thesis proposal amr kleb
TRANSCRIPT
1
INTRODUCTION
1.1 Background
Antimicrobials are medically important in the prevention, control and treatment of
infections and disease. They are mainly used for therapy, metaphylaxis, prophylaxis and in
the case of the animal industry, growth promotion. In fact, the Center of Disease Control
(CDC) in the United States of America says that 80% of the antimicrobial use is for the farm
animals which help microorganisms become resistant.
The World Health Organization (WHO) defines antimicrobial resistance (AMR) as
the resistance of a microorganism to an antimicrobial previously effective for treatment of
infections and diseases caused by it. The growing concern on AMR involves the over use of
antimicrobials (Younes, A.M., 2011) which include non-observance of the withdrawal period
for meat and milk. Moreover, extra-label or off-label use of antimicrobials is also rampant
(Barlow, 2011). The care for extra-label drug use in food animals relate to residue avoidance,
and its use requires documentation of adequate withholding period for milk and slaughter to
ensure food safety. Extra-label use is prohibited if the use results in the presence of drug
residue in food or if presents a public health risk (CDC). WHO lists the major causes of
antibiotic resistance below.
1. Over-prescription of antibiotics
CDC states that in humans up to half of the time, antibiotics are not properly
prescribed in terms of dosage and duration and often done so when not needed. Also in
animals, there are instances when some minor clinical signs can be alleviated with mere
vitamin and/or mineral supplementation, rest and isolation, but some are still prescribed with
2
antimicrobials. Over-prescription of antibiotics can be prevented by also using alternative
methods such as herbal medicine.
2. Patient’s non-completion of treatment regimen and period
Due to expensive medical costs, some patients, farmers and pet owners opt to
discontinue the treatment. Moreover, as in the animal industry, medication may also be quite
difficult to perform.
3. Over-use of antibiotics in livestock and fish farming
It has been a wide practice in the animal sector to give antibiotics as prophylaxis and
more especially to promote growth by suppressing bacterial load that hinders optimum
growth and production of the animals and not necessarily intended for those microorganisms
already causing infection and disease. CDC further mentions that the use of antibiotics in
food animals increases resistance for some microbes.
4. Inadequate infection control in hospital and clinics
An effective sanitation program in hospitals and clinics helps prevent infection and
spread of disease. Poor infection control helps microorganisms thrive in the environment
enabling them to adapt well even after exposure to sanitizers and disinfectants thus leading to
resistance.
5. Lack of hygiene and inadequate sanitation
Basic hand washing and safe food preparation are essential elements in good hygiene,
optimum health and prevention of spread of disease.
3
6. Lack of new antibiotics being developed
The growth and spread of microorganisms is exponentially fast however due to lack
of funds and manpower, research has been difficult and slow in the development of a new
drug. Aside from this, the development and validation of methods to quantify and document
antimicrobial use and the effect of prudent antimicrobial use practices have continue to be a
challenge (Barlow, 2011).
As an effect to AMR, CDC declares that at least 2 million people in the United States
become infected with antibiotic resistant bacteria annually and at least 23,000 people die each
year as a direct result of these infections.
Moreover, bovine mastitis is an economically significant disease due to the high
veterinary costs, extra labor, decreased fertility, decrease in milk production let alone the
discarded milk, and death or culling of infected animals thus affecting the daily income of the
local dairy farmers (Paulin-Curlee, et al., 2007). Specifically, Klebsiella pneumoniae is a
facultative anaerobic Gram negative bacterium (Holt, et al., 1994) that is present in the
environment, mucosal surfaces of humans and animals (Macrae, et al., 2001; Brisse, et al.,
2009). Mastitis caused by Klebsiella pneumoniae can be more severe than the other mastitis
pathogens due to its poor antimicrobial response, rapid progress to toxic shock and death. It
has been reported to be more pathogenic and cause higher losses than infections due to
Eschericia coli (Paulin-Curlee, et al., 2007).
This study will help the dairy animals in the Philippines especially the cattle which is
estimated to be 46, 363 heads (NDA, 2015) as the data and recommendations that will be
generated already fit the local conditions. Identifying Klebsiella pneumoniae as the cause of
mastitis and the risk factors leading to it will help provide worthy recommendations to the
local dairy farmers on its prevention, management and treatment. The whole dairy animal
4
industry which comprises of dairy cattle farmers, fresh milk processors, farm workers, dairy
products consumers and government officers will also benefit from this research through the
increase of food source.
AMR can also be acquired through the consumption of untreated or inadequately
treated milk (Timofte et al., 2014). Furthermore, studying about the antimicrobial properties
of Klebsiella pneumoniae will help prevent or at least lessen the occurrence of their drug
resistance which is essential in combating mastitis and of not incurring high treatment costs.
This will also help diminish or avoid transfer of such resistance properties to other pathogens
that could infect humans. Through this study, data such as antimicrobial resistance genes of
Klebsiella pneumoniae from bovine milk will be made available. This study will provide
vital information to various industry players, academicians, drug companies & policy makers.
As a pioneering work, it will serve as a benchmark for further researches.
1.2 Objectives of the study
The study aims to understand the antimicrobial resistance and its associated risk
factors, and genetic characterization of Klebsiella pneumoniae isolates from bovine milk.
Specific Objectives
1. To establish the prevalence of Klebsiella pneumoniae in mastitic cows from dairy
cattle farms in Batangas;
2. To determine the antibiotic resistance patterns and virulence factors of Klebsiella
pneumoniae and characterize its mechanisms, distribution and transfer among bacteria
isolated from bovine milk;
5
3. To establish the risk factors present in each farm in relation to Klebsiella pneumoniae
antimicrobial resistance in bovine mastitis; and
4. To formulate recommendations for each farm involved in terms of prevention, control
and management of Klebsiella pneumoniae antimicrobial resistance bovine mastitis.
1.3 Time and place of the study
The study will be conducted at the Department of Paraclinical Sciences, College of
Veterinary Medicine, University of the Philippines Los Banos, Laguna, and in dairy cattle
farms in Batangas from December 2015 to August 2016.
6
REVIEW OF RELATED LITERATURE
2.1 Mastitis
Mastitis is the inflammation of the mammary gland caused by several bacteria (Oliver
& Murinda, 2012; Zadoks et al., 2011) but it is also a response to intramammary
mycoplasmal, fungal, or algal infections. Microorganisms may escape the natural defense
mechanisms by multiplication along the streak canal (especially after milking), or by
propulsion into the teat cistern by vacuum fluctuations at the teat end during milking.
Mechanical trauma, thermal trauma, and chemical insult predispose the gland to
intramammary infection (IMI) as well. Occurrence of mastitis depends on the interaction of
host, agent, and environmental factors (Zhao & Lacasse, 2008).
The two classifications of mastitis according to severity are subclinical and clinical.
Subclinical mastitis depicts mild non-visible inflammation of the mammary gland and the
milk and quarter still appear normal. It is the main form of mastitis in dairy herds, exceeding
50% of cows in given herds (Oliver & Murinda, 2012). Subclinical mastitis may be
identified by bacteriological culture of milk or by the measurement of indicators of
inflammation such as Somatic cell count (SCC) and California Mastitis Test (CMT) (Oliver
& Murinda, 2012 and Barlow, 2011). The culture of milk from cows postpartum or cows
with high SCC may be used as a surveillance tool to identify common organisms causing
subclinical mastitis during lactation or as a component of a mastitis control program to
identify cows for treatment, segregation, or culling during lactation (Barlow, 2011).
Subclinical mastitis can be self-limiting and could heal spontaneously or it could develop
within hours up to several months to clinical mastitis (Oliver & Murinda, 2012). The cost of
subclinical mastitis is very difficult to quantify, but most experts agree that subclinical
7
mastitis costs the average dairy farmer more than does clinical mastitis (Zhao & Lacasse,
2008).
On the other hand, clinical mastitis is manifested through visible abnormal, clotty or
flaky appearance of the milk even if the udder may appear normal (Oliver & Murinda, 2012).
It is in dairy cattle in as many as 40% of samples (Barlow, 2011). Furthermore, clinical
mastitis can be categorized to mild, moderate and severe. In moderate clinical mastitis, the
udder is already visibly inflamed caused by the clots blocking the milk passage preventing
drainage from the alveoli. Consequentially, the alveoli swell leading to lower milk
production. Lastly, severe clinical mastitis poses a systemic threat to the animal as it
becomes ill inclusive of dull, sunken eyes, drooping cold ears, weakness, loss of appetite,
depression, dehydration, shivering, increased rectal temperature, increased pulse rate and
respiratory rate, reduced rumen contraction rate and diarrhea (Oliver & Murinda, 2012).
The two types of mastitis in terms of causative agent are the contagious and the
environmental type. The contagious type includes that of Staphylococus aureus,
Streptococcus agalactiae and Mycoplasma sp. which may spread from cow to cow (Oliver &
Murinda, 2012; Zhao & Lacasse, 2008) through the milkers’ hands, milking machine, and
flies (Levesque et al, 1995). Milking time hygiene is the basis for control of contagious
mastitis (Hogan & Smith, 2012). Antibiotic treatment of clinical mastitis caused by the
gram-positive cocci (e.g. Staphylococcus aureus, Streptococcus uberis, Streptococcus
dysgalactiae, and Streptococcus agalactiae) is often recommended. Treatment decisions
should be guided by culture results (Barlow, 2011).
The environmental type includes that of Streptococcus uberis, Streptococcus
dysgalactiae and coliforms such as Escherichia coli and Klebsiella pneumoniae (Oliver &
Murinda, 2012; Zhao & Lacasse, 2008) which have increased in relative importance as a
8
cause of both clinical and subclinical mastitis (Barlow, 2011). They are of fecal origin or
may come from the surroundings such as the beddings, feed and soil. Rates of environmental
mastitis are directly proportional to the temperature and moisture and are greatest during the
dry period and early lactation compared with other stages of lactation. Bulk tank and
monthly cow somatic cell counts (SCCs) are poor milk quality indicators of environmental
mastitis. Approximately 85% of coliform and 50% of environmental streptococcal infections
will cause clinical mastitis. The severity of clinical mastitis brought about by environmental
pathogens ranges from mild local signs to death. The vast majority of clinical coliform and
environmental streptococcal clinical cases are characterized by only abnormal milk and a
swollen gland. During the dry period, susceptibility to intramammary infections is greatest at
the 2 weeks after drying off and the 2 weeks prior to calving. Research has shown that 65%
of coliform clinical cases that occur in the first 2 months of lactation are intramammary
infections that originated during the dry period. Coliforms are skilled at infecting the
mammary gland during the transitional phase from lactating to fully involuted mammary
gland. Management include frequent manure removal, eliminating standing water in the
cow’s walking lanes and loafing areas, and avoiding overcrowding of animals in barns and
pastures (Hogan & Smith, 2012).
Culture negative results have been attributed to infectious bovine mastitis where
concentrations of pathogens are beneath the limit of detection using standard techniques, the
presence of endogenous inhibitory substances in milk decreases the viability of bacteria in
vitro, or the bacteria from the mammary gland were effectively cleared by the host immune
response prior to obtaining milk samples for culture. Less commonly isolated organisms
such as Mycoplasma spp., Serratia spp., Pseudomonas spp., Arcanobacterium pyogenes
(formerly Actinomyces pyogenes), Nocardia spp., Prototheca spp., Bacillus spp., yeasts and
fungi are unlikely to respond to treatment (Barlow, 2011). Escherichia coli, Klebsiella
9
pneumoniae, Streptococcus agalactiae and Staphylococcus aureus also occur as commensals
or pathogens of humans whereas other causative species, such as Streptococcus uberis,
Streptococcus dysgalactiae subsp. dysgalactiae or Staphylococcus chromogenes, are almost
exclusively found in animals (Zadoks et al., 2011).
Mastitis is recognized as the most costly disease in dairy cattle. Decreased milk
production accounts for approximately 70% of the total cost of mastitis (Zhao & Lacasse,
2008). As it is caused by several bacteria, it is difficult to control and massive economic loss
is to be expected. In the United States, the national mastitis council estimates that the annual
economic loss due to mastitis amounts to more than $2 billion (Oliver & Murinda, 2012).
Mammary tissue damage reduces the number and activity of epithelial cells and consequently
contributes to decreased milk production. Mammary tissue damage has been shown to be
induced by either apoptosis or necrosis (Zhao & Lacasse, 2008).
Segregation and culling is often the most prudent response for persistently infected
animals. It influences prevalence of mastitis pathogens in dairy herds and selective culling of
cows with mastitis may influence the prevalence of specific species or strains. Pathogen
genotype and host-restriction may influence the probability of infection persistence and cure
following treatment. Moreover, acquired resistance of species and strains through horizontal
gene transfer can be influenced by its bacterial genotype. Non-antibiotic control options such
as culling, segregation, hygiene and biosecurity will be important to limit transmission within
and between farms. In the past, when milk was bought largely for volume, the main aim of
treatment was to restore milk production and the failure to eliminate infection was not of
major priority. This likely brought about the use of short duration treatment regimens such as
2 days of therapy, targeting resolution of clinical signs but not bacteriological cure, although
the importance of bacteriological cure has long been recognized (Barlow, 2011).
10
Antimicrobial agents remain a component of infectious mastitis treatment and control
(Barlow, 2011). Antibiotic therapy of clinical mastitis involves detection of the infected
quarter, immediate treatment, administration and completion of recommended treatments,
recordkeeping, identification of treated cows, and strict observance of milk withdrawal
periods (Oliver & Murinda, 2012). The success of the therapy depends on the treatment
product, length of treatment and whether treatment was administered during lactation or
during the dry period, or in the case of heifers, shortly before calving, increasing cow age,
increasing SCC, increasing persistence of infection, increasing bacteria counts, and
increasing numbers of mammary quarters infected. Of these factors, the most important
affecting cure is treatment duration (Middleton, 2012). Antibiotics such as penicillin,
cephalosporin, non-cephalosporin beta-lactam, streptomycin, tetracycline and macrolide-
lincosamide drugs are used to combat mastitis. Additionally, penicillin is combined with
either novobiocin or dihydrostreptomycin (Barlow, 2011; Oliver & Murinda, 2012).
Treatment of clinical IMI caused by coliform organisms with IMM (intramammary) or
systemic formulations is not recommended due to the short duration of infection and high
spontaneous cure rates. Supportive care such as fluid therapy and treatment with steroidal or
non-steroidal anti-inflammatory drugs has been recommended for cases of acute clinical
coliform mastitis. Frequent milk-out is a popular recommendation in the dairy industry for
treatment of acute clinical coliform mastitis.
Cure of IMI following treatment of either clinical or subclinical mastitis is generally
higher for lower parity, lower number bacterial colonies in the pre-treatment sample, a
shorter duration of infection or lower number of positive pre-treatment samples, and a lower
pre-treatment milk somatic cell count. Bacterial genetic factors also affect clinical properties
of infection and the response to treatment. Cases of subclinical mastitis are commonly
11
treated at the end of a lactation cycle such as dry-cow therapy administered at the start of the
dry period. Dry cow therapy is an established mastitis control practice that is applied to 100%
of cattle on an estimated 73% of U.S. dairy farms (Barlow, 2011).
2.2 Antimicrobials and its stewardship
Antimicrobial drugs (Appendix 1) function by targeting different parts of the bacterial
cell. Various mechanisms include interference with cell wall synthesis; interference of
protein synthesis through the 30S and 50S subunit; interference with nucleic acid (DNA)
synthesis; inhibition of Ribonucleic acid (RNA) synthesis; inhibition of a metabolic pathway;
and disruption of bacterial membrane structure.
In detail, interference with cell wall synthesis happens through synthesis of uridine
diphosphate (UDP)-N-acetylglucosamine and uridine diphosphate (UDP)-N-acetylmuramyl
pentapeptide; peptidoglycan formation (UDP-N-acetylglucosamine, UDP-N-acetylmuramyl-
pentapeptide and pentapeptide of glycine); and cross-linkage of peptidoglycans by enzyme
transpeptidase (PBPs) also known as “transpeptidation”. Antimicrobials of this mode of
action include ß-lactam antibiotics such as penicillinase-resistant aminopenicillins and first-
to fifth-generation cephalosporins. Antimicrobials that interfere the protein synthesis through
the 30S subunit are aminoglycosides and aminocyclitols which interfere with the recognition
between amino-acyl tRNA and codon causing incorporation of incorrect amino acids,
formation of abnormal and non-functional protein and rapid cell death; and tetracyclines
which prevent the binding of aminoacyl tRNA to the A site of the ribosome and suppress the
movement of tRNA along the ribosome. On the other hand, interference through the 50S
subunit happens through binding to the domain V of 23S rRNA (peptidyl transferase center)
and inhibiting the formation of peptide bond between amino acid on aminoacyl t-RNA and
12
growing peptide chain. They also bind to the A site and prevent the transfer of peptide chain
form the A site to the P site. Antimicrobials having this mechanism are chloramphenicol,
macrolides, lincosamides and streptogramins.
Intervention with nucleic acid (DNA) synthesis occurs by interfering with DNA
gyrase (topoisomerase II) for gram-negative bacteria and topoisomerase IV for gram-positive
bacteria. Antimicrobials having this mode of action are quinolones, nitroimidazoles and
nitrofurans. While on ribonucleic acid (RNA), synthesis is inhibited by rifamycins by
binding on DNA directed beta subunit RNA polymerase disabling bacterial DNA to transfer
its information to RNA and inhibiting protein synthesis. Furthermore, inhibition of a
metabolic pathway ensues by acting on the synthesis of tetrahydropholic acid specifically on
the dihydropteroate synthetase and dihydrofolate reductase by the sulphonamides and
diaminopyrimidines respectively. Lastly, disruption of bacterial membrane structure takes
place as manifested by polymyxins through interaction with the phospholipids of cell
membrane of gram-negative bacteria by increasing its permeability thus disrupting and
destabilizing the membrane (Younes, A.M., 2010).
Aspects of antimicrobial use to consider in the development of farm specific strategies
may include pathogen identification causing specific health problems, determination of the
most appropriate drug classes to use for treatments, ensuring appropriate treatment regimens
including dosage, route of administration, and duration of therapy, and pathogen
susceptibility testing and monitoring. Strategies should be reviewed regularly and revised to
meet changing circumstances. Use minimum inhibitory concentration (MIC) test methods,
report results at the species level, and present MIC data as the proportion of isolates
susceptible or resistant for each dilution tested in complete tabular form or using histograms.
Eliminating unnecessary antibiotic treatments would be beneficial for economic and prudent
drug use purposes. Treatment of culture negative mastitis is not recommended. Selective
13
dry-cow therapy can also be implemented to only treat cows at high risk for infection at the
end of lactation as opposed to doing blanket dry cow therapy which entails treating all cows
at the end of lactation regardless of infection status. The former appears to be an option in
herds with low prevalence of infection, but the potential impact on net drug use still remains
unknown. Non-antibiotic alternatives to dry cow therapy such as internal teat sealants may
provide an alternative which contributes to reduced drug use in dairy herds. It has been
estimated that antibiotics would not be justified for treatment of at least 50% of clinical
mastitis cases (Barlow, 2011).
Benefits of antimicrobial usage include healthier, more productive cows; lower
disease incidence; reduced morbidity and mortality; decreased pathogen loads; and
production of abundant quantities of nutritious, high-quality, longer shelf-life milk for human
consumption. However, there is controversy on its wide usage which may have led to the
occurrence of antimicrobial resistance. It may also lead to presence of antibiotic residue in
milk. These are two public health and food safety issues but also an economic issue for the
farmer to be penalized of having poor quality milk (Oliver & Murinda, 2012).
2.3 Antimicrobial Resistance
Issues related to antimicrobial use in dairy production systems include antimicrobial
agents such as cephalosporins, lincosamides, non-cephalosporin beta-lactams and
aminoglycosides relating to their availability ‘over-the-counter’ (OTC) at the disposal of
producers without veterinary supervision; the use of antimicrobial agents in an extra-label
manner; the relationship between antimicrobial use practices and the risk for development of
antimicrobial resistance; the development and validation of methods to quantify and
document antimicrobial use and the effect of prudent antimicrobial use practices.
14
Specifically, key conditions for extra-label drug use in food animals relate to residue
avoidance and documentation of adequate milk and slaughter withholding times to ensure
food safety. Extra-label use is not permitted if the use results in a violative drug residue in
food or if the use presents a public health risk, if another drug exists equivalent to what is
needed, and if no evidence is available on any approved antibiotic product establishing its
efficacy. Injectable products approved for use in beef or dairy cattle less than 20 months of
age are strictly prohibited for IMM extra label use. Such drugs are the macrolides or
flouroquinolones labelled for treatment of bovine respiratory disease.
U.S. Food and Drug Administration (FDA) Center for Veterinary Medicine (CVM)
has prohibited the extra-label veterinary use of flouroquinolones and glycopeptides in food
animals due to their importance in human medicine and the risk that extra-label use may
increase the antimicrobial resistance of bacteria that can cause human illness. Systemic use
of an antimicrobial drug such as ceftiofur or ampicillin to treat severe acute coliform mastitis,
especially when bacteremia is suspected or documented, represents an extra-label drug use
that maybe justified as there are no antimicrobials labelled for systemic administration for
mastitis and a significant proportion of coliform mastitis cases have been demonstrated to
progress to bacteremia where inclusion of antimicrobial therapy in treatment regimens
improves cow survival. Improved surveillance of antimicrobial use in food-producing
animals, including standardized class specific estimates of dosing per animal unit such as per
kilogram live weight, per time period such as the animal daily dose, is required to accurately
attribute risk to specific production systems (Barlow, 2011).
15
2.3.1 Transmission of resistance genes
AMR started from antimicrobial-producing organisms such as fungi or soil bacteria.
Through selective pressure, a few bacteria emerge after exposure to a given antimicrobial
with development of antimicrobial resistance mechanisms. Resistance genes can either be
transmitted vertically or horizontally via mobile genetic elements such as plasmids,
transposons and integrons. Specifically, plasmids are single stranded DNA in gram-positive
bacteria called the “jumping genes”. They vary widely in size from 1,000 to 10,000 base
pairs. They occur most often as closed covalently circular (CCC) with no free ends. They
replicate as the cell grows and encode RNA and protein. Secondly, transposons are small
pieces of DNA that insert itself into another place in the genome. Lastly, integrons, with nine
classes, are genetic units characterized by their ability to capture and incorporate gene
cassettes by site-specific recombination. Moreover, a gene cassette is a type of
mobile genetic element that contains a gene and a recombination site of 57-141 base pairs.
They often carry antibiotic resistance genes. They may vary considerably in total length from
262 to 1,549 base pairs. They exist incorporated linearized form into an integron or at a non-
specific location or freely as closed covalently circular DNA molecules which are important
intermediates in the dissemination of the cassettes. The second unit of transfer is the vector
which is a DNA molecule used as a vehicle to artificially carry foreign genetic material into
another cell, where it can be replicated and/or expressed (Synder and Champness, 1997).
Lastly, bacteria itself through zoonosis can transfer resistance genes from man to animals and
vice versa and through the different species of animals.
16
2.3.2 Types of Antimicrobial resistance
There are two types of AMR such as endogenous and exogenous AMR. Endogenous
AMR is the genetic change in bacterial genome also known as mutation while exogenous
AMR is the horizontal acquisition of foreign genetic information. In the latter, gene transfer
is classified as transformation or acquisition of free DNA, transduction via bacteriophages,
and conjugation or cell-to-cell transfer.
Transformation is the transfer of free or “naked” DNA into competent recipient cells.
It requires homology between donor and recipient DNA for recombination to happen. It only
plays a limited role in the transfer of resistance genes due to a rapid degradation of free DNA
from lysed bacteria. Only a few bacteria, such as Streptococcus pneumoniae and Bacillus
spp. exhibit a natural ability to take up free DNA from environment. On the other hand,
transduction is a bacteriophage-mediated transfer process. A bacteriophage is a virus that
infects and replicates within a bacterium. Transduction does not require viability of the
donor cell. It is also limited only to closely related bacteria carrying the same receptors
(specific receptor) for phage attachment. It is commonly observed between bacteria of the
same species particularly in gram-positive bacteria such as the spread of β-lactamase genes in
Staphylococcus aureus or multiple resistance phenotypes in Salmonella Typhimurium phage
type DT104. Lastly, we have conjugation which is a self-transfer of conjugative plasmid or
transposon from donor to recipient cells. It requires close contact between donor and
recipient cells via the conjugation bridge and it is an important means for the spread of
resistance genes between bacteria of different species and genera (Synder and Champness,
1997).
17
2.3.3 Mechanisms of AMR
The major mechanisms of AMR are enzymatic drug inactivation, reduced intracellular
accumulation of antimicrobials, and protection, alteration or replacement of the cellular target
sites. Enzymatic drug activation happens through resistance to β-lactams and
aminoglycosides via the enzymes β-lactamases and aminoglycoside-modifying enzymes
respectively. Decreased drug uptake through decreased cell wall permeability is how
intracellular accumulation of antimicrobials is reduced. This is an important mechanism of
resistance to β-lactams and fluoroquinolones in gram-negative bacteria, especially in
Pseudomonas aeruginosa and in Enterobacteriaceae. The outer membrane of gram-negative
bacteria may represent a permeability barrier to certain antibiotics. Mutations leading to
reduced expression, structural alteration or even loss of porins have been associated with
reduced permeability to antimicrobial drugs.
Aside from that, there could be increased removal of the drugs through an active efflux
which is an energy-dependent transmembrane protein mechanism. Furthermore, it is a
channel that actively exports antimicrobials and other compounds out of the cell. It prevents
intracellular accumulation necessary to exert the lethal activity inside the cell (Wannaprasat,
2012). The last mechanism is modification or replacement of the drug target and target
protection so the drug can no longer bind and exert its activity on the cell. This is important
for resistance to penicillin and glycopeptides in gram-positive and to quinolones in both
gram-positive and gram-negative bacteria. Structural changes of the binding sites of the
drugs targeting the bacterial ribosome in aminoglycosides are usually due to methylation.
Other changes are modification of DNA gyrase enzyme due to gene mutation causing
quinolone resistance and glycopeptide resistance in enterococci and methicillin resistance in
Staphylococcus aureus (MRSA) are due to drug target replacement. Target replacement is
18
also the main mechanism of acquired resistance to sulfonamides and trimethoprim followed
by increasing production of the drug target or another molecule with affinity for the drug
while target protection is the one mainly associated with tetracycline resistance.
2.3.4 Antibiotic sensitivity test (AST)
ASTs act as an epidemiologic tool and as a guide for treatment as it is a diagnostic
procedure being done to detect the extent of AMR in common pathogens and to assure
susceptibility to antimicrobials of choice for treatment of particular infections. The ideal
AST has low detection limit, high sensitivity and validity, ease of usage, storage and
longevity, no need for expensive equipment, and has scientific support. It should also be fast,
economical and environmental-friendly. However, its limitations include none mimicry of in
vivo environment and its results cannot predict outcome such as diffusion in tissue and host
cells, serum protein binding, drug interactions, host immune status & underlying illness,
organism virulence and site and severity of infection.
ASTs can fall under two types of methods such as the diffusion and the dilution
method. The diffusion method detects AMR through zone diameter breakpoint but still
considered qualitative since measurement of resistance through zone of inhibition (diameter
in mm) as compared with a standard table can only be categorized as susceptible,
intermediate and resistant. Intermediate results can further be characterized as moderate
susceptible for low toxic antibiotics and a buffer zone between resistant and susceptible for
high toxic antibiotics. The diffusion method is further classified into two types of tests such
as the disk diffusion test also known as the Kirby- Bauer test and the Epsilometer test also
known as the E-test. The former uses antibiotic-impregnated filter discs with set
19
concentration and measures AMR against more than one antibiotic through measurement of
the size of the zone of inhibition. The result depicts a direct relationship between the sizes of
the zone of inhibition to the antibiotic effectivity. Three possible AST results can occur such
as susceptible with wide zone of inhibition, intermediate with medium zone of inhibition and
resistant without zone of inhibition. The latter uses a plastic strip instead with a predefined
gradient of fifteen antibiotic concentrations. It measures an approximate-MIC value. Results
are read directly on the strip where the elliptical zone of inhibition intersects with the strip.
This is good for slow-growing or nutritionally deficient microorganisms and is used on
antimicrobials not used routinely or on a new antimicrobial. Additionally, it can
confirm/detect a specific resistance phenotype and can detect low levels of resistance.
On the other hand, the dilution method is a quantitative type which detects AMR
through minimum inhibitory concentration (MIC) which is the lowest concentration of the
antimicrobial completely inhibiting visible growth of the microbial isolate being tested. It is
also further classified into three tests such as agar dilution test, broth microdilution and broth
macrodilution. The first test gives visible growth of the microbial isolate on agar plates with
a series of antimicrobials. It is the method of choice for a large number of bacterial isolates
as multiple isolates are tested on each plate and it is not good to use if susceptibility to a wide
range of different antimicrobial is to be tested. It uses a replicator, be it 96-teeth manual
applicator with a rod handle or 64-teeth semi-automatic applicator with a knob handle in a
64-well plate. Final concentration of organism is at 1 x 104 CFU/mL. Secondly, broth
microdilution uses various concentrations of antimicrobial in broth of which the range varies
depending on the antimicrobial used. Testing volume is at 0.05-0.1mL. Final concentration
of organism is at 5 x 105 CFU/mL. The disadvantages of this test include test limiting to only
one antimicrobial & one organism to be tested each time and it being time consuming. It uses
20
96-well plates that are manually or commercially prepared. The broth macrodilution uses the
same principle as that of broth microdilution. Testing volume is rather at >1.0 mL. Final
concentration of organism is at 5 x 105 CFU/mL (CLSI, 2012).
2.4 Klebsiella pneumoniae
2.4.1 General characteristics
Klebsiella pneumoniae is a facultative anaerobic Gram negative bacterium (Holt, et
al., 1994), named after Edwin Klebs, a German microbiologist and recognized over a century
ago as a source of community-acquired pneumonia (Younes, A.M., 2011). It is present in the
environment, mucosal surfaces of humans and animals (Macrae, et al., 2001; Brisse, et al.,
2009). It belongs to the family Enterobacteriaceae and under the genus Klebsiella. It appears
gray-brown 3-5mm diameter colonies, non-hemolytic with the characteristic fecal odor on
blood agar (Hogan and Smith, 2003) while on McConkey agar, it appears small to large (1-
7mm) wet, glistening, dome-shaped, pink-yellow mucoid colonies with smooth edges
(Younes, A.M., 2011) and without precipitate in the surrounding agar (Munoz et al., 2006;
Zadoks, et al., 2011).
It is oxidase and methyl red negative and does not produce indole and H2S. It is
catalase, Voges-Proskauer (VP), Simmons citrate and lysine decarboxylase positive. It
produces acid but not gas on Triple Iron Sugar and is negative to arginine dihydrolase and
ornithine decarboxylase. It is not motile and does not hydrolyze urea and gelatin. It ferments
using D-glucose and reduces nitrates (Holt, et al., 1994). Clinical isolates of Klebsiella
pneumoniae are categorized according to the nucleotide variations of the gyrA, parC, and
21
rpoB genes into four phylogenetic groups called KpI, KpII-A, KpIIB, and KpIII (Younes,
A.M., 2011).
Klebsiella spp. populates soils, grains, water, and intestinal tracts of animals (Brisse,
et al., 2009). It is more capable than Escherichia coli at surviving in the mammary gland
from the onset of involution until calving as E. coli intramammary infections will only last
for less than 10 days on the average during lactation while intramammary infections caused
by K. pneumoniae would endure about 21 days on the average. The prevalence of coliform
mastitis in a herd seldom exceeds 5% of lactating quarters because coliform infections tend to
be short duration during lactation. They rarely cause chronic infections of greater than 90
days (Hogan & Smith, 2012). The most common Klebsiella species causing bovine mastitis
is K. pneumoniae. The presence of Klebsiella in used bedding is due to contamination with
bovine feces or with milk from Klebsiella infected cows (Zadoks et al., 2011).
There are three layers composing the cell wall of Klebsiella namely the cytoplasmic
membrane, the peptidoglycan layer and the outer membrane consisting of a complex of
lipopolysaccharide (LPS) forming the O antigen, phospholipid and protein. Additionally, the
LPS has three parts, viz region I, which is the outermost part called O-specific polysaccharide
composed of oligosaccharide repeating units to which the O-antigen is chemically based,
region II, the middle area termed core oligosaccharide which expresses the rough (R) antigen
specificity and region III, the innermost part which is the lipid moiety of the molecule named
lipid A where the hydrophobic reaction is attached to the lipoprotein of the outer cell
membrane of the bacterial cell. Aside from this, Klebsiella is covered by a thick
polysaccharide capsule forming glistening mucoid colonies of viscid consistency (Bergan,
1984) which becomes the basis for serotyping in reference to the 77 known antigenic capsular
or K-antigen strains of which serotypes K1 and K2 are the virulent types due to resistance to
22
serum killing (Pan et al, 2008). Conventional serotyping through slide agglutination for O
antigens and capsular swelling tests for K antigens yielded cross reactivity between serotypes
(Bergan, 1984; Podschun and Ullman, 1998) that is why molecular serotyping has gain its
popularity over the years since polymerase chain reaction is more sensitive and specific.
Further classification of Klebsiella pneumoniae isolates would be the three phylogenetic
groups called KpI which represents more than 80% of Klebsiella pneumoniae human clinical
isolates and has higher antimicrobial resistance rates to the remaining groups KpII and KpIII
(Brisse and Duijkere, 2005).
Due to imprudent use of antibiotics, Klebsiella pneumoniae infections have developed
multi-drug resistance (MDR) otherwise known as multiple antibiotic resistant Klebsiella spp.
(MRKs) due to production of ‘extended-spectrum’ β-lactamases (ESBLs) (Macrae, et al.,
2001) which are enzymes contributing to resistance to penicillins, aztreonam, first generation
cephalosporins and to newer ones like cefotaxime, ceftazidime, cefoxitin and ceftiofur
(Brisse and Duijkeren, 2005). Klebsiella pneumoniae is also the most common Klebsiella
species infecting animals and causing mastitis further imposing a higher economic loss in
terms of milk production and survival (Munoz et al., 2006). It also carries potential public
health implications through the consumption of untreated or inadequately treated milk
(Timofte et al., 2014). However, not much research has still been done on the prevalence of
antimicrobial resistance in animal Klebsiella isolates (Brisse and Duijkeren, 2005).
2.4.2 Pathogenesis
Klebsiella pneumoniae is the most medically important amongst the Klebsiella
species (Younes, A.M., 2011). It is an opportunistic pathogen both shared by humans and
23
animals. It can be spread horizontally through the gastrointestinal tract, personnel hands and
devices and environmental contamination (Parasakthi et al., 2000; Brisse, et al., 2009).
Klebsiella pneumoniae causes bacteraemia, respiratory and urinary tract infection particularly
in immunocompromised patients (Cortes et al., 2002; Brisse, et al., 2009) and community-
acquired pyogenic liver abscess and septic metastatic complications like meningitis and
endophthalmitis (Yeh et al., 2006; Pan et al., 2008; Brisse, et al., 2009). It has the ability to
spread rapidly in the hospital environment causing intense nosocomial outbreaks (Podschun
and Ullman, 1998; Brisse, et al., 2009; Younes, A.M., 2011). In animals, it causes similar
clinical signs to hospital patients and mastitis specifically on bovine (Brisse and van
Duijkere, 2005; Younes, A.M., 2011) and metritis in mares after transmission from an
infected stud especially capsular serotype K1, K2, K5 and K7. It can further cause infection
in dogs, monkeys, guinea pigs, muskrats, birds and fox (Younes, A.M., 2011). Adhesins,
siderophore (Koczura and Kaznowski, 2003), lipopolysaccharide (LPS), and the capsular
polysaccharide (CPS) are factors adding to its virulence (Brisse, et al., 2009; Younes, A.M.,
2011).
2.4.2.1 Capsular antigens
Capsular polysaccharide (CPS) gives the characteristic mucoid appearance of the
colony and is deemed to be one of the primal virulence factors of Klebsiella pneumoniae. It
is composed of four to six sugars such as glucose, galactose, mannose, fucose and rhamnose,
and very often, uronic acids (Podschun and Ullman, 1998; Younes, A.M., 2011). It is
incorporated by the horizontal transfer of the cps operon (Brisse, et al., 2009). Now with 77
serotypes, it is involved in resistance to macrophage phagocytosis and to the complement
system (Cortes et al., 2002; Brisse, et al., 2009) especially C3b and serum resistance due to
24
the bulky bundles of fibrillous structures covering the bacterial surface in extensive layers
(Podschun and Ullman, 1998; Younes, A.M., 2011).
Being the predominantly virulent strains, Klebsiella pneumoniae K1 capsular serotype
isolates cause liver abscess (Younes, A.M., 2011), endophthalmitis and acute pneumonia
(Chuang, et al., 2006; Brisse, et al., 2009). K2, K4 and K5 isolates can also be involved in
the latter aside from causing metritis in mares (Brisse, et al., 2009). They have also started to
develop resistance to neutrophil phagocytosis as opposed to non-K1/K2 isolates such as K3,
K4, K5 and K6 (Struve et al., 2005; Yeh et al., 2006).
2.4.2.2 Adhesins
Adhesins are almost always hemagglutinins that may be located on fimbrae or pili
protruding on the bacterial cell surface. Majority of the Klebsiella pneumoniae isolates have
fimbrae which display either one or both adhesive properties such as “mannose-sensitive
(MS) adhesion”, linked to the common type 1 thick fimbrae (MSHA) and susceptible to
inhibition by D-mannose, and “MR adhesion”, involved with type 3 thinner fimbrae
(mannose-resistant, Klebsiella-like hemagglutination or MR-K/HA) and resistant to mannose
(Bergan, 1984; Podschun and Ullman, 1998 and Yousen, A.M., 2011). In addition, type 3
fimbriae are set by the mrk gene cluster composing the major fimbrial subunit mrkA gene and
the mrkD fimbrial adhesin in charge of the mannose resistant Klebsiella-like
hemagglutination. They are also believed to help in the establishment of extended
extracellular structures known as biofilms which serve as structural anchors and barriers to
contact with host defenses thus protecting against antibiotics (Yousen, A.M., 2011).
25
Other types of Klebsiella adhesins include Type 6 pili (Yousen, A.M., 2011),
nonfimbrial CF29K, aggregative adhesion and KPF-28 fimbriae (Koczura and Kaznowski,
2003). The non-fimbrial R-plasmid-encoded CF29K adhesin is known to mediate adherence
to the human intestinal cells lines Intestine-407 and CaCo-2. Non-fimbrial adhesin consists
of capsule-like extracellular material that mediates adherence pattern described by
aggregative adhesion to intestinal cell lines. Lastly, the fimbrial KPF-28 produces the CAZ-
5/SHV-4 type ESBL (Podschun and Ullman, 1998).
2.4.2.3 Lipopolysaccharide
Three distinguishable sections such as the lipid A, the core polysaccharide and the
side chain O-antigen (O-Ag) polysaccharide comprise the lipopolysaccharide (LPS) molecule
which is with eight serotypes and are associated with resistance to complement-mediated
killing. Particularly, the lipid A attaches the LPS molecule into the outer membrane. It also
serves as an endotoxin which stimulates the immune system through agonism of Toll-like
receptor 4 (TLR4) present on macrophages, dendritic cells and other cell types inducing
nuclear factor kappa-light-chain-enhancer of activated B cells (NF-kB) mediated production
of cytokines. The negatively charged core polysaccharide likewise links the O-Ag onto the
lipid A molecule. Finally, the O-Ag forms a polysaccharide layer covering up to 30 nm into
the surrounding media (Younes, A.M., 2011).
2.4.2.4 Other factors
Siderophores are high-affinity, low-molecular-weight iron chelators that solubilize
and import the required iron bound to host proteins. Phenolates or enterochelin/enterobactin
26
and hydroxamates or aerobactin are the two different groups of siderophores prominent in the
genus Klebsiella. The former is found to be produced by all strains as opposed to the few
that can only produce the latter (Koczura and Kaznowski, 2003; Younes, A.M., 2011).
2.4.3 Typing
Typing is being done to obtain information about endemic and epidemic outbreaks of
Klebsiella infections and to determine the clonality of the strains. The two typing methods
include the phenotypic or molecular typing. Explicitly, phenotypic typing can be done
through biotyping, phage typing, bacteriocin typing or serotyping. On the other hand,
molecular typing methods are used to determine bacterial strains or clones and are further
subdivided to protein based method such as sodium dodecyl sulfate polyacrylamide gel
electrophoresis (SDS-PAGE) which is proven effective by Costas, et al (1990) when
comparable to capsular serotyping or nucleic acid based methods such as PCR amplification
and sequencing, pulsed-field gel electrophoresis (PFGE), randomly amplified polymorphic
DNA (RAPD), restriction fragment length polymorphism (RFLP), multilocus sequence
typing (MLST) and repetitive sequence-based PCR (rep-PCR) (Younes, A.M., 2011).
Additionally, biotyping is based on biochemical reactions and environmental
tolerance with the use of automated instruments such as API 20E systems with macrotube
tests. Unfortunately, identification to the species level is often difficult due to the similarity
of biochemical profiles making it of little use to epidemiological studies and only appropriate
for smaller laboratory setups. Phage typing is based on the receptiveness of bacterial strains
to a group of bacteriophages. It has never been used extensively starting from its
establishment in 1964 because of its poor typing rate due to the lack of standardization and
27
inoculum concentration, the limited availability and stability of bacteriophages needing
maintenance and evaluation from time and again. Supplementary, bacteriocin typing makes
use of protein-based bactericidal substances produced by bacteria to inhibit the growth of
other bacteria of the same species through inhibition of protein and nucleic acid synthesis and
uncoupling of electron transport from active transport of thiomethyl-ß-Dgalactoside and
potassium. Lastly, seroptying is the reaction of the surface-exposed antigen determinant such
as the capsule to a specific antiserum (Younes, A.M., 2011). Although it is the predominant
method in typing Klebsiella species now, it has disadvantages such as the occurrence of large
number of serological cross-reactions among the 77 capsule types, the weak reaction due to a
weak antigen which affects interpretation, the huge amount of time consumed, the scarcity of
commercially available anti-capsule antisera, and the occurrence of non-typable isolates
(Podschun and Ullmann 1998).
Molecular methods were developed to address the numerous concerns regarding
phenotypic typing. PFGE, which may be used for genotyping or genetic fingerprinting, is
considered the gold standard in epidemiological studies of pathogenic organisms as it can
detect chromosomal rearrangements by mobile elements with swift evolutionary rates. To
establish taxonomic identity, evaluate kinship relationships, investigate mixed genome
samples, and generate specific probes, RAPD is the method of choice as it makes use of low-
stringency PCR amplification with single primers of random sequence to produce strain-
specific arrays of anonymous DNA fragments. gyrA PCR-RFLP using restriction enzymes
HincII, TaqI and HaeIII of the 441-bp fragment of the gyrA gene, and the 940-bp fragment of
the RNA polymerase beta subunit gene (rpoB) can be used as well to confirm identified
isolates of Klebsiella pneumoniae. Moreover, MLST is set to describe the genetic
relationships among bacterial isolates and is more appropriate for strain phylogeny and large-
scale epidemiology. Last of all, rep-PCR is a quick method for strain typing and description
28
of bacteria by using primers targeting noncoding repetitive elements interspersed throughout
the bacterial genome (Younes, A.M., 2011).
2.4.4 Antimicrobial resistance
Emergence of nosocomial multidrug-resistant Klebsiella pneumoniae (MRKP) and
ESBL-producing strains have been observed since 1983 followed by the emergence of
resistant strains to third-generation cephalosphorins since 1990 (Parasakthiet al., 2000 and
Younes, A.M., 2011). Extended-spectrum β-lactamases (ESBL) are plasmid-mediated
multiple antimicrobial resistance enzymes that can be spread horizontally to recipient
microorganisms. It can hydrolyze broad-spectrum cephalosporins and monobactams and
cannot be detected on routine antimicrobial susceptibility testing resulting to poor clinical
outcome (Mosqueda-Gomez et al., 2008) although can be hindered by β-lactamase inhibitors
such as clavulanic acid (Younes, A.M., 2011).
Its molecular classification depends on their amino acid homology namely classes A,
B, C and D as proposed by Russell Ambler (Jeong et al., 2004; Younes, A.M., 2011) or on
substrate and inhibitor profile namely groups 1, 2, 3 and 4 as proposed by Bush-Jacoby-
Medeiros as listed on Table 1 (Younes, A.M., 2011).
Table 1. β-lactamase classification schemes.Ambler
classBush-Jacobygroup
Distinctivesubstrates
Inhibited by Representativeenzymes
CA /TZB
EDTA
C 1 Cephalosporins - - AmpC, P99, ACT-1,CMY-2, FOX-1, MIR-1
C 1e Cephalosporins - - GC-1, CMY-37A 2a Pencillins + - PC1A 2b Pencillins,
early+ - TEM-1, TEM-2,
SHV-1
29
cephalosporins
A 2be Extended-spectrumcephalosporins,monobactams
+ - TEM-3, SHV-2, CTX-Ms, PER, VEB
A 2br Penicillins - - TEM-30, SHV-10A 2ber Extended-
spectrumcephalosporins,monobactams
- - TEM-50
A 2c Carbencillin + - PSE-1, CARB-3A 2ce Carbencillin,
cefepime+ - RTG-4
D 2d Cloxacillin V - OXA-1, OXA-10D 2de Extended-
spectrumcephalosporins
V - OXA-11, OXA-15
D 2df Carbapenems V - OXA-23, 0XA-48A 2e Extended-
spectrumcephalosporins
+ - CEPA
A 2f Carbapenems V - KPC-2, IMI-1, SME-1B 3a (B1) Carbapenems - + IMP-1, VIM-1, IND-
1, CcrA(B2) L1, CAU-1, GOB-1,
FEZ-1
B 3b (B3) Carbapenems - + CphA, Sfh-1Unkown 4 -
ESBLs have various types such as those of class A like TEM and SHV types which
are more associated to hospital-acquired infections and have evolved from narrow-spectrum
β-lactamases such as TEM-1, -2 and SHV-1; PER type which denotes resistance to
oxyimino-β-lactams and are mostly restricted to South America and Europe so far (Paterson
et al., 2003), and CTX-M type enzymes identified mainly as ciprofloxacin resistant causing
community-acquired urinary tract infections (Pitout et al., 2005).
30
The TEM family of ESBLs which name came from the patient Temoniera, is the
largest and widely spread. Its plasmid mediated TEM-1 was first discovered in 1965 and is
the most prevalent in enteric bacilli such as Klebsiella pneumoniae and in other Gram-
negative bacteria. It is encoded by a series of gene alleles, blaTEM-1A to blaTEM-1F, differing
from each other by specific silent mutations. Although not as common, TEM-2 being the
first derivative of TEM-1, encoded by blaTEM-2 possesses a stronger promoter than that of the
blaTEM-1 gene giving a higher enzymatic activity as compared to TEM-1 producing strains
(Younes, A.M., 2011).
Moreover, the SHV (sulfhydryl variable) enzymes are categorized in Ambler class A
and in groups 2b and 2be of the Bush-Jacoby-Medeiros classification scheme. Specifically,
SHV-1 was first reported in 1972 and named Pit-2 after its discoverer Pitton. It denotes
resistance to ampicillin, amoxicillin, carbenicillin and ticarcillin and encoded by gene alleles
blaSHV-1 or blaSHV-11 which are prevalent in Klebsiella pneumoniae strains and is behind
approximately 20% of the plasmid-mediated ampicillin resistance in this species. Such genes
are possibly mobilized from genome to plasmid as facilitated by IS26 insertion which was
identified into the blaSHV promoter particularly in plasmid-mediated SHV-2a, SHV-11 and
SHV-12. There are only a few SHV that signify resistance to ß-lactamase inhibitors as
opposed to TEM ß-lactamases (Younes, A.M., 2011). The β-lactamases of ceftazidime-
resistant Klebsiella pneumoniae strains are usually of the SHV-5 type in Europe and TEM-10
and TEM-12 types in the United States (Podschun and Ullman, 1998).
Last of those belonging to class A, the CTX-M type ß-lactamases (active on
cefotaxime) were first discovered in Japan in 1986. They are further subcategorized in 5
subgroups namely CTX-M-1, CTX-M-2, CTXM-8, CTX-M-9 and CTX-M-25. Over time,
they have become more predominant than TEM and SHV type ß-lactamases in Africa,
Europe, South America and Asia mainly due to their mode of acquisition of horizontal gene
31
transfer from other bacteria and to the ability of insertion sequences such as ISEcp1, ISCR,
IS26, IS10 and IS903, phage-related elements and plasmids, to facilitate and induce the
expression of ß-lactamase genes (Pitout et al., 2005 and Younes, A.M., 2011). The genes
responsible for CTX-M ß-lactamases are encoded by plasmids belonging to the narrow host-
range incompatibility types (IncFI, IncFII, IncHI2 and IncI) or the broad host-range
incompatibility types (IncN, IncP1, IncL/M and IncA/C). The CTX-M enzymes depict
higher level resistance to cefotaxime, ceftriaxone and aztreonam than to ceftazidime and are
susceptible to ß-lactamase inhibitors, although a low-level of resistance to the combination of
clavulanic acid with amoxicillin and ticarcillin could be experienced (Younes, A.M., 2011).
Furthermore, class B enzymes termed ‘metallo-ß-lactamases’ were first distinguished
in 1980 again by Russell Ambler. They hydrolyse penicillin, cephalosporins and
carbapenems but not monobactams. They are EDTA-inhibited enzymes and are resistant to ß-
lactamase inhibitors. They are further subdivided on the basis of sequence alignments into
three subclasses B1, B2 and B3. AmpC type enzymes belonging to class C are named
according to the resistance produced, type of enzyme, site of discovery or patient’s name.
These include CMY-1 (cephamycin resistance), MOX-1 (moxalactam resistance), FOX-1
(cefoxitin resistance), LAT-1 (latamoxef resistance), ACT-1 (AmpC type enzyme), MIR-1
(Miriam Hospital, Providence) and ACC-1 (Ambler class C enzyme) (Jeong et al., 2004;
Younes, A.M., 2011). They have emerged due to the ongoing use of 7--methoxy-
cephalosporins (cefoxitin and cefotetan) and ß-lactamase inhibitor combinations (clavulanate,
sulbactam or tazobactam) with amoxicillin, ticarcillin, ampicillin, or piperacillin (Younes,
A.M., 2011) which lead to the resistance to many β-lactam antibiotics like cephamycins,
extended-spectrum cephalosporins (Jeong et al., 2004) and ß-lactamase inhibitor-ß-lactam
combinations. They are usually chromosomal such as FOX-1 and MOX-1 but can also be
plasmid-encoded such as MIR-1, CMY-1 and CMY-2. The continued spread of AmpC
32
enzymes globally may be attributed to the association of mobile elements such as ISEcp1,
ISCR1 or IS26 to the latter. Finally, OXA ß-lactamases belong to Ambler class D (2d) which
attack the oxyimino-cephalosporins and have a high hydrolytic activity in opposition to
oxacillin, methicillin and cloxacillin more than benzylpenicillin. They are inhibited by NaCl
and less efficiently by clavulanalic acid. Contrary to class C, OXA ß-lactamases are typically
plasmids incorporated as gene cassettes in integrons than chromosomal encoded. They are
often not considered as ESBLs as they do not hydrolyze the extended-spectrum
cephalosporins (Younes, A.M., 2011).
As presented on Table 2, nosocomial Klebsiella pneumoniae isolates are resistant to
ampicillin, gentamicin, amikacin, trimethoprim-sulfamethoxazole, cefuroxime, cefotaxime,
ceftriaxone, cefoperazone, and ceftazidime but susceptible to imipenem and ciprofloxacin
(Parasakthi et al., 2000). Studies of Macrae et al (2001) and Mena et al (2006) showed
similar results on human isolates adding resistance to tetracycline but still showed differently
as it was susceptible to imipenem, aztreonam and ciprofloxacin. In bovine milk, their isolates
were resistant to penicillin, cloxacillin, ceftiofur, gentamicin, tetracycline, trimethoprim-
sulfonamide and enrofloxacin. In addition, those isolates of Timofte et al (2014) taken from
bovine milk showed resistance to penicillin G, amoxicillin-clavulanic acid, co-trimoxazole,
neomycin, streptomycin, tylosin, ceftiofur, cefquinome and cefpodoxime and were
susceptible only to framycetin. On the other hand, the animal isolates of Brisse and Duijkere
(2005) showed susceptibility to ceftazidime, ceftiofur, tetracycline, enrofloxacin, gentamicin
and trimethoprim-sulfamethoxazole but were resistant also to ampicillin and cephalexin.
Most of their isolates also showed multi-drug resistance. Moreover, Mosqueda-Gomez et al
(2008) demonstrated that there are higher resistance rates in ESBL-Kp to aminoglycosides,
quinolones, ticarcillin/clavulanate, and piperacillin/tazobactam but susceptible to imipenem.
33
ESBL production can be determined through the use of ESBL E-test screen strips
impregnated with ceftazidime and ceftazidime-clavulanate wherein a positive test denotes
ceftazidime MIC/ceftazidime-clavulanate MIC ratio to be ≥8 (Podschun and Ullman, 1998;
Afifi, 2013). Disc diffusion method using the discs impregnated with the aforementioned
antibiotics can be used as well although double disc synergy method is more widely
employed to detect synergy between cefotaxime and clavulanate exemplified by a clear-cut
extension of the edge of cefotaxime inhibition zone toward the disc containing clavulanic
acid. This is done by placing a disc of amoxicillin-clavulanic acid and a disc of cefotaxime
30 mm apart strategically placed center to center and is considered ESBL positive when there
is decreased susceptibility to cefotaxime combined with synergy between cefotaxime and
amoxicillin-clavulanic acid (Younes, A.M., 2011).
Fig 1. Combination disc method showing synergybetween cefotaxime, ceftazidime and amoxicillin-clavulanate (amoxiclav). The right disc iscefotaxime, the left is ceftazidime. Amoxiclavdisc is in middle.
Fig. 2. Confirmation of ESBLs production bydouble disc diffusion method. The plate showsthat the inhibition zone around cefotaxime-clavulanate (left disc) is more than 5 mm ofcefotaxime (right disc).
33
ESBL production can be determined through the use of ESBL E-test screen strips
impregnated with ceftazidime and ceftazidime-clavulanate wherein a positive test denotes
ceftazidime MIC/ceftazidime-clavulanate MIC ratio to be ≥8 (Podschun and Ullman, 1998;
Afifi, 2013). Disc diffusion method using the discs impregnated with the aforementioned
antibiotics can be used as well although double disc synergy method is more widely
employed to detect synergy between cefotaxime and clavulanate exemplified by a clear-cut
extension of the edge of cefotaxime inhibition zone toward the disc containing clavulanic
acid. This is done by placing a disc of amoxicillin-clavulanic acid and a disc of cefotaxime
30 mm apart strategically placed center to center and is considered ESBL positive when there
is decreased susceptibility to cefotaxime combined with synergy between cefotaxime and
amoxicillin-clavulanic acid (Younes, A.M., 2011).
Fig 1. Combination disc method showing synergybetween cefotaxime, ceftazidime and amoxicillin-clavulanate (amoxiclav). The right disc iscefotaxime, the left is ceftazidime. Amoxiclavdisc is in middle.
Fig. 2. Confirmation of ESBLs production bydouble disc diffusion method. The plate showsthat the inhibition zone around cefotaxime-clavulanate (left disc) is more than 5 mm ofcefotaxime (right disc).
33
ESBL production can be determined through the use of ESBL E-test screen strips
impregnated with ceftazidime and ceftazidime-clavulanate wherein a positive test denotes
ceftazidime MIC/ceftazidime-clavulanate MIC ratio to be ≥8 (Podschun and Ullman, 1998;
Afifi, 2013). Disc diffusion method using the discs impregnated with the aforementioned
antibiotics can be used as well although double disc synergy method is more widely
employed to detect synergy between cefotaxime and clavulanate exemplified by a clear-cut
extension of the edge of cefotaxime inhibition zone toward the disc containing clavulanic
acid. This is done by placing a disc of amoxicillin-clavulanic acid and a disc of cefotaxime
30 mm apart strategically placed center to center and is considered ESBL positive when there
is decreased susceptibility to cefotaxime combined with synergy between cefotaxime and
amoxicillin-clavulanic acid (Younes, A.M., 2011).
Fig 1. Combination disc method showing synergybetween cefotaxime, ceftazidime and amoxicillin-clavulanate (amoxiclav). The right disc iscefotaxime, the left is ceftazidime. Amoxiclavdisc is in middle.
Fig. 2. Confirmation of ESBLs production bydouble disc diffusion method. The plate showsthat the inhibition zone around cefotaxime-clavulanate (left disc) is more than 5 mm ofcefotaxime (right disc).
34
Table 2. List of more recent AMR cases of Klebsiella pneumoniaeCountry Samples AMR Authors
China Cooked meatproducts
tetracycline Jiang and Shi, 2013trimethoprimsulphonamide
Indiahospitalpatients
cephalosporinsParasakthi et al., 2000ampicillin
aminoglycosidestrimethoprimsulfamethoxazole
Australia hospitalpatients
gentamicinJones et al., 2005tobramycin
kanamycinstreptomycinspectinomycin
Mexico
hospitalpatients
aminoglycosides
Mosqueda-Gomez et al(2008)
quinolonesticarcillin/clavulanatepiperacillin/tazobactam
Italyhumansamples;bovine milk
tetracyclineMacrae et al., 2001;Mena et al., 2006
penicillincloxacillincephalosporinsaminoglycosidestrimethoprimsulfamethoxazole
fluoroquinolone
UK bovine milk
penicillin
Timofte et al., 2014amoxicillin-clavulanateco-trimoxazoleneomycinstreptomycintylosincephalosporins
France animalampicillin Brisse and Duijkere,
2005cephalosporins
35
2.4.5 Genetics of Antimicrobial resistance
Horizontal transfer through the mobile gene cassettes enhances the spread of
antimicrobial resistance genes through mobilization of individual cassettes by the integron-
encoded integrase, migration of the cassette in the integron probably by targeted tranposition,
distribution of larger transposons such as Tn21 carrying integrons and relocation of
conjugative plasmids with integrons among different bacterial species (Levesque et al., 1995;
White, et al., 2001). There are four classes of integrons namely classes 1, 2, 3 and 4 which
are differentiated by their respective integrase (int) genes (White, et al., 2001). They possess
two conserved segments that is the 5’ and the 3’, separated by a variable region with
integrated antibiotic resistance genes or cassettes. The 5’ conserved segment contains the int
gene while the 3’ conserved segment contains an open reading frame (ORF) termed orf5 and
the qacE∆1 and sulI which establish resistance to ethidium bromide and quaternary
ammonium compounds and to sulfonamide, respectively (Levesque et al., 1995).
Genes found on the mobile genetic elements such as the bacterial chromosome, plasmids,
transposons or integrons, encode ESBLs enabling the spread of β-lactamases to other
members of the Enterobacteriaceae family and increasing the incidence of multi-drug
resistant bacteria with complex resistance patterns to aminoglycosides, trimethoprim,
sulphonamides, tetracyclines, chloramphenicol and recently, to quinolones specifically
nalidixic acid (Pitout et al., 2005 and Younes, A.M., 2011). The most common ESBL
phenotypes come from point mutations in the blaTEM, blaSHV or blaCTX genes which happen
regularly at position 104 (TEM), 146 (SHV), 156 (SHV), 164 (TEM), 167 (CTX-M), 169
(SHV), 179 (SHV and TEM), 205 (TEM), 237 (TEM), 238 (SHV and TEM) and 240 (TEM,
SHV and CTX-M), leading to changes in the primary amino acid sequence of the enzyme
(Younes, A.M., 2011). blaCTX-Mgenes are usually involved with sul1-type class 1 integrons
36
known to harbor antimicrobial resistance gene casettes resistant to β-lactams,
aminoglycosides, chloramphenicol, sulphonamides and in a lower level, rifampicin.
Specifically, blaCTX-M-14gene is linked with insertion sequence ISEcp1 which is responsible
for mobilization and high-level expression of the β-lactamase gene (Pitout et al., 2005).
Other Klebsiella pneumoniae ESBL genes include blaoxa, blaAMPC (Timofte et al., 2014),
blaPER, blaVER, (Nobrega et al., 2013), blaCMY-1, blaFOX, blaMox, blaMIR, blaACT, blaToho (Lee et
al., 2000) and blaNDM genes which are associated with metallo-β-lactamase 1 (NDM-1)
(Yong et al., 2009 and Giske et al., 2012).
A study by Paterson et al. (2003) identified CTX-M-type ESBL-producing Klebsiella
pneumoniae isolates in Taiwan, Australia, South Africa, Turkey, Belgium and Argentina but
not United States. SHV and TEM type β-lactamases were seen in Australia, South Africa,
Turkey, Argentina and United States but not Taiwan and Belgium. Lastly, PER-1-type β-
lactamases were found in isolates from Turkey alone although previous study denotes its
detection in South America. In milk, Nobrega et al. (2013) noted that earlier studies done by
Hammad et al. (2008) and Locatelli et al. (2009) already detected TEM and SHV enzymes in
ESBL bacteria causing intramammary infections in dairy herds while his study was the first
to report detection of blaCTX-M gene in Klebsiella pneumoniae isolated from bulk tank milk.
It can be then noted that SHV and TEM type β-lactamases are already predominant
worldwide and CTX-M and PER-1 types are increasingly emerging in various countries
(Paterson et al., 2013).
Aminoglycoside resistance genes include aadB gene, which denotes resistance to
gentamicin, tobramycin and kanamycin and aadA1 and aadA2 genes which relate resistance
to streptomycin and spectinomycin (Jones et al., 2005). The Klebsiella pneumoniae isolates
of Jiang and Shi (2013) obtained dfrA6 and dfrA12 and sul1 genes associated with
37
trimethoprim and sulphonamide resistance respectively. The same study also discovered
tetracycline resistance genes such as tetA which is linked with ribosomal protection and/or
efflux pump mechanism, tetB and tetM which are associated with efflux pump mechanism
only (Ng, et al., 2001).
Quinolone resistance genes which are plasmid-mediated include qnr gene, composed
of qnrA, qnrB, qnrS, qnrC and qnrD, which encodes a protein protecting type II
topoisomerase increasing its MICs to nalidixic acid and flouroquinolones by four to eight
times (Nazik et al, 2011; Younes, A.M., 2001; and Ruiz et al, 2012). qnrA and qnrB genes
had been located in complex In4 family class 1 integrons In36 and In37 also known as
complex sul1-type integrons which may serve as a recombinase for mobilization of CTX-M
and ampC (Wang et al., 2004 and Younes, A.M., 2011). They were first reported in 1998
from Klebsiella pneumoniae clinical isolates in the USA (Cattoir, et al., 2007) followed by
Canada, Asia, Australia, Turkey and Europe. On the other hand, qnrS genes were reported to
be connected to Tn3-like blaTEM-1-containing transposon and not like as a gene cassette in a
common class 1 integron. They were found in Shigella flexnri isolates in Japan. Lastly,
qnrC and qnrD genes were discovered in China in isolates of Proteus mirabilis and
Salmonella enterica respectively (Younes, A.M., 2011). Other plasmid-mediated quinolone
resistance genes include aac(6’)-Ib-cr gene which encodes an aminoglycoside
acetyltransferase convening reduced susceptibility to aminoglycosides and ciprofloxacin
(Nazik et al, 2011 and Ruiz et al, 2012) and qepA gene which involves active efflux pumps
namely OqxAB multidrug efflux pump related to reduced fluoroquinolone susceptibility, and
QepA efflux pump pertaining to decreased susceptibility to hydrophilic flouroquinolones
such as norfloxacin and ciprofloxacin (Nazik et al, 2011).
38
2.4.6 Virulence genes
Mucoviscosity-associated gene A (magA) is an important virulence gene present only
in serotype K1 K. pneumoniae. It is associated the hypermucoviscosity phenotype and also
played an important role in resistance to serum and phagocytosis (Chuang, et al., 2006;
Nadasy, et al., 2007). Contrary to previous knowledge as suggested by Fang et al (2004), it
is the capsular serotype K1 and not the magA gene that is responsible for the majority of the
clinical K. pneumoniae liver abscess cases observed by Yeh et al (2006) and Brisse, et al
(2009). Figure 3 shows us the gene clusters found in serotype K1 K. pneumoniae. The
regulator of mucoid phenotype A (rmpA) is plasmid-mediated managing the extracapsular
polysaccharide synthesis (Nadasy, et al., 2007; Brisse, et al., 2009; Giske et al., 2012). It
was first described in 1989 but was only established recently to be involved with the
hypermucoviscosity phenotype and with the invasive clinical syndrome (Nadasy, et al.,
2007).
Fig. 3. Gene cluster for K1 capsular polysaccharide (GenBank accession no. AY762939),indicating genes with known and unknown functions (Yeh et al2006)
39
Other than that, wzy gene family inputs an O-polysaccharide polymerase that
identifies and expands the O-antigen polysaccharide-repeating units. This was also thought
responsible for lipid-linked repeat unit polymerization in the capsular synthesis process of
K57 of whose deletion would lead to diminished mucoviscosity. galF, ORF2 and gnd are
regarded to be associated with carbohydrate metabolism; wzi (orfX), wza , wzb and wzc are
deemed responsible for the translocation and surface assembly of the capsule (Chuang, et al.,
2006; Pan et al., 2008). Other virulence genes include allS which stimulates growth in iron-
deficient media, codes for activator of the allantoin regulon and specific for K1 pyogenic
liver abscess (PLA) (Brisse, et al., 2009), wcaG which synthesizes fucose needed to escape
phagocytosis (Brisse, et al., 2009; Giske et al., 2012), mrkD coding for the type 3 fimbriae
adhesin responsible for the adhesion to the basement membranes of several human tissues
(Brisse, et al., 2009; Younes, A.M., 2011), kfu being the iron uptake marker, cf29a, fimH,
uge, wabG, and ureA (Brisse, et al., 2009).
40
MATERIALS AND METHODS
3.1 Study Area
The Bureau of Agricultural Statistics (BAS) states that in 2009, there are already
about 15,073 dairy cattle and cow fresh milk production amounted to 8.6 million liters
(Villareal, 2009). Presently, the national cow fresh milk production is now at 20.01 million
liters. Specifically last year, South Luzon produced 40.2% valued at Php162.3 million. In
particular, Batangas produced more than half of South Luzon’s milk production. Milk
producers vary from the cooperative farms (63.0%), individual farms (19.3%), commercial
farms (12.1%), and institutional farms (5.6%) (NDA, 2015).
The study shall be carried out in dairy cattle farms in Batangas and the laboratory
work shall be done in the microbiology and molecular biology laboratories of Department of
Paraclinical Science, College of Veterinary Medicine, University of the Philippines Los
Banos from December 2015 to August 2016. The cows will be handled according to RA 8485
“The Animal Welfare Act of 1998” (Appendix 2) and the Animal Welfare Code (2011) Good
Agricultural and Husbandry Practices (GAHP) set by the Bureau of Agriculture and Fisheries
Product Standards (BAFS). The laboratory work shall conform to the standards of the
National Mastitis Council (NMC) and Performance Standards for Antimicrobial
Susceptibility Testing; 22ND Informational Supplement of the Clinical and Laboratory
Standards Institute (CLSI).
The list of dairy cattle farms in Batangas and their respective herd population will be
obtained from the National Dairy Authority. The selected South Luzon dairy zone (Fig. 4)
was selected due to its greatest contribution to the national dairy industry in terms of highest
density of cattle, greatest number of high producing cattle, and highest milk production
(NDA, 2015). The altitude of Batangas ranges from approximately 80 m to 360 m. The
41
average ambient temperature and relative humidity in Batangas are approximately 25 °C and
78 % respectively. The annual average rainfall is 1767 mm being climate type I having only
two seasons such as the dry season from November to April and wet season from May to
September (PAGASA, 2016). Farms and farm associations to be included in the study will
be selected randomly. Individual farms in each included farm association will be selected
randomly (Furgasa, et al., 2010). To be qualified, set inclusion criteria for each farm include
good record-keeping and history of recurrent bovine clinical mastitis cases.
Records of daily milk production and clinical mastitic cases and their respective
treatment for at least a year prior to the start of the study will be examined. Government
standardized milking protocols, post milking teat disinfection, pre-dipping or pre-wiping
factors (Furgasa, et al., 2010; Swinkels, et al., 2013) and mastitic cases monitoring including
mastitis diagnostic tests, treatment and antibiotic sensitivity tests will be inspected if being
practiced in the farm in all cows throughout the lactation (Swinkels, et al., 2013). Moreover,
other factors such as farmers’ education, frequency of personnel and environment cleaning
and disinfection will also be looked into (Gunawardana, et al, 2014). As much as possible,
milking procedures and equipment management will not change during the study period
(Swinkels, et al., 2013).
3.2 Study Animals (Lactating cattle)
Holstein-Friesian crossbred lactating cattle suffering from subclinical and clinical
mastitis in at least one teat will be used in this study and will be chosen randomly. A
combination of concentrates and forage feed will be made available to feed the study animals.
Drinking water will be made available ad libitum. The cows will be managed under either a
small scale or a semi-intensive management system (Furgasa, et al., 2010). Source animals
42
will be pooled in one pen so cleaning and feeding will be organized so as to prevent cross
contamination effectively throughout the course of the study. Pertinent data to be taken for
each cow include age, average milk production (L), lactation number, days in milk, present
lactation total, past milk production average (L), past lactation total, mastitis history, mastitis
therapy, other disease treatment history, dry cow therapy and other relevant clinical data.
These will be recorded onto the respective form or logbook, electronic report or on-farm
software (Swinkel et al, 2013).
3.3 Research design
This study is of a cross-sectional study design that mainly aims in assessing the
prevalence of Klebsiella pneumoniae (Tenhagen, et al., 2006) in bovine milk and
understanding its antimicrobial resistance, genetic characterization and risk factors.
Fig. 4 Philippine map showing Batangas and its various citiesand municipalities
43
3.3 Sample size
The sample size was identified using the OpenEpi version 2.3.1. The total number of
sample units (lactating animals) to be used in this study will be calculated based on 37% cow
prevalence of mastitis (Gunawardana, et al, 2014) with 5% confidence limit and 95%
confidence level. To avoid confounding and to further increase its power, an additional of
20% will be added to have a sample size of 233. Assuming that mortality rate of 4.8% is
expected (McConnel, et al., 2008), an additional of 4.8% will be added to have a final sample
size of 244 (Israel, D.G. 2013).
3.4 Clinical mastitis screening
California mastitis test (CMT) together with physical examination will be done to
screen mastitis and differentiate patients from subclinical to clinical cases (Ruegg, P.L, 2005;
Safi, et al., 2009; Furgasa, et al., 2010; Gunawardana, et al, 2014) (Appendix 3). The
severity of mastitis shall be classified with the following scores as listed on Table 3: Negative
(N), no infections due to no thickening of the mixture which is estimated to be 100,000
somatic cell count (SCC); Trace (T), possible infections due to slight thickening of the
mixture with estimated 300,000 SCC which seems to disappear with continued paddle
rotation. If all quarters sampled read trace, there is no infection but if one or two quarters
read trace, there is possible infection. Other scores include Grade 1 (weak positive), mild
infection with only clots in the milk due to distinct thickening of the mixture but no tendency
of gel formation; Grade 2 (distinct positive), moderate infection indicative of immediate
thickening of the mixture, with a slight gel formation estimated to be 2,700,000 SCC leading
to milk changes also in colour and/or presence of clots, heat, pain and/or swelling of the
44
udder; and Grade 3 (strong positive), severe infection indicative of gel formation and
elevation of surface of mixture with central peak remaining projected even after the rotation
of CMT paddle has stopped further leading to milk changes in colour and/or presence of clots
and systemic signs such as fever, depression, anorexia and very swollen udder (Ruegg, P.L,
2005; Furgasa, et al., 2010; Swinkel et al., 2013).
Table 3. California Mastitis Test (CMT) scores (Ruegg, P.L;, 2005)CMT score Somatic Cell Range Interpretation
N (negative) 0-200,000 Healthy quarterT (trace) 200,000-400,000 Subclinical mastitis
1 400,000-1,200,000 Subclinical mastitis2 1,200,000-5,000,000 Serious mastitis infection3 Over 5,000,000 Serious mastitis infection
3.5 Sample Collection
10 mL milk samples shall be obtained according to the standards of National Mastitis
Council (1999) a day after CMT screening from identified subclinical and clinical mastitic
cows which did not receive any antibiotic treatment at least one week prior to collection in
accordance to the respective milk withdrawal period of each antibiotic being used at the farm
(Furgasa, et al., 2010). Samples shall be collected aseptically and stored in sterile 10 mL
glass tubes with screw cap and kept in ice at approximately 4ºC during transport to the
laboratory. Pertinent data shall be obtained.
3.6 Bacterial isolation and identification
Samples will be cultured and bacteria that had grown will be identified using rapid
laboratory techniques (NMC, 1999). 10µL of milk will be inoculated onto trypticase soy
45
agar plate supplement with 5% defribinated bovine blood (Gillespie, B.E. and Oliver, S.P.,
2005; Furgasa, et al., 2010) and onto McConkey agar (Younes, A.M., 2011) before
incubation at 37ºC overnight. Growing bacteria will be identified by colony morphology and
by using a microtube identification system API Rapid 20 E® (API System, France) which is
a useful first stage in determining Gram negative bacteria (Younes, A.M, 2011). Individual
identified bacterial isolates of Klebsiella pneumoniae will be streaked in nutrient dish agar
before incubation at 37ºC overnight. 3 separate colonies will be chosen, suspended in Luria-
Bertani (LB) broth with 20% glycerol and will be stored in Eppendorf tubes at -80ºC (Paulin-
Curlee, G.G. et al., 2007; Yamane, K, et al., 2008)).
3.7 Molecular serotyping
Serotyping of K1, K2, and K5 will be done through multiplex Polymerase Chain
Reaction (PCR). 3 colonies from each positive sample will be taken to determine the various
serovars. As recommended by EU, one Klebsiella isolate will be collected for each serotype
from each positive sample which then will give the actual number of isolates. DNA
extraction of the Klebsiella isolates will be done through the boiling method (Appendix 4) as
done by Yeh et al (2007) and described by Levesque et al (1995). The PCR reactions will be
composed of 5µL of 2X Reddymix® PCR MasterMix (0.625 units Taq polymerase, 1.5nM
MgCl2 and 0.2mM each of dNTP/reaction), 0.5µL of each primer (10µM), 2.5µL of DNA
template and 4µL of double distilled water. The PCR conditions for K1 (1283 bp), K2 (641
bp) and K5 (280 bp) will be an initial denaturation at 94ºC for 1 minute, and 30 cycles each
of denaturation at 94ºC for 30 seconds, primer annealing at 59ºC for 45 seconds and
46
extension at 72ºC for 1 minute & 30 seconds and one cycle of final extension at 72ºC for 6
minutes (Turton et al., 2008).
Non-K1/K2 isolates will be serotyped by determination of the prevalence of rmpA
(516 bp) through PCR of which conditions will be an initial denaturation at 95ºC for 5
minutes, and 40 initial cycles each of denaturation at 95ºC for 60 seconds, primer annealing
at 50ºC for 60 seconds and extension at 72ºC for 2 minutes and one cycle of final extension at
72ºC for 7 minutes (Yeh et al., 2007). PCR amplification will be performed using a PCR
Swift Maximodl (Esco®, South Yorkshire, UK). PCR amplicons will be separated using
1.5% agarose gel electrophoresis (Major Science, Saratoga, CA, USA) in 1X Tris-
acetate/EDTA (TAE) buffer. Gel staining will be done by soaking in an ethidium bromide
solution (Sigma-Aldrich®) for 10 minutes and destaining in distilled water for 5 minutes.
The gels will be digitally photographed under UV light. The primers used in typing are listed
in Appendix 5.
3.8 Antibiotic susceptibility & ESBL production testing
To determine the minimum inhibitory concentration (MIC), microbroth dilution as the
method of choice (Tenhagen, et al., 2006) (Appendix 6) will be done conforming to the
Performance Standards for Antimicrobial Susceptibility Testing of the Clinical and
Laboratory Standards Institute. Various classes of antibiotics being used in bovine mastitis
(Appendix 7) and in humans such as amoxicillin-clavunalate (AMC), ampicillin (AMP),
ceftiofur (CEF), ciprofloxacin (CIP), cloxacillin (CLX), enrofloxacin (ENR), gentamicin
(GEN), penicillin (PEN), streptomycin (STR), sulfamethoxazole (SUL), tetracycline (TET)
and trimethoprim (TRI) will be used for this study (CLSI, 2012). Reference strain used to
47
serve as quality control will be Klebsiella pneumoniae ATCC 700603 (Mosqueda-Gomez, et
al., 2008), Staphylococcus aureus NCTC 6571, Escherichia coli NCTC 10418 and
Pseudomonas aeruginosa NCTC 10662 (Younes, A.M., 2011).
ESBL production will be done using microbroth dilution compliant to the guidelines
from CLSI (2012). Any isolate with a ceftazidime/ ceftiofur MIC >1µg/mL will be suspected
of having ESBLs thus E-test will be done to ceftazidime alone and in combination with
clavulanic acid (AB Biodisk, Solna, Sweden). A decrease of >3-fold in the MIC value for
ceftazidime in combination with clavulanic acid versus the MIC value for ceftazidime alone
will be considered as confirmation of ESBL production (Mosqueda-Gomez, et al., 2008).
3.9 Characterization of class 1 integron and test for transferability
All isolates will be screened for the presence of the integrase gene, intI1 (254 bp)
using polymerase chain reaction (PCR). The PCR reactions composed of 5µL of 2X
Reddymix® PCR MasterMix (0.625 units Taq polymerase, 1.5nM MgCl2 and 0.2mM each of
dNTP/reaction), 0.5µL of each primer (10µM), 1µL of DNA template and 8µL of double
distilled water. The PCR conditions will be an initial denaturation at 94ºC for 4 minutes, and
10 cycles each of denaturation at 94ºC for 60 seconds, primer annealing at 65ºC for 30
seconds (decreasing 1ºC/cycle) and extension at 70ºC for 2 minutes, 24 cycles of 94ºC for 60
seconds, 55ºC for 30 seconds and 70ºC for 2 minutes, and one cycle of final extension at
70ºC for 5 minutes (Murinda et al., 2005). PCR amplicons will be separated using 1%
agarose gel electrophoresis (Esco®, South Yorkshire, UK) in 1X Tris-acetate/EDTA (TAE)
buffer.
48
Gene cassettes (1000 bp) will be screened on any of the isolates containing int1 gene
using PCR with a specific primer pair 5’CS and 3’CS. The PCR reactions composed of 5µL
of 2X Reddymix® PCR MasterMix (0.625 units Taq polymerase, 1.5nM MgCl2 and 0.2mM
each of dNTP/reaction), 0.5µL of each primer (10µM), 1µL of DNA template and 8µL of
double distilled water. The PCR conditions will be an initial denaturation at 94ºC for 12
minutes, and 35 cycles each of denaturation at 94ºC for 60 seconds, primer annealing at 55ºC
for 60 seconds and extension at 72ºC for 5 minutes with five seconds to be added to the
extension time at each cycle, and one cycle of final extension at 72ºC for 5 minutes
(Levesque et al, 1995). The PCR products will be subjected to purification using Nucleospin
Gel Extension Kit (Nucleospin®, Gutenberg, France) and sent for DNA sequencing to
Macrogen, South Korea. DNA sequences will be compared with the published sequence
using NCBI blast search available at the National Center for Biotechnology Information
website (www.ncbi.nlm.nih.gov). Restriction enzymes such as EcoRI, Alul and Taql will be
used to digest any PCR products with the same size and will be considered identical if they
show the same restriction patterns (Wannaprasat, 2012). The primers used are listed in
Appendix 8.
Conjugation studies as described by Wang et al (2004) (Appendix 9) will be done to
all isolates carrying class 1 integrons with resistance gene casettes which are to be used as
donors and E. coli J53 AzR derivatives to be used as recipients. Transconjugants will be
screened on presence of blaCTX-M, blaSHV,blaTEM through PCR. All PCR products obtained
for this screening will be sent for DNA sequencing on both 5’ and 3’ strands and will be
BLAST compared with those of GenBank (Timofte et al., 2014).
49
3.10 Characterization of quinolone resistance mechanisms
All non-susceptible Klebsiella isolates to ciprofloxacin will be tested for the
presence of three types of PMQR determinants which includes qnr family (qnrA, qnrB,
qnrS), quinolone efflux pump (qepA) and aac(6’)lb-cr using PCR. The PCR reactions
composed of 5µL of 2X Reddymix® PCR MasterMix (0.625 units Taq polymerase, 1.5nM
MgCl2 and 0.2mM each of dNTP/reaction), 0.5µL of each primer (10µM), 1µL of DNA
template and 8µL of double distilled water. The PCR conditions for qnrA (516 bp), qnrB
(469 bp), and qnrS (417 bp) genes will be an initial denaturation at 94ºC for 4 minutes, and
32 cycles each of denaturation at 94ºC for 45 seconds, primer annealing at 53ºC for 45
seconds and extension at 72ºC for 60 seconds and one cycle of final extension at 72ºC for 5
minutes (Stephenson., et al., 2010). On the other hand, the PCR conditions for qepA gene
(617 bp) will be an initial denaturation at 96ºC for 1 minute, and 30 cycles each of
denaturation at 96ºC for 60 seconds, primer annealing at 60ºC for 60 seconds and extension
at 72ºC for 60 seconds and one cycle of final extension at 72ºC for 5 minutes (Yamane, et al.,
2008). Lastly, the PCR conditions for aac(6’)lb-cr gene (482 bp) will be an initial
denaturation at 94ºC for 4 minutes, and 34 cycles each of denaturation at 94ºC for 45
seconds, primer annealing at 55ºC for 45 seconds and extension at 72ºC for 45 seconds and
one cycle of final extension at 72ºC for 5 minutes (Park, et al., 2006). PCR amplicons will be
separated using 1.5% agarose gel electrophoresis (Esco®, South Yorkshire, UK) in 1X Tris-
acetate/EDTA (TAE) buffer. The primers used are listed in Appendix 10.
3.11 Detection and characterization of extended-spectrum β-lactamases (ESBLs) andother non-integron borne antibiotic resistance genes
Only the main groups of ESBL genes like blaCTX-M (variable size), blaPER-1(7-301 bp),
blaAMPC (141-311 bp), blaTEM (799bp) and blaSHV (862bp) will be tested on all of the Klebsiella
50
isolates. Resistance genes for other antibiotics such as gentamicin (aadB – 300bp),
streptomycin (aadA1 – 631 bp and aadA2 – 500 bp), sulfamethoxaole (sul1 – 331 bp),
tetracycline (tetA – 372bp, tetB – 228bp and tetM – 406 bp) and trimethoprim (dfrA6 – 419
bp and dfrA12 – 395bp) will also be investigated. The PCR reactions composed of 6.25µL of
2X Reddymix® PCR MasterMix (0.625 units Taq polymerase, 1.5nM MgCl2 and 0.2mM
each of dNTP/reaction), 0.5µL of each primer (10µM), 2.5µL of DNA template and 2.75µL
of double distilled water. The multiplex PCR conditions for blaTEM and blaSHV will be an initial
denaturation at 94ºC for 5 minutes, and 35 cycles each of denaturation at 94ºC for 30
seconds, primer annealing at 60ºC for 30 seconds and extension at 72ºC for 3 minutes and
one cycle of final extension at 72ºC for 10 minutes (Afifi, 2013). PCR amplicons were
separated using 1.5% agarose gel electrophoresis (Esco®, South Yorkshire, UK) in 1X Tris-
acetate/EDTA (TAE) buffer. The PCR conditions for blaCTX-M will be an initial denaturation at
94ºC for 2 minutes, 35 cycles each of denaturation at 95ºC for 20 seconds, primer annealing
at 51ºC for 30 seconds and extension at 72ºC for 30 seconds and one cycle of final extension
at 72ºC for 3 minutes (Edelstein et al., 2003). PCR amplicons were separated using 1%
agarose gel electrophoresis (Esco®, South Yorkshire, UK) in 1X Tris-acetate/EDTA (TAE)
buffer.
The multiplex PCR conditions for aadB (300bp), aadA1 (631 bp) and aadA2 (500
bp) will be an initial denaturation at 94ºC for 5 minutes, and 30 cycles each of denaturation at
94ºC for 45 seconds, primer annealing at 54ºC for 45 seconds and extension at 72ºC for 60
seconds and one cycle of final extension at 72ºC for 5 minutes (Chuanchuen et al., 2008).
The PCR conditions for dfrA6 (419 bp), dfrA12 (406 bp) and sul1 (331 bp) genes will be an
initial denaturation at 95ºC for 10 minutes, and 30 cycles each of denaturation at 95ºC for 30
seconds, primer annealing at 55ºC for 60 seconds and extension at 72ºC for 60 seconds and
51
one cycle of final extension at 72ºC for 7 minutes. PCR amplicons will be separated using
1% agarose gel electrophoresis (Esco®, South Yorkshire, UK) in 1X Tris-acetate/EDTA
(TAE) buffer (Chen et al., 2004). The PCR conditions for tetA (210 bp) and tetB (659 bp)
will be an initial denaturation at 94ºC for 5 minutes, and 35 cycles each of denaturation at
94ºC for 60 seconds, primer annealing at 55ºC for 60 seconds and extension at 72ºC for 1.5
minutes. PCR amplicons will be separated using 1% agarose gel electrophoresis (Esco®,
South Yorkshire, UK) in 1X Tris-acetate/EDTA (TAE) buffer (Ng et al., 2001). The primers
used in detection of antibiotic resistance genes are listed in Appendix 11.
3.12 Detection and characterization of plasmid-borne virulence genes
PCR will be done to detect the presence of virulence gene rmpA gene (regulator of
mucoid phenotype A). The PCR reactions will be composed of 5µL of 2X Reddymix® PCR
MasterMix (0.625 units Taq polymerase, 1.5nM MgCl2 and 0.2mM each of dNTP/reaction),
0.5µL of each primer (10µM), 2.5µL of DNA template and 4µL of double distilled water.
The PCR conditions for rmpA gene (516 bp) will be the same that of molecular serotyping
with an initial denaturation at 95ºC for 5 minutes, and 40 initial cycles each of denaturation at
95ºC for 60 seconds, primer annealing at 50ºC for 60 seconds and extension at 72ºC for 2
minutes and one cycle of final extension at 72ºC for 7 minutes (Yeh et al., 2007). To detect
magA gene (1283 bp), the PCR conditions will be an initial denaturation at 94ºC for 1
minute, and 30 cycles each of denaturation at 94ºC for 30 seconds, primer annealing at 59ºC
for 45 seconds and extension at 72ºC for 1 minute & 30 seconds and one cycle of final
extension at 72ºC for 6 minutes (Turton et al., 2008). PCR amplicons will be separated using
2% agarose gel electrophoresis (Esco®, South Yorkshire, UK) in 1X Tris-acetate/EDTA
(TAE) buffer. The primers in this study are listed in Appendix 5.
52
3.13 Risk factor analysis
A pretested standardized questionnaire will be used to collect information on each
farm’s clinical history, use of antimicrobials for bovine mastitis, use of disinfectants, farmer
knowledge especially on antimicrobial resistance, farm demographics, and farm-level
management including post milking teat disinfection, pre-dipping or pre-wiping, mastitic
cases monitoring, frequency of personnel cleaning and disinfection factors (Furgasa, et al.,
2010) and environmental factors. Additional records will be gathered on any cases of
misdiagnosis of mastitis by non-veterinary staff including farmer, treatment with indigenous
and/or herbal medicine, delay in seeking veterinary service, treatment without laboratory
diagnosis, non-adherence to set treatment protocol due to economic constraints, unavailability
of recommended drugs, and access to limited laboratory diagnostic facilities and veterinary
services (Gunawardana, et al, 2014).
On a cow level, data will be gathered relating to average milk production (L),
lactation number, days in milk, present lactation total, past milk production average (L), past
lactation total, mastitis history, mastitis therapy, other disease treatment history, dry cow
therapy and other relevant clinical data. All interviews will be conducted in the farmers’
native language (Pilipino). Both the clinical examination and the survey will be conducted
by the same investigator (Gunawardana, et al, 2014). The introductory letter for the survey is
presented in Appendix 12.
Data that will be coming from the questionnaires will be encoded into a Microsoft
Excel worksheet. The prevalence of mastitis will be computed. Association between
antimicrobial resistance and the various factors will be known by calculating Pearson’s chi-
square value, and the degree of association will be calculated via the odds ratio (OR) using
SPSS 12.0 statistical software, SPSS, Inc. (Munich, Germany) for Windows. Logistic
53
regression by means of p<0.05 will be used to identify potential risk factors (Furgasa, et al.,
2010; Afifi, 2013; Gunawardana, et al, 2014). All descriptive and inferential analyses will be
executed using SPSS 12.0 statistical software for Windows (Gunawardana, et al, 2014).
54
RESULTS
Table 1. List of serotypes and virulence genes found in Klebsiella pneumoniae isolates
# Serotype Virulence genesNumber (%)
1 K1 magA 5 (1)2 K23 K54 Non-K1/K2 rmpA
Table 2. Antibiotic resistance genes in Klebsiella pneumoniae isolates
# AntibioticResistance
# (%)Gene
1 StreptomycinaadA1 1 (3)aadA2
2 Sulfamethoxazole sul13 Gentamicin aadB
4 TetracyclinetetAtetB
5 TrimethoprimdfrA6dfrA12
6 β-lactamase
blaTEMblaSHV
blaCTX-M
55
REFERENCES
Afifi, M.M. 2013. Detection of extended spectrum beta-lactamase producing Klebsiellapneumoniae and Escherichia coli of environmental surfaces at upper Egypt. Int J ofBiological Chem. 7(2): 58-68.
Barlow, J., 2011: Mastitis therapy and antimicrobial susceptibility: a multispecies reviewwith a focus on antibiotic treatment of mastitis in dairy cattle. J Mammary Gland BiolNeoplasia,16, 383-407.
Bergan, T., 1984.Methods in Microbiology.Vol 14.Academic Press. London, UK. pp.145-160.
Boucher, Y., Labbate, M., Koenig, J.E. and Stokes, H.W. 2007.Integrons: mobilizableplatforms that promote genetic diversity in bacteria. TRENDS in Microbiol.15(7):301-309.
Brisse, S. and van Duijkeren, E. 2005.Identification and antimicrobial susceptibility of 100Klebsiella animal clinical isolates.Vet Microbiol.105: 307-312.
Brisse, S., Fevre, C., Passet, V., Issenhuth-Jeanjean., S., Tournebize, R., Diancourt, L., andGrimont, P. 2009. Virulent clones of Klebsiella pneumoniae: Identification andevolutionary scenario based on genomic and phenotypic characterization. Plos One.4(3): e4982.
Cattoir, V., Poirel, L., Rotimi, V., Soussy, C-J. And Nordmann, P. 2007. Multiplex PCR fordetection of plasmid-mediated quinolone resistance qnr genes in ESBL-producingenterobacterial isolates. J. of Antimicrob Chemother. 60: 394-397.
Chen, S., Zhao, S., White, D.G., Schroeder, C.M., Lu, R., Yang, H., McDermott, P.F., Ayers,S. and Meng, J. 2004. Characterization of multiple-antimicrobial-resistant Salmonellaserovars isolate from retail meats. Appl Environ Microbiol. 70(1): 1-7.
Chuanchuen, R., Pathanasophon, P., Khemtong, S., Wannaprasat, W. and Padungtod, P.2008. Susceptibilities to antimicrobials and disinfectants in Salmonella isolatesobtained from poultry and swine in Thailand. J Vet Med Sci. 70(6): 595-601.
Chuang, Y.P., Fang, C.T, Lai, S.Y., Chang, S.C. and Wang, J.T. 2006. Genetic determinantsof capsular serotype K1 of Klebsiella pneumoniae causing primary pyogenic liverabscess. J. of Infect Dis. 193: 645-654.
CLSI, 2012. Performance Standards for Antimicrobial Susceptibility Testing: Twenty-secondInformational Supplement. CLSI document, M31-A3, vol. 28 No.8.ClinicalLaboratory Standards Institute, Wayne, PA, USA.
Cortes, G., de Astorza, B., Benedi, V.J. and Alberti, S. 2002. Role of the htrA gene inKlebsiella pneumoniae virulence. Infect. Immun.70(9): 4772-4776.
56
Costas, M., Holmes, B. & Sloss, L. L. (1990). Comparison of SDS-PAGE protein patternswith other typing methods for investigating the epidemiology of 'Klebsiellaaerogenes'. Epidemiol Infect 104: 455-465.
Cremet, L., Caroff, N., Dauvergne, S., Reynaud, A., Lepelletier, D. and Corvec. S. 2011.Prevalence of plasmid-mediated quinolone resistance determinants in ESBLEnterobacteriaceae clinical isolates over a 1-year period in a French hospital.PathologieBiologie. 59: 151-156.
Edelstein, M., Pimkin, M., Palagin, I., Edelstein, I. and Stratchounski, L. 2003. Prevalenceand molecular epidemiology of CTX-M extended-spectrum ß-lactamaseproducing E.coli and K. pneumoniae in Russian hospitals. Antimicrob Agents Chemother 47(12):3724-3732.
Fang, C.T., Chuang, Y.P., Shun, C.T., Chang, S.C. and Wang, J.T. 2004. A novel virulencegene in Klebsiella pneumoniae strains causing primary liver abscess and septicmetastatic complications. J Exp Med. 199: 697-705.
Furgasa, M.B., Abunna, M., Megersa, B., and Regassa, 2010. A. Bovine mastitis: Prevalence,risk factors and major pathogens in dairy farms of Holeta town, Central Ethiopia. VetWorld. 3(9): 397-403
Gillespie, B.E. and Oliver, S.P. 2005. Simultaneous detection of mastitis pathogens,Staphylococcus aureus, Streptococcus uberis, and Streptococcus agalactiae bymultiplex real-time polymerase chain reaction. J Dairy Sci. 88:3510-3518.
Giske, C.G., Froding, I., Hasan, C.M., Turlej-Rogacka, A., Toleman, M., Livermore, D.,Woodford, N. and Walsh, T.R. 2012. Diverse sequence types of Klebsiellapneumoniae contribute to the dissemination of blaNDM-1 in India, Sweden, and theUnited Kingdom. Antimicrob Agents Chemother. 56(5):2735-2738.
Gunawardana, S., Thilakarathne, D., Abegunawardana, I.S., Abeynayake, P., Robertson, C.,and Stephen, C. 2014. Risk factors for bovine mastitis in the central province of SriLanka. Trop Anim Health Prod 46:1005-1112.
Hogan, J. and Smith, KL. 2003. Coliform mastitis. Vet. Res.34: 507–519.
Hogan, J. and Smith, KL. 2012: Managing environmental mastitis. Vet Clin North Am FoodAnim Pract, 28, 217-224.
Holt, J.G., Krieg, N.R., Sneath, P.H.A., Staley, J.T. and Williams, S.T. 1994.Bergey’sManual of Determinative Bacteriology. 9th ed. Lippincott Williams & Wilkins,Baltimore, MA, USA.pp.211.
Israel, D.G., 2013. Determining sample size. IFAS, University of Florida. 1-5.
Janet, E.L., Corry, G.D.W., Curtis and Baird, R.M. 2011. Handbook of culture media forfood and water microbiology. 3rd ed. RSC Publishing, London, U.K.
Jeong, S.H., Bae, I.K., Lee, J.H., Sohn, S.G., Kang, G. H., Jeon, G.J., Kim, Y.H., Jeong, B.C.and Lee, S.H. 2004. Molecular characterization of extended-spectrum beta-lactamases
57
produced by clinical isolates of Klebsiella pneumoniae and Eschericia coli from aKorean nationwide survey. J of Clin Microbiol. 42(7): 2902-2906.
Jiang, X. and Shi, L. 2013. Distribution of tetracycline and trimethoprim/sulfamethoxazoleresistance genes in aerobic bacteria isolated from cooked meat products Guangzhou,China. Food Control. 30:30-34.
Jones, L.A., Mclver, C.J., Kim, M-J., Rawlinson, W.D. and White, P.E. 2005. The aadB genecassette is associated with blaSHV genes in Klebsiella species producing extended-spectrum β-lactamases. Antimicrob Agents Chemother. 49(2): 794-797.
Koczura, R. and Kaznowski, A. 2003.Occurrence of the Yersinia high-pathogenicity islandand iron uptake systems in clinical isolates of Klebsiella pneumoniae. MicrobialPathogenesis.35: 197-202.
Lee, S.H., Kim, J.Y., Lee, S.K., Jin, W., Kang, S.G. and Lee, K.J. 2000. Discriminatorydetection of extended-spectrum β-lactamases by restriction fragment lengthdimorphism-polymerase chain reaction. Letters in Applied Microbiol.31: 307-312.
Levesque, C., Piche, L., Larose, C. and Roy, P.H. 1995. PCR mapping of integrons revealsseveral novel combinations of resistance genes. Antimicrob Agents Chemother.39(1):185-191.
Macrae, MB., Shannon, KP., Rayner, DM., Kaisery, AM., Hoffmanz, PN and French, GL.2001.A simultaneous outbreak on a neonatal unit of two strains of multiply antibioticresistant Klebsiella pneumoniae controllable only by ward closure. J of Hos Inf.49:183±192.
Marchese, A. And Schito, G.C. 2007. Recent results of multinational studies on antibioticresistance: should we have “protection” against these resistances?. MedecineetMaladies Infectieuses, 37(1): 2-5.
McConnel, C.S., Lombard, J.E., Wagner, B.A., and Garry, F.B. 2008. Evaluation of factorsassociated with increased dairy cow mortality on United States dairy operations. J.Dairy Sci. 91:1423–1432.
Mena, A., Plasencia, V., Garci, L., Hidalgo, O., Ayestara, JI., Alberti, S., Borrell, N., Perez,JL., and Oliver, A. 2006. Characterization of a large outbreak by CTX-M-1-producingKlebsiella pneumoniae and mechanisms leading to in vivo carbapenem resistancedevelopment. J. of Clin Microbiol, 44(8): 2831–2837.
Mosqueda-Gomez, J.L., Montano-Loza, A., Rolon, A.L., Cervantes, C., Bobadilla-del-Valle,J.M., Silva-Sanchez, J., Garza-Ramos, U., Villasis-Keever, A., Galindo-Fraga, A.,Ruiz Palacios, G.M., Ponce-de-Leon, A. and Sifuentes-Osornio, J. 2008. Molecularepidemiology and risk factors of bloodstream infections caused by extended-spectrumβ-lactamase producing Klebsiella pneumoniae A case-control study. Int J Infect Dis.12: 653-659.
58
Munoz, MA., Ahlstrom C., Rauch, BJ., and Zadoks, RN. 2006. Fecal Shedding of Klebsiellapneumoniae by Dairy Cows. J. Dairy Sci. 89:3425–3430.
Nadasy, K.A., Domiati-Saad, R. and Tribble, M.A. 2007.Invasive Klebsiella pneumoniaesyndrome in North America.CID.45: 25-28.
National Mastitis Council. 1999. Laboratory Handbook on Bovine Mastitis. National MastitisCouncil Inc., Madison, WI.
Nazik, H., Ongen, B., Mete, B., Aydin, S., Yemisen, M., Kelesoglu, F.M., Ergul, Y., andTabak, F. 2011. Coexistence of blaoxa-48and aac(6’)-Ib-cr genes in Klebsiellapneumoniae isolates from Istanbul, Turkey. The J of Int Med Res.39:1932-1940.
Ng, L.K., Martin, I., Alfa, M. and Mulvey, M. 2001. Multiplex PCR for the detection oftetracycline resistant genes. Mol and Cellular Probes.15: 209-215.
Oliver, S. P. and Murinda, SE. 2012: Antimicrobial resistance of mastitis pathogens. Vet ClinNorth Am Food Anim Pract. 28, 165-185.
Pan, Y-J., Fang, H-C., Yang, H-C., Lin, T-L., Hsieh, P-F., Tsai, F-C., Keynan, Y and Wang,J-T. 2008. Capsular polysaccharide synthesis regions in Klebsiella pneumoniaeserotype K57 and a new capsular serotype. J. Clin. Microbiol. 46(7): 2231-2240.
Parasakthi, N., Vadivelu, J., Ariffin, H., Iyer, L., Palasubramaniam, S. and Arasu, A. 2000.Epidemiology and molecular characterization of nosocomially transmitted multidrug-resistant Klebsiella pneumoniae. Int J Infect Dis.4: 123-128.
Park, C.H., Robicsek, A., Jacoby, G. A. Sahm, D. and Hooper, D.C. 2006. Prevalence in theUnited States of aac(6’)-Ib-cr encoding a ciprofloxacin-modifying enzyme.Antimicrob Agents Chemother. 50(11): 3953-3955.
Paulin-Curlee, G.G., Singer, R.S., Sreevatsan, S., Isaacson, R., Reneau, J., Foster, D., andRey, B. 2007. Genetic diversity of mastitis-associated Klebsiella pneumoniae in dairycows. J. Dairy Sci. 90:3681-3689.
Paterson, D.L., Hujer, K.M., Hujer, A.M., Yeiser, B., Bonomo, M.D., Rise, L.B., Bonomo,R.A. and the International Klebsiella Study Group. 2003. Extended-spectrum β-lactamases in Klebsiella pneumoniae bloodstream isolates from seven countries:dominance and widespread prevalence of SHV- and CTX-M-Type β-lactamases.Antimicrob Agents Chemother. 47(11): 3554-3560.
Paulin-Curlee, G.G., Singer, R.S., Sreevatsan, S., Isaacson, R., Reneau, J., Foster, D., andBey, R. 2007. Genetic diversity of mastitis-associated Klebsiella pneumoniae in dairycows. J. Dairy Sci. 90:3681-3689.
Pitout, J.D.D., Nordmann, P., Laupland, K.B. and Poirel, L. 2005. Emergence ofEnterobacteriaceae producing extended-spectrum β-lactamases (ESBLs) in thecommunity. J of AntimicrobChemother.56: 52-59.
59
Podschun, R. and Ullman, U. 1998. Klebsiella spp. as nosocomial pathogens: epidemiology,taxonomy, typing methods, and pathogenicity factors.Clin.Microbiol. Rev.11(4): 589-603.
Rocha-Gracia, R., Ruiz, E., Romero-Romero, S., Lozano-Zarain, P., Somalo, S., Palacios-Hernandez, J.M., Caballero-Torres, P. And Torres, C. 2010. Detection of the plasmid-borne quinolone resistance determinant qepA1 in a CTX-M-15-producing Escherichiacoli strain from Mexico. J Antimicrob Chemother. 65: 169–177.
Ruegg, P.L., 2005. California mastitis Test (CMT) fact sheet 1. Resources Milk Money. Pp.1-3.
Ruiz, E., Saenz, Y., Zarazaga, M., Rocha-Gracia, R., Martinez-Martinez, L., Arlet, G. andToress, C. 2012. qnr, aac(6’)-Ib-cr and qepA genes in Escherichia coli and Klebsiellaspp.: genetic environments and plasmid and chromosomal action. J ofAntimicrobChemother.67: 886-897.
Safi, S., Khoshvaghti, A., Jafarzadeh, S.R., Bolourchi, M., and Nowrouzian, I. 2009. Acutephase proteins in the diagnosis of bovine subclinical mastitis. Vet Clin Path. 38(4):417-476.
Saishu, N., Ozaki, H. and Murase, T. 2014. CTX-M-type extended-spectrum ß-lactamase-producing Klebsiella pneumoniae isolated from cases of bovine mastitis in Japan. J.Vet. Med. Sci. 76(8): 1153–1156.
Stephenson, S., Brown, P.D., Holness, A., and Wilks, M. 2010.The emergence of Qnr-mediated quinolone resistance among Enterobacteriaceae in Jamaica. West IndianMed J.59(3): 241.
Struve, C., Bojer, M., Nielsen, E.M., Hansen, D.S. and Krogfelt, K.A. 2005. Investigation ofthe putative virulence gene magA in a worldwide collection of 495 Klebsiella isolates:magA is restricted to the gene cluster of Klebsiella pneumoniae capsule serotype K1.J. Med. Microbiol.54: 11111-11113.
Swinkels, J.M., Lam, T.J.G.M., Green, M.J. and Bradley, A.J. 2013.Effect of extendedcefquionome treatment on clinical persistence of recurrence of environmental clinicalmastitis. The Veterinary Journal.197: 682-687.
Synder, L. and Champness W. Molecular genetics of bacteria. 1997. ASM Press,Washington, D.C. USA. pp. 8-9, 105-124, 129-130, 149, 161, 178 and 195.
Tenhagen, B.A., Koster, G., Wallmann, J., and Heuwieser, W. Prevalence of mastitispathogens and their resistance against antimicrobial agents in dairy cows inBrandenburg, Germany. 2006. J. Dairy Sci. 89:2542-2551.
Timofte, D., Maciuca, IE., Evans, NJ., Williams, H., Wattret, A., Fick, JC., and Williams, NJ.2014. Detection and Molecular Characterization of Escherichia coli CTX-M-15 andKlebsiella pneumoniae SHV-12 b-Lactamases from Bovine Mastitis Isolates in theUnited Kingdom. AntimicrobAgents Chemother.58(2):789.
60
Turton, J.F., Baklan, H., Siu, L.K., Kaufmann, M.E. and Pitt, T.L. 2008.Evaluation of amultiplex PCR for detection of serotypes K1, K2 and K5 in Klebsiella sp. andcomparison of isolates within these serotypes. FEMS MicrobiolLett.284: 247-252.
Wannaprasat, W., 2012. Molecular Characteristics of Multi-drug Resistant Salmonellaenterica isolated from humans and pork. (Unpublished Doctoral Dissertation).Chulalongkorn University, Bangkok, Thailand.
Wang, M., Sahm, D.F., Jacoby, G.A. and Hooper, D.C. 2004. Emerging plasmid-mediatedquinolone resistance associated with the qnr gene in Klebsiella pneumoniae clinicalisolates in the United States. Antimicrob Agents Chemother.48(4): 1295-1299.
White, P.A., Mciver, C.J. and Rawlinson, W.D. 2001. Integrons and gene cassettes in theEnterobacteriaceae. Antimicrob Agents Chemother. 45(9): 2658–2661.
Yamane, K., Wachino, J., Suzuki, S. and Arakawa, Y. 2008. Plasmid-mediated qepA geneamong Escherichia coli clinical isolates from Japan. Antimicrob Agents Chemother,52(4): 1564–1566.
Yeh, K-M., Chang, F-Y., Fung, C-P., Lin, J-C and Siu, L.K. 2006.magA is not a specificvirulence gene for Klebsiella pneumoniae strains causing liver abscess but is part ofthe capsular polysaccharide gene cluster of K. pneumoniae serotype K1. J of MedicalMicrobiol.55: 803-804.
Yeh, K-M., Kurup, A., Siu, L.K., Koh, Y.L, Fung, C-P., Lin, J-C., Chen, T-L., Chang, F-Y.and Koh, T-H. 2007. Capsular serotype K1 or K2, rather than magA and rmpA, is amajor virulence determinant for Klebsiella pneumoniae liver abscess in Singapore andTaiwan. J of Medical Microbiol.45(2): 466-471.
Yong, D., Toleman, M.A., Giske, C.G., Cho, H.S., Sundman, K., Lee, K. and Walsh, T.R.2009.Characterization of a New Metallo-β-Lactamase Gene, blaNDM-1, and a NovelErythromycin Esterase Gene Carried on a Unique Genetic Structure in Klebsiellapneumoniae Sequence Type 14 from India. Antimicrob Agents Chemother.53(12):5046-5054.
Younes, A.M., 2010. Molecular diversity and genetic organization of antibiotic resistance inKlebsiella species. (Unpublished Doctoral Dissertation). The University of Edinburgh,Edinburgh, Scotland.
Zadoks , RN., Griffiths , HM., Munoz , MA., Ahlstrom , C., Bennett ,GJ., Thomas , E., andSchukken, YH. 2011. Sources of Klebsiella and Raoultella species on dairy farms: Becareful where you walk. J. Dairy Sci. 94:1045–1051.
Zadoks, RN., Middleton, JR., McDougall, S., Katholm, J., and Schukken, YH. 2011:Molecular epidemiology of mastitis pathogens of dairy cattle and comparativerelevance to humans. J Mammary Gland Biol Neoplasia,16, 357-372.
Zhao, X. and Lacasse, P. 2008: Mammary tissue damage during bovine mastitis: causes andcontrol. J Anim Sci,86, 57-65.
61
APPENDIX 1
List of antimicrobial class and their respective animal licensed drugs.
# Antibiotic classType ofActivity License drugs Target
1 Aminoglycosides Bactericidal
Gentamicin
30S ribosomal subunit
AmikacinStreptomycinKanamycinNeomycinApramycin
2 Aminocyclitols Bactericidal Spectinomycin 30S ribosomal subunit
3 Cephalosporins Bactericidal
Cefalexin
Transpeptidase
CefazolinCeftiofurCefoperazone
4 Diaminopyrimidines Bacteriostatic Trimethoprim Dihydrofolate reductase
5 Lincosamides BacteriostaticLincomycin
50S ribosomal subunitClindamycin
6 Macrolides Bacteriostatic
Erythromycin
50S ribosomal subunit
TylosinTilmicosinSpiramycin
7 Nitrofurans Bactericidal Furazolidone DNA8 Nitroimidazoles Bactericidal Metronidazole DNA
9 Penicillins Bactericidal
Penicillin G
Transpeptidase
Penicillin VAmpicillinAmoxicillin
10 Phenicols Bacteriostatic
Chloramphenicol
Peptidyl transferaseFlorfenicolThiamphenicol
11 Pleuromutilins Bacteriostatic Tiamulin Peptidyl transferase
12 Polypeptides Bactericidal
Bacitracin IsoprenylphosphatePolymixin B
Membrane phospholipidsColistin
13 Quinolones Bactericidal
Oxolinic acid
DNA gyrase
FlumequineEnrofloxacinDanofloxacinDifloxacinSarafloxacin
62
14 Quinoxalines Bactericidal Carbadox DNA15 Rifamycins Bactericidal Rifampin RNA polymerase16 Streptogramins Bacteriostatic Virginiamycin 50S ribosomal subunit17 Sulfonamides Bacteriostatic Trimethoprim Pteroate synthetase
18 Tetracyclines Bacteriostatic
Oxytetracycline
30S ribosomal subunit
ChlortetracyclineTetracyclineDoxycycline
63
APPENDIX 2
REPUBLIC ACT NO. 8485
AN ACT TO PROMOTE ANIMAL WELFARE INTHE PHILIPPINES, OTHERWISE KNOWN AS
"THE ANIMAL WELFARE ACT OF 1998".Section 1. It is the purpose of this Act to protect and promote thewelfare of all animals in the Philippines by supervising and regulatingthe establishment and operations of all facilities utilized for breeding,maintaining, keeping, treating or training of all animals either asobjects of trade or as household pets. For purposes of this Act, petanimal shall include birds.
Sec. 2. No person, association, partnership, corporation, cooperative orany government agency or instrumentality including slaughter housesshall establish, maintain and operate any pet shop, kennel, veterinaryclinic, veterinary hospital, stockyard, corral, stud farm or stock farm orzoo for the breeding, treatment, sale or trading, or training of animalswithout first securing from the Bureau of Animal Industry a certificateof registration therefor.
The certificate shall be issued upon proof that the facilities of suchestablishment for animals are adequate, clean and sanitary and will notbe used for, nor cause pain and/or suffering to the animals. Thecertificate shall be valid for a period of one (1) year unless earliercancelled for just cause before the expiration of its term by theDirector of the Bureau of Animal Industry and may be renewed fromyear to year upon compliance with the conditions imposed hereunder.The Bureau shall charge reasonable fees for the issuance or renewal ofsuch certificate.
The condition that such facilities be adequate, clean and sanitary, andthat they will not be used for nor cause pain and/or suffering to theanimals is a continuing requirement for the operation of theseestablishments. The Bureau may revoke or cancel such certificate ofregistration for failure to observe these conditions and other justcauses.
Sec. 3. The Director of the Bureau of Animal Industry shall superviseand regulate the establishment, operation and maintenance of petshops, kennels, veterinary clinics, veterinary hospitals, stockyards,
64
corrals, stud farms and zoos and any other form or structure for theconfinement of animals where they are bred, treated, maintained, orkept either for sale or trade or for training as well as the transport ofsuch animals in any form of public or private transportation facility inorder to provide maximum comfort while in transit and minimize, ifnot totally eradicate, incidence of sickness and death and prevent anycruelty from being inflicted upon the animals.The Director may call upon any government agency for assistanceconsistent with its powers, duties, and responsibilities for the purposeof ensuring the effective and efficient implementation of this Act andthe rules and regulations promulgated thereunder.
It shall be the duty of such government agency to assist said Directorwhen called upon for assistance using any available fund in its budgetfor the purpose.
Sec. 4. It shall be the duty of any owner or operator of any land, air orwater public utility transporting pet, wildlife and all other animals toprovide in all cases adequate, clean and sanitary facilities for the safeconveyance and delivery thereof to their consignee at the place ofconsignment. They shall provide sufficient food and water for suchanimals while in transit for more than twelve (12) hours or whenevernecessary.No public utility shall transport any such animal without a writtenpermit from the Director of the Bureau of Animal Industry or his/herauthorized representative. No cruel confinement or restraint shall bemade on such animals while being transported.
Any form of cruelty shall be penalized even if the transporter hasobtained a permit from the Bureau of Animal Industry. Cruelty intransporting includes overcrowding, placing of animals in the trunks orunder the hood trunks of the vehicles.
Sec. 5. There is hereby created a Committee on Animal Welfareattached to the Department of Agriculture which shall, subject to theapproval of the Secretary of the Department of Agriculture, issue thenecessary rules and regulations for the strict implementation of theprovisions of this Act, including the setting of safety and sanitarystandards, within thirty (30) calendar days following its approval. Suchguidelines shall be reviewed by the Committee every three (3) yearsfrom its implementation or whenever necessary.The Committee shall be composed of the official representatives of thefollowing:cralaw
(1) The Department of Interior and Local Government (DILG);(2) Department of Education, Culture and Sports (DECS);
65
(3) Bureau of Animal Industry (BAI) of the Department of Agriculture(DA);(4) Protected Areas and Wildlife Bureau (PAWB) of the Department ofEnvironment and Natural Resources (DENR);(5) National Meat Inspection Commission (NMIC) of the DA;(6) Agriculture Training Institute (ATI) of the DA;(7) Philippine Veterinary Medical Association (PVMA);(8) Veterinary Practitioners Association of the Philippines (VPAP);(9) Philippine Animal Hospital Association of the Philippines (PAHA);(10) Philippine Animal Welfare Society (PAWS);(11) Philippine Society for the Prevention of Cruelty to Animals(PSPCA);(12) Philippine Society of Swine Practitioners (PSSP);(13) Philippine College of Canine Practitioners (PCCP); and(14) Philippine Society of Animal Science (PSAS).The Committee shall be chaired by a representative coming from theprivate sector and shall have two (2) vice-chairpersons composed of therepresentative of the BAI and another from the private sector.
The Committee shall meet quarterly or as often as the need arises. TheCommittee members shall not receive any compensation but mayreceive reasonable honoraria from time to time.
Sec. 6. It shall be unlawful for any person to torture any animal, toneglect to provide adequate care, sustenance or shelter, or maltreatany animal or to subject any dog or horse to dogfights or horsefights,kill or cause or procure to be tortured or deprived of adequate care,sustenance or shelter, or maltreat or use the same in research orexperiments not expressly authorized by the Committee on AnimalWelfare.
The killing of any animal other than cattle pigs, goats, sheep, poultry,rabbits, carabaos, horses, deer and crocodiles is likewise herebydeclared unlawful except in the following instances: cralaw
(1) When it is done as part of the religious rituals of an establishedreligion or sect or a ritual required by tribal or ethnic custom ofindigenous cultural communities; however, leaders shall keep recordsin cooperation with the Committee on Animal Welfare;
(2) When the pet animal is afflicted with an incurable communicabledisease as determined and certified by a duly licensed veterinarian;
(3) When the killing is deemed necessary to put an end to the miserysuffered by the animal as determined and certified by a duly licensedveterinarian;
66
(4) When it is done to prevent an imminent danger to the life or limb ofa human being;
(5) When done for the purpose of animal population control;
(6) When the animal is killed after it has been used in authorizedresearch or experiments; and
(7) Any other ground analogous to the foregoing as determined andcertified licensed veterinarian.In all the above mentioned cases, including those of cattle, pigs, goats,sheep, poultry, rabbits, carabaos, horses, deer and crocodiles the killingof the animals shall be done through humane procedures at all times.
For this purpose, humane procedures shall mean the use of the mostscientific methods available as may be determined and approved by thecommittee.
Only those procedures approved by the Committee shall be used in thekilling of animals.
Sec. 7. It shall be the duty of every person to protect the naturalhabitat of the wildlife. The destruction of said habitat shall beconsidered as a form of cruelty to animals and its preservation is a wayof protecting the animals.
Sec. 8. Any person who violates any of the provisions of this Act shall,upon conviction by final judgment, be punished by imprisonment ofnot less than six (6) months nor more than two (2) years or a fine of notless than One thousand pesos (P1,000.00) nor more than Five thousandpesos (P5,000.00) or both at the discretion of the Court. If the violationis committed by a juridical person, the officer responsible therefor shallserve the imprisonment when imposed. If the violation is committed byan alien, he or she shall be immediately deported after service ofsentence without any further proceedings.
Sec. 9. All laws, acts, decrees, executive orders, rules and regulationsinconsistent with the provisions of this Act are hereby repealed ormodified accordingly.
Sec. 10. This Act shall take effect fifteen (15) days after its publicationin at least two (2) newspapers of general circulation.
Approved: February 11, 1998
67
APPENDIX 3
California Mastitis Test (CMT) protocolNOTE: The CMT paddle has 4 shallow cups marked A-D depicting the individual quarterfrom which the milk will be obtained.Step Activities
1 Take ~2cc milk from each quarter.2 Add same amount of reconstituted CMT solution to each cup in the paddle
3Rotate the CMT paddle in circular motion to thoroughly mix the contents.Do not mix longer than 10 seconds.
4Read the test quickly. The reaction is scored visually.Visible reactions disintegrate in 20 seconds.
68
APPENDIX 4
Table 4. DNA extraction through boiling method (Chuang, et al., 2006).Step Activities
1Subculture isolates to LB (Luria-Bertani) agar.Incubate at 37ºC for 24 hrs.
2
Pick 1 colony.Mix in 60µL distilled water in a 1.5mL Eppendorf tube.Vortex.
3Boil for 10 minutes starting when steam appears.Put on ice immediately.
4
Centrifuge at 12,000 rpm for 5 minutes.Transfer supernatant in new Eppendorf tubes.Discard precipitate.
5 Keep whole DNA in freezer -20ºC.
69
APPENDIX 5
List of primers used in this study for detection of serotypes and virulence genes
# GeneSize(bp) Serotype Primers Sequence (5'-3') Reference
1magA 1283 K1
magAF1 GGTGCTCTTTACATCATTGC Turton et al.,20082 magAR1 GCAATGGCCATTTGCGTTAG
3wzy 641 K2
wzy-F1 GACCCGATATTCATACTTGACAGAG Turton et al.,20084 wzy-R1 CCTGAAGTAAAATCGTAAATAGATGGC
5K5wzx 280 K5
K5wzxF360 TGGTAGTGATGCTCGCGA Turton et al.,20086 K5wzxR639 CCTGAACCCACCCCAATC
7rmpA 516
Non-K1/K2
rmpAF ACTGGGCTACCTCTGCTTCA Yeh, et al.,20078 rmpAR CTTGCATGAGCCATCTTTCA
70
APPENDIX 6
Minimum inhibitory concentration using 2-fold microbroth dilution.Day Activities
1
Subculture isolates + reference strains then incubate 37C overnight.Prepare 10mL DW tubes per antibiotic. Label.Prepare 2mL & 9mL 0.9% NSS tubes for the bacterial inoculum. Label.Prepare 5mL Cation adjusted Mueller-Hinton broth (CAMB) per isolate & reference strainAutoclave 20-200μl pipette tips.
2
Label the microtitre plates 128 to 0 (control) antibiotic dilutions horizontally &isolate # or reference strain vertically.Prepare antibiotic stock solution (concentration: 50mg/mL).Pour CAMHB on plate.Pipette 50µL CAMHB to wells except the first column (labelled 128).Pipette 512µL out of 10mL DW and pipette 512µL antibiotic to ~9.5mL DW .Pour antibiotic on plate.Pipette 50µL antibiotic to 128 & 64 labelled wells and mix by pipetting.Serially dilute by pipetting 50µL antibiotic & mixing from 64 labelled well to the next except thecontrol well.Inoculate isolate in 2mL 0.9% NSS to 0.5 McFarland turbidity. Compare to standard. Label.Pipette 1mL of 0.5 McFarland bacterial solution to 9mL 0.9% NSS tube then vortex. RepeatPour 1:100 diluted 10mL inoculum on plate.Pipette 50µL inoculum from control well to 128 labelled well.Seal the plate with a parafilm and store in a sealed contained with wet tissue up to 4 stacks only.Incubate plates at 37C for 16-18 hrs.
3Read MIC results and plot on MIC table.Compare MIC results of reference strains to standard.
71
APPENDIX 7
List of antimicrobials generally used on farms to treat mastitis.
# Antibiotic Route of AdministrationMilkWithdrawal
1 Cloxacillin Intramammary 72 hours2 Penicillin streptomycin Intramuscular 7 days3 Ceftiofur hydrochloride Intramammary 72 hours4 Ceftiofur hydrochloride Intramuscular NIL
72
APPENDIX 8
List of primers used in this study for detection of integrons and gene casettes
# GeneSize(bp) Primers Sequence (5'-3') Reference
1intI1 254
intIF CCTTCGAATGCTGTAACCGCMurinda et al., 20052 intIR ACGCCCTTGAGCGGAAGTATC
3 Gene1000
5'CS GGCATCCAAGCAGCAAGLevesque et al., 19954 casette 3'CS AAGCAGACTTGACCTGA
73
APPENDIX 9
Conjugation study protocol
Day Activities
1Inoculate K. pneumoniae isolate/s &E.coli J53AzR strain onto LB broth w/o antibiotic.Incubate at 37ºC for 3-4 hrs (bacteria in log phase).
2
Pipette 0.5mL from each culture of LB broth tube & inoculate into 1 tube of 4ml fresh warm LBbroth.Incubate without shaking at 37ºC for 24 hrs.Pour Trypticase soy agar w/ sodium azide (100µg/mL) &sulfamethoxazole (300µg/mL) to glass plate for day 3.Keep on refrigerator.
3
Dry plates.Streak isolates onto TSA w/ sodium azide (100µg/mL) &sulfamethoxazole (300µg/mL).Prepare TSA plates w/ & w/o ciprofloxacin (0.06µg/ml) for day 4.Do not let the antibiotic dry on plate before pouring TS agar.Do not let LB agar dry on plate before putting antibiotics.
4Pick multiple colonies from plates & streak on to TSA plates w/ & w/o ciprofloxacin (0.06µg/ml).Incubate at 37ºC for 24 hrs.
5
Dry TSA plates. Colonies on TSA plates with ciprofloxacin should be E.coli .Select 1 colony and inoculate into 60µl DW in 1.5ml Eppendorf tube.Vortex to resuspend bacteria.Boil for 10 minutes in water suspension.Chill tubes immediately.Centrifuge at 12,000 rpm for 5 minutes.Pipet off supernatant to sterile 1.5ml tube for storage (Discard tubes and pellets).Screen for Int1 gene.Run Int1 PCR program.Visualize product on 1.5% agarose gel (run at 90mA for 50 minutes).Stain ethidium bromide for 10 minutes &destain with distilled water for 5 minutes.
74
APPENDIX 10
List of primers used in this study for detection of quinolone resistance genes
# GeneSize(bp) Primers Sequence (5'-3') Reference
1qnrA 516
qnrAF ATTTCTCACGCCAGGATTTGStephenson et al., 20102 qnrAR GATCGGCAAAGGTTAGGTCA
3qnrB 469
qnrBF GATCGTGAAAGCCAGAAAGGStephenson et al., 20104 qnrBR ACGATGCCTGGTAGTTGTCC
5qnrS 417
qnrSF ACGACATTCGTCAACTGCAAStephenson et al., 20106 qnrSR TAAATTGGCACCCTGTAGGC
7qepA 617
qepA-F GCAGGTCCAGCAGCGGGTAG Yamane et al., 20088 qepA-R GGACATCTACGGCTTCTTCG Rocha-Gracia, et al., 20109
aac(6’)lb-cr 482aac(6’)lb-cr -F TTGCGATGCTCTATGAGTGGCTA
Park et al., 200610 aac(6’)lb-cr -R CTCGAATGCCTGGCGTGTTT
75
APPENDIX 11
List of primers used in this study for detection of antibiotic resistance genes# Gene Size (bp) Primers Sequence (5'-3') Reference1
blaSHV 1704SHV-F GCCGGGTTATTCTTATTTGTCGC
Afifi, 20132 SHV-R ATGCCGCCGCCAGTCA3
blaTEM 1016TEM-F TCGGGGAAATGTGCG
Afifi, 20134 TEM-R TGCTTAATCAGTGAGGCACC5
blaCTX-M 544CTX-M-F TTTGCGATGTGCAGTACCAGTA
Edelstein et al., 20036 CTX-M-R CGATATCGTTGGTGGTGCCATA7
aadA1 631aadA1F CTCCGCAGTGGATGGCGG
Chuanchuen et al., 20088 aadA1R GATCTGCGCGCGAGGCCA9
aadA2 500aadA2F CATTGAGCGCCATCTGGAAT
Chuanchuen et al., 200810 aadA2R ACATTTCGCTCATCGCCGGC11
aadB 300aadBF CTAGCTGCGGCAGATGAGC
Chuanchuen et al., 200812 aadBR CTCAGCCGCCTCTGGGCA13
dfrA6 419dfrA6F AGCAAAAGGTGAGCAGTTAC
Chen et al., 200414 dfrA6R GTGCTGGAACGACTTGTTAG15
dfrA12 406dfrA12F GCCGTGGGTCGATGTTTGAT
Chen et al., 200416 dfrA12R TTCACCACCACCAGACACA17
sul1 331sul1F TCACCGAGGACTCCTTCTTC
Chen et al., 200418 sul1R CAGTCCGCCTCAGCAATATC19
tetA 210tetAF GCTACATCCTGCTTGCCTTC
Ng et al., 200120 tetAR CATAGATCGCCGTGAAGAGG21
tetB 659tetBF TTGGTTAGGGGCAAGTTTTG
Ng et al., 200122 tetBR GTAATGGGCCAATAACACCG
76
APPENDIX 12
Dear _________________,
Ako si __________________________________, isang estudyante ng Unibersidad ng Pilipinas,
Kolehiyo ng Medisinang Pambeterinaryo. Ako ay nagsasagawa ng pagsisiyasat patungkol sa Gatas
ng mga Inahing Baka sa lalawigan ng Batangas. Lubos kong pahahalagahan ang iyongpakikilahok
sa pamamagitan ng pagsagot ng lahat ng mga katanungan.
Ang pakikilahok sa pagsisiyasat na ito ay iyong pagkusang loob. Gayunpaman, ang iyong pananaw ay
mahalaga at umaasa ako na ikaw ay sumali. Ang impormasyon na makukuha ay itinuturinglihim at
posibleng maging batayan ng mahalagang pagpapasya at pagsasagawa ng rekomendasyon upang
mapabuti ang kalusugan ng mga hayop at tao sa komunidad. Walang mali o tamang sagot sa mga
tanong na ito.
77
TIME TABLE
EXPECTED
ACTIVITIES
PERIOD TO BE COVERED2015-2016
OUTPUT
4th Q 2015 1st Q 2016 2nd Q 2016Sept-Oct
Nov-Dec
Jan-Feb
Mar-Apr
May-June
July-Aug
A. Drafting&presentation of 1. Visitation ofstudy proposal laboratory &source farm
2. Literature reviewB. Documentation & 1. Recording of dataExperimentation 2. Editing and
summarization of resultsC. Data analyses Statistical
computation & analysesD. Manuscript 1. Drafting ofPreparation experimentation results
2. Submission ofmanuscript draft
E. Defense of Presentation andresearch paper ReviewF. Final revision Finalization ofof research paper research paperG. Submissionof research paperfor publication
78
BUDGET
ITEM PROJECTED COST
Unit ofMeasure
UnitPrice Qty Amount
I. DRAFTING OF STUDY PROPOSAL
Survey of laboratory & source farms(Batangas)
Transportation 100 10 1000.00
Food 150 10 1500.00
Securing of necessary permits
Transportation 1500 1 1,500.00
Food 1000 1 1,000.00
Consultations with industry practitioners
Transportation 1500 1 1,500.00
Food 1000 1 1,000.00
SUBTOTAL 7,500.00
II. PRESENTATION OF STUDYPROPOSAL
Proposal Defense
Printing 500 500.00
Food 2000 2,000.00
Revision of Proposal
English Critic 750 750.00
Proof reader 750 750.00
79
SUBTOTAL 4,000.00
III. MATERIALS NEEDED
Facilities
Rental 5000 5,000.00
Consumables
Supplies for sample collection 50000 150,000.00
Reagents for molecular experiments 100000 250,000.00
Culture media, biochemical tests 100000 171,500.00
Antimicrobial agents 50000 150,000.00
Others 10000 50,000.00
Services
Postal services 1000 1,000.00
Sequencing 20000 80,000.00
Standby antibiotic medication per syringe 75 50 3,750.00
SUBTOTAL 861,250.00
IV. DATA GATHERING
Food 1000 1 1,000.00
Transportation 2,500 1 2, 500.00
SUBTOTAL 3,500.00
V. DATA ANALYSES
Statisticians fee 15000 15,000.00
SUBTOTAL 15,000.00
VI. WRITING OF THE MANUSCRIPT
Printing 750 750.00
Food 500 500.00
80
English Critic 750 750.00
Proof reader 750 750.00
SUBTOTAL 2,750.00
VII. DEFENSE PRESENTATION OFRESEARCH PAPER
Printing 750 750.00
Food 2000 2,000.00
SUBTOTAL 2,750.00
VIII. REVISION OF THE RESEARCHPAPER
Printing 750 750.00
Food 500 500.00
SUBTOTAL 1,250.00
IX. SUBMISSION OF RESEARCH PAPER
FOR PUBLICATION
Printing 1000 1,000.00
SUBTOTAL 1,000.00
X. MISCELLANEOUS
Printing 1000 1,000.00
SUBTOTAL 1,000.00
GRAND TOTAL 900,000.00
Funding:
The researcher will be applying for research grants by the United States Department ofAgriculture.