Theme: Molecular basis of heredity.

Realization of hereditary information

Lecturer: ass. prof. Tetyana Bihunyak

The questions of the lecture:

1. Molecular biology as science 2.  The chemistry of nucleic acids2.1. Deoxyribonucleic acid (DNA) 2.2. Ribonucleic acid (RNA) 3. DNA Replication 4. Genetic code5. Gene Expression6. Functions of Proteins in the organism

Molecular biology is the study of biology at a molecular level.

Molecular biology concerns itself with understanding the interactions between the various systems of a cell, including the interactions between DNA, RNA and protein biosynthesis and learning how these interactions are regulated.

Nucleus contains genetic materials encoded in DNA of chromosomes

Only nucleus directs protein synthesis in the cytoplasm via ribosomal RNA (rRNA), messenger RNA (mRNA) and transport RNA (tRNA), which are synthesized in the nucleus

Nucleic acids• The nucleic acids are polymers of

smaller units called nucleotides.

• There are 2 types of nucleic acids:

DNA (deoxyribonucleic acid)

RNA (ribonucleic acid).

Structure of nucleotide

1) five-carbon sugar (deoxyribose C5H10O4 in DNA and ribose C5H10O5 in RNA);

2) a phosphate group (PO4);

3) one of five types nitrogen-containing compounds called nitrogenous bases.

Nucleic acids

The nitrogenous bases are:

• Purines, which are larger – Adenine (A), Guanine (G);

• Pyramidines, which are smaller – Thymine (T), Cytosine (C), Uracil (U).

Chromosome

DNA

Nucleotides

Nucleus

DNA located in nucleus, packaged into

chromosomes

DNA Basics

Organelles (mitochondria, chloroplasts) have their own chromosomes (DNA)

DNA Basics

• DNA is a long, double-stranded, linear molecule composed of multiple nucleotide sequences.

• DNA contains Adenine, Guanine, Cytosine, Thymine.

Thymine (T)

Cytosine (C)

Nitrogenous bases

Purines Pyrimidines

DNA Basics

The DNA double helix consists of two complementary DNA strands held together by hydrogen bonds between the base pairs A-T and G-C

A-T base pair

G-C base pair

Chargaff’s rule: The content of A equals the content of T, and the content of G equals the content of C in double-stranded DNA from any species

Hydrogen bonding of the bases

Chargaff's rules said that A = T and G = C. The model shows that A is hydrogen bonded to T and G is hydrogen bonded to C. This so-called complementary base pairing means that a purine is always bonded to a pyrimidine. Only in this way will the molecule have the width (2 nm) dictated by its X-ray diffraction pattern, since 2 pyrimidines together are too narrow and 2 purines together are too wide.

DNA Basics

In the formation of a nucleic acid chain the phosphate group of the nucleotide binds to the hydroxyl group of another, forming what is called a phosphodiester bond, which is very strong.

Watson JamesCrick Francis

The double helix of DNA was discovered in 1953 by Crick F. and Watson J. Nobel prize in 1962

Structure of DNA

Watson and Crick model shows that DNA is a double helix with sugar-phosphate backbones on the outside and paired bases on the inside. This arrangement first the mathematical measurements provided by the X-ray diffraction data for the spacing between the base pairs (0.34 nm) and for a complete turn of the double helix (3.4 nm)

The main biological DNA functions:

• DNA stores hereditary information about primary protein structure.

• The order of the bases specifies the order of amino acids in polypeptides.

• DNA-replication – maintaining genetic information.

DNA Replication

• The Watson and Crick model suggests that DNA can be replicated by means of complementary base pairing.

• During replication, each old DNA strand of the parent molecule serves as a template for a new strand in a daughter molecule.

• A template is most often a mold used to produce a shape complementary to itself

The human cell cycle

G1

S

G2M

G0

Growth and preparation forcell division

Rapid growth and preparation forDNA synthesis

Quiescent cells

phase

phase

phase

phase

Mitosis

S phaseis the synthetic

phase, resulting in duplication of the chromosomes: one

replicated chromosome

consisting of two chromatids

Steps of replication:

1. Unwinding

• The old strands that make up the parent DNA molecule are unwound and "unzipped" (i.e., the weak hydrogen bonds between the paired bases are broken)

• There is a special enzyme called helicase that unwinds the molecule

Helicase

DNA replication

• DNA helicase (enzyme) unwinds the DNA. The junction between the unwound part and the open part is called a replication fork.

• DNA polymerase adds the complementary nucleotides and binds the sugars and phosphates. DNA polymerase travels from the 3' to the 5' end.

Steps of replication:

2. Complementary base pairing

New complementary nucleotides,

always present in the nucleus,

are positioned by the process

of complementary base pairing.

DNA replication• DNA polymerase adds

complementary nucleotides on the other side of the ladder. Traveling in the opposite direction.

• One side is the leading strand - it follows the helicase as it unwinds.

• The other side is the lagging strand - its moving away from the helicase

DNA replication• Problem: it reaches the

replication fork, but the helicase is moving in the opposite direction. It stops, and another polymerase binds farther down the chain.

• This process creates several fragments, called Okazaki Fragments, that are bound together by DNA ligase.

Steps of replication:

3. Joining• The complementary nucleotides

become joined together to form new strands.

• Each daughter DNA molecule contains an old strand and a new strand.

• Steps 2 and 3 are carried out by the enzyme DNA polymerase.

DNA replication• During replication, there are many points along the

DNA that are synthesized at the same time (multiple replication forks).

• It would take forever to go from one end to the other, it is more efficient to open up several points at one time.

A model for DNA replication

DNA replication is termed semiconservative replication because one of the old strands is conserved, or present, in each daughter double helix. Semiconservative replication was experimentally confirmed by Matthew Meselson and Franklin Stahl in 1958.

Accuracy of Replication• The mismatched nucleotide causes a

pause in replication, and during this time, the mismatched nucleotide is excised from the daughter strand.

• The errors that slip through nucleotide

selection and proofreading cause a gene mutation to occur.

• Actually it is of benefit for mutations to occur occasionally because variation is the raw material for the evolutionary process.

Rate of Gene Mutations

• Per cell cycle, gene mutations don't occur very often

• There are several mechanisms that protect against the occurrence of mutations.

• The bases are on the interior of the DNA molecule, and the supercoiling of the molecule in eukaryotes also lends stability.

• During replication, DNA polymerases proofread the new strand against the old strand and detect any mismatched pairs, which are then replaced with the correct nucleotides. In the end, there is usually only one mistake for every one billion nucleotide pairs replicated.

Excision repair

ATGCUGCATTGATAGTACGGCGTAACTATC

thymine dimer

AT AGTACGGCGTAACTATC

ATGCCGCATTGATAGTACGGCGTAACTATC

ATGCCGCATTGATAGTACGGCGTAACTATC

excinuclease

DNA polymerase

DNA ligase

(~30 nucleotides)

ATGCUGCATTGATACGGCGTAACT

ATGC GCATTGATACGGCGTAACT

AT GCATTGATACGGCGTAACT

deamination

ATGCCGCATTGATACGGCGTAACT

ATGCCGCATTGATACGGCGTAACT

uracil DNA glycosylase

repair nucleases

DNA polymerase

DNA ligase

Base excision repair Nucleotide excision repair

DNA repair activity

Life

sp

an

1

10

100 human

elephant

cow

hamsterratmouseshrew

Correlation between DNA repair activity in fibroblast cells from various mammalian species and the life span of the organism

Point Mutations

• Point mutations involve a change in a single nucleotide and therefore a change in a specific codon.

• When one base is substituted for another, the results can be variable. For example, if UAC is changed to UAU, there is no noticeable effect, because both of these codons code for tyrosine. This is called a silent mutation.

• If UAC is changed to UAG, however, the result could very well be a drastic one because UAG is a stop codon. If this substitution occurs early in the gene, the resulting protein may be too short and may be unable to function. Such an effect is called a nonsense mutation. Finally, if UAC is changed to CAC, then histidine is incorporated into the protein instead of tyrosine. This is a missense mutation.

• A change in one amino acid may not have an effect if the change occurs in a noncritical area or if the 2 amino acids have the same chemical properties. In this instance, the polarities of tyrosine and histidine differ; this substitution most likely will have a deleterious effect on the functioning of the protein. Recall that the occurrence of valine instead of glutamate in the beta (B) chain of hemoglobin results in a sickle-cell disease.

Defects in DNA repair or replicationAll are associated with a high frequency of chromosome

and gene (base pair) mutations; most are also associated with a predisposition to cancer, particularly leukemias

• Xeroderma pigmentosum• caused by mutations in genes involved in nucleotide excision repair• associated with a >1000-fold increase of sunlight-induced skin cancer and with other types of cancer such as melanoma

• Ataxia telangiectasia• caused by gene that detects DNA damage• increased risk of X-ray• associated with increased breast cancer in carriers

• Fanconi anemia• caused by a gene involved in DNA repair• increased risk of X-ray and sensitivity to sunlight

• Bloom syndrome• caused by mutations in a DNA helicase gene• increased risk of X-ray• sensitivity to sunlight

• Cockayne syndrome• caused by a defect in transcription-linked DNA repair• sensitivity to sunlight

• Werner’s syndrome• caused by mutations in a DNA helicase gene• premature aging

DNA and RNA differ

RNA is single-stranded (but it can fold back upon itself to form secondary structure, e.g. tRNA)

In RNA, the sugar molecule is ribose rather than deoxyribose

In RNA, the fourth base is uracil rather than thymine.

DNA RNA

1

OH

OH

OH

OH

2

U

H

3

The major bases found in DNA and RNA

DNA RNA

Adenine Adenine Cytosine Cytosine Guanine Guanine Thymine Uracil (U)

uracil-adenine base pairthymine-adenine base pair

RNA Basics• Messenger RNA carries the genetic code to the

cytoplasm to direct protein synthesis.• 1. This single-stranded molecule (hundreds to

thousands of nucleotides).• 2. mRNA contains codons that are complementary

to the DNA codons from which it was transcribed

• Ribosomal RNA associates with many different proteins (including enzymes) to form ribosomes.

• 1. rRNA associates with mRNA and tRNA during protein synthesis.

• 2. rRNA synthesis takes place in the nucleolus and is catalyzed by RNA polymerase.

Transfer RNA - the adapter

Transfer RNA is folded into a cloverleaf shape and contains about 80 nucleotides.

• 1. Each tRNA combines with a specific amino acid that has been activated by an enzyme.

• 2. One end of the tRNA molecule possesses an anticodon, a triplet of nucleotides that recognizes the complementary codon in mRNA.

Types of RNA

Transcription: DNA-Directed RNA Synthesis

• Transcription has three phases:InitiationElongationTermination

• RNA is transcribed from a DNA template after the bases of DNA are exposed by unwinding of the double helix.

• In a given region of DNA, only one of the two strands can act as a template for transcription.

Figure 12.4 – Part 1

Transcription: DNA-Directed RNA Synthesis - Elongation

• Nucleotides are added by complementary base pairing with the template strand

• The substrates, ribonucleoside triphosphates, are hydrolyzed as added, releasing energy for RNA synthesis.

DNA Replication figure adapted for Transcription

OH

OH

OH

OH

OH

OH

OH

OH

OH

OH

RNA RNA DNA

U U

All organisms use the same genetic codeEach set of three nucleotides codes for an

amino acid = “The Genetic Code”

Genetic code

The Genetic Code is universal

• All organisms use the same genetic code

• Each set of three nucleotides codes for an amino acid = “The Genetic Code”

AUG = Met

The genetic code

– consists of 64 triplet codons (A, G, C, U) 43 = 64– all codons are used in protein synthesis

• 20 amino acids• 3 termination (stop) codons: UAA, UAG, UGA• AUG (methionine) is the start codon (also used

internally)– multiple codons for a single amino acid =

degeneracy– Genetic code is unambiguous. Each triplet codon has

only one meaning– 5 amino acids are specified by the first two

nucleotides only– 3 additional amino acids (Arg, Leu, and Ser) are

specified by six different codons

Gene Expression• The process by which a gene produces a product, usually a

protein, is called gene expression.• DNA not only serves as a template for its own replication, it is also a

template for RNA formation. • Gene Expression in prokaryotes:• transcription, translation. • Gene Expression in eukaryotic cells:• transcription, processing, translation.

Transcription

• It is the first step required for gene expression.

• During transcription, a mRNA molecule is formed that has a sequence of bases complementary to a portion of one DNA strand;

• A, T, G, or С is present in the DNA template,

• U, A, C, or G is incorporated into the mRNA molecule

The process by which a mRNA copy is made of a portion of DNA

Transcription

• Transcription begins at a region of DNA called a promoter.

• A promoter is a special sequence of DNA bases where RNA polymerase attaches and the transcribing process begins. A promoter is at the start end of the gene to be transcribed.

• Elongation of the mRNA molecule occurs as long as transcription proceeds. Finally, RNA polymerase comes to a terminator sequence at the other end of the gene being transcribed.

• The terminator causes RNA polymerase to stop transcribing the DNA and to release the mRNA molecule, now called a RNA transcript

Transcription: DNA-Directed RNA Synthesis - Termination

• Termination: Special DNA sequences and protein helpers terminate transcription.

• The transcript is released from the DNA.

• This Primary Transcript is called the “pre-mRNA”

• The pre-mRNA is processed to generate the mature mRNA

RNA Processing • introns are noncoding portions of the original mRNA tape;

they do not contain information for the sequencing of amino acids in a protein

• exons: portions of the mRNA transcript that code for amino acids

• special molecular splicing complexes cut out sections of introns. Then the remaining portions of the mRNA (exons) tape are spliced together

Translation

During translation, the sequence of codons in mRNA directs the sequence of amino acids in a protein.

Two other types of RNA are needed for protein synthesis.

• rRNA is contained in the ribosomes, where the codons of mRNA are read

• tRNA carries amino acids to the ribosomes so that protein synthesis сan occur.

Ribosomes are the protein synthesis machines, and use RNA as the template for translation

Codon-anticodon interactions• codon-anticodon base-pairing is antiparallel• the third position in the codon is frequently degenerate• one tRNA can interact with more than one codon (therefore 50 tRNAs)• wobble rules

C with G A with U G with C U with A

5’ 3’

A U G

U A C

3’ 5’ tRNAmet

mRNA

5’ 3’

C U A G

G A U

3’ 5’ tRNAleu

mRNA

wobble base

• one tRNAleu can read two of the leucine codons

PROTEIN SYNTESIS ON RIBOSOMES

The Central Dogma

The Flow of Information: DNA RNA protein

DNA Replication

Transcription Translation

Regulation of Gene expression in prokaryotes

lac operon in E. Coli•Function - to produce enzymes which break down lactose (milk sugar). When lactose (inducer)is present, they turn on and produce enzymes (5) •Two components - repressor genes (1) and functional strutural genes (4)•Promoter (P) - aids in RNA polymerase binding •Operator (O) - "on/off" switch (3) - binding site for the repressor protein •Repressor (lacI) gene - produces repressor protein w/ two binding sites, one for the operator and one for lactose. The repressor protein is under allosteric control - when not bound to lactose, the repressor protein can bind to the operator

Regulation of Gene expression in prokaryotes

lac operon in E. Coli

Operation if lactose is present:

When lactose is present, an isomer of lactose, allolactose, will also be present in small amounts.  Allolactose binds to the allosteric site and changes the conformation of the repressor protein so that it is no longer capable of binding to the operator

Operation if lactose is not present:

the repressor gene produces repressor, which binds to the operator. This blocks the action of RNA polymerase, thereby preventing transcription

Proteins are polymers of amino acids

• There are 20 different amino acids in cells that differ only by R groups

• All amino acids contain 2 important functional groups: an amino, - NH2, group and a carboxyl (acid) –СООН, group, both of which ionize at normal body pH

•All enzymes are proteins.• Storing amino acids as nutrients and as building blocks for the growing organism.•Transport function (proteins transport fatty acids, bilirubin, ions, hormones, some drugs etc.).•Proteins are essential elements in contractile and motile systems (actin, myosin).• Protective or defensive function (fibrinogen, antibodies).• Some hormones are proteins (insulin, somatotropin).•Structural function (collagen, elastin).

Functions of Proteins in the organism

Types of proteins• Enzymes -Quicken chemical reactions (surcease

brocks sugar to glucose and fructose)• Hormones - chemical messengers (growth hormone)• Transport –move other molecules (hemoglobin)• Contractive –movement (myosin and actin -allow

muscles to contract)• Protective - healing, defense against invader

(fibrinogen: stops bleeding antibodies: kill bacterial invaders)

• Structural –mechanical support (keratin: hair collagen: cartilage)

• Storage - stores nutrients (ovalbumin: egg white: used as nutrient for embryos)

• Toxins - defense, predations (bacterial diphteria toxin)

• Communication – cell signaling (glicoprotein: receptors on cell surface)

TEST QUESTIONS

1. Which one of the following nucleotides is not present in DNA?A. Thymine. B. Adenine. C. Uracil. D. Cytosine. E. Guanine.2. DNA is duplicated in the cell cycle during the:A. G1 phase. B. S-phase. C. G2-phase. D. Prophase. E. Metaphase.3. If one strand of DNA has the base sequence ATCGTA, what will the complementary strand of

mRNA have?A. TAGCAT B. UAGCAUC. CAGTCTD. ATCGTAE. All of these.4. Which of the following statements concerning transcription is false:A. A gene is transcribed into DNA on RNA molecule by RNA polymerase.B. Both exons and introns are transcribed.C. DNA molecule unwinds at the end of transcriptionD. The codon always represents a single amino acid.E. The chain terminator on the DNA molecule stops the transcription process.

“You can take a horse to the water, but you cannot make him drink”

(English proverb)

Thank you for attention !