps2�hxk1�, R265hxk2�, R265tps1�hxk2�, R265tps2�hxk2�, and R265hxk1�::HXK1.

Unlike HXK2 of C. neoformans, which is required forgalactose utilization (26), HXK2 of C. gattii is not essentialfor either glucose or galactose utilization, as R265hxk2� hadno growth defect when grown on 2% glucose or 2% galac-tose YNB (Fig. 5A and B). However, HXK1 of C. gattii wasrequired for utilizing galactose as a sole carbon source. Recon-stitution of strain R265hxk1�::HXK1 recovered growth on ga-lactose to the wild-type level (data not shown). As predictedfrom the significant transcriptional suppression of HXK2 in theR265tps2�S strain, deletion of HXK2 suppressed the ts phe-notype of both R265tps1� and R265tps2� strains (Fig. 5A).R265tps2�hxk2� growth at 37°C was similar to that ofR265tps2�S (Fig. 5B). As seen by a slight difference in colonysize on the solid medium (data not shown), both R265tps2�Sand R265tps2�hxk2� also showed a slower growth rate thanthe wild-type strain in liquid medium. In addition, deletionof HXK1 also suppressed the ts phenotype of R265tps1�.However, the ts suppression by the hexokinase deletion ofR265tps1� was lower compared to its effect on R265tps2�(Fig. 5A and B).

R265tps1� and R265tps2�S mutants possess defects inother virulence factors. An effect on other unknown virulencefactors of TPS1 beside temperature sensitivity was previouslyhypothesized in the C. neoformans strain H99 because of thehypovirulence of the H99tps1� mutant in the room tempera-ture C. elegans model (46). Therefore, we tested expression ofseveral known virulence factors in our R265tps1� mutants. TheR265tps2�S mutant was also tested due to its loss of T6P,similar to R265tps1�. Unlike the H99tps1� mutant, the

FIG. 3. Growth on different media (glucose and galactose Sabouraud agar and YPD with 1 M sorbitol medium) of R265, H99, and theirmutants at 37°C compared to the control growth on Sabouraud agar at 30°C.

FIG. 4. Transcriptional analysis of R265 and the R265tps1�,R265tps2�, and R265tps2�S mutants revealed that the gene HXK2 wassuppressed in the R265tps2�S strain at 37°C compared to the wild typegrown at 30°C. The asterisk represents statistically significant data(P � 0.049 and 0.033 when comparing R265tps2�S to the wild-typeand R265tps2� strains, respectively). The error bars indicate 2standard errors of the mean. All data were presented by propor-tionally comparing with R265 grown in YPD at 30°C for 1 h.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

R265tps1� and R265tps2�S mutants showed a severe decreasein melanin production and capsule size in all tested inductionmedia (Fig. 6 and 7). Impaired cell wall integrity was observedwhen the R265tps1� mutant was grown on known cell wall-perturbing agents (caffeine, calcofluor white, and Congo red),while the R265tps2�S mutant showed sensitivity only to cal-cofluor white and slight sensitivity to Congo red (Fig. 8).Defects in filamentation and sporulation were observed dur-ing bilateral crossings (mutant � mutant) of the R265tps1�mutant with the CBS1930tps1� mutant but not in unilateral

crossings (mutant � wild type). None of these phenotypicvirulence or morphological defects was observed in theR265tps2� and R265nth1� mutants or the reconstitutedstrains for all mutants (data not shown).

To investigate a possible mechanism of phenotypic differ-ences, and since the extracellular protein secretion in C. gattiicontains several proteins potentially indispensable for tissueinvasion and growth, such as proteases and phospholipases (6),the amount of total protein secreted by each strain at 30°Cgrowth to saturation was measured. The secreted protein con-centrations of the R265tps1� and R265tps2�S mutants weresignificantly less than that of the wild-type strain R265 (P �0.001). In contrast, the secreted protein concentrations of theR265tps2� and H99tps1� mutants were higher than that of thestrain R265 or H99, respectively (P � 0.001) (Fig. 9).

Transcriptional studies suggest that T6P is directly linkedto melanin production and cell integrity. In order to geneti-cally link the trehalose pathway with the virulence phenotypesof melanin and cell wall integrity, transcriptions of the majorcryptococcal laccase genes (LAC1 and LAC2, required formelanin production) and the MAP kinase gene (MPK1, re-quired in the PKC pathway for cell wall integrity) were exam-ined while strains were grown in YPD medium at 30°C. In theR265tps1� and R265tps2�S strains with no detectable T6Pformation, the gene transcripts were reduced significantly (P �0.05) compared to the wild-type R265 when grown in YPD at30°C. This significant reduction was not seen in the R265tps2�mutant (P � 0.05) (Fig. 10). These transcription observationsalong with the phenotypic analysis of the mutants support T6Pas a potential regulator of genes involved in both melaninproduction and cell wall integrity in C. gattii, which appears tobe unique for C. gattii compared to C. neoformans.

In vivo characterization of the mutants. In the C. eleganspathogenesis model, in which high-temperature growth is not arequired survival factor for a pathogen, an attenuation of vir-

FIG. 5. (A) Growth on 2% glucose and 2% galactose YNB at30°C and 37°C of the R265hxk1�, R265tps1�hxk1�, R265tps2�hxk1�,R265hxk2�, R265�tps1hxk2�, and R265tps2�hxk2� mutant strains.(B) Growth curve in 2% glucose YNB at 37°C. OD, optical density;glu, glucose; gal, galactose.

FIG. 6. Melanin synthesis tests on dopamine agar plate (top) andcaffeic acid agar plate (bottom). All strains were incubated at 30°C for72 h. Melanin synthesis was observed as the production of dark versuswhite colonies.

FIG. 7. Capsule formation in 10% fetal bovine serum with 5%CO2 for R265 and the R265tps1�, R265tps2�, R265tps2�S,R265tps1�::TPS1, R265tps2�::TPS2, H99, and H99tps1� strains. Thecapsule was visualized as the translucent area around each yeast cell,and positive induction was considered when the majority of yeast cellswere found to have an enlarged capsule. Magnification, �400.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

ulence was observed for both the R265tps1� and R265tps2�mutants. The R265tps1� mutant was substantially less virulentthan the wild-type strain R265 and its reconstituted strains(P � 0.001). The R265tps2� mutant showed only a slight de-crease in virulence in the C. elegans model compared to strainR265 (P � 0.001), and the hypovirulence status of theR265tps2� mutant was not found in a similar mutant in C.neoformans (46) (Fig. 11). The R265nth1� mutant was notattenuated in the C. elegans model. Restoration of wild-typevirulence was observed in all of the reconstituted strains (datanot shown).

To test for the overall impact of these genetic loci on thetotal virulence composite, murine inhalation models for yeasttissue survival were used. The R265tps1�, R265tps2�, andR265tps2�S mutants were found to be severely attenuated inthe mice. These strains revealed a profound loss of virulence inthat there was a rapid loss of viable yeasts in the host tissue. Allyeasts were eliminated from the lungs and brains of mice byday 7 of the infection in both BALB/c and A/JCr murinemodels (P � 0.001). The R265nth1� mutant and both recon-stituted strains, R265tps1�::TPS1 and R265tps2�::TPS2, re-

mained fully virulent, with tissue yeast counts comparable tothose of the wild-type strain R265 (Fig. 12).

DISCUSSION

The ability to grow at human physiological temperatures haslong been known as an essential virulence factor for any patho-genic microorganism for mammals. The trehalose synthesispathway has been extensively reported in several fungal speciesas a major pathway controlling heat tolerance in yeasts (20).Therefore, the pathway has been validated to be critically nec-essary for the virulence potential of several pathogenic fungi(16, 46, 57). In the present study, the trehalose pathway in C.gattii had the same organization as in C. neoformans withthe primary genes of T6P synthase (TPS1), T6P phosphatase(TPS2), and a neutral trehalase (NTH1), with similar sequencestructures and impact on cellular T6P and trehalose levels. De-spite a similar impact on high-temperature growth and responseto mammalian host stresses for TPS1 and TPS2, several differ-ences in their regulations, connections, and functions of genes inthis pathway between these closely related species were found.

FIG. 10. Comparison of LAC1, LAC2, and MPK1 number tran-scripts of R265tps1�, R265tps2�, and R265tps2�S compared to R265showing downregulation of these genes in the absence of T6P. Theerror bars indicate 2 standard errors of the mean. All data werepresented by proportionally comparing with R265 grown in YPD at30°C for 1 h.

FIG. 8. Growth on several different cell wall-perturbing agents of strains R265, R265tps1�, R265tps2�, R265tps2�S, R265tps1�::TPS1,R265tps2�::TPS2, H99, and H99tps1� at 30°C. The cell integrity of each strain was determined by its ability to grow on agar medium supplementedwith a cell wall stress agent. CFW, calcofluor white.

FIG. 9. Protein concentration of supernatant among different strains.Asterisks represent statistically significant differences (P � 0.001)when compared to the wild type. The error bars indicate 2 standarderrors of the mean.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

First, there was a change in mannitol production (two- tothreefold) only in the R265tps1� and R265tps2� mutants of C.gattii compared to that in the wild-type strain. Production ofmannitol might be a cellular protective mechanism as an oxi-dative scavenger (8) and/or osmotic stabilizer (7) for the yeastwhen trehalose production is compromised. For example, inSaccharomyces cerevisiae, stress protectants such as trehaloseand glycerol are induced to protect against osmotic stresses(27), and thus mannitol might also be used in C. gattii as afactor for protection against environmental stresses. This hy-pothesis for mannitol use in stress protection was further em-phasized by the suppression of the R265tps2� ts phenotypeafter further exogenous exposure to mannitol or sorbitol sup-plementation in the media.

Second, only the R265tps2� and not the R265tps1� ts phe-notype could be suppressed by galactose substitution for glu-cose, while in contrast, the ts phenotype of both H99tps1� andH99tps2� could be suppressed by galactose substitution. Thisfinding implies that TPS1 and TPS2 may control glycolyticfluxes in slightly different manners within the two species.

Third, although the trehalose pathway appeared to controlvirulence factors other than growth at 37°C in C. neoformansbased on the outcomes in the worm model, specific identifica-

tion of virulence factors was not found in the in vitro studies(46). On the other hand, several known virulence factors wereclearly reduced in the C. gattii R265tps1� mutant and similarlyin the R265tps2�S mutant.

These profound physiological and genetic network differ-ences provide additional support for the rise of C. gattii to aseparate species from C. neoformans (34). Our results empha-size that although these two cryptococcal species produce sim-ilar disease processes in humans and animals, some of theirgenetic connections are different, and further genetic differ-ences may support their known diversity in ecology and theirprevalence of disease in certain host risk groups (6).

Interestingly, we observed the relatively frequent formationof C. gattii R265�tps2 suppressors with persistent defects inseveral virulence factor phenotypes. The discovery of thesesuppressors, which retained their ability to grow well at 37°Cwithout producing any trehalose or T6P, suggests that theeffects of intracellular trehalose on the support of high-tem-perature growth are not absolute. Moreover, the R265tps2�suppressors, instead of possessing high T6P levels, had bothundetectable T6P and trehalose levels and a phenotype similarto that of the R265tps1� mutant despite an apparently normalTPS1 gene. This observation suggests an activation of an al-ternative metabolic pathway or alteration of a sugar transport-er(s), resulting in either glucose-6-phosphate being no longeravailable for the Tps1 enzyme or TPS1 being posttranscrip-tionally modified. These possible mechanisms are supported bythe loss of incorporated 13C in several end products of glucose-6-phosphate, including glycerol, 6-13C-labeled hexoses, fattyacids, ethanol, or acetate, in the R265tps2�S mutants, whichindicates a general downregulation of the glycolytic pathway,which is needed to enable yeast growth at high temperatures inthe presence of glucose. In support of this hypothesis, a tran-scriptional analysis showed a marked reduction of transcrip-tion of HXK2, which encodes one of the first enzymes in theglycolytic pathway, of the tps2�S mutant.

An interaction of the trehalose pathway and glycolysis hasbeen demonstrated in several fungi (20). Since in C. gattii, thets suppressor of the R265tps2� mutant in the presence of

FIG. 11. Survival curves of C. elegans feeding with either R265 ormutants.

FIG. 12. In vivo virulence study of murine inhalation model for mutants of the trehalose stress response pathway in lungs and brain comparedto R265 in A/JCr (A) and BALB/c (B) mice. Asterisks and double asterisks indicate strains that produced an organ burden of 0. Note that theR265tps1� and R265tps2� mutants were eliminated from mouse lungs as early as the seventh day. The error bars indicate 2 standard errors ofthe mean.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

glucose was associated with HXK2 downregulation, we furthercharacterized the connection of the two hexokinases, HXK1and HXK2, with the trehalose pathway. For instance, the lossof the ts phenotype of R265tps2�hxk2� directly supports aglycolytic link with the trehalose pathway and its impact onhigh-temperature growth through HXK2, possibly by reducingglucose-6-phosphate availability to make the toxic buildup ofT6P in the R265tps2� mutant. On the other hand, TPS1 and itsability to produce T6P appear to control high-temperaturegrowth and glycolysis through either HXK1 or HXK2. How-ever, since ts phenotypic suppression of either tps1� or tps2�through the interruption of the hexokinase genes was not com-plete, additional trehalose pathway effects on other pathwaysevolved in high-temperature growth are suggested. One possi-bility is the PKC pathway, which is known to control both cellwall integrity and growth at 37°C in C. neoformans (30). Wefound that the gene for last kinase of this pathway (MPK1), infact, was downregulated in both of the R265tps1� andR265tps2�S mutants. This connection could explain the possi-bility that another pathway is linked with trehalose for both thets and cell wall integrity phenotypes. This linkage is also sup-ported by the fact that sorbitol, a membrane stabilizer (21, 30),could suppress the ts growth of R265tps2�. However, a similarsuppression was not found for the C. gattii R265tps1� mutant,in which growth was not recovered by the addition of sorbitolto the medium. This finding suggests that T6P, which is absentin the R265tps1� mutant, may regulate or interact with otherstress pathways besides the PKC pathway.

It has been known that T6P is a major regulatory moleculefor other metabolic pathways in yeasts (2, 53). Like that inC. neoformans (46), toxicity of intracellular T6P accumula-tion to the cryptococcal cell was vividly shown at 37°C inthe R265�tps2 mutant and prevented further studies ofTCP’s importance as a regulatory molecule. Therefore, wesearched for comparative metabolic alterations in theR265tps1�, R265tps2�, and R265tps2�S mutants. Apart fromtrehalose and mannitol, in the R265tps1� and R265tps2� mu-tants, T6P was the only metabolite showing a major differencefrom the wild-type strain R265. Moreover, several in vitrovirulence phenotypes, such as melanin production and cell wallintegrity, together with the transcription of genes related tomelanin production, LAC1 and LAC2, and MAP kinase geneMPK1, were significantly reduced in the R265tps1� andR265tps2�S mutants without T6P. In contrast to C. neofor-mans, C. gattii in the absence of TPS1 and/or T6P has profounddefects in several virulence phenotypes, including melanin syn-thesis, capsule production, cell wall integrity, and fertility, andit possesses a general protein secretion defect. This impact ofthe pathway on other virulence factors is similar to the findingsof C. neoformans, in which the cyclic AMP pathway has beenshown to control both melanin and capsule production (13).Although we have not yet found a direct link of trehalose andthe cyclic AMP pathways in C. gattii, it is clear that bothpathways in C. gattii converge on the control of several viru-lence phenotypes. These observations suggest that T6P is amajor regulatory molecule in C. gattii. Similar findings havebeen made in the plant pathogenic fungus Magnaporthe grisea,where TPS1 and T6P are able to regulate NADPH levels, theoxidative pentose phosphate pathway, expression of nitrogensource utilization, and direct virulence genes (53). It is clear

that in C. gattii, TPS1 provides the gateway for all the majorvirulence phenotypes and that this pathway (TPS1 and TPS2)also impacts carbon utilization.

The total impact of the deletion of either TPS1 and TPS2 onthe pathobiology of C. gattii for the mammalian host was hy-pothesized to be severe from our mechanistic studies. Whilethe TPS1 block was found to be fungistatic for in vitro growthat 37°C, its impact on multiple virulence factors and pathwaysfor fitness of C. gattii predicted a rapid loss of survival in themammalian host. However, in the R265tps2� mutant we ob-served in vitro death at 37°C, with a propensity to select forcolonies that were resistant to high-temperature lethality inglucose-containing environments. Therefore, we first testedthe trehalose mutants in the C. elegans model in which high-temperature growth of yeasts is not a factor in their pathobi-ology. Similar to the H99tps1� mutant in C. neoformans, the C.gattii R265tps1� mutant was profoundly attenuated, reflectingmultiple areas of impact for this locus on the pathobiologicalcharacteristics of C. gattii. In fact, the C. elegans model doesnot even detect survival differences in capsule and melaninmutants (E. Mylonakis, personal observations), thus confirm-ing that TPS1 impacts multiple virulence characteristics otherthan just the three major virulence factors. Unlike in the C.neoformans studies (46), there was a slight attenuation of theR265tps2� mutant in the worm, but it is likely that the tsphenotype still remains the major feature of the R265tps2�mutant’s ability to produce disease in the mammalian host.

In the mammalian model, we used two strains of mice topresent different immune responses to the mutants: A/JCrmice with a complement deficiency and immunocompetentBALB/c mice. In both sets of mice, we found that the C. gattiiR265tps1�, R265tps2�, and R265tps2�S mutants were severelyattenuated with a rapid loss of yeast viability in the lungs anda lack of consistent brain involvement, which is in concordancewith the C. neoformans H99tps1� mutant (46) in both hostgenetic backgrounds. These results compare favorably with themost severely attenuated cryptococcal mutants that we havestudied in mice (44). The animals were able to completelyeliminate the yeasts from both clinically important tissue sites.These findings support the fact that either TPS1 or TPS2 whenused as an antifungal target would be considered fungicidaleven with the frequent development of ts suppressors duringthe block of TPS2 (resistant to high temperatures). It is veryunlikely that this process would become a clinically importantdrug resistance mechanism for the yeast during infection sincethe virulence of these suppressors was also severely attenuated.

In contrast to the profound effects of blocking trehalosesynthesis, the neutral trehalase (NTH1) had no apparent im-pact on the C. neoformans or C. gattii virulence phenotypes ortheir virulence composite. In contrast to diminished thermo-tolerance of both neutral trehalase mutants of S. cerevisiae (39,40), the R265nth1� mutant of C. gattii had no ts growth phe-notype. The neutral trehalase mutants of C. neoformans (46)and C. albicans (14) also did not show ts growth patterns.Furthermore, trehalose levels were not increased in the tre-halase mutants of C. albicans, and an arbuscular mycorrhizalfungus showed no changes in neutral trehalase RNA accumu-lation in response to stress treatments (41). Since the C. gattiiR265nth1� mutant can grow on trehalose-only media (data notshown), it is possible that there are other NTH gene homo-



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

logues in C. gattii that have not yet been identified. However,at present the synthesis part of the trehalose pathway appearsto profoundly impact the virulence composite of both patho-genic cryptococcal species and not its degradation compo-nent.

Our results show that the trehalose synthesis pathway in C.gattii represents a complex network of cross talking with otherpathways and is a major site for control of the virulence com-posite. From this study, it is clear that C. gattii and C. neofor-mans have a conserved trehalose pathway, but both pathwayshave evolutionarily diverged in certain connections that aremanifested in some phenotypic differences between the twosibling species. However, the uniqueness of this pathway tofungi compared to mammals and its profound impact on theability of pathogenic Cryptococcus species to produce diseasesupport the potential of this pathway at several steps to be-come an ideal antifungal drug target(s).

ACKNOWLEDGMENTS

We thank the following members of the Duke University Mycolog-ical Research Unit: Joseph Heitman, James Fraser, Gary Cox, TomRude, and Alexander Idnurm, and thank the members of AndrewAlspaugh’s laboratory for their scientific advice.

This work was supported by Public Service Grants AI28388 andAI73896.

REFERENCES

1. Bell, W., W. Sun, S. Hohmann, S. Wera, A. Reinders, C. De Virgilio, A.Wiemken, and J. M. Thevelein. 1998. Composition and functional analysis ofthe Saccharomyces cerevisiae trehalose synthase complex. J. Biol. Chem.273:33311–33319.

2. Blazquez, M. A., R. Lagunas, C. Gancedo, and J. M. Gancedo. 1993. Tre-halose-6-phosphate, a new regulator of yeast glycolysis that inhibits hexoki-nases. FEBS Lett. 329:51–54.

3. Boekhout, T., A. van Belkum, A. C. Leenders, H. A. Verbrugh, P. Mukamu-rangwa, D. Swinne, and W. A. Scheffers. 1997. Molecular typing of Crypto-coccus neoformans: taxonomic and epidemiological aspects. Int. J. Syst. Bac-teriol. 47:432–442.

4. Borgia, P. T., Y. Miao, and C. L. Dodge. 1996. The orlA gene from Aspergillusnidulans encodes a trehalose-6-phosphate phosphatase necessary for normalgrowth and chitin synthesis at elevated temperatures. Mol. Microbiol. 20:1287–1296.

5. Callejas, A., N. Ordonez, M. C. Rodriguez, and E. Castaneda. 1998. Firstisolation of Cryptococcus neoformans var. gattii, serotype C, from the envi-ronment in Colombia. Med. Mycol. 36:341–344.

6. Casadevall, A., and J. R. Perfect. 1998. Cryptococcus neoformans. ASMPress, Washington, DC.

7. Chaturvedi, V., T. Flynn, W. G. Niehaus, and B. Wong. 1996. Stress toleranceand pathogenic potential of a mannitol mutant of Cryptococcus neoformans.Microbiology 142:937–943.

8. Chaturvedi, V., B. Wong, and S. L. Newman. 1996. Oxidative killing ofCryptococcus neoformans by human neutrophils. Evidence that fungal man-nitol protects by scavenging reactive oxygen intermediates. J. Immunol.156:3836–3840.

9. Chayakulkeeree, M., T. H. Rude, D. L. Toffaletti, and J. R. Perfect. 2007.Fatty acid synthesis is essential for survival of Cryptococcus neoformans anda potential fungicidal target. Antimicrob. Agents Chemother. 51:3537–3545.

10. Chen, Q., and G. G. Haddad. 2004. Role of trehalose phosphate synthaseand trehalose during hypoxia: from flies to mammals. J. Exp. Biol. 207:3125–3129.

11. Cramer, K. L., Q. D. Gerrald, C. B. Nichols, M. S. Price, and J. A. Alspaugh.2006. Transcription factor Nrg1 mediates capsule formation, stress response,and pathogenesis in Cryptococcus neoformans. Eukaryot. Cell 5:1147–1156.

12. Djordjevic, J. T., M. Del Poeta, T. C. Sorrell, K. M. Turner, and L. C.Wright. 2005. Secretion of cryptococcal phospholipase B1 (PLB1) is regu-lated by a glycosylphosphatidylinositol (GPI) anchor. Biochem. J. 389:803–812.

13. D’Souza, C. A., J. A. Alspaugh, C. Yue, T. Harashima, G. M. Cox, J. R.Perfect, and J. Heitman. 2001. Cyclic AMP-dependent protein kinase con-trols virulence of the fungal pathogen Cryptococcus neoformans. Mol. Cell.Biol. 21:3179–3191.

14. Eck, R., C. Bergmann, K. Ziegelbauer, W. Schonfeld, and W. Kunkel. 1997.A neutral trehalase gene from Candida albicans: molecular cloning, charac-terization and disruption. Microbiology 143:3747–3756.

15. Elbein, A. D. 1974. The metabolism of �,�-trehalose. Adv. Carbohydr.Chem. Biochem. 30:227–256.

16. Foster, A. J., J. M. Jenkinson, and N. J. Talbot. 2003. Trehalose synthesisand metabolism are required at different stages of plant infection by Mag-naporthe grisea. EMBO J. 22:225–235.

17. Fraser, J. A., S. S. Giles, E. C. Wenink, S. G. Geunes-Boyer, J. R. Wright, S.Diezmann, A. Allen, J. E. Stajich, F. S. Dietrich, J. R. Perfect, and J. Heit-man. 2005. Same-sex mating and the origin of the Vancouver Island Cryp-tococcus gattii outbreak. Nature 437:1360–1364.

18. Fraser, J. A., R. L. Subaran, C. B. Nichols, and J. Heitman. 2003. Recapit-ulation of the sexual cycle of the primary fungal pathogen Cryptococcusneoformans var. gattii: implications for an outbreak on Vancouver Island,Canada. Eukaryot. Cell 2:1036–1045.

19. Frealle, E., C. Noel, E. Viscogliosi, D. Camus, E. Dei-Cas, and L. Delhaes.2005. Manganese superoxide dismutase in pathogenic fungi: an issue withpathophysiological and phylogenetic involvements. FEMS Immunol. Med.Microbiol. 45:411–422.

20. Gancedo, C., and C. L. Flores. 2004. The importance of a functional treha-lose biosynthetic pathway for the life of yeasts and fungi. FEMS Yeast Res.4:351–359.

21. Gerik, K. J., M. J. Donlin, C. E. Soto, A. M. Banks, I. R. Banks, M. A.Maligie, C. P. Selitrennikoff, and J. K. Lodge. 2005. Cell wall integrity isdependent on the PKC1 signal transduction pathway in Cryptococcus neo-formans. Mol. Microbiol. 58:393–408.

22. Granger, D. L., J. R. Perfect, and D. T. Durack. 1985. Virulence of Crypto-coccus neoformans. Regulation of capsule synthesis by carbon dioxide.J. Clin. Investig. 76:508–516.

23. Hicks, J. K., and J. Heitman. 2007. Divergence of protein kinase A catalyticsubunits in Cryptococcus neoformans and Cryptococcus gattii illustrates evo-lutionary reconfiguration of a signaling cascade. Eukaryot. Cell 6:413–420.

24. Himmelreich, U., C. Allen, S. Dowd, R. Malik, B. P. Shehan, C. Mountford,and T. C. Sorrell. 2003. Identification of metabolites of importance in thepathogenesis of pulmonary cryptococcoma using nuclear magnetic reso-nance spectroscopy. Microbes Infect. 5:285–290.

25. Hull, C. M., and J. Heitman. 2002. Genetics of Cryptococcus neoformans.Annu. Rev. Genet. 36:557–615.

26. Idnurm, A., S. S. Giles, J. R. Perfect, and J. Heitman. 2007. Peroxisomefunction regulates growth on glucose in the basidiomycete fungus Crypto-coccus neoformans. Eukaryot. Cell 6:60–72.

27. Kaino, T., and H. Takagi. 2008. Gene expression profiles and intracellularcontents of stress protectants in Saccharomyces cerevisiae under ethanol andsorbitol stresses. Appl. Microbiol. Biotechnol. 79:273–283.

28. Kidd, S. E., F. Hagen, R. L. Tscharke, M. Huynh, K. H. Bartlett, M. Fyfe, L.Macdougall, T. Boekhout, K. J. Kwon-Chung, and W. Meyer. 2004. A raregenotype of Cryptococcus gattii caused the cryptococcosis outbreak on Van-couver Island (British Columbia, Canada). Proc. Natl. Acad. Sci. USA 101:17258–17263.

29. Kollar, R., B. B. Reinhold, E. Petrakova, H. J. Yeh, G. Ashwell, J. Drgonova,J. C. Kapteyn, F. M. Klis, and E. Cabib. 1997. Architecture of the yeast cellwall. (136)-Glucan interconnects mannoprotein, (133)-glucan, andchitin. J. Biol. Chem. 272:17762–17775.

30. Kraus, P. R., D. S. Fox, G. M. Cox, and J. Heitman. 2003. The Cryptococcusneoformans MAP kinase Mpk1 regulates cell integrity in response to anti-fungal drugs and loss of calcineurin function. Mol. Microbiol. 48:1377–1387.

31. Kwon-Chung, K. J., and J. E. Bennett. 1992. Cryptococcosis, p. 397–446. InK. J. Kwon-Chung and J. E. Bennett (ed.), Medical mycology. Lea & Fe-biger, Philadelphia, PA.

32. Kwon-Chung, K. J., and J. E. Bennett. 1984. Epidemiologic differencesbetween the two varieties of Cryptococcus neoformans. Am. J. Epidemiol.120:123–130.

33. Kwon-Chung, K. J., J. E. Bennett, and J. C. Rhodes. 1982. Taxonomicstudies on Filobasidiella species and their anamorphs. Antonie van Leeu-wenhoek 48:25–38.

34. Kwon-Chung, K. J., T. Boekhout, J. W. Fell, and M. Diaz. 2002. Proposal toconserve the name Cryptococcus gattii against C. hondurianus and C. basil-lisporus (Basidiomycota, Hymenomycetes, Tremellomycetidae). Taxon 51:804–806.

35. Latouche, G. N., T. C. Sorrell, and W. Meyer. 2002. Isolation and charac-terisation of the phospholipase B gene of Cryptococcus neoformans var. gattii.FEMS Yeast Res. 2:551–561.

36. Lazera, M. S., B. Wanke, and M. M. Nishikawa. 1993. Isolation of bothvarieties of Cryptococcus neoformans from saprophytic sources in the city ofRio de Janeiro, Brazil. J. Med. Vet. Mycol. 31:449–454.

37. Lin, X., and J. Heitman. 2005. Chlamydospore formation during hyphalgrowth in Cryptococcus neoformans. Eukaryot. Cell 4:1746–1754.

38. Narasipura, S. D., V. Chaturvedi, and S. Chaturvedi. 2005. Characterizationof Cryptococcus neoformans variety gattii SOD2 reveals distinct roles of thetwo superoxide dismutases in fungal biology and virulence. Mol. Microbiol.55:1782–1800.

39. Nwaka, S., M. Kopp, and H. Holzer. 1995. Expression and function of thetrehalase genes NTH1 and YBR0106 in Saccharomyces cerevisiae. J. Biol.Chem. 270:10193–10198.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

40. Nwaka, S., B. Mechler, M. Destruelle, and H. Holzer. 1995. Phenotypicfeatures of trehalase mutants in Saccharomyces cerevisiae. FEBS Lett. 360:286–290.

41. Ocon, A., R. Hampp, and N. Requena. 2007. Trehalose turnover duringabiotic stress in arbuscular mycorrhizal fungi. New Phytol. 174:879–891.

42. Pardini, G., P. W. De Groot, A. T. Coste, M. Karababa, F. M. Klis, C. G. deKoster, and D. Sanglard. 2006. The CRH family coding for cell wall glyco-sylphosphatidylinositol proteins with a predicted transglycosidase domainaffects cell wall organization and virulence of Candida albicans. J. Biol.Chem. 281:40399–40411.

43. Perfect, J. R. 1989. Cryptococcosis. Infect. Dis. Clin. N. Am. 3:77–102.44. Perfect, J. R. 2005. Cryptococcus neoformans: a sugar-coated killer with

designer genes. FEMS Immunol. Med. Microbiol. 45:395–404.45. Perfect, J. R., N. Ketabchi, G. M. Cox, C. W. Ingram, and C. L. Beiser. 1993.

Karyotyping of Cryptococcus neoformans as an epidemiological tool. J. Clin.Microbiol. 31:3305–3309.

46. Petzold, E. W., U. Himmelreich, E. Mylonakis, T. Rude, D. Toffaletti, G. M.Cox, J. L. Miller, and J. R. Perfect. 2006. Characterization and regulation ofthe trehalose synthesis pathway and its importance in the pathogenicity ofCryptococcus neoformans. Infect. Immun. 74:5877–5887.

47. Pitkin, J. W., D. G. Panaccione, and J. D. Walton. 1996. A putative cyclicpeptide efflux pump encoded by the TOXA gene of the plant-pathogenicfungus Cochliobolus carbonum. Microbiology 142:1557–1565.

48. Ren, P., D. J. Springer, M. J. Behr, W. A. Samsonoff, S. Chaturvedi, and V.Chaturvedi. 2006. Transcription factor STE12� has distinct roles in morpho-genesis, virulence, and ecological fitness of the primary pathogenic yeastCryptococcus gattii. Eukaryot. Cell 5:1065–1080.

49. Siafakas, A. R., T. C. Sorrell, L. C. Wright, C. Wilson, M. Larsen, R. Boadle,P. R. Williamson, and J. T. Djordjevic. 2007. Cell wall-linked cryptococcal

phospholipase B1 is a source of secreted enzyme and a determinant of cellwall integrity. J. Biol. Chem. 282:37508–37514.

50. Toffaletti, D. L., T. H. Rude, S. A. Johnston, D. T. Durack, and J. R. Perfect.1993. Gene transfer in Cryptococcus neoformans by use of biolistic delivery ofDNA. J. Bacteriol. 175:1405–1411.

51. Van Dijck, P., L. De Rop, K. Szlufcik, E. Van Ael, and J. M. Thevelein. 2002.Disruption of the Candida albicans TPS2 gene encoding trehalose-6-phos-phate phosphatase decreases infectivity without affecting hypha formation.Infect. Immun. 70:1772–1782.

52. Voit, E. O. 2003. Biochemical and genomic regulation of the trehalose cyclein yeast: review of observations and canonical model analysis. J. Theor. Biol.223:55–78.

53. Wilson, R. A., J. M. Jenkinson, R. P. Gibson, J. A. Littlechild, Z. Y. Wang,and N. J. Talbot. 2007. Tps1 regulates the pentose phosphate pathway,nitrogen metabolism and fungal virulence. EMBO J. 26:3673–3685.

54. Wright, L. C., J. Payne, R. T. Santangelo, M. F. Simpanya, S. C. Chen, F.Widmer, and T. C. Sorrell. 2004. Cryptococcal phospholipases: a novellysophospholipase discovered in the pathogenic fungus Cryptococcus gattii.Biochem. J. 384:377–384.

55. Zaragoza, O., M. A. Blazquez, and C. Gancedo. 1998. Disruption of theCandida albicans TPS1 gene encoding trehalose-6-phosphate synthase im-pairs formation of hyphae and decreases infectivity. J. Bacteriol. 180:3809–3815.

56. Zaragoza, O., and A. Casadevall. 2004. Experimental modulation of capsulesize in Cryptococcus neoformans. Biol. Proced. Online 6:10–15.

57. Zaragoza, O., C. de Virgilio, J. Ponton, and C. Gancedo. 2002. Disruption inCandida albicans of the TPS2 gene encoding trehalose-6-phosphate phos-phatase affects cell integrity and decreases infectivity. Microbiology 148:1281–1290.

Editor: A. Casadevall



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

the trehalose synthesis pathway is an integral part of the ... · formation, are controlled by this...

Documents