thesis proposal amr kleb

1

INTRODUCTION

1.1 Background

Antimicrobials are medically important in the prevention, control and treatment of

infections and disease. They are mainly used for therapy, metaphylaxis, prophylaxis and in

the case of the animal industry, growth promotion. In fact, the Center of Disease Control

(CDC) in the United States of America says that 80% of the antimicrobial use is for the farm

animals which help microorganisms become resistant.

The World Health Organization (WHO) defines antimicrobial resistance (AMR) as

the resistance of a microorganism to an antimicrobial previously effective for treatment of

infections and diseases caused by it. The growing concern on AMR involves the over use of

antimicrobials (Younes, A.M., 2011) which include non-observance of the withdrawal period

for meat and milk. Moreover, extra-label or off-label use of antimicrobials is also rampant

(Barlow, 2011). The care for extra-label drug use in food animals relate to residue avoidance,

and its use requires documentation of adequate withholding period for milk and slaughter to

ensure food safety. Extra-label use is prohibited if the use results in the presence of drug

residue in food or if presents a public health risk (CDC). WHO lists the major causes of

antibiotic resistance below.

1. Over-prescription of antibiotics

CDC states that in humans up to half of the time, antibiotics are not properly

prescribed in terms of dosage and duration and often done so when not needed. Also in

animals, there are instances when some minor clinical signs can be alleviated with mere

vitamin and/or mineral supplementation, rest and isolation, but some are still prescribed with

2

antimicrobials. Over-prescription of antibiotics can be prevented by also using alternative

methods such as herbal medicine.

2. Patient’s non-completion of treatment regimen and period

Due to expensive medical costs, some patients, farmers and pet owners opt to

discontinue the treatment. Moreover, as in the animal industry, medication may also be quite

difficult to perform.

3. Over-use of antibiotics in livestock and fish farming

It has been a wide practice in the animal sector to give antibiotics as prophylaxis and

more especially to promote growth by suppressing bacterial load that hinders optimum

growth and production of the animals and not necessarily intended for those microorganisms

already causing infection and disease. CDC further mentions that the use of antibiotics in

food animals increases resistance for some microbes.

4. Inadequate infection control in hospital and clinics

An effective sanitation program in hospitals and clinics helps prevent infection and

spread of disease. Poor infection control helps microorganisms thrive in the environment

enabling them to adapt well even after exposure to sanitizers and disinfectants thus leading to

resistance.

5. Lack of hygiene and inadequate sanitation

Basic hand washing and safe food preparation are essential elements in good hygiene,

optimum health and prevention of spread of disease.

3

6. Lack of new antibiotics being developed

The growth and spread of microorganisms is exponentially fast however due to lack

of funds and manpower, research has been difficult and slow in the development of a new

drug. Aside from this, the development and validation of methods to quantify and document

antimicrobial use and the effect of prudent antimicrobial use practices have continue to be a

challenge (Barlow, 2011).

As an effect to AMR, CDC declares that at least 2 million people in the United States

become infected with antibiotic resistant bacteria annually and at least 23,000 people die each

year as a direct result of these infections.

Moreover, bovine mastitis is an economically significant disease due to the high

veterinary costs, extra labor, decreased fertility, decrease in milk production let alone the

discarded milk, and death or culling of infected animals thus affecting the daily income of the

local dairy farmers (Paulin-Curlee, et al., 2007). Specifically, Klebsiella pneumoniae is a

facultative anaerobic Gram negative bacterium (Holt, et al., 1994) that is present in the

environment, mucosal surfaces of humans and animals (Macrae, et al., 2001; Brisse, et al.,

2009). Mastitis caused by Klebsiella pneumoniae can be more severe than the other mastitis

pathogens due to its poor antimicrobial response, rapid progress to toxic shock and death. It

has been reported to be more pathogenic and cause higher losses than infections due to

Eschericia coli (Paulin-Curlee, et al., 2007).

This study will help the dairy animals in the Philippines especially the cattle which is

estimated to be 46, 363 heads (NDA, 2015) as the data and recommendations that will be

generated already fit the local conditions. Identifying Klebsiella pneumoniae as the cause of

mastitis and the risk factors leading to it will help provide worthy recommendations to the

local dairy farmers on its prevention, management and treatment. The whole dairy animal

4

industry which comprises of dairy cattle farmers, fresh milk processors, farm workers, dairy

products consumers and government officers will also benefit from this research through the

increase of food source.

AMR can also be acquired through the consumption of untreated or inadequately

treated milk (Timofte et al., 2014). Furthermore, studying about the antimicrobial properties

of Klebsiella pneumoniae will help prevent or at least lessen the occurrence of their drug

resistance which is essential in combating mastitis and of not incurring high treatment costs.

This will also help diminish or avoid transfer of such resistance properties to other pathogens

that could infect humans. Through this study, data such as antimicrobial resistance genes of

Klebsiella pneumoniae from bovine milk will be made available. This study will provide

vital information to various industry players, academicians, drug companies & policy makers.

As a pioneering work, it will serve as a benchmark for further researches.

1.2 Objectives of the study

The study aims to understand the antimicrobial resistance and its associated risk

factors, and genetic characterization of Klebsiella pneumoniae isolates from bovine milk.

Specific Objectives

1. To establish the prevalence of Klebsiella pneumoniae in mastitic cows from dairy

cattle farms in Batangas;

2. To determine the antibiotic resistance patterns and virulence factors of Klebsiella

pneumoniae and characterize its mechanisms, distribution and transfer among bacteria

isolated from bovine milk;

5

3. To establish the risk factors present in each farm in relation to Klebsiella pneumoniae

antimicrobial resistance in bovine mastitis; and

4. To formulate recommendations for each farm involved in terms of prevention, control

and management of Klebsiella pneumoniae antimicrobial resistance bovine mastitis.

1.3 Time and place of the study

The study will be conducted at the Department of Paraclinical Sciences, College of

Veterinary Medicine, University of the Philippines Los Banos, Laguna, and in dairy cattle

farms in Batangas from December 2015 to August 2016.

6

REVIEW OF RELATED LITERATURE

2.1 Mastitis

Mastitis is the inflammation of the mammary gland caused by several bacteria (Oliver

& Murinda, 2012; Zadoks et al., 2011) but it is also a response to intramammary

mycoplasmal, fungal, or algal infections. Microorganisms may escape the natural defense

mechanisms by multiplication along the streak canal (especially after milking), or by

propulsion into the teat cistern by vacuum fluctuations at the teat end during milking.

Mechanical trauma, thermal trauma, and chemical insult predispose the gland to

intramammary infection (IMI) as well. Occurrence of mastitis depends on the interaction of

host, agent, and environmental factors (Zhao & Lacasse, 2008).

The two classifications of mastitis according to severity are subclinical and clinical.

Subclinical mastitis depicts mild non-visible inflammation of the mammary gland and the

milk and quarter still appear normal. It is the main form of mastitis in dairy herds, exceeding

50% of cows in given herds (Oliver & Murinda, 2012). Subclinical mastitis may be

identified by bacteriological culture of milk or by the measurement of indicators of

inflammation such as Somatic cell count (SCC) and California Mastitis Test (CMT) (Oliver

& Murinda, 2012 and Barlow, 2011). The culture of milk from cows postpartum or cows

with high SCC may be used as a surveillance tool to identify common organisms causing

subclinical mastitis during lactation or as a component of a mastitis control program to

identify cows for treatment, segregation, or culling during lactation (Barlow, 2011).

Subclinical mastitis can be self-limiting and could heal spontaneously or it could develop

within hours up to several months to clinical mastitis (Oliver & Murinda, 2012). The cost of

subclinical mastitis is very difficult to quantify, but most experts agree that subclinical

7

mastitis costs the average dairy farmer more than does clinical mastitis (Zhao & Lacasse,

2008).

On the other hand, clinical mastitis is manifested through visible abnormal, clotty or

flaky appearance of the milk even if the udder may appear normal (Oliver & Murinda, 2012).

It is in dairy cattle in as many as 40% of samples (Barlow, 2011). Furthermore, clinical

mastitis can be categorized to mild, moderate and severe. In moderate clinical mastitis, the

udder is already visibly inflamed caused by the clots blocking the milk passage preventing

drainage from the alveoli. Consequentially, the alveoli swell leading to lower milk

production. Lastly, severe clinical mastitis poses a systemic threat to the animal as it

becomes ill inclusive of dull, sunken eyes, drooping cold ears, weakness, loss of appetite,

depression, dehydration, shivering, increased rectal temperature, increased pulse rate and

respiratory rate, reduced rumen contraction rate and diarrhea (Oliver & Murinda, 2012).

The two types of mastitis in terms of causative agent are the contagious and the

environmental type. The contagious type includes that of Staphylococus aureus,

Streptococcus agalactiae and Mycoplasma sp. which may spread from cow to cow (Oliver &

Murinda, 2012; Zhao & Lacasse, 2008) through the milkers’ hands, milking machine, and

flies (Levesque et al, 1995). Milking time hygiene is the basis for control of contagious

mastitis (Hogan & Smith, 2012). Antibiotic treatment of clinical mastitis caused by the

gram-positive cocci (e.g. Staphylococcus aureus, Streptococcus uberis, Streptococcus

dysgalactiae, and Streptococcus agalactiae) is often recommended. Treatment decisions

should be guided by culture results (Barlow, 2011).

The environmental type includes that of Streptococcus uberis, Streptococcus

dysgalactiae and coliforms such as Escherichia coli and Klebsiella pneumoniae (Oliver &

Murinda, 2012; Zhao & Lacasse, 2008) which have increased in relative importance as a

8

cause of both clinical and subclinical mastitis (Barlow, 2011). They are of fecal origin or

may come from the surroundings such as the beddings, feed and soil. Rates of environmental

mastitis are directly proportional to the temperature and moisture and are greatest during the

dry period and early lactation compared with other stages of lactation. Bulk tank and

monthly cow somatic cell counts (SCCs) are poor milk quality indicators of environmental

mastitis. Approximately 85% of coliform and 50% of environmental streptococcal infections

will cause clinical mastitis. The severity of clinical mastitis brought about by environmental

pathogens ranges from mild local signs to death. The vast majority of clinical coliform and

environmental streptococcal clinical cases are characterized by only abnormal milk and a

swollen gland. During the dry period, susceptibility to intramammary infections is greatest at

the 2 weeks after drying off and the 2 weeks prior to calving. Research has shown that 65%

of coliform clinical cases that occur in the first 2 months of lactation are intramammary

infections that originated during the dry period. Coliforms are skilled at infecting the

mammary gland during the transitional phase from lactating to fully involuted mammary

gland. Management include frequent manure removal, eliminating standing water in the

cow’s walking lanes and loafing areas, and avoiding overcrowding of animals in barns and

pastures (Hogan & Smith, 2012).

Culture negative results have been attributed to infectious bovine mastitis where

concentrations of pathogens are beneath the limit of detection using standard techniques, the

presence of endogenous inhibitory substances in milk decreases the viability of bacteria in

vitro, or the bacteria from the mammary gland were effectively cleared by the host immune

response prior to obtaining milk samples for culture. Less commonly isolated organisms

such as Mycoplasma spp., Serratia spp., Pseudomonas spp., Arcanobacterium pyogenes

(formerly Actinomyces pyogenes), Nocardia spp., Prototheca spp., Bacillus spp., yeasts and

fungi are unlikely to respond to treatment (Barlow, 2011). Escherichia coli, Klebsiella

9

pneumoniae, Streptococcus agalactiae and Staphylococcus aureus also occur as commensals

or pathogens of humans whereas other causative species, such as Streptococcus uberis,

Streptococcus dysgalactiae subsp. dysgalactiae or Staphylococcus chromogenes, are almost

exclusively found in animals (Zadoks et al., 2011).

Mastitis is recognized as the most costly disease in dairy cattle. Decreased milk

production accounts for approximately 70% of the total cost of mastitis (Zhao & Lacasse,

2008). As it is caused by several bacteria, it is difficult to control and massive economic loss

is to be expected. In the United States, the national mastitis council estimates that the annual

economic loss due to mastitis amounts to more than $2 billion (Oliver & Murinda, 2012).

Mammary tissue damage reduces the number and activity of epithelial cells and consequently

contributes to decreased milk production. Mammary tissue damage has been shown to be

induced by either apoptosis or necrosis (Zhao & Lacasse, 2008).

Segregation and culling is often the most prudent response for persistently infected

animals. It influences prevalence of mastitis pathogens in dairy herds and selective culling of

cows with mastitis may influence the prevalence of specific species or strains. Pathogen

genotype and host-restriction may influence the probability of infection persistence and cure

following treatment. Moreover, acquired resistance of species and strains through horizontal

gene transfer can be influenced by its bacterial genotype. Non-antibiotic control options such

as culling, segregation, hygiene and biosecurity will be important to limit transmission within

and between farms. In the past, when milk was bought largely for volume, the main aim of

treatment was to restore milk production and the failure to eliminate infection was not of

major priority. This likely brought about the use of short duration treatment regimens such as

2 days of therapy, targeting resolution of clinical signs but not bacteriological cure, although

the importance of bacteriological cure has long been recognized (Barlow, 2011).

10

Antimicrobial agents remain a component of infectious mastitis treatment and control

(Barlow, 2011). Antibiotic therapy of clinical mastitis involves detection of the infected

quarter, immediate treatment, administration and completion of recommended treatments,

recordkeeping, identification of treated cows, and strict observance of milk withdrawal

periods (Oliver & Murinda, 2012). The success of the therapy depends on the treatment

product, length of treatment and whether treatment was administered during lactation or

during the dry period, or in the case of heifers, shortly before calving, increasing cow age,

increasing SCC, increasing persistence of infection, increasing bacteria counts, and

increasing numbers of mammary quarters infected. Of these factors, the most important

affecting cure is treatment duration (Middleton, 2012). Antibiotics such as penicillin,

cephalosporin, non-cephalosporin beta-lactam, streptomycin, tetracycline and macrolide-

lincosamide drugs are used to combat mastitis. Additionally, penicillin is combined with

either novobiocin or dihydrostreptomycin (Barlow, 2011; Oliver & Murinda, 2012).

Treatment of clinical IMI caused by coliform organisms with IMM (intramammary) or

systemic formulations is not recommended due to the short duration of infection and high

spontaneous cure rates. Supportive care such as fluid therapy and treatment with steroidal or

non-steroidal anti-inflammatory drugs has been recommended for cases of acute clinical

coliform mastitis. Frequent milk-out is a popular recommendation in the dairy industry for

treatment of acute clinical coliform mastitis.

Cure of IMI following treatment of either clinical or subclinical mastitis is generally

higher for lower parity, lower number bacterial colonies in the pre-treatment sample, a

shorter duration of infection or lower number of positive pre-treatment samples, and a lower

pre-treatment milk somatic cell count. Bacterial genetic factors also affect clinical properties

of infection and the response to treatment. Cases of subclinical mastitis are commonly

11

treated at the end of a lactation cycle such as dry-cow therapy administered at the start of the

dry period. Dry cow therapy is an established mastitis control practice that is applied to 100%

of cattle on an estimated 73% of U.S. dairy farms (Barlow, 2011).

2.2 Antimicrobials and its stewardship

Antimicrobial drugs (Appendix 1) function by targeting different parts of the bacterial

cell. Various mechanisms include interference with cell wall synthesis; interference of

protein synthesis through the 30S and 50S subunit; interference with nucleic acid (DNA)

synthesis; inhibition of Ribonucleic acid (RNA) synthesis; inhibition of a metabolic pathway;

and disruption of bacterial membrane structure.

In detail, interference with cell wall synthesis happens through synthesis of uridine

diphosphate (UDP)-N-acetylglucosamine and uridine diphosphate (UDP)-N-acetylmuramyl

pentapeptide; peptidoglycan formation (UDP-N-acetylglucosamine, UDP-N-acetylmuramyl-

pentapeptide and pentapeptide of glycine); and cross-linkage of peptidoglycans by enzyme

transpeptidase (PBPs) also known as “transpeptidation”. Antimicrobials of this mode of

action include ß-lactam antibiotics such as penicillinase-resistant aminopenicillins and first-

to fifth-generation cephalosporins. Antimicrobials that interfere the protein synthesis through

the 30S subunit are aminoglycosides and aminocyclitols which interfere with the recognition

between amino-acyl tRNA and codon causing incorporation of incorrect amino acids,

formation of abnormal and non-functional protein and rapid cell death; and tetracyclines

which prevent the binding of aminoacyl tRNA to the A site of the ribosome and suppress the

movement of tRNA along the ribosome. On the other hand, interference through the 50S

subunit happens through binding to the domain V of 23S rRNA (peptidyl transferase center)

and inhibiting the formation of peptide bond between amino acid on aminoacyl t-RNA and

12

growing peptide chain. They also bind to the A site and prevent the transfer of peptide chain

form the A site to the P site. Antimicrobials having this mechanism are chloramphenicol,

macrolides, lincosamides and streptogramins.

Intervention with nucleic acid (DNA) synthesis occurs by interfering with DNA

gyrase (topoisomerase II) for gram-negative bacteria and topoisomerase IV for gram-positive

bacteria. Antimicrobials having this mode of action are quinolones, nitroimidazoles and

nitrofurans. While on ribonucleic acid (RNA), synthesis is inhibited by rifamycins by

binding on DNA directed beta subunit RNA polymerase disabling bacterial DNA to transfer

its information to RNA and inhibiting protein synthesis. Furthermore, inhibition of a

metabolic pathway ensues by acting on the synthesis of tetrahydropholic acid specifically on

the dihydropteroate synthetase and dihydrofolate reductase by the sulphonamides and

diaminopyrimidines respectively. Lastly, disruption of bacterial membrane structure takes

place as manifested by polymyxins through interaction with the phospholipids of cell

membrane of gram-negative bacteria by increasing its permeability thus disrupting and

destabilizing the membrane (Younes, A.M., 2010).

Aspects of antimicrobial use to consider in the development of farm specific strategies

may include pathogen identification causing specific health problems, determination of the

most appropriate drug classes to use for treatments, ensuring appropriate treatment regimens

including dosage, route of administration, and duration of therapy, and pathogen

susceptibility testing and monitoring. Strategies should be reviewed regularly and revised to

meet changing circumstances. Use minimum inhibitory concentration (MIC) test methods,

report results at the species level, and present MIC data as the proportion of isolates

susceptible or resistant for each dilution tested in complete tabular form or using histograms.

Eliminating unnecessary antibiotic treatments would be beneficial for economic and prudent

drug use purposes. Treatment of culture negative mastitis is not recommended. Selective

13

dry-cow therapy can also be implemented to only treat cows at high risk for infection at the

end of lactation as opposed to doing blanket dry cow therapy which entails treating all cows

at the end of lactation regardless of infection status. The former appears to be an option in

herds with low prevalence of infection, but the potential impact on net drug use still remains

unknown. Non-antibiotic alternatives to dry cow therapy such as internal teat sealants may

provide an alternative which contributes to reduced drug use in dairy herds. It has been

estimated that antibiotics would not be justified for treatment of at least 50% of clinical

mastitis cases (Barlow, 2011).

Benefits of antimicrobial usage include healthier, more productive cows; lower

disease incidence; reduced morbidity and mortality; decreased pathogen loads; and

production of abundant quantities of nutritious, high-quality, longer shelf-life milk for human

consumption. However, there is controversy on its wide usage which may have led to the

occurrence of antimicrobial resistance. It may also lead to presence of antibiotic residue in

milk. These are two public health and food safety issues but also an economic issue for the

farmer to be penalized of having poor quality milk (Oliver & Murinda, 2012).

2.3 Antimicrobial Resistance

Issues related to antimicrobial use in dairy production systems include antimicrobial

agents such as cephalosporins, lincosamides, non-cephalosporin beta-lactams and

aminoglycosides relating to their availability ‘over-the-counter’ (OTC) at the disposal of

producers without veterinary supervision; the use of antimicrobial agents in an extra-label

manner; the relationship between antimicrobial use practices and the risk for development of

antimicrobial resistance; the development and validation of methods to quantify and

document antimicrobial use and the effect of prudent antimicrobial use practices.

14

Specifically, key conditions for extra-label drug use in food animals relate to residue

avoidance and documentation of adequate milk and slaughter withholding times to ensure

food safety. Extra-label use is not permitted if the use results in a violative drug residue in

food or if the use presents a public health risk, if another drug exists equivalent to what is

needed, and if no evidence is available on any approved antibiotic product establishing its

efficacy. Injectable products approved for use in beef or dairy cattle less than 20 months of

age are strictly prohibited for IMM extra label use. Such drugs are the macrolides or

flouroquinolones labelled for treatment of bovine respiratory disease.

U.S. Food and Drug Administration (FDA) Center for Veterinary Medicine (CVM)

has prohibited the extra-label veterinary use of flouroquinolones and glycopeptides in food

animals due to their importance in human medicine and the risk that extra-label use may

increase the antimicrobial resistance of bacteria that can cause human illness. Systemic use

of an antimicrobial drug such as ceftiofur or ampicillin to treat severe acute coliform mastitis,

especially when bacteremia is suspected or documented, represents an extra-label drug use

that maybe justified as there are no antimicrobials labelled for systemic administration for

mastitis and a significant proportion of coliform mastitis cases have been demonstrated to

progress to bacteremia where inclusion of antimicrobial therapy in treatment regimens

improves cow survival. Improved surveillance of antimicrobial use in food-producing

animals, including standardized class specific estimates of dosing per animal unit such as per

kilogram live weight, per time period such as the animal daily dose, is required to accurately

attribute risk to specific production systems (Barlow, 2011).

15

2.3.1 Transmission of resistance genes

AMR started from antimicrobial-producing organisms such as fungi or soil bacteria.

Through selective pressure, a few bacteria emerge after exposure to a given antimicrobial

with development of antimicrobial resistance mechanisms. Resistance genes can either be

transmitted vertically or horizontally via mobile genetic elements such as plasmids,

transposons and integrons. Specifically, plasmids are single stranded DNA in gram-positive

bacteria called the “jumping genes”. They vary widely in size from 1,000 to 10,000 base

pairs. They occur most often as closed covalently circular (CCC) with no free ends. They

replicate as the cell grows and encode RNA and protein. Secondly, transposons are small

pieces of DNA that insert itself into another place in the genome. Lastly, integrons, with nine

classes, are genetic units characterized by their ability to capture and incorporate gene

cassettes by site-specific recombination. Moreover, a gene cassette is a type of

mobile genetic element that contains a gene and a recombination site of 57-141 base pairs.

They often carry antibiotic resistance genes. They may vary considerably in total length from

262 to 1,549 base pairs. They exist incorporated linearized form into an integron or at a non-

specific location or freely as closed covalently circular DNA molecules which are important

intermediates in the dissemination of the cassettes. The second unit of transfer is the vector

which is a DNA molecule used as a vehicle to artificially carry foreign genetic material into

another cell, where it can be replicated and/or expressed (Synder and Champness, 1997).

Lastly, bacteria itself through zoonosis can transfer resistance genes from man to animals and

vice versa and through the different species of animals.

16

2.3.2 Types of Antimicrobial resistance

There are two types of AMR such as endogenous and exogenous AMR. Endogenous

AMR is the genetic change in bacterial genome also known as mutation while exogenous

AMR is the horizontal acquisition of foreign genetic information. In the latter, gene transfer

is classified as transformation or acquisition of free DNA, transduction via bacteriophages,

and conjugation or cell-to-cell transfer.

Transformation is the transfer of free or “naked” DNA into competent recipient cells.

It requires homology between donor and recipient DNA for recombination to happen. It only

plays a limited role in the transfer of resistance genes due to a rapid degradation of free DNA

from lysed bacteria. Only a few bacteria, such as Streptococcus pneumoniae and Bacillus

spp. exhibit a natural ability to take up free DNA from environment. On the other hand,

transduction is a bacteriophage-mediated transfer process. A bacteriophage is a virus that

infects and replicates within a bacterium. Transduction does not require viability of the

donor cell. It is also limited only to closely related bacteria carrying the same receptors

(specific receptor) for phage attachment. It is commonly observed between bacteria of the

same species particularly in gram-positive bacteria such as the spread of β-lactamase genes in

Staphylococcus aureus or multiple resistance phenotypes in Salmonella Typhimurium phage

type DT104. Lastly, we have conjugation which is a self-transfer of conjugative plasmid or

transposon from donor to recipient cells. It requires close contact between donor and

recipient cells via the conjugation bridge and it is an important means for the spread of

resistance genes between bacteria of different species and genera (Synder and Champness,

1997).

17

2.3.3 Mechanisms of AMR

The major mechanisms of AMR are enzymatic drug inactivation, reduced intracellular

accumulation of antimicrobials, and protection, alteration or replacement of the cellular target

sites. Enzymatic drug activation happens through resistance to β-lactams and

aminoglycosides via the enzymes β-lactamases and aminoglycoside-modifying enzymes

respectively. Decreased drug uptake through decreased cell wall permeability is how

intracellular accumulation of antimicrobials is reduced. This is an important mechanism of

resistance to β-lactams and fluoroquinolones in gram-negative bacteria, especially in

Pseudomonas aeruginosa and in Enterobacteriaceae. The outer membrane of gram-negative

bacteria may represent a permeability barrier to certain antibiotics. Mutations leading to

reduced expression, structural alteration or even loss of porins have been associated with

reduced permeability to antimicrobial drugs.

Aside from that, there could be increased removal of the drugs through an active efflux

which is an energy-dependent transmembrane protein mechanism. Furthermore, it is a

channel that actively exports antimicrobials and other compounds out of the cell. It prevents

intracellular accumulation necessary to exert the lethal activity inside the cell (Wannaprasat,

2012). The last mechanism is modification or replacement of the drug target and target

protection so the drug can no longer bind and exert its activity on the cell. This is important

for resistance to penicillin and glycopeptides in gram-positive and to quinolones in both

gram-positive and gram-negative bacteria. Structural changes of the binding sites of the

drugs targeting the bacterial ribosome in aminoglycosides are usually due to methylation.

Other changes are modification of DNA gyrase enzyme due to gene mutation causing

quinolone resistance and glycopeptide resistance in enterococci and methicillin resistance in

Staphylococcus aureus (MRSA) are due to drug target replacement. Target replacement is

18

also the main mechanism of acquired resistance to sulfonamides and trimethoprim followed

by increasing production of the drug target or another molecule with affinity for the drug

while target protection is the one mainly associated with tetracycline resistance.

2.3.4 Antibiotic sensitivity test (AST)

ASTs act as an epidemiologic tool and as a guide for treatment as it is a diagnostic

procedure being done to detect the extent of AMR in common pathogens and to assure

susceptibility to antimicrobials of choice for treatment of particular infections. The ideal

AST has low detection limit, high sensitivity and validity, ease of usage, storage and

longevity, no need for expensive equipment, and has scientific support. It should also be fast,

economical and environmental-friendly. However, its limitations include none mimicry of in

vivo environment and its results cannot predict outcome such as diffusion in tissue and host

cells, serum protein binding, drug interactions, host immune status & underlying illness,

organism virulence and site and severity of infection.

ASTs can fall under two types of methods such as the diffusion and the dilution

method. The diffusion method detects AMR through zone diameter breakpoint but still

considered qualitative since measurement of resistance through zone of inhibition (diameter

in mm) as compared with a standard table can only be categorized as susceptible,

intermediate and resistant. Intermediate results can further be characterized as moderate

susceptible for low toxic antibiotics and a buffer zone between resistant and susceptible for

high toxic antibiotics. The diffusion method is further classified into two types of tests such

as the disk diffusion test also known as the Kirby- Bauer test and the Epsilometer test also

known as the E-test. The former uses antibiotic-impregnated filter discs with set

19

concentration and measures AMR against more than one antibiotic through measurement of

the size of the zone of inhibition. The result depicts a direct relationship between the sizes of

the zone of inhibition to the antibiotic effectivity. Three possible AST results can occur such

as susceptible with wide zone of inhibition, intermediate with medium zone of inhibition and

resistant without zone of inhibition. The latter uses a plastic strip instead with a predefined

gradient of fifteen antibiotic concentrations. It measures an approximate-MIC value. Results

are read directly on the strip where the elliptical zone of inhibition intersects with the strip.

This is good for slow-growing or nutritionally deficient microorganisms and is used on

antimicrobials not used routinely or on a new antimicrobial. Additionally, it can

confirm/detect a specific resistance phenotype and can detect low levels of resistance.

On the other hand, the dilution method is a quantitative type which detects AMR

through minimum inhibitory concentration (MIC) which is the lowest concentration of the

antimicrobial completely inhibiting visible growth of the microbial isolate being tested. It is

also further classified into three tests such as agar dilution test, broth microdilution and broth

macrodilution. The first test gives visible growth of the microbial isolate on agar plates with

a series of antimicrobials. It is the method of choice for a large number of bacterial isolates

as multiple isolates are tested on each plate and it is not good to use if susceptibility to a wide

range of different antimicrobial is to be tested. It uses a replicator, be it 96-teeth manual

applicator with a rod handle or 64-teeth semi-automatic applicator with a knob handle in a

64-well plate. Final concentration of organism is at 1 x 104 CFU/mL. Secondly, broth

microdilution uses various concentrations of antimicrobial in broth of which the range varies

depending on the antimicrobial used. Testing volume is at 0.05-0.1mL. Final concentration

of organism is at 5 x 105 CFU/mL. The disadvantages of this test include test limiting to only

one antimicrobial & one organism to be tested each time and it being time consuming. It uses

20

96-well plates that are manually or commercially prepared. The broth macrodilution uses the

same principle as that of broth microdilution. Testing volume is rather at >1.0 mL. Final

concentration of organism is at 5 x 105 CFU/mL (CLSI, 2012).

2.4 Klebsiella pneumoniae

2.4.1 General characteristics

Klebsiella pneumoniae is a facultative anaerobic Gram negative bacterium (Holt, et

al., 1994), named after Edwin Klebs, a German microbiologist and recognized over a century

ago as a source of community-acquired pneumonia (Younes, A.M., 2011). It is present in the

environment, mucosal surfaces of humans and animals (Macrae, et al., 2001; Brisse, et al.,

2009). It belongs to the family Enterobacteriaceae and under the genus Klebsiella. It appears

gray-brown 3-5mm diameter colonies, non-hemolytic with the characteristic fecal odor on

blood agar (Hogan and Smith, 2003) while on McConkey agar, it appears small to large (1-

7mm) wet, glistening, dome-shaped, pink-yellow mucoid colonies with smooth edges

(Younes, A.M., 2011) and without precipitate in the surrounding agar (Munoz et al., 2006;

Zadoks, et al., 2011).

It is oxidase and methyl red negative and does not produce indole and H2S. It is

catalase, Voges-Proskauer (VP), Simmons citrate and lysine decarboxylase positive. It

produces acid but not gas on Triple Iron Sugar and is negative to arginine dihydrolase and

ornithine decarboxylase. It is not motile and does not hydrolyze urea and gelatin. It ferments

using D-glucose and reduces nitrates (Holt, et al., 1994). Clinical isolates of Klebsiella

pneumoniae are categorized according to the nucleotide variations of the gyrA, parC, and

21

rpoB genes into four phylogenetic groups called KpI, KpII-A, KpIIB, and KpIII (Younes,

A.M., 2011).

Klebsiella spp. populates soils, grains, water, and intestinal tracts of animals (Brisse,

et al., 2009). It is more capable than Escherichia coli at surviving in the mammary gland

from the onset of involution until calving as E. coli intramammary infections will only last

for less than 10 days on the average during lactation while intramammary infections caused

by K. pneumoniae would endure about 21 days on the average. The prevalence of coliform

mastitis in a herd seldom exceeds 5% of lactating quarters because coliform infections tend to

be short duration during lactation. They rarely cause chronic infections of greater than 90

days (Hogan & Smith, 2012). The most common Klebsiella species causing bovine mastitis

is K. pneumoniae. The presence of Klebsiella in used bedding is due to contamination with

bovine feces or with milk from Klebsiella infected cows (Zadoks et al., 2011).

There are three layers composing the cell wall of Klebsiella namely the cytoplasmic

membrane, the peptidoglycan layer and the outer membrane consisting of a complex of

lipopolysaccharide (LPS) forming the O antigen, phospholipid and protein. Additionally, the

LPS has three parts, viz region I, which is the outermost part called O-specific polysaccharide

composed of oligosaccharide repeating units to which the O-antigen is chemically based,

region II, the middle area termed core oligosaccharide which expresses the rough (R) antigen

specificity and region III, the innermost part which is the lipid moiety of the molecule named

lipid A where the hydrophobic reaction is attached to the lipoprotein of the outer cell

membrane of the bacterial cell. Aside from this, Klebsiella is covered by a thick

polysaccharide capsule forming glistening mucoid colonies of viscid consistency (Bergan,

1984) which becomes the basis for serotyping in reference to the 77 known antigenic capsular

or K-antigen strains of which serotypes K1 and K2 are the virulent types due to resistance to

22

serum killing (Pan et al, 2008). Conventional serotyping through slide agglutination for O

antigens and capsular swelling tests for K antigens yielded cross reactivity between serotypes

(Bergan, 1984; Podschun and Ullman, 1998) that is why molecular serotyping has gain its

popularity over the years since polymerase chain reaction is more sensitive and specific.

Further classification of Klebsiella pneumoniae isolates would be the three phylogenetic

groups called KpI which represents more than 80% of Klebsiella pneumoniae human clinical

isolates and has higher antimicrobial resistance rates to the remaining groups KpII and KpIII

(Brisse and Duijkere, 2005).

Due to imprudent use of antibiotics, Klebsiella pneumoniae infections have developed

multi-drug resistance (MDR) otherwise known as multiple antibiotic resistant Klebsiella spp.

(MRKs) due to production of ‘extended-spectrum’ β-lactamases (ESBLs) (Macrae, et al.,

2001) which are enzymes contributing to resistance to penicillins, aztreonam, first generation

cephalosporins and to newer ones like cefotaxime, ceftazidime, cefoxitin and ceftiofur

(Brisse and Duijkeren, 2005). Klebsiella pneumoniae is also the most common Klebsiella

species infecting animals and causing mastitis further imposing a higher economic loss in

terms of milk production and survival (Munoz et al., 2006). It also carries potential public

health implications through the consumption of untreated or inadequately treated milk

(Timofte et al., 2014). However, not much research has still been done on the prevalence of

antimicrobial resistance in animal Klebsiella isolates (Brisse and Duijkeren, 2005).

2.4.2 Pathogenesis

Klebsiella pneumoniae is the most medically important amongst the Klebsiella

species (Younes, A.M., 2011). It is an opportunistic pathogen both shared by humans and

23

animals. It can be spread horizontally through the gastrointestinal tract, personnel hands and

devices and environmental contamination (Parasakthi et al., 2000; Brisse, et al., 2009).

Klebsiella pneumoniae causes bacteraemia, respiratory and urinary tract infection particularly

in immunocompromised patients (Cortes et al., 2002; Brisse, et al., 2009) and community-

acquired pyogenic liver abscess and septic metastatic complications like meningitis and

endophthalmitis (Yeh et al., 2006; Pan et al., 2008; Brisse, et al., 2009). It has the ability to

spread rapidly in the hospital environment causing intense nosocomial outbreaks (Podschun

and Ullman, 1998; Brisse, et al., 2009; Younes, A.M., 2011). In animals, it causes similar

clinical signs to hospital patients and mastitis specifically on bovine (Brisse and van

Duijkere, 2005; Younes, A.M., 2011) and metritis in mares after transmission from an

infected stud especially capsular serotype K1, K2, K5 and K7. It can further cause infection

in dogs, monkeys, guinea pigs, muskrats, birds and fox (Younes, A.M., 2011). Adhesins,

siderophore (Koczura and Kaznowski, 2003), lipopolysaccharide (LPS), and the capsular

polysaccharide (CPS) are factors adding to its virulence (Brisse, et al., 2009; Younes, A.M.,

2011).

2.4.2.1 Capsular antigens

Capsular polysaccharide (CPS) gives the characteristic mucoid appearance of the

colony and is deemed to be one of the primal virulence factors of Klebsiella pneumoniae. It

is composed of four to six sugars such as glucose, galactose, mannose, fucose and rhamnose,

and very often, uronic acids (Podschun and Ullman, 1998; Younes, A.M., 2011). It is

incorporated by the horizontal transfer of the cps operon (Brisse, et al., 2009). Now with 77

serotypes, it is involved in resistance to macrophage phagocytosis and to the complement

system (Cortes et al., 2002; Brisse, et al., 2009) especially C3b and serum resistance due to

24

the bulky bundles of fibrillous structures covering the bacterial surface in extensive layers

(Podschun and Ullman, 1998; Younes, A.M., 2011).

Being the predominantly virulent strains, Klebsiella pneumoniae K1 capsular serotype

isolates cause liver abscess (Younes, A.M., 2011), endophthalmitis and acute pneumonia

(Chuang, et al., 2006; Brisse, et al., 2009). K2, K4 and K5 isolates can also be involved in

the latter aside from causing metritis in mares (Brisse, et al., 2009). They have also started to

develop resistance to neutrophil phagocytosis as opposed to non-K1/K2 isolates such as K3,

K4, K5 and K6 (Struve et al., 2005; Yeh et al., 2006).

2.4.2.2 Adhesins

Adhesins are almost always hemagglutinins that may be located on fimbrae or pili

protruding on the bacterial cell surface. Majority of the Klebsiella pneumoniae isolates have

fimbrae which display either one or both adhesive properties such as “mannose-sensitive

(MS) adhesion”, linked to the common type 1 thick fimbrae (MSHA) and susceptible to

inhibition by D-mannose, and “MR adhesion”, involved with type 3 thinner fimbrae

(mannose-resistant, Klebsiella-like hemagglutination or MR-K/HA) and resistant to mannose

(Bergan, 1984; Podschun and Ullman, 1998 and Yousen, A.M., 2011). In addition, type 3

fimbriae are set by the mrk gene cluster composing the major fimbrial subunit mrkA gene and

the mrkD fimbrial adhesin in charge of the mannose resistant Klebsiella-like

hemagglutination. They are also believed to help in the establishment of extended

extracellular structures known as biofilms which serve as structural anchors and barriers to

contact with host defenses thus protecting against antibiotics (Yousen, A.M., 2011).

25

Other types of Klebsiella adhesins include Type 6 pili (Yousen, A.M., 2011),

nonfimbrial CF29K, aggregative adhesion and KPF-28 fimbriae (Koczura and Kaznowski,

2003). The non-fimbrial R-plasmid-encoded CF29K adhesin is known to mediate adherence

to the human intestinal cells lines Intestine-407 and CaCo-2. Non-fimbrial adhesin consists

of capsule-like extracellular material that mediates adherence pattern described by

aggregative adhesion to intestinal cell lines. Lastly, the fimbrial KPF-28 produces the CAZ-

5/SHV-4 type ESBL (Podschun and Ullman, 1998).

2.4.2.3 Lipopolysaccharide

Three distinguishable sections such as the lipid A, the core polysaccharide and the

side chain O-antigen (O-Ag) polysaccharide comprise the lipopolysaccharide (LPS) molecule

which is with eight serotypes and are associated with resistance to complement-mediated

killing. Particularly, the lipid A attaches the LPS molecule into the outer membrane. It also

serves as an endotoxin which stimulates the immune system through agonism of Toll-like

receptor 4 (TLR4) present on macrophages, dendritic cells and other cell types inducing

nuclear factor kappa-light-chain-enhancer of activated B cells (NF-kB) mediated production

of cytokines. The negatively charged core polysaccharide likewise links the O-Ag onto the

lipid A molecule. Finally, the O-Ag forms a polysaccharide layer covering up to 30 nm into

the surrounding media (Younes, A.M., 2011).

2.4.2.4 Other factors

Siderophores are high-affinity, low-molecular-weight iron chelators that solubilize

and import the required iron bound to host proteins. Phenolates or enterochelin/enterobactin

26

and hydroxamates or aerobactin are the two different groups of siderophores prominent in the

genus Klebsiella. The former is found to be produced by all strains as opposed to the few

that can only produce the latter (Koczura and Kaznowski, 2003; Younes, A.M., 2011).

2.4.3 Typing

Typing is being done to obtain information about endemic and epidemic outbreaks of

Klebsiella infections and to determine the clonality of the strains. The two typing methods

include the phenotypic or molecular typing. Explicitly, phenotypic typing can be done

through biotyping, phage typing, bacteriocin typing or serotyping. On the other hand,

molecular typing methods are used to determine bacterial strains or clones and are further

subdivided to protein based method such as sodium dodecyl sulfate polyacrylamide gel

electrophoresis (SDS-PAGE) which is proven effective by Costas, et al (1990) when

comparable to capsular serotyping or nucleic acid based methods such as PCR amplification

and sequencing, pulsed-field gel electrophoresis (PFGE), randomly amplified polymorphic

DNA (RAPD), restriction fragment length polymorphism (RFLP), multilocus sequence

typing (MLST) and repetitive sequence-based PCR (rep-PCR) (Younes, A.M., 2011).

Additionally, biotyping is based on biochemical reactions and environmental

tolerance with the use of automated instruments such as API 20E systems with macrotube

tests. Unfortunately, identification to the species level is often difficult due to the similarity

of biochemical profiles making it of little use to epidemiological studies and only appropriate

for smaller laboratory setups. Phage typing is based on the receptiveness of bacterial strains

to a group of bacteriophages. It has never been used extensively starting from its

establishment in 1964 because of its poor typing rate due to the lack of standardization and

27

inoculum concentration, the limited availability and stability of bacteriophages needing

maintenance and evaluation from time and again. Supplementary, bacteriocin typing makes

use of protein-based bactericidal substances produced by bacteria to inhibit the growth of

other bacteria of the same species through inhibition of protein and nucleic acid synthesis and

uncoupling of electron transport from active transport of thiomethyl-ß-Dgalactoside and

potassium. Lastly, seroptying is the reaction of the surface-exposed antigen determinant such

as the capsule to a specific antiserum (Younes, A.M., 2011). Although it is the predominant

method in typing Klebsiella species now, it has disadvantages such as the occurrence of large

number of serological cross-reactions among the 77 capsule types, the weak reaction due to a

weak antigen which affects interpretation, the huge amount of time consumed, the scarcity of

commercially available anti-capsule antisera, and the occurrence of non-typable isolates

(Podschun and Ullmann 1998).

Molecular methods were developed to address the numerous concerns regarding

phenotypic typing. PFGE, which may be used for genotyping or genetic fingerprinting, is

considered the gold standard in epidemiological studies of pathogenic organisms as it can

detect chromosomal rearrangements by mobile elements with swift evolutionary rates. To

establish taxonomic identity, evaluate kinship relationships, investigate mixed genome

samples, and generate specific probes, RAPD is the method of choice as it makes use of low-

stringency PCR amplification with single primers of random sequence to produce strain-

specific arrays of anonymous DNA fragments. gyrA PCR-RFLP using restriction enzymes

HincII, TaqI and HaeIII of the 441-bp fragment of the gyrA gene, and the 940-bp fragment of

the RNA polymerase beta subunit gene (rpoB) can be used as well to confirm identified

isolates of Klebsiella pneumoniae. Moreover, MLST is set to describe the genetic

relationships among bacterial isolates and is more appropriate for strain phylogeny and large-

scale epidemiology. Last of all, rep-PCR is a quick method for strain typing and description

28

of bacteria by using primers targeting noncoding repetitive elements interspersed throughout

the bacterial genome (Younes, A.M., 2011).

2.4.4 Antimicrobial resistance

Emergence of nosocomial multidrug-resistant Klebsiella pneumoniae (MRKP) and

ESBL-producing strains have been observed since 1983 followed by the emergence of

resistant strains to third-generation cephalosphorins since 1990 (Parasakthiet al., 2000 and

Younes, A.M., 2011). Extended-spectrum β-lactamases (ESBL) are plasmid-mediated

multiple antimicrobial resistance enzymes that can be spread horizontally to recipient

microorganisms. It can hydrolyze broad-spectrum cephalosporins and monobactams and

cannot be detected on routine antimicrobial susceptibility testing resulting to poor clinical

outcome (Mosqueda-Gomez et al., 2008) although can be hindered by β-lactamase inhibitors

such as clavulanic acid (Younes, A.M., 2011).

Its molecular classification depends on their amino acid homology namely classes A,

B, C and D as proposed by Russell Ambler (Jeong et al., 2004; Younes, A.M., 2011) or on

substrate and inhibitor profile namely groups 1, 2, 3 and 4 as proposed by Bush-Jacoby-

Medeiros as listed on Table 1 (Younes, A.M., 2011).

Table 1. β-lactamase classification schemes.Ambler

classBush-Jacobygroup

Distinctivesubstrates

Inhibited by Representativeenzymes

CA /TZB

EDTA

C 1 Cephalosporins - - AmpC, P99, ACT-1,CMY-2, FOX-1, MIR-1

C 1e Cephalosporins - - GC-1, CMY-37A 2a Pencillins + - PC1A 2b Pencillins,

early+ - TEM-1, TEM-2,

SHV-1

29

cephalosporins

A 2be Extended-spectrumcephalosporins,monobactams

+ - TEM-3, SHV-2, CTX-Ms, PER, VEB

A 2br Penicillins - - TEM-30, SHV-10A 2ber Extended-

spectrumcephalosporins,monobactams

- - TEM-50

A 2c Carbencillin + - PSE-1, CARB-3A 2ce Carbencillin,

cefepime+ - RTG-4

D 2d Cloxacillin V - OXA-1, OXA-10D 2de Extended-

spectrumcephalosporins

V - OXA-11, OXA-15

D 2df Carbapenems V - OXA-23, 0XA-48A 2e Extended-

spectrumcephalosporins

+ - CEPA

A 2f Carbapenems V - KPC-2, IMI-1, SME-1B 3a (B1) Carbapenems - + IMP-1, VIM-1, IND-

1, CcrA(B2) L1, CAU-1, GOB-1,

FEZ-1

B 3b (B3) Carbapenems - + CphA, Sfh-1Unkown 4 -

ESBLs have various types such as those of class A like TEM and SHV types which

are more associated to hospital-acquired infections and have evolved from narrow-spectrum

β-lactamases such as TEM-1, -2 and SHV-1; PER type which denotes resistance to

oxyimino-β-lactams and are mostly restricted to South America and Europe so far (Paterson

et al., 2003), and CTX-M type enzymes identified mainly as ciprofloxacin resistant causing

community-acquired urinary tract infections (Pitout et al., 2005).

30

The TEM family of ESBLs which name came from the patient Temoniera, is the

largest and widely spread. Its plasmid mediated TEM-1 was first discovered in 1965 and is

the most prevalent in enteric bacilli such as Klebsiella pneumoniae and in other Gram-

negative bacteria. It is encoded by a series of gene alleles, blaTEM-1A to blaTEM-1F, differing

from each other by specific silent mutations. Although not as common, TEM-2 being the

first derivative of TEM-1, encoded by blaTEM-2 possesses a stronger promoter than that of the

blaTEM-1 gene giving a higher enzymatic activity as compared to TEM-1 producing strains

(Younes, A.M., 2011).

Moreover, the SHV (sulfhydryl variable) enzymes are categorized in Ambler class A

and in groups 2b and 2be of the Bush-Jacoby-Medeiros classification scheme. Specifically,

SHV-1 was first reported in 1972 and named Pit-2 after its discoverer Pitton. It denotes

resistance to ampicillin, amoxicillin, carbenicillin and ticarcillin and encoded by gene alleles

blaSHV-1 or blaSHV-11 which are prevalent in Klebsiella pneumoniae strains and is behind

approximately 20% of the plasmid-mediated ampicillin resistance in this species. Such genes

are possibly mobilized from genome to plasmid as facilitated by IS26 insertion which was

identified into the blaSHV promoter particularly in plasmid-mediated SHV-2a, SHV-11 and

SHV-12. There are only a few SHV that signify resistance to ß-lactamase inhibitors as

opposed to TEM ß-lactamases (Younes, A.M., 2011). The β-lactamases of ceftazidime-

resistant Klebsiella pneumoniae strains are usually of the SHV-5 type in Europe and TEM-10

and TEM-12 types in the United States (Podschun and Ullman, 1998).

Last of those belonging to class A, the CTX-M type ß-lactamases (active on

cefotaxime) were first discovered in Japan in 1986. They are further subcategorized in 5

subgroups namely CTX-M-1, CTX-M-2, CTXM-8, CTX-M-9 and CTX-M-25. Over time,

they have become more predominant than TEM and SHV type ß-lactamases in Africa,

Europe, South America and Asia mainly due to their mode of acquisition of horizontal gene

31

transfer from other bacteria and to the ability of insertion sequences such as ISEcp1, ISCR,

IS26, IS10 and IS903, phage-related elements and plasmids, to facilitate and induce the

expression of ß-lactamase genes (Pitout et al., 2005 and Younes, A.M., 2011). The genes

responsible for CTX-M ß-lactamases are encoded by plasmids belonging to the narrow host-

range incompatibility types (IncFI, IncFII, IncHI2 and IncI) or the broad host-range

incompatibility types (IncN, IncP1, IncL/M and IncA/C). The CTX-M enzymes depict

higher level resistance to cefotaxime, ceftriaxone and aztreonam than to ceftazidime and are

susceptible to ß-lactamase inhibitors, although a low-level of resistance to the combination of

clavulanic acid with amoxicillin and ticarcillin could be experienced (Younes, A.M., 2011).

Furthermore, class B enzymes termed ‘metallo-ß-lactamases’ were first distinguished

in 1980 again by Russell Ambler. They hydrolyse penicillin, cephalosporins and

carbapenems but not monobactams. They are EDTA-inhibited enzymes and are resistant to ß-

lactamase inhibitors. They are further subdivided on the basis of sequence alignments into

three subclasses B1, B2 and B3. AmpC type enzymes belonging to class C are named

according to the resistance produced, type of enzyme, site of discovery or patient’s name.

These include CMY-1 (cephamycin resistance), MOX-1 (moxalactam resistance), FOX-1

(cefoxitin resistance), LAT-1 (latamoxef resistance), ACT-1 (AmpC type enzyme), MIR-1

(Miriam Hospital, Providence) and ACC-1 (Ambler class C enzyme) (Jeong et al., 2004;

Younes, A.M., 2011). They have emerged due to the ongoing use of 7--methoxy-

cephalosporins (cefoxitin and cefotetan) and ß-lactamase inhibitor combinations (clavulanate,

sulbactam or tazobactam) with amoxicillin, ticarcillin, ampicillin, or piperacillin (Younes,

A.M., 2011) which lead to the resistance to many β-lactam antibiotics like cephamycins,

extended-spectrum cephalosporins (Jeong et al., 2004) and ß-lactamase inhibitor-ß-lactam

combinations. They are usually chromosomal such as FOX-1 and MOX-1 but can also be

plasmid-encoded such as MIR-1, CMY-1 and CMY-2. The continued spread of AmpC

32

enzymes globally may be attributed to the association of mobile elements such as ISEcp1,

ISCR1 or IS26 to the latter. Finally, OXA ß-lactamases belong to Ambler class D (2d) which

attack the oxyimino-cephalosporins and have a high hydrolytic activity in opposition to

oxacillin, methicillin and cloxacillin more than benzylpenicillin. They are inhibited by NaCl

and less efficiently by clavulanalic acid. Contrary to class C, OXA ß-lactamases are typically

plasmids incorporated as gene cassettes in integrons than chromosomal encoded. They are

often not considered as ESBLs as they do not hydrolyze the extended-spectrum

cephalosporins (Younes, A.M., 2011).

As presented on Table 2, nosocomial Klebsiella pneumoniae isolates are resistant to

ampicillin, gentamicin, amikacin, trimethoprim-sulfamethoxazole, cefuroxime, cefotaxime,

ceftriaxone, cefoperazone, and ceftazidime but susceptible to imipenem and ciprofloxacin

(Parasakthi et al., 2000). Studies of Macrae et al (2001) and Mena et al (2006) showed

similar results on human isolates adding resistance to tetracycline but still showed differently

as it was susceptible to imipenem, aztreonam and ciprofloxacin. In bovine milk, their isolates

were resistant to penicillin, cloxacillin, ceftiofur, gentamicin, tetracycline, trimethoprim-

sulfonamide and enrofloxacin. In addition, those isolates of Timofte et al (2014) taken from

bovine milk showed resistance to penicillin G, amoxicillin-clavulanic acid, co-trimoxazole,

neomycin, streptomycin, tylosin, ceftiofur, cefquinome and cefpodoxime and were

susceptible only to framycetin. On the other hand, the animal isolates of Brisse and Duijkere

(2005) showed susceptibility to ceftazidime, ceftiofur, tetracycline, enrofloxacin, gentamicin

and trimethoprim-sulfamethoxazole but were resistant also to ampicillin and cephalexin.

Most of their isolates also showed multi-drug resistance. Moreover, Mosqueda-Gomez et al

(2008) demonstrated that there are higher resistance rates in ESBL-Kp to aminoglycosides,

quinolones, ticarcillin/clavulanate, and piperacillin/tazobactam but susceptible to imipenem.

33

ESBL production can be determined through the use of ESBL E-test screen strips

impregnated with ceftazidime and ceftazidime-clavulanate wherein a positive test denotes

ceftazidime MIC/ceftazidime-clavulanate MIC ratio to be ≥8 (Podschun and Ullman, 1998;

Afifi, 2013). Disc diffusion method using the discs impregnated with the aforementioned

antibiotics can be used as well although double disc synergy method is more widely

employed to detect synergy between cefotaxime and clavulanate exemplified by a clear-cut

extension of the edge of cefotaxime inhibition zone toward the disc containing clavulanic

acid. This is done by placing a disc of amoxicillin-clavulanic acid and a disc of cefotaxime

30 mm apart strategically placed center to center and is considered ESBL positive when there

is decreased susceptibility to cefotaxime combined with synergy between cefotaxime and

amoxicillin-clavulanic acid (Younes, A.M., 2011).

Fig 1. Combination disc method showing synergybetween cefotaxime, ceftazidime and amoxicillin-clavulanate (amoxiclav). The right disc iscefotaxime, the left is ceftazidime. Amoxiclavdisc is in middle.

Fig. 2. Confirmation of ESBLs production bydouble disc diffusion method. The plate showsthat the inhibition zone around cefotaxime-clavulanate (left disc) is more than 5 mm ofcefotaxime (right disc).

33














33














34

Table 2. List of more recent AMR cases of Klebsiella pneumoniaeCountry Samples AMR Authors

China Cooked meatproducts

tetracycline Jiang and Shi, 2013trimethoprimsulphonamide

Indiahospitalpatients

cephalosporinsParasakthi et al., 2000ampicillin

aminoglycosidestrimethoprimsulfamethoxazole

Australia hospitalpatients

gentamicinJones et al., 2005tobramycin

kanamycinstreptomycinspectinomycin

Mexico

hospitalpatients

aminoglycosides

Mosqueda-Gomez et al(2008)

quinolonesticarcillin/clavulanatepiperacillin/tazobactam

Italyhumansamples;bovine milk

tetracyclineMacrae et al., 2001;Mena et al., 2006

penicillincloxacillincephalosporinsaminoglycosidestrimethoprimsulfamethoxazole

fluoroquinolone

UK bovine milk

penicillin

Timofte et al., 2014amoxicillin-clavulanateco-trimoxazoleneomycinstreptomycintylosincephalosporins

France animalampicillin Brisse and Duijkere,

2005cephalosporins

35

2.4.5 Genetics of Antimicrobial resistance

Horizontal transfer through the mobile gene cassettes enhances the spread of

antimicrobial resistance genes through mobilization of individual cassettes by the integron-

encoded integrase, migration of the cassette in the integron probably by targeted tranposition,

distribution of larger transposons such as Tn21 carrying integrons and relocation of

conjugative plasmids with integrons among different bacterial species (Levesque et al., 1995;

White, et al., 2001). There are four classes of integrons namely classes 1, 2, 3 and 4 which

are differentiated by their respective integrase (int) genes (White, et al., 2001). They possess

two conserved segments that is the 5’ and the 3’, separated by a variable region with

integrated antibiotic resistance genes or cassettes. The 5’ conserved segment contains the int

gene while the 3’ conserved segment contains an open reading frame (ORF) termed orf5 and

the qacE∆1 and sulI which establish resistance to ethidium bromide and quaternary

ammonium compounds and to sulfonamide, respectively (Levesque et al., 1995).

Genes found on the mobile genetic elements such as the bacterial chromosome, plasmids,

transposons or integrons, encode ESBLs enabling the spread of β-lactamases to other

members of the Enterobacteriaceae family and increasing the incidence of multi-drug

resistant bacteria with complex resistance patterns to aminoglycosides, trimethoprim,

sulphonamides, tetracyclines, chloramphenicol and recently, to quinolones specifically

nalidixic acid (Pitout et al., 2005 and Younes, A.M., 2011). The most common ESBL

phenotypes come from point mutations in the blaTEM, blaSHV or blaCTX genes which happen

regularly at position 104 (TEM), 146 (SHV), 156 (SHV), 164 (TEM), 167 (CTX-M), 169

(SHV), 179 (SHV and TEM), 205 (TEM), 237 (TEM), 238 (SHV and TEM) and 240 (TEM,

SHV and CTX-M), leading to changes in the primary amino acid sequence of the enzyme

(Younes, A.M., 2011). blaCTX-Mgenes are usually involved with sul1-type class 1 integrons

36

known to harbor antimicrobial resistance gene casettes resistant to β-lactams,

aminoglycosides, chloramphenicol, sulphonamides and in a lower level, rifampicin.

Specifically, blaCTX-M-14gene is linked with insertion sequence ISEcp1 which is responsible

for mobilization and high-level expression of the β-lactamase gene (Pitout et al., 2005).

Other Klebsiella pneumoniae ESBL genes include blaoxa, blaAMPC (Timofte et al., 2014),

blaPER, blaVER, (Nobrega et al., 2013), blaCMY-1, blaFOX, blaMox, blaMIR, blaACT, blaToho (Lee et

al., 2000) and blaNDM genes which are associated with metallo-β-lactamase 1 (NDM-1)

(Yong et al., 2009 and Giske et al., 2012).

A study by Paterson et al. (2003) identified CTX-M-type ESBL-producing Klebsiella

pneumoniae isolates in Taiwan, Australia, South Africa, Turkey, Belgium and Argentina but

not United States. SHV and TEM type β-lactamases were seen in Australia, South Africa,

Turkey, Argentina and United States but not Taiwan and Belgium. Lastly, PER-1-type β-

lactamases were found in isolates from Turkey alone although previous study denotes its

detection in South America. In milk, Nobrega et al. (2013) noted that earlier studies done by

Hammad et al. (2008) and Locatelli et al. (2009) already detected TEM and SHV enzymes in

ESBL bacteria causing intramammary infections in dairy herds while his study was the first

to report detection of blaCTX-M gene in Klebsiella pneumoniae isolated from bulk tank milk.

It can be then noted that SHV and TEM type β-lactamases are already predominant

worldwide and CTX-M and PER-1 types are increasingly emerging in various countries

(Paterson et al., 2013).

Aminoglycoside resistance genes include aadB gene, which denotes resistance to

gentamicin, tobramycin and kanamycin and aadA1 and aadA2 genes which relate resistance

to streptomycin and spectinomycin (Jones et al., 2005). The Klebsiella pneumoniae isolates

of Jiang and Shi (2013) obtained dfrA6 and dfrA12 and sul1 genes associated with

37

trimethoprim and sulphonamide resistance respectively. The same study also discovered

tetracycline resistance genes such as tetA which is linked with ribosomal protection and/or

efflux pump mechanism, tetB and tetM which are associated with efflux pump mechanism

only (Ng, et al., 2001).

Quinolone resistance genes which are plasmid-mediated include qnr gene, composed

of qnrA, qnrB, qnrS, qnrC and qnrD, which encodes a protein protecting type II

topoisomerase increasing its MICs to nalidixic acid and flouroquinolones by four to eight

times (Nazik et al, 2011; Younes, A.M., 2001; and Ruiz et al, 2012). qnrA and qnrB genes

had been located in complex In4 family class 1 integrons In36 and In37 also known as

complex sul1-type integrons which may serve as a recombinase for mobilization of CTX-M

and ampC (Wang et al., 2004 and Younes, A.M., 2011). They were first reported in 1998

from Klebsiella pneumoniae clinical isolates in the USA (Cattoir, et al., 2007) followed by

Canada, Asia, Australia, Turkey and Europe. On the other hand, qnrS genes were reported to

be connected to Tn3-like blaTEM-1-containing transposon and not like as a gene cassette in a

common class 1 integron. They were found in Shigella flexnri isolates in Japan. Lastly,

qnrC and qnrD genes were discovered in China in isolates of Proteus mirabilis and

Salmonella enterica respectively (Younes, A.M., 2011). Other plasmid-mediated quinolone

resistance genes include aac(6’)-Ib-cr gene which encodes an aminoglycoside

acetyltransferase convening reduced susceptibility to aminoglycosides and ciprofloxacin

(Nazik et al, 2011 and Ruiz et al, 2012) and qepA gene which involves active efflux pumps

namely OqxAB multidrug efflux pump related to reduced fluoroquinolone susceptibility, and

QepA efflux pump pertaining to decreased susceptibility to hydrophilic flouroquinolones

such as norfloxacin and ciprofloxacin (Nazik et al, 2011).

38

2.4.6 Virulence genes

Mucoviscosity-associated gene A (magA) is an important virulence gene present only

in serotype K1 K. pneumoniae. It is associated the hypermucoviscosity phenotype and also

played an important role in resistance to serum and phagocytosis (Chuang, et al., 2006;

Nadasy, et al., 2007). Contrary to previous knowledge as suggested by Fang et al (2004), it

is the capsular serotype K1 and not the magA gene that is responsible for the majority of the

clinical K. pneumoniae liver abscess cases observed by Yeh et al (2006) and Brisse, et al

(2009). Figure 3 shows us the gene clusters found in serotype K1 K. pneumoniae. The

regulator of mucoid phenotype A (rmpA) is plasmid-mediated managing the extracapsular

polysaccharide synthesis (Nadasy, et al., 2007; Brisse, et al., 2009; Giske et al., 2012). It

was first described in 1989 but was only established recently to be involved with the

hypermucoviscosity phenotype and with the invasive clinical syndrome (Nadasy, et al.,

2007).

Fig. 3. Gene cluster for K1 capsular polysaccharide (GenBank accession no. AY762939),indicating genes with known and unknown functions (Yeh et al2006)

39

Other than that, wzy gene family inputs an O-polysaccharide polymerase that

identifies and expands the O-antigen polysaccharide-repeating units. This was also thought

responsible for lipid-linked repeat unit polymerization in the capsular synthesis process of

K57 of whose deletion would lead to diminished mucoviscosity. galF, ORF2 and gnd are

regarded to be associated with carbohydrate metabolism; wzi (orfX), wza , wzb and wzc are

deemed responsible for the translocation and surface assembly of the capsule (Chuang, et al.,

2006; Pan et al., 2008). Other virulence genes include allS which stimulates growth in iron-

deficient media, codes for activator of the allantoin regulon and specific for K1 pyogenic

liver abscess (PLA) (Brisse, et al., 2009), wcaG which synthesizes fucose needed to escape

phagocytosis (Brisse, et al., 2009; Giske et al., 2012), mrkD coding for the type 3 fimbriae

adhesin responsible for the adhesion to the basement membranes of several human tissues

(Brisse, et al., 2009; Younes, A.M., 2011), kfu being the iron uptake marker, cf29a, fimH,

uge, wabG, and ureA (Brisse, et al., 2009).

40

MATERIALS AND METHODS

3.1 Study Area

The Bureau of Agricultural Statistics (BAS) states that in 2009, there are already

about 15,073 dairy cattle and cow fresh milk production amounted to 8.6 million liters

(Villareal, 2009). Presently, the national cow fresh milk production is now at 20.01 million

liters. Specifically last year, South Luzon produced 40.2% valued at Php162.3 million. In

particular, Batangas produced more than half of South Luzon’s milk production. Milk

producers vary from the cooperative farms (63.0%), individual farms (19.3%), commercial

farms (12.1%), and institutional farms (5.6%) (NDA, 2015).

The study shall be carried out in dairy cattle farms in Batangas and the laboratory

work shall be done in the microbiology and molecular biology laboratories of Department of

Paraclinical Science, College of Veterinary Medicine, University of the Philippines Los

Banos from December 2015 to August 2016. The cows will be handled according to RA 8485

“The Animal Welfare Act of 1998” (Appendix 2) and the Animal Welfare Code (2011) Good

Agricultural and Husbandry Practices (GAHP) set by the Bureau of Agriculture and Fisheries

Product Standards (BAFS). The laboratory work shall conform to the standards of the

National Mastitis Council (NMC) and Performance Standards for Antimicrobial

Susceptibility Testing; 22ND Informational Supplement of the Clinical and Laboratory

Standards Institute (CLSI).

The list of dairy cattle farms in Batangas and their respective herd population will be

obtained from the National Dairy Authority. The selected South Luzon dairy zone (Fig. 4)

was selected due to its greatest contribution to the national dairy industry in terms of highest

density of cattle, greatest number of high producing cattle, and highest milk production

(NDA, 2015). The altitude of Batangas ranges from approximately 80 m to 360 m. The

41

average ambient temperature and relative humidity in Batangas are approximately 25 °C and

78 % respectively. The annual average rainfall is 1767 mm being climate type I having only

two seasons such as the dry season from November to April and wet season from May to

September (PAGASA, 2016). Farms and farm associations to be included in the study will

be selected randomly. Individual farms in each included farm association will be selected

randomly (Furgasa, et al., 2010). To be qualified, set inclusion criteria for each farm include

good record-keeping and history of recurrent bovine clinical mastitis cases.

Records of daily milk production and clinical mastitic cases and their respective

treatment for at least a year prior to the start of the study will be examined. Government

standardized milking protocols, post milking teat disinfection, pre-dipping or pre-wiping

factors (Furgasa, et al., 2010; Swinkels, et al., 2013) and mastitic cases monitoring including

mastitis diagnostic tests, treatment and antibiotic sensitivity tests will be inspected if being

practiced in the farm in all cows throughout the lactation (Swinkels, et al., 2013). Moreover,

other factors such as farmers’ education, frequency of personnel and environment cleaning

and disinfection will also be looked into (Gunawardana, et al, 2014). As much as possible,

milking procedures and equipment management will not change during the study period

(Swinkels, et al., 2013).

3.2 Study Animals (Lactating cattle)

Holstein-Friesian crossbred lactating cattle suffering from subclinical and clinical

mastitis in at least one teat will be used in this study and will be chosen randomly. A

combination of concentrates and forage feed will be made available to feed the study animals.

Drinking water will be made available ad libitum. The cows will be managed under either a

small scale or a semi-intensive management system (Furgasa, et al., 2010). Source animals

42

will be pooled in one pen so cleaning and feeding will be organized so as to prevent cross

contamination effectively throughout the course of the study. Pertinent data to be taken for

each cow include age, average milk production (L), lactation number, days in milk, present

lactation total, past milk production average (L), past lactation total, mastitis history, mastitis

therapy, other disease treatment history, dry cow therapy and other relevant clinical data.

These will be recorded onto the respective form or logbook, electronic report or on-farm

software (Swinkel et al, 2013).

3.3 Research design

This study is of a cross-sectional study design that mainly aims in assessing the

prevalence of Klebsiella pneumoniae (Tenhagen, et al., 2006) in bovine milk and

understanding its antimicrobial resistance, genetic characterization and risk factors.

Fig. 4 Philippine map showing Batangas and its various citiesand municipalities

43

3.3 Sample size

The sample size was identified using the OpenEpi version 2.3.1. The total number of

sample units (lactating animals) to be used in this study will be calculated based on 37% cow

prevalence of mastitis (Gunawardana, et al, 2014) with 5% confidence limit and 95%

confidence level. To avoid confounding and to further increase its power, an additional of

20% will be added to have a sample size of 233. Assuming that mortality rate of 4.8% is

expected (McConnel, et al., 2008), an additional of 4.8% will be added to have a final sample

size of 244 (Israel, D.G. 2013).

3.4 Clinical mastitis screening

California mastitis test (CMT) together with physical examination will be done to

screen mastitis and differentiate patients from subclinical to clinical cases (Ruegg, P.L, 2005;

Safi, et al., 2009; Furgasa, et al., 2010; Gunawardana, et al, 2014) (Appendix 3). The

severity of mastitis shall be classified with the following scores as listed on Table 3: Negative

(N), no infections due to no thickening of the mixture which is estimated to be 100,000

somatic cell count (SCC); Trace (T), possible infections due to slight thickening of the

mixture with estimated 300,000 SCC which seems to disappear with continued paddle

rotation. If all quarters sampled read trace, there is no infection but if one or two quarters

read trace, there is possible infection. Other scores include Grade 1 (weak positive), mild

infection with only clots in the milk due to distinct thickening of the mixture but no tendency

of gel formation; Grade 2 (distinct positive), moderate infection indicative of immediate

thickening of the mixture, with a slight gel formation estimated to be 2,700,000 SCC leading

to milk changes also in colour and/or presence of clots, heat, pain and/or swelling of the

44

udder; and Grade 3 (strong positive), severe infection indicative of gel formation and

elevation of surface of mixture with central peak remaining projected even after the rotation

of CMT paddle has stopped further leading to milk changes in colour and/or presence of clots

and systemic signs such as fever, depression, anorexia and very swollen udder (Ruegg, P.L,

2005; Furgasa, et al., 2010; Swinkel et al., 2013).

Table 3. California Mastitis Test (CMT) scores (Ruegg, P.L;, 2005)CMT score Somatic Cell Range Interpretation

N (negative) 0-200,000 Healthy quarterT (trace) 200,000-400,000 Subclinical mastitis

1 400,000-1,200,000 Subclinical mastitis2 1,200,000-5,000,000 Serious mastitis infection3 Over 5,000,000 Serious mastitis infection

3.5 Sample Collection

10 mL milk samples shall be obtained according to the standards of National Mastitis

Council (1999) a day after CMT screening from identified subclinical and clinical mastitic

cows which did not receive any antibiotic treatment at least one week prior to collection in

accordance to the respective milk withdrawal period of each antibiotic being used at the farm

(Furgasa, et al., 2010). Samples shall be collected aseptically and stored in sterile 10 mL

glass tubes with screw cap and kept in ice at approximately 4ºC during transport to the

laboratory. Pertinent data shall be obtained.

3.6 Bacterial isolation and identification

Samples will be cultured and bacteria that had grown will be identified using rapid

laboratory techniques (NMC, 1999). 10µL of milk will be inoculated onto trypticase soy

45

agar plate supplement with 5% defribinated bovine blood (Gillespie, B.E. and Oliver, S.P.,

2005; Furgasa, et al., 2010) and onto McConkey agar (Younes, A.M., 2011) before

incubation at 37ºC overnight. Growing bacteria will be identified by colony morphology and

by using a microtube identification system API Rapid 20 E® (API System, France) which is

a useful first stage in determining Gram negative bacteria (Younes, A.M, 2011). Individual

identified bacterial isolates of Klebsiella pneumoniae will be streaked in nutrient dish agar

before incubation at 37ºC overnight. 3 separate colonies will be chosen, suspended in Luria-

Bertani (LB) broth with 20% glycerol and will be stored in Eppendorf tubes at -80ºC (Paulin-

Curlee, G.G. et al., 2007; Yamane, K, et al., 2008)).

3.7 Molecular serotyping

Serotyping of K1, K2, and K5 will be done through multiplex Polymerase Chain

Reaction (PCR). 3 colonies from each positive sample will be taken to determine the various

serovars. As recommended by EU, one Klebsiella isolate will be collected for each serotype

from each positive sample which then will give the actual number of isolates. DNA

extraction of the Klebsiella isolates will be done through the boiling method (Appendix 4) as

done by Yeh et al (2007) and described by Levesque et al (1995). The PCR reactions will be

composed of 5µL of 2X Reddymix® PCR MasterMix (0.625 units Taq polymerase, 1.5nM

MgCl2 and 0.2mM each of dNTP/reaction), 0.5µL of each primer (10µM), 2.5µL of DNA

template and 4µL of double distilled water. The PCR conditions for K1 (1283 bp), K2 (641

bp) and K5 (280 bp) will be an initial denaturation at 94ºC for 1 minute, and 30 cycles each

of denaturation at 94ºC for 30 seconds, primer annealing at 59ºC for 45 seconds and

46

extension at 72ºC for 1 minute & 30 seconds and one cycle of final extension at 72ºC for 6

minutes (Turton et al., 2008).

Non-K1/K2 isolates will be serotyped by determination of the prevalence of rmpA

(516 bp) through PCR of which conditions will be an initial denaturation at 95ºC for 5

minutes, and 40 initial cycles each of denaturation at 95ºC for 60 seconds, primer annealing

at 50ºC for 60 seconds and extension at 72ºC for 2 minutes and one cycle of final extension at

72ºC for 7 minutes (Yeh et al., 2007). PCR amplification will be performed using a PCR

Swift Maximodl (Esco®, South Yorkshire, UK). PCR amplicons will be separated using

1.5% agarose gel electrophoresis (Major Science, Saratoga, CA, USA) in 1X Tris-

acetate/EDTA (TAE) buffer. Gel staining will be done by soaking in an ethidium bromide

solution (Sigma-Aldrich®) for 10 minutes and destaining in distilled water for 5 minutes.

The gels will be digitally photographed under UV light. The primers used in typing are listed

in Appendix 5.

3.8 Antibiotic susceptibility & ESBL production testing

To determine the minimum inhibitory concentration (MIC), microbroth dilution as the

method of choice (Tenhagen, et al., 2006) (Appendix 6) will be done conforming to the

Performance Standards for Antimicrobial Susceptibility Testing of the Clinical and

Laboratory Standards Institute. Various classes of antibiotics being used in bovine mastitis

(Appendix 7) and in humans such as amoxicillin-clavunalate (AMC), ampicillin (AMP),

ceftiofur (CEF), ciprofloxacin (CIP), cloxacillin (CLX), enrofloxacin (ENR), gentamicin

(GEN), penicillin (PEN), streptomycin (STR), sulfamethoxazole (SUL), tetracycline (TET)

and trimethoprim (TRI) will be used for this study (CLSI, 2012). Reference strain used to

47

serve as quality control will be Klebsiella pneumoniae ATCC 700603 (Mosqueda-Gomez, et

al., 2008), Staphylococcus aureus NCTC 6571, Escherichia coli NCTC 10418 and

Pseudomonas aeruginosa NCTC 10662 (Younes, A.M., 2011).

ESBL production will be done using microbroth dilution compliant to the guidelines

from CLSI (2012). Any isolate with a ceftazidime/ ceftiofur MIC >1µg/mL will be suspected

of having ESBLs thus E-test will be done to ceftazidime alone and in combination with

clavulanic acid (AB Biodisk, Solna, Sweden). A decrease of >3-fold in the MIC value for

ceftazidime in combination with clavulanic acid versus the MIC value for ceftazidime alone

will be considered as confirmation of ESBL production (Mosqueda-Gomez, et al., 2008).

3.9 Characterization of class 1 integron and test for transferability

All isolates will be screened for the presence of the integrase gene, intI1 (254 bp)

using polymerase chain reaction (PCR). The PCR reactions composed of 5µL of 2X

Reddymix® PCR MasterMix (0.625 units Taq polymerase, 1.5nM MgCl2 and 0.2mM each of

dNTP/reaction), 0.5µL of each primer (10µM), 1µL of DNA template and 8µL of double

distilled water. The PCR conditions will be an initial denaturation at 94ºC for 4 minutes, and

10 cycles each of denaturation at 94ºC for 60 seconds, primer annealing at 65ºC for 30

seconds (decreasing 1ºC/cycle) and extension at 70ºC for 2 minutes, 24 cycles of 94ºC for 60

seconds, 55ºC for 30 seconds and 70ºC for 2 minutes, and one cycle of final extension at

70ºC for 5 minutes (Murinda et al., 2005). PCR amplicons will be separated using 1%

agarose gel electrophoresis (Esco®, South Yorkshire, UK) in 1X Tris-acetate/EDTA (TAE)

buffer.

48

Gene cassettes (1000 bp) will be screened on any of the isolates containing int1 gene

using PCR with a specific primer pair 5’CS and 3’CS. The PCR reactions composed of 5µL

of 2X Reddymix® PCR MasterMix (0.625 units Taq polymerase, 1.5nM MgCl2 and 0.2mM

each of dNTP/reaction), 0.5µL of each primer (10µM), 1µL of DNA template and 8µL of

double distilled water. The PCR conditions will be an initial denaturation at 94ºC for 12

minutes, and 35 cycles each of denaturation at 94ºC for 60 seconds, primer annealing at 55ºC

for 60 seconds and extension at 72ºC for 5 minutes with five seconds to be added to the

extension time at each cycle, and one cycle of final extension at 72ºC for 5 minutes

(Levesque et al, 1995). The PCR products will be subjected to purification using Nucleospin

Gel Extension Kit (Nucleospin®, Gutenberg, France) and sent for DNA sequencing to

Macrogen, South Korea. DNA sequences will be compared with the published sequence

using NCBI blast search available at the National Center for Biotechnology Information

website (www.ncbi.nlm.nih.gov). Restriction enzymes such as EcoRI, Alul and Taql will be

used to digest any PCR products with the same size and will be considered identical if they

show the same restriction patterns (Wannaprasat, 2012). The primers used are listed in

Appendix 8.

Conjugation studies as described by Wang et al (2004) (Appendix 9) will be done to

all isolates carrying class 1 integrons with resistance gene casettes which are to be used as

donors and E. coli J53 AzR derivatives to be used as recipients. Transconjugants will be

screened on presence of blaCTX-M, blaSHV,blaTEM through PCR. All PCR products obtained

for this screening will be sent for DNA sequencing on both 5’ and 3’ strands and will be

BLAST compared with those of GenBank (Timofte et al., 2014).

49

3.10 Characterization of quinolone resistance mechanisms

All non-susceptible Klebsiella isolates to ciprofloxacin will be tested for the

presence of three types of PMQR determinants which includes qnr family (qnrA, qnrB,

qnrS), quinolone efflux pump (qepA) and aac(6’)lb-cr using PCR. The PCR reactions

composed of 5µL of 2X Reddymix® PCR MasterMix (0.625 units Taq polymerase, 1.5nM

MgCl2 and 0.2mM each of dNTP/reaction), 0.5µL of each primer (10µM), 1µL of DNA

template and 8µL of double distilled water. The PCR conditions for qnrA (516 bp), qnrB

(469 bp), and qnrS (417 bp) genes will be an initial denaturation at 94ºC for 4 minutes, and

32 cycles each of denaturation at 94ºC for 45 seconds, primer annealing at 53ºC for 45

seconds and extension at 72ºC for 60 seconds and one cycle of final extension at 72ºC for 5

minutes (Stephenson., et al., 2010). On the other hand, the PCR conditions for qepA gene

(617 bp) will be an initial denaturation at 96ºC for 1 minute, and 30 cycles each of

denaturation at 96ºC for 60 seconds, primer annealing at 60ºC for 60 seconds and extension

at 72ºC for 60 seconds and one cycle of final extension at 72ºC for 5 minutes (Yamane, et al.,

2008). Lastly, the PCR conditions for aac(6’)lb-cr gene (482 bp) will be an initial

denaturation at 94ºC for 4 minutes, and 34 cycles each of denaturation at 94ºC for 45

seconds, primer annealing at 55ºC for 45 seconds and extension at 72ºC for 45 seconds and

one cycle of final extension at 72ºC for 5 minutes (Park, et al., 2006). PCR amplicons will be

separated using 1.5% agarose gel electrophoresis (Esco®, South Yorkshire, UK) in 1X Tris-

acetate/EDTA (TAE) buffer. The primers used are listed in Appendix 10.

3.11 Detection and characterization of extended-spectrum β-lactamases (ESBLs) andother non-integron borne antibiotic resistance genes

Only the main groups of ESBL genes like blaCTX-M (variable size), blaPER-1(7-301 bp),

blaAMPC (141-311 bp), blaTEM (799bp) and blaSHV (862bp) will be tested on all of the Klebsiella

50

isolates. Resistance genes for other antibiotics such as gentamicin (aadB – 300bp),

streptomycin (aadA1 – 631 bp and aadA2 – 500 bp), sulfamethoxaole (sul1 – 331 bp),

tetracycline (tetA – 372bp, tetB – 228bp and tetM – 406 bp) and trimethoprim (dfrA6 – 419

bp and dfrA12 – 395bp) will also be investigated. The PCR reactions composed of 6.25µL of

2X Reddymix® PCR MasterMix (0.625 units Taq polymerase, 1.5nM MgCl2 and 0.2mM

each of dNTP/reaction), 0.5µL of each primer (10µM), 2.5µL of DNA template and 2.75µL

of double distilled water. The multiplex PCR conditions for blaTEM and blaSHV will be an initial

denaturation at 94ºC for 5 minutes, and 35 cycles each of denaturation at 94ºC for 30

seconds, primer annealing at 60ºC for 30 seconds and extension at 72ºC for 3 minutes and

one cycle of final extension at 72ºC for 10 minutes (Afifi, 2013). PCR amplicons were

separated using 1.5% agarose gel electrophoresis (Esco®, South Yorkshire, UK) in 1X Tris-

acetate/EDTA (TAE) buffer. The PCR conditions for blaCTX-M will be an initial denaturation at

94ºC for 2 minutes, 35 cycles each of denaturation at 95ºC for 20 seconds, primer annealing

at 51ºC for 30 seconds and extension at 72ºC for 30 seconds and one cycle of final extension

at 72ºC for 3 minutes (Edelstein et al., 2003). PCR amplicons were separated using 1%

agarose gel electrophoresis (Esco®, South Yorkshire, UK) in 1X Tris-acetate/EDTA (TAE)

buffer.

The multiplex PCR conditions for aadB (300bp), aadA1 (631 bp) and aadA2 (500

bp) will be an initial denaturation at 94ºC for 5 minutes, and 30 cycles each of denaturation at

94ºC for 45 seconds, primer annealing at 54ºC for 45 seconds and extension at 72ºC for 60

seconds and one cycle of final extension at 72ºC for 5 minutes (Chuanchuen et al., 2008).

The PCR conditions for dfrA6 (419 bp), dfrA12 (406 bp) and sul1 (331 bp) genes will be an

initial denaturation at 95ºC for 10 minutes, and 30 cycles each of denaturation at 95ºC for 30

seconds, primer annealing at 55ºC for 60 seconds and extension at 72ºC for 60 seconds and

51

one cycle of final extension at 72ºC for 7 minutes. PCR amplicons will be separated using

1% agarose gel electrophoresis (Esco®, South Yorkshire, UK) in 1X Tris-acetate/EDTA

(TAE) buffer (Chen et al., 2004). The PCR conditions for tetA (210 bp) and tetB (659 bp)

will be an initial denaturation at 94ºC for 5 minutes, and 35 cycles each of denaturation at

94ºC for 60 seconds, primer annealing at 55ºC for 60 seconds and extension at 72ºC for 1.5

minutes. PCR amplicons will be separated using 1% agarose gel electrophoresis (Esco®,

South Yorkshire, UK) in 1X Tris-acetate/EDTA (TAE) buffer (Ng et al., 2001). The primers

used in detection of antibiotic resistance genes are listed in Appendix 11.

3.12 Detection and characterization of plasmid-borne virulence genes

PCR will be done to detect the presence of virulence gene rmpA gene (regulator of

mucoid phenotype A). The PCR reactions will be composed of 5µL of 2X Reddymix® PCR

MasterMix (0.625 units Taq polymerase, 1.5nM MgCl2 and 0.2mM each of dNTP/reaction),

0.5µL of each primer (10µM), 2.5µL of DNA template and 4µL of double distilled water.

The PCR conditions for rmpA gene (516 bp) will be the same that of molecular serotyping

with an initial denaturation at 95ºC for 5 minutes, and 40 initial cycles each of denaturation at

95ºC for 60 seconds, primer annealing at 50ºC for 60 seconds and extension at 72ºC for 2

minutes and one cycle of final extension at 72ºC for 7 minutes (Yeh et al., 2007). To detect

magA gene (1283 bp), the PCR conditions will be an initial denaturation at 94ºC for 1

minute, and 30 cycles each of denaturation at 94ºC for 30 seconds, primer annealing at 59ºC

for 45 seconds and extension at 72ºC for 1 minute & 30 seconds and one cycle of final

extension at 72ºC for 6 minutes (Turton et al., 2008). PCR amplicons will be separated using

2% agarose gel electrophoresis (Esco®, South Yorkshire, UK) in 1X Tris-acetate/EDTA

(TAE) buffer. The primers in this study are listed in Appendix 5.

52

3.13 Risk factor analysis

A pretested standardized questionnaire will be used to collect information on each

farm’s clinical history, use of antimicrobials for bovine mastitis, use of disinfectants, farmer

knowledge especially on antimicrobial resistance, farm demographics, and farm-level

management including post milking teat disinfection, pre-dipping or pre-wiping, mastitic

cases monitoring, frequency of personnel cleaning and disinfection factors (Furgasa, et al.,

2010) and environmental factors. Additional records will be gathered on any cases of

misdiagnosis of mastitis by non-veterinary staff including farmer, treatment with indigenous

and/or herbal medicine, delay in seeking veterinary service, treatment without laboratory

diagnosis, non-adherence to set treatment protocol due to economic constraints, unavailability

of recommended drugs, and access to limited laboratory diagnostic facilities and veterinary

services (Gunawardana, et al, 2014).

On a cow level, data will be gathered relating to average milk production (L),

lactation number, days in milk, present lactation total, past milk production average (L), past

lactation total, mastitis history, mastitis therapy, other disease treatment history, dry cow

therapy and other relevant clinical data. All interviews will be conducted in the farmers’

native language (Pilipino). Both the clinical examination and the survey will be conducted

by the same investigator (Gunawardana, et al, 2014). The introductory letter for the survey is

presented in Appendix 12.

Data that will be coming from the questionnaires will be encoded into a Microsoft

Excel worksheet. The prevalence of mastitis will be computed. Association between

antimicrobial resistance and the various factors will be known by calculating Pearson’s chi-

square value, and the degree of association will be calculated via the odds ratio (OR) using

SPSS 12.0 statistical software, SPSS, Inc. (Munich, Germany) for Windows. Logistic

53

regression by means of p<0.05 will be used to identify potential risk factors (Furgasa, et al.,

2010; Afifi, 2013; Gunawardana, et al, 2014). All descriptive and inferential analyses will be

executed using SPSS 12.0 statistical software for Windows (Gunawardana, et al, 2014).

54

RESULTS

Table 1. List of serotypes and virulence genes found in Klebsiella pneumoniae isolates

# Serotype Virulence genesNumber (%)

1 K1 magA 5 (1)2 K23 K54 Non-K1/K2 rmpA

Table 2. Antibiotic resistance genes in Klebsiella pneumoniae isolates

# AntibioticResistance

# (%)Gene

1 StreptomycinaadA1 1 (3)aadA2

2 Sulfamethoxazole sul13 Gentamicin aadB

4 TetracyclinetetAtetB

5 TrimethoprimdfrA6dfrA12

6 β-lactamase

blaTEMblaSHV

blaCTX-M

55

REFERENCES

Afifi, M.M. 2013. Detection of extended spectrum beta-lactamase producing Klebsiellapneumoniae and Escherichia coli of environmental surfaces at upper Egypt. Int J ofBiological Chem. 7(2): 58-68.

Barlow, J., 2011: Mastitis therapy and antimicrobial susceptibility: a multispecies reviewwith a focus on antibiotic treatment of mastitis in dairy cattle. J Mammary Gland BiolNeoplasia,16, 383-407.

Bergan, T., 1984.Methods in Microbiology.Vol 14.Academic Press. London, UK. pp.145-160.

Boucher, Y., Labbate, M., Koenig, J.E. and Stokes, H.W. 2007.Integrons: mobilizableplatforms that promote genetic diversity in bacteria. TRENDS in Microbiol.15(7):301-309.

Brisse, S. and van Duijkeren, E. 2005.Identification and antimicrobial susceptibility of 100Klebsiella animal clinical isolates.Vet Microbiol.105: 307-312.

Brisse, S., Fevre, C., Passet, V., Issenhuth-Jeanjean., S., Tournebize, R., Diancourt, L., andGrimont, P. 2009. Virulent clones of Klebsiella pneumoniae: Identification andevolutionary scenario based on genomic and phenotypic characterization. Plos One.4(3): e4982.

Cattoir, V., Poirel, L., Rotimi, V., Soussy, C-J. And Nordmann, P. 2007. Multiplex PCR fordetection of plasmid-mediated quinolone resistance qnr genes in ESBL-producingenterobacterial isolates. J. of Antimicrob Chemother. 60: 394-397.

Chen, S., Zhao, S., White, D.G., Schroeder, C.M., Lu, R., Yang, H., McDermott, P.F., Ayers,S. and Meng, J. 2004. Characterization of multiple-antimicrobial-resistant Salmonellaserovars isolate from retail meats. Appl Environ Microbiol. 70(1): 1-7.

Chuanchuen, R., Pathanasophon, P., Khemtong, S., Wannaprasat, W. and Padungtod, P.2008. Susceptibilities to antimicrobials and disinfectants in Salmonella isolatesobtained from poultry and swine in Thailand. J Vet Med Sci. 70(6): 595-601.

Chuang, Y.P., Fang, C.T, Lai, S.Y., Chang, S.C. and Wang, J.T. 2006. Genetic determinantsof capsular serotype K1 of Klebsiella pneumoniae causing primary pyogenic liverabscess. J. of Infect Dis. 193: 645-654.

CLSI, 2012. Performance Standards for Antimicrobial Susceptibility Testing: Twenty-secondInformational Supplement. CLSI document, M31-A3, vol. 28 No.8.ClinicalLaboratory Standards Institute, Wayne, PA, USA.

Cortes, G., de Astorza, B., Benedi, V.J. and Alberti, S. 2002. Role of the htrA gene inKlebsiella pneumoniae virulence. Infect. Immun.70(9): 4772-4776.

56

Costas, M., Holmes, B. & Sloss, L. L. (1990). Comparison of SDS-PAGE protein patternswith other typing methods for investigating the epidemiology of 'Klebsiellaaerogenes'. Epidemiol Infect 104: 455-465.

Cremet, L., Caroff, N., Dauvergne, S., Reynaud, A., Lepelletier, D. and Corvec. S. 2011.Prevalence of plasmid-mediated quinolone resistance determinants in ESBLEnterobacteriaceae clinical isolates over a 1-year period in a French hospital.PathologieBiologie. 59: 151-156.

Edelstein, M., Pimkin, M., Palagin, I., Edelstein, I. and Stratchounski, L. 2003. Prevalenceand molecular epidemiology of CTX-M extended-spectrum ß-lactamaseproducing E.coli and K. pneumoniae in Russian hospitals. Antimicrob Agents Chemother 47(12):3724-3732.

Fang, C.T., Chuang, Y.P., Shun, C.T., Chang, S.C. and Wang, J.T. 2004. A novel virulencegene in Klebsiella pneumoniae strains causing primary liver abscess and septicmetastatic complications. J Exp Med. 199: 697-705.

Furgasa, M.B., Abunna, M., Megersa, B., and Regassa, 2010. A. Bovine mastitis: Prevalence,risk factors and major pathogens in dairy farms of Holeta town, Central Ethiopia. VetWorld. 3(9): 397-403

Gillespie, B.E. and Oliver, S.P. 2005. Simultaneous detection of mastitis pathogens,Staphylococcus aureus, Streptococcus uberis, and Streptococcus agalactiae bymultiplex real-time polymerase chain reaction. J Dairy Sci. 88:3510-3518.

Giske, C.G., Froding, I., Hasan, C.M., Turlej-Rogacka, A., Toleman, M., Livermore, D.,Woodford, N. and Walsh, T.R. 2012. Diverse sequence types of Klebsiellapneumoniae contribute to the dissemination of blaNDM-1 in India, Sweden, and theUnited Kingdom. Antimicrob Agents Chemother. 56(5):2735-2738.

Gunawardana, S., Thilakarathne, D., Abegunawardana, I.S., Abeynayake, P., Robertson, C.,and Stephen, C. 2014. Risk factors for bovine mastitis in the central province of SriLanka. Trop Anim Health Prod 46:1005-1112.

Hogan, J. and Smith, KL. 2003. Coliform mastitis. Vet. Res.34: 507–519.

Hogan, J. and Smith, KL. 2012: Managing environmental mastitis. Vet Clin North Am FoodAnim Pract, 28, 217-224.

Holt, J.G., Krieg, N.R., Sneath, P.H.A., Staley, J.T. and Williams, S.T. 1994.Bergey’sManual of Determinative Bacteriology. 9th ed. Lippincott Williams & Wilkins,Baltimore, MA, USA.pp.211.

Israel, D.G., 2013. Determining sample size. IFAS, University of Florida. 1-5.

Janet, E.L., Corry, G.D.W., Curtis and Baird, R.M. 2011. Handbook of culture media forfood and water microbiology. 3rd ed. RSC Publishing, London, U.K.

Jeong, S.H., Bae, I.K., Lee, J.H., Sohn, S.G., Kang, G. H., Jeon, G.J., Kim, Y.H., Jeong, B.C.and Lee, S.H. 2004. Molecular characterization of extended-spectrum beta-lactamases

57

produced by clinical isolates of Klebsiella pneumoniae and Eschericia coli from aKorean nationwide survey. J of Clin Microbiol. 42(7): 2902-2906.

Jiang, X. and Shi, L. 2013. Distribution of tetracycline and trimethoprim/sulfamethoxazoleresistance genes in aerobic bacteria isolated from cooked meat products Guangzhou,China. Food Control. 30:30-34.

Jones, L.A., Mclver, C.J., Kim, M-J., Rawlinson, W.D. and White, P.E. 2005. The aadB genecassette is associated with blaSHV genes in Klebsiella species producing extended-spectrum β-lactamases. Antimicrob Agents Chemother. 49(2): 794-797.

Koczura, R. and Kaznowski, A. 2003.Occurrence of the Yersinia high-pathogenicity islandand iron uptake systems in clinical isolates of Klebsiella pneumoniae. MicrobialPathogenesis.35: 197-202.

Lee, S.H., Kim, J.Y., Lee, S.K., Jin, W., Kang, S.G. and Lee, K.J. 2000. Discriminatorydetection of extended-spectrum β-lactamases by restriction fragment lengthdimorphism-polymerase chain reaction. Letters in Applied Microbiol.31: 307-312.

Levesque, C., Piche, L., Larose, C. and Roy, P.H. 1995. PCR mapping of integrons revealsseveral novel combinations of resistance genes. Antimicrob Agents Chemother.39(1):185-191.

Macrae, MB., Shannon, KP., Rayner, DM., Kaisery, AM., Hoffmanz, PN and French, GL.2001.A simultaneous outbreak on a neonatal unit of two strains of multiply antibioticresistant Klebsiella pneumoniae controllable only by ward closure. J of Hos Inf.49:183±192.

Marchese, A. And Schito, G.C. 2007. Recent results of multinational studies on antibioticresistance: should we have “protection” against these resistances?. MedecineetMaladies Infectieuses, 37(1): 2-5.

McConnel, C.S., Lombard, J.E., Wagner, B.A., and Garry, F.B. 2008. Evaluation of factorsassociated with increased dairy cow mortality on United States dairy operations. J.Dairy Sci. 91:1423–1432.

Mena, A., Plasencia, V., Garci, L., Hidalgo, O., Ayestara, JI., Alberti, S., Borrell, N., Perez,JL., and Oliver, A. 2006. Characterization of a large outbreak by CTX-M-1-producingKlebsiella pneumoniae and mechanisms leading to in vivo carbapenem resistancedevelopment. J. of Clin Microbiol, 44(8): 2831–2837.

Mosqueda-Gomez, J.L., Montano-Loza, A., Rolon, A.L., Cervantes, C., Bobadilla-del-Valle,J.M., Silva-Sanchez, J., Garza-Ramos, U., Villasis-Keever, A., Galindo-Fraga, A.,Ruiz Palacios, G.M., Ponce-de-Leon, A. and Sifuentes-Osornio, J. 2008. Molecularepidemiology and risk factors of bloodstream infections caused by extended-spectrumβ-lactamase producing Klebsiella pneumoniae A case-control study. Int J Infect Dis.12: 653-659.

58

Munoz, MA., Ahlstrom C., Rauch, BJ., and Zadoks, RN. 2006. Fecal Shedding of Klebsiellapneumoniae by Dairy Cows. J. Dairy Sci. 89:3425–3430.

Nadasy, K.A., Domiati-Saad, R. and Tribble, M.A. 2007.Invasive Klebsiella pneumoniaesyndrome in North America.CID.45: 25-28.

National Mastitis Council. 1999. Laboratory Handbook on Bovine Mastitis. National MastitisCouncil Inc., Madison, WI.

Nazik, H., Ongen, B., Mete, B., Aydin, S., Yemisen, M., Kelesoglu, F.M., Ergul, Y., andTabak, F. 2011. Coexistence of blaoxa-48and aac(6’)-Ib-cr genes in Klebsiellapneumoniae isolates from Istanbul, Turkey. The J of Int Med Res.39:1932-1940.

Ng, L.K., Martin, I., Alfa, M. and Mulvey, M. 2001. Multiplex PCR for the detection oftetracycline resistant genes. Mol and Cellular Probes.15: 209-215.

Oliver, S. P. and Murinda, SE. 2012: Antimicrobial resistance of mastitis pathogens. Vet ClinNorth Am Food Anim Pract. 28, 165-185.

Pan, Y-J., Fang, H-C., Yang, H-C., Lin, T-L., Hsieh, P-F., Tsai, F-C., Keynan, Y and Wang,J-T. 2008. Capsular polysaccharide synthesis regions in Klebsiella pneumoniaeserotype K57 and a new capsular serotype. J. Clin. Microbiol. 46(7): 2231-2240.

Parasakthi, N., Vadivelu, J., Ariffin, H., Iyer, L., Palasubramaniam, S. and Arasu, A. 2000.Epidemiology and molecular characterization of nosocomially transmitted multidrug-resistant Klebsiella pneumoniae. Int J Infect Dis.4: 123-128.

Park, C.H., Robicsek, A., Jacoby, G. A. Sahm, D. and Hooper, D.C. 2006. Prevalence in theUnited States of aac(6’)-Ib-cr encoding a ciprofloxacin-modifying enzyme.Antimicrob Agents Chemother. 50(11): 3953-3955.

Paulin-Curlee, G.G., Singer, R.S., Sreevatsan, S., Isaacson, R., Reneau, J., Foster, D., andRey, B. 2007. Genetic diversity of mastitis-associated Klebsiella pneumoniae in dairycows. J. Dairy Sci. 90:3681-3689.

Paterson, D.L., Hujer, K.M., Hujer, A.M., Yeiser, B., Bonomo, M.D., Rise, L.B., Bonomo,R.A. and the International Klebsiella Study Group. 2003. Extended-spectrum β-lactamases in Klebsiella pneumoniae bloodstream isolates from seven countries:dominance and widespread prevalence of SHV- and CTX-M-Type β-lactamases.Antimicrob Agents Chemother. 47(11): 3554-3560.

Paulin-Curlee, G.G., Singer, R.S., Sreevatsan, S., Isaacson, R., Reneau, J., Foster, D., andBey, R. 2007. Genetic diversity of mastitis-associated Klebsiella pneumoniae in dairycows. J. Dairy Sci. 90:3681-3689.

Pitout, J.D.D., Nordmann, P., Laupland, K.B. and Poirel, L. 2005. Emergence ofEnterobacteriaceae producing extended-spectrum β-lactamases (ESBLs) in thecommunity. J of AntimicrobChemother.56: 52-59.

59

Podschun, R. and Ullman, U. 1998. Klebsiella spp. as nosocomial pathogens: epidemiology,taxonomy, typing methods, and pathogenicity factors.Clin.Microbiol. Rev.11(4): 589-603.

Rocha-Gracia, R., Ruiz, E., Romero-Romero, S., Lozano-Zarain, P., Somalo, S., Palacios-Hernandez, J.M., Caballero-Torres, P. And Torres, C. 2010. Detection of the plasmid-borne quinolone resistance determinant qepA1 in a CTX-M-15-producing Escherichiacoli strain from Mexico. J Antimicrob Chemother. 65: 169–177.

Ruegg, P.L., 2005. California mastitis Test (CMT) fact sheet 1. Resources Milk Money. Pp.1-3.

Ruiz, E., Saenz, Y., Zarazaga, M., Rocha-Gracia, R., Martinez-Martinez, L., Arlet, G. andToress, C. 2012. qnr, aac(6’)-Ib-cr and qepA genes in Escherichia coli and Klebsiellaspp.: genetic environments and plasmid and chromosomal action. J ofAntimicrobChemother.67: 886-897.

Safi, S., Khoshvaghti, A., Jafarzadeh, S.R., Bolourchi, M., and Nowrouzian, I. 2009. Acutephase proteins in the diagnosis of bovine subclinical mastitis. Vet Clin Path. 38(4):417-476.

Saishu, N., Ozaki, H. and Murase, T. 2014. CTX-M-type extended-spectrum ß-lactamase-producing Klebsiella pneumoniae isolated from cases of bovine mastitis in Japan. J.Vet. Med. Sci. 76(8): 1153–1156.

Stephenson, S., Brown, P.D., Holness, A., and Wilks, M. 2010.The emergence of Qnr-mediated quinolone resistance among Enterobacteriaceae in Jamaica. West IndianMed J.59(3): 241.

Struve, C., Bojer, M., Nielsen, E.M., Hansen, D.S. and Krogfelt, K.A. 2005. Investigation ofthe putative virulence gene magA in a worldwide collection of 495 Klebsiella isolates:magA is restricted to the gene cluster of Klebsiella pneumoniae capsule serotype K1.J. Med. Microbiol.54: 11111-11113.

Swinkels, J.M., Lam, T.J.G.M., Green, M.J. and Bradley, A.J. 2013.Effect of extendedcefquionome treatment on clinical persistence of recurrence of environmental clinicalmastitis. The Veterinary Journal.197: 682-687.

Synder, L. and Champness W. Molecular genetics of bacteria. 1997. ASM Press,Washington, D.C. USA. pp. 8-9, 105-124, 129-130, 149, 161, 178 and 195.

Tenhagen, B.A., Koster, G., Wallmann, J., and Heuwieser, W. Prevalence of mastitispathogens and their resistance against antimicrobial agents in dairy cows inBrandenburg, Germany. 2006. J. Dairy Sci. 89:2542-2551.

Timofte, D., Maciuca, IE., Evans, NJ., Williams, H., Wattret, A., Fick, JC., and Williams, NJ.2014. Detection and Molecular Characterization of Escherichia coli CTX-M-15 andKlebsiella pneumoniae SHV-12 b-Lactamases from Bovine Mastitis Isolates in theUnited Kingdom. AntimicrobAgents Chemother.58(2):789.

60

Turton, J.F., Baklan, H., Siu, L.K., Kaufmann, M.E. and Pitt, T.L. 2008.Evaluation of amultiplex PCR for detection of serotypes K1, K2 and K5 in Klebsiella sp. andcomparison of isolates within these serotypes. FEMS MicrobiolLett.284: 247-252.

Wannaprasat, W., 2012. Molecular Characteristics of Multi-drug Resistant Salmonellaenterica isolated from humans and pork. (Unpublished Doctoral Dissertation).Chulalongkorn University, Bangkok, Thailand.

Wang, M., Sahm, D.F., Jacoby, G.A. and Hooper, D.C. 2004. Emerging plasmid-mediatedquinolone resistance associated with the qnr gene in Klebsiella pneumoniae clinicalisolates in the United States. Antimicrob Agents Chemother.48(4): 1295-1299.

White, P.A., Mciver, C.J. and Rawlinson, W.D. 2001. Integrons and gene cassettes in theEnterobacteriaceae. Antimicrob Agents Chemother. 45(9): 2658–2661.

Yamane, K., Wachino, J., Suzuki, S. and Arakawa, Y. 2008. Plasmid-mediated qepA geneamong Escherichia coli clinical isolates from Japan. Antimicrob Agents Chemother,52(4): 1564–1566.

Yeh, K-M., Chang, F-Y., Fung, C-P., Lin, J-C and Siu, L.K. 2006.magA is not a specificvirulence gene for Klebsiella pneumoniae strains causing liver abscess but is part ofthe capsular polysaccharide gene cluster of K. pneumoniae serotype K1. J of MedicalMicrobiol.55: 803-804.

Yeh, K-M., Kurup, A., Siu, L.K., Koh, Y.L, Fung, C-P., Lin, J-C., Chen, T-L., Chang, F-Y.and Koh, T-H. 2007. Capsular serotype K1 or K2, rather than magA and rmpA, is amajor virulence determinant for Klebsiella pneumoniae liver abscess in Singapore andTaiwan. J of Medical Microbiol.45(2): 466-471.

Yong, D., Toleman, M.A., Giske, C.G., Cho, H.S., Sundman, K., Lee, K. and Walsh, T.R.2009.Characterization of a New Metallo-β-Lactamase Gene, blaNDM-1, and a NovelErythromycin Esterase Gene Carried on a Unique Genetic Structure in Klebsiellapneumoniae Sequence Type 14 from India. Antimicrob Agents Chemother.53(12):5046-5054.

Younes, A.M., 2010. Molecular diversity and genetic organization of antibiotic resistance inKlebsiella species. (Unpublished Doctoral Dissertation). The University of Edinburgh,Edinburgh, Scotland.

Zadoks , RN., Griffiths , HM., Munoz , MA., Ahlstrom , C., Bennett ,GJ., Thomas , E., andSchukken, YH. 2011. Sources of Klebsiella and Raoultella species on dairy farms: Becareful where you walk. J. Dairy Sci. 94:1045–1051.

Zadoks, RN., Middleton, JR., McDougall, S., Katholm, J., and Schukken, YH. 2011:Molecular epidemiology of mastitis pathogens of dairy cattle and comparativerelevance to humans. J Mammary Gland Biol Neoplasia,16, 357-372.

Zhao, X. and Lacasse, P. 2008: Mammary tissue damage during bovine mastitis: causes andcontrol. J Anim Sci,86, 57-65.

61

APPENDIX 1

List of antimicrobial class and their respective animal licensed drugs.

# Antibiotic classType ofActivity License drugs Target

1 Aminoglycosides Bactericidal

Gentamicin

30S ribosomal subunit

AmikacinStreptomycinKanamycinNeomycinApramycin

2 Aminocyclitols Bactericidal Spectinomycin 30S ribosomal subunit

3 Cephalosporins Bactericidal

Cefalexin

Transpeptidase

CefazolinCeftiofurCefoperazone

4 Diaminopyrimidines Bacteriostatic Trimethoprim Dihydrofolate reductase

5 Lincosamides BacteriostaticLincomycin

50S ribosomal subunitClindamycin

6 Macrolides Bacteriostatic

Erythromycin


TylosinTilmicosinSpiramycin

7 Nitrofurans Bactericidal Furazolidone DNA8 Nitroimidazoles Bactericidal Metronidazole DNA

9 Penicillins Bactericidal

Penicillin G

Transpeptidase

Penicillin VAmpicillinAmoxicillin

10 Phenicols Bacteriostatic

Chloramphenicol

Peptidyl transferaseFlorfenicolThiamphenicol

11 Pleuromutilins Bacteriostatic Tiamulin Peptidyl transferase

12 Polypeptides Bactericidal

Bacitracin IsoprenylphosphatePolymixin B

Membrane phospholipidsColistin

13 Quinolones Bactericidal

Oxolinic acid

DNA gyrase

FlumequineEnrofloxacinDanofloxacinDifloxacinSarafloxacin

62

14 Quinoxalines Bactericidal Carbadox DNA15 Rifamycins Bactericidal Rifampin RNA polymerase16 Streptogramins Bacteriostatic Virginiamycin 50S ribosomal subunit17 Sulfonamides Bacteriostatic Trimethoprim Pteroate synthetase

18 Tetracyclines Bacteriostatic

Oxytetracycline


ChlortetracyclineTetracyclineDoxycycline

63

APPENDIX 2

REPUBLIC ACT NO. 8485

AN ACT TO PROMOTE ANIMAL WELFARE INTHE PHILIPPINES, OTHERWISE KNOWN AS

"THE ANIMAL WELFARE ACT OF 1998".Section 1. It is the purpose of this Act to protect and promote thewelfare of all animals in the Philippines by supervising and regulatingthe establishment and operations of all facilities utilized for breeding,maintaining, keeping, treating or training of all animals either asobjects of trade or as household pets. For purposes of this Act, petanimal shall include birds.

Sec. 2. No person, association, partnership, corporation, cooperative orany government agency or instrumentality including slaughter housesshall establish, maintain and operate any pet shop, kennel, veterinaryclinic, veterinary hospital, stockyard, corral, stud farm or stock farm orzoo for the breeding, treatment, sale or trading, or training of animalswithout first securing from the Bureau of Animal Industry a certificateof registration therefor.

The certificate shall be issued upon proof that the facilities of suchestablishment for animals are adequate, clean and sanitary and will notbe used for, nor cause pain and/or suffering to the animals. Thecertificate shall be valid for a period of one (1) year unless earliercancelled for just cause before the expiration of its term by theDirector of the Bureau of Animal Industry and may be renewed fromyear to year upon compliance with the conditions imposed hereunder.The Bureau shall charge reasonable fees for the issuance or renewal ofsuch certificate.

The condition that such facilities be adequate, clean and sanitary, andthat they will not be used for nor cause pain and/or suffering to theanimals is a continuing requirement for the operation of theseestablishments. The Bureau may revoke or cancel such certificate ofregistration for failure to observe these conditions and other justcauses.

Sec. 3. The Director of the Bureau of Animal Industry shall superviseand regulate the establishment, operation and maintenance of petshops, kennels, veterinary clinics, veterinary hospitals, stockyards,

64

corrals, stud farms and zoos and any other form or structure for theconfinement of animals where they are bred, treated, maintained, orkept either for sale or trade or for training as well as the transport ofsuch animals in any form of public or private transportation facility inorder to provide maximum comfort while in transit and minimize, ifnot totally eradicate, incidence of sickness and death and prevent anycruelty from being inflicted upon the animals.The Director may call upon any government agency for assistanceconsistent with its powers, duties, and responsibilities for the purposeof ensuring the effective and efficient implementation of this Act andthe rules and regulations promulgated thereunder.

It shall be the duty of such government agency to assist said Directorwhen called upon for assistance using any available fund in its budgetfor the purpose.

Sec. 4. It shall be the duty of any owner or operator of any land, air orwater public utility transporting pet, wildlife and all other animals toprovide in all cases adequate, clean and sanitary facilities for the safeconveyance and delivery thereof to their consignee at the place ofconsignment. They shall provide sufficient food and water for suchanimals while in transit for more than twelve (12) hours or whenevernecessary.No public utility shall transport any such animal without a writtenpermit from the Director of the Bureau of Animal Industry or his/herauthorized representative. No cruel confinement or restraint shall bemade on such animals while being transported.

Any form of cruelty shall be penalized even if the transporter hasobtained a permit from the Bureau of Animal Industry. Cruelty intransporting includes overcrowding, placing of animals in the trunks orunder the hood trunks of the vehicles.

Sec. 5. There is hereby created a Committee on Animal Welfareattached to the Department of Agriculture which shall, subject to theapproval of the Secretary of the Department of Agriculture, issue thenecessary rules and regulations for the strict implementation of theprovisions of this Act, including the setting of safety and sanitarystandards, within thirty (30) calendar days following its approval. Suchguidelines shall be reviewed by the Committee every three (3) yearsfrom its implementation or whenever necessary.The Committee shall be composed of the official representatives of thefollowing:cralaw

(1) The Department of Interior and Local Government (DILG);(2) Department of Education, Culture and Sports (DECS);

65

(3) Bureau of Animal Industry (BAI) of the Department of Agriculture(DA);(4) Protected Areas and Wildlife Bureau (PAWB) of the Department ofEnvironment and Natural Resources (DENR);(5) National Meat Inspection Commission (NMIC) of the DA;(6) Agriculture Training Institute (ATI) of the DA;(7) Philippine Veterinary Medical Association (PVMA);(8) Veterinary Practitioners Association of the Philippines (VPAP);(9) Philippine Animal Hospital Association of the Philippines (PAHA);(10) Philippine Animal Welfare Society (PAWS);(11) Philippine Society for the Prevention of Cruelty to Animals(PSPCA);(12) Philippine Society of Swine Practitioners (PSSP);(13) Philippine College of Canine Practitioners (PCCP); and(14) Philippine Society of Animal Science (PSAS).The Committee shall be chaired by a representative coming from theprivate sector and shall have two (2) vice-chairpersons composed of therepresentative of the BAI and another from the private sector.

The Committee shall meet quarterly or as often as the need arises. TheCommittee members shall not receive any compensation but mayreceive reasonable honoraria from time to time.

Sec. 6. It shall be unlawful for any person to torture any animal, toneglect to provide adequate care, sustenance or shelter, or maltreatany animal or to subject any dog or horse to dogfights or horsefights,kill or cause or procure to be tortured or deprived of adequate care,sustenance or shelter, or maltreat or use the same in research orexperiments not expressly authorized by the Committee on AnimalWelfare.

The killing of any animal other than cattle pigs, goats, sheep, poultry,rabbits, carabaos, horses, deer and crocodiles is likewise herebydeclared unlawful except in the following instances: cralaw

(1) When it is done as part of the religious rituals of an establishedreligion or sect or a ritual required by tribal or ethnic custom ofindigenous cultural communities; however, leaders shall keep recordsin cooperation with the Committee on Animal Welfare;

(2) When the pet animal is afflicted with an incurable communicabledisease as determined and certified by a duly licensed veterinarian;

(3) When the killing is deemed necessary to put an end to the miserysuffered by the animal as determined and certified by a duly licensedveterinarian;

66

(4) When it is done to prevent an imminent danger to the life or limb ofa human being;

(5) When done for the purpose of animal population control;

(6) When the animal is killed after it has been used in authorizedresearch or experiments; and

(7) Any other ground analogous to the foregoing as determined andcertified licensed veterinarian.In all the above mentioned cases, including those of cattle, pigs, goats,sheep, poultry, rabbits, carabaos, horses, deer and crocodiles the killingof the animals shall be done through humane procedures at all times.

For this purpose, humane procedures shall mean the use of the mostscientific methods available as may be determined and approved by thecommittee.

Only those procedures approved by the Committee shall be used in thekilling of animals.

Sec. 7. It shall be the duty of every person to protect the naturalhabitat of the wildlife. The destruction of said habitat shall beconsidered as a form of cruelty to animals and its preservation is a wayof protecting the animals.

Sec. 8. Any person who violates any of the provisions of this Act shall,upon conviction by final judgment, be punished by imprisonment ofnot less than six (6) months nor more than two (2) years or a fine of notless than One thousand pesos (P1,000.00) nor more than Five thousandpesos (P5,000.00) or both at the discretion of the Court. If the violationis committed by a juridical person, the officer responsible therefor shallserve the imprisonment when imposed. If the violation is committed byan alien, he or she shall be immediately deported after service ofsentence without any further proceedings.

Sec. 9. All laws, acts, decrees, executive orders, rules and regulationsinconsistent with the provisions of this Act are hereby repealed ormodified accordingly.

Sec. 10. This Act shall take effect fifteen (15) days after its publicationin at least two (2) newspapers of general circulation.

Approved: February 11, 1998

67

APPENDIX 3

California Mastitis Test (CMT) protocolNOTE: The CMT paddle has 4 shallow cups marked A-D depicting the individual quarterfrom which the milk will be obtained.Step Activities

1 Take ~2cc milk from each quarter.2 Add same amount of reconstituted CMT solution to each cup in the paddle

3Rotate the CMT paddle in circular motion to thoroughly mix the contents.Do not mix longer than 10 seconds.

4Read the test quickly. The reaction is scored visually.Visible reactions disintegrate in 20 seconds.

68

APPENDIX 4

Table 4. DNA extraction through boiling method (Chuang, et al., 2006).Step Activities

1Subculture isolates to LB (Luria-Bertani) agar.Incubate at 37ºC for 24 hrs.

2

Pick 1 colony.Mix in 60µL distilled water in a 1.5mL Eppendorf tube.Vortex.

3Boil for 10 minutes starting when steam appears.Put on ice immediately.

4

Centrifuge at 12,000 rpm for 5 minutes.Transfer supernatant in new Eppendorf tubes.Discard precipitate.

5 Keep whole DNA in freezer -20ºC.

69

APPENDIX 5

List of primers used in this study for detection of serotypes and virulence genes

# GeneSize(bp) Serotype Primers Sequence (5'-3') Reference

1magA 1283 K1

magAF1 GGTGCTCTTTACATCATTGC Turton et al.,20082 magAR1 GCAATGGCCATTTGCGTTAG

3wzy 641 K2

wzy-F1 GACCCGATATTCATACTTGACAGAG Turton et al.,20084 wzy-R1 CCTGAAGTAAAATCGTAAATAGATGGC

5K5wzx 280 K5

K5wzxF360 TGGTAGTGATGCTCGCGA Turton et al.,20086 K5wzxR639 CCTGAACCCACCCCAATC

7rmpA 516

Non-K1/K2

rmpAF ACTGGGCTACCTCTGCTTCA Yeh, et al.,20078 rmpAR CTTGCATGAGCCATCTTTCA

70

APPENDIX 6

Minimum inhibitory concentration using 2-fold microbroth dilution.Day Activities

1

Subculture isolates + reference strains then incubate 37C overnight.Prepare 10mL DW tubes per antibiotic. Label.Prepare 2mL & 9mL 0.9% NSS tubes for the bacterial inoculum. Label.Prepare 5mL Cation adjusted Mueller-Hinton broth (CAMB) per isolate & reference strainAutoclave 20-200μl pipette tips.

2

Label the microtitre plates 128 to 0 (control) antibiotic dilutions horizontally &isolate # or reference strain vertically.Prepare antibiotic stock solution (concentration: 50mg/mL).Pour CAMHB on plate.Pipette 50µL CAMHB to wells except the first column (labelled 128).Pipette 512µL out of 10mL DW and pipette 512µL antibiotic to ~9.5mL DW .Pour antibiotic on plate.Pipette 50µL antibiotic to 128 & 64 labelled wells and mix by pipetting.Serially dilute by pipetting 50µL antibiotic & mixing from 64 labelled well to the next except thecontrol well.Inoculate isolate in 2mL 0.9% NSS to 0.5 McFarland turbidity. Compare to standard. Label.Pipette 1mL of 0.5 McFarland bacterial solution to 9mL 0.9% NSS tube then vortex. RepeatPour 1:100 diluted 10mL inoculum on plate.Pipette 50µL inoculum from control well to 128 labelled well.Seal the plate with a parafilm and store in a sealed contained with wet tissue up to 4 stacks only.Incubate plates at 37C for 16-18 hrs.

3Read MIC results and plot on MIC table.Compare MIC results of reference strains to standard.

71

APPENDIX 7

List of antimicrobials generally used on farms to treat mastitis.

# Antibiotic Route of AdministrationMilkWithdrawal

1 Cloxacillin Intramammary 72 hours2 Penicillin streptomycin Intramuscular 7 days3 Ceftiofur hydrochloride Intramammary 72 hours4 Ceftiofur hydrochloride Intramuscular NIL

72

APPENDIX 8

List of primers used in this study for detection of integrons and gene casettes

# GeneSize(bp) Primers Sequence (5'-3') Reference

1intI1 254

intIF CCTTCGAATGCTGTAACCGCMurinda et al., 20052 intIR ACGCCCTTGAGCGGAAGTATC

3 Gene1000

5'CS GGCATCCAAGCAGCAAGLevesque et al., 19954 casette 3'CS AAGCAGACTTGACCTGA

73

APPENDIX 9

Conjugation study protocol

Day Activities

1Inoculate K. pneumoniae isolate/s &E.coli J53AzR strain onto LB broth w/o antibiotic.Incubate at 37ºC for 3-4 hrs (bacteria in log phase).

2

Pipette 0.5mL from each culture of LB broth tube & inoculate into 1 tube of 4ml fresh warm LBbroth.Incubate without shaking at 37ºC for 24 hrs.Pour Trypticase soy agar w/ sodium azide (100µg/mL) &sulfamethoxazole (300µg/mL) to glass plate for day 3.Keep on refrigerator.

3

Dry plates.Streak isolates onto TSA w/ sodium azide (100µg/mL) &sulfamethoxazole (300µg/mL).Prepare TSA plates w/ & w/o ciprofloxacin (0.06µg/ml) for day 4.Do not let the antibiotic dry on plate before pouring TS agar.Do not let LB agar dry on plate before putting antibiotics.

4Pick multiple colonies from plates & streak on to TSA plates w/ & w/o ciprofloxacin (0.06µg/ml).Incubate at 37ºC for 24 hrs.

5

Dry TSA plates. Colonies on TSA plates with ciprofloxacin should be E.coli .Select 1 colony and inoculate into 60µl DW in 1.5ml Eppendorf tube.Vortex to resuspend bacteria.Boil for 10 minutes in water suspension.Chill tubes immediately.Centrifuge at 12,000 rpm for 5 minutes.Pipet off supernatant to sterile 1.5ml tube for storage (Discard tubes and pellets).Screen for Int1 gene.Run Int1 PCR program.Visualize product on 1.5% agarose gel (run at 90mA for 50 minutes).Stain ethidium bromide for 10 minutes &destain with distilled water for 5 minutes.

74

APPENDIX 10

List of primers used in this study for detection of quinolone resistance genes

# GeneSize(bp) Primers Sequence (5'-3') Reference

1qnrA 516

qnrAF ATTTCTCACGCCAGGATTTGStephenson et al., 20102 qnrAR GATCGGCAAAGGTTAGGTCA

3qnrB 469

qnrBF GATCGTGAAAGCCAGAAAGGStephenson et al., 20104 qnrBR ACGATGCCTGGTAGTTGTCC

5qnrS 417

qnrSF ACGACATTCGTCAACTGCAAStephenson et al., 20106 qnrSR TAAATTGGCACCCTGTAGGC

7qepA 617

qepA-F GCAGGTCCAGCAGCGGGTAG Yamane et al., 20088 qepA-R GGACATCTACGGCTTCTTCG Rocha-Gracia, et al., 20109

aac(6’)lb-cr 482aac(6’)lb-cr -F TTGCGATGCTCTATGAGTGGCTA

Park et al., 200610 aac(6’)lb-cr -R CTCGAATGCCTGGCGTGTTT

75

APPENDIX 11

List of primers used in this study for detection of antibiotic resistance genes# Gene Size (bp) Primers Sequence (5'-3') Reference1

blaSHV 1704SHV-F GCCGGGTTATTCTTATTTGTCGC

Afifi, 20132 SHV-R ATGCCGCCGCCAGTCA3

blaTEM 1016TEM-F TCGGGGAAATGTGCG

Afifi, 20134 TEM-R TGCTTAATCAGTGAGGCACC5

blaCTX-M 544CTX-M-F TTTGCGATGTGCAGTACCAGTA

Edelstein et al., 20036 CTX-M-R CGATATCGTTGGTGGTGCCATA7

aadA1 631aadA1F CTCCGCAGTGGATGGCGG

Chuanchuen et al., 20088 aadA1R GATCTGCGCGCGAGGCCA9

aadA2 500aadA2F CATTGAGCGCCATCTGGAAT

Chuanchuen et al., 200810 aadA2R ACATTTCGCTCATCGCCGGC11

aadB 300aadBF CTAGCTGCGGCAGATGAGC

Chuanchuen et al., 200812 aadBR CTCAGCCGCCTCTGGGCA13

dfrA6 419dfrA6F AGCAAAAGGTGAGCAGTTAC

Chen et al., 200414 dfrA6R GTGCTGGAACGACTTGTTAG15

dfrA12 406dfrA12F GCCGTGGGTCGATGTTTGAT

Chen et al., 200416 dfrA12R TTCACCACCACCAGACACA17

sul1 331sul1F TCACCGAGGACTCCTTCTTC

Chen et al., 200418 sul1R CAGTCCGCCTCAGCAATATC19

tetA 210tetAF GCTACATCCTGCTTGCCTTC

Ng et al., 200120 tetAR CATAGATCGCCGTGAAGAGG21

tetB 659tetBF TTGGTTAGGGGCAAGTTTTG

Ng et al., 200122 tetBR GTAATGGGCCAATAACACCG

76

APPENDIX 12

Dear _________________,

Ako si __________________________________, isang estudyante ng Unibersidad ng Pilipinas,

Kolehiyo ng Medisinang Pambeterinaryo. Ako ay nagsasagawa ng pagsisiyasat patungkol sa Gatas

ng mga Inahing Baka sa lalawigan ng Batangas. Lubos kong pahahalagahan ang iyongpakikilahok

sa pamamagitan ng pagsagot ng lahat ng mga katanungan.

Ang pakikilahok sa pagsisiyasat na ito ay iyong pagkusang loob. Gayunpaman, ang iyong pananaw ay

mahalaga at umaasa ako na ikaw ay sumali. Ang impormasyon na makukuha ay itinuturinglihim at

posibleng maging batayan ng mahalagang pagpapasya at pagsasagawa ng rekomendasyon upang

mapabuti ang kalusugan ng mga hayop at tao sa komunidad. Walang mali o tamang sagot sa mga

tanong na ito.

77

TIME TABLE

EXPECTED

ACTIVITIES

PERIOD TO BE COVERED2015-2016

OUTPUT

4th Q 2015 1st Q 2016 2nd Q 2016Sept-Oct

Nov-Dec

Jan-Feb

Mar-Apr

May-June

July-Aug

A. Drafting&presentation of 1. Visitation ofstudy proposal laboratory &source farm

2. Literature reviewB. Documentation & 1. Recording of dataExperimentation 2. Editing and

summarization of resultsC. Data analyses Statistical

computation & analysesD. Manuscript 1. Drafting ofPreparation experimentation results

2. Submission ofmanuscript draft

E. Defense of Presentation andresearch paper ReviewF. Final revision Finalization ofof research paper research paperG. Submissionof research paperfor publication

78

BUDGET

ITEM PROJECTED COST

Unit ofMeasure

UnitPrice Qty Amount

I. DRAFTING OF STUDY PROPOSAL

Survey of laboratory & source farms(Batangas)

Transportation 100 10 1000.00

Food 150 10 1500.00

Securing of necessary permits

Transportation 1500 1 1,500.00

Food 1000 1 1,000.00

Consultations with industry practitioners

Transportation 1500 1 1,500.00

Food 1000 1 1,000.00

SUBTOTAL 7,500.00

II. PRESENTATION OF STUDYPROPOSAL

Proposal Defense

Printing 500 500.00

Food 2000 2,000.00

Revision of Proposal

English Critic 750 750.00

Proof reader 750 750.00

79

SUBTOTAL 4,000.00

III. MATERIALS NEEDED

Facilities

Rental 5000 5,000.00

Consumables

Supplies for sample collection 50000 150,000.00

Reagents for molecular experiments 100000 250,000.00

Culture media, biochemical tests 100000 171,500.00

Antimicrobial agents 50000 150,000.00

Others 10000 50,000.00

Services

Postal services 1000 1,000.00

Sequencing 20000 80,000.00

Standby antibiotic medication per syringe 75 50 3,750.00

SUBTOTAL 861,250.00

IV. DATA GATHERING

Food 1000 1 1,000.00

Transportation 2,500 1 2, 500.00

SUBTOTAL 3,500.00

V. DATA ANALYSES

Statisticians fee 15000 15,000.00

SUBTOTAL 15,000.00

VI. WRITING OF THE MANUSCRIPT

Printing 750 750.00

Food 500 500.00

80

English Critic 750 750.00

Proof reader 750 750.00

SUBTOTAL 2,750.00

VII. DEFENSE PRESENTATION OFRESEARCH PAPER

Printing 750 750.00

Food 2000 2,000.00

SUBTOTAL 2,750.00

VIII. REVISION OF THE RESEARCHPAPER

Printing 750 750.00

Food 500 500.00

SUBTOTAL 1,250.00

IX. SUBMISSION OF RESEARCH PAPER

FOR PUBLICATION

Printing 1000 1,000.00

SUBTOTAL 1,000.00

X. MISCELLANEOUS

Printing 1000 1,000.00

SUBTOTAL 1,000.00

GRAND TOTAL 900,000.00

Funding:

The researcher will be applying for research grants by the United States Department ofAgriculture.

thesis proposal amr kleb

Documents