This content has been downloaded from IOPscience. Please scroll down to see the full text.

Download details:

IP Address: 158.130.107.105

This content was downloaded on 15/05/2016 at 17:31

Please note that terms and conditions apply.

Three-dimensional bioprinting of embryonic stem cells directs highly uniform embryoid body

formation

View the table of contents for this issue, or go to the journal homepage for more

2015 Biofabrication 7 044101

(http://iopscience.iop.org/1758-5090/7/4/044101)

Home Search Collections Journals About Contact us My IOPscience

Biofabrication 7 (2015) 044101 doi:10.1088/1758-5090/7/4/044101

PAPER

Three-dimensional bioprinting of embryonic stem cells directs highlyuniform embryoid body formation

LiliangOuyang1,2,6, Rui Yao1,2,6, ShuangshuangMao1,2, Xi Chen3, JieNa3 andWei Sun1,2,4,5

1 Biomanufacturing Center, Department ofMechanical Engineering, TsinghuaUniversity, Beijing 100084, People’s Republic of China2 Biomanufacturing andRapid Forming TechnologyKey Laboratory of Beijing, Beijing 100084, People’s Republic of China3 Center for StemCell Biology andRegenerativeMedicine, School ofMedicine, TsinghuaUniversity, Beijing 100084, People’s Republic of

China4 Biomanufacturing Engineering Research Laboratory, Graduate School at Shenzhen, TsinghuaUniversity, Shenzhen 518055, People’s

Republic of China5 Department ofMechanical Engineering, DrexelUniversity, Philadelphia, Pennsylvania 19104,USA6 These authors contributed to this work equally

E-mail: weisun@tsinghua.edu.cn and sunwei@drexel.edu

Keywords: embryonic stem cell, 3D bioprinting, embryoid body formation

Supplementarymaterial for this article is available online

AbstractWith the ability tomanipulate cells temporarily and spatially into three-dimensional (3D) tissue-likeconstruct, 3Dbioprinting technologywas used inmany studies to facilitate the recreation of complexcell niche and/or to better understand the regulation of stem cell proliferation and differentiation bycellularmicroenvironment factors. Embryonic stem cells (ESCs) have the capacity to differentiate intoany specialized cell type of the animal body, generally via the formation of embryoid body (EB), whichmimics the early stages of embryogenesis. In this study, extrusion-based 3Dbioprinting technologywas utilized for biofabricating ESCs into 3D cell-laden construct. The influence of 3Dprintingparameters on ESC viability, proliferation,maintenance of pluripotency and the rule of EB formationwas systematically studied in this work. Results demonstrated that ESCswere successfully printedwithhydrogel into 3Dmacroporous construct. Upon process optimization, about 90%ESCs remainedalive after the process of bioprinting and cell-laden construct formation. ESCs continued proliferatinginto spheroid EBs in the hydrogel construct, while retaining the protein expression and geneexpression of pluripotentmarkers, like octamer binding transcription factor 4, stage specificembryonic antigen 1 andNanog. In this novel technology, EBswere formed through cell proliferationinstead of aggregation, and the quantity of EBswas tuned by the initial cell density in the 3Dbioprinting process. This study introduces the 3Dbioprinting of ESCs into a 3D cell-laden hydrogelconstruct for the first time and showed the production of uniform, pluripotent, high-throughput andsize-controllable EBs, which indicated strong potential in ESC large scale expansion, stem cellregulation and fabrication of tissue-like structure and drug screening studies.

1. Introduction

With the capability of self-renewal and differentiatinginto all somatic cell types, embryonic stem cells (ESCs)hold great promise as an in vitro model system forstudies in early embryonic development, as well as arobust cell source for applications in diagnostics,therapeutics, and drug screening [1]. Derived from theinner cell mass of a blastocyst, ESCs requires delicateculture condition and trend to cluster together, and in

particular, forms three-dimensional (3D) cellularspheroids termed embryoid body (EB) [2]. In order tobetter understand stem cell niche and regulation ofESC differentiation and reprogramming, in vitro reca-pitulation of the spatial distribution of cells, cell–celland cell–matrix interactions, is of paramount impor-tance [3–5]. Compared with 2D monolayer culture,3D cell culture is believed to confer a higher degree ofclinical and biological relevance to in vitro model[6, 7], since the spatial arrangement of cells and extra-

RECEIVED

16April 2015

REVISED

19 June 2015

ACCEPTED FOR PUBLICATION

26 June 2015

PUBLISHED

4November 2015

© 2015 IOPPublishing Ltd

cellular matrix could influence cell differentiation andfunction both in vivo [8] and in vitro [9]. Therefore,reconstruction of 3D cell microenvironment is criticalto directing stem cell fate and generating cell sourcesfor tissue engineering, regenerative medicine and drugscreening studies.

By mimicking some of the spatial and temporalaspects of in vivo development, EB is a basic 3Dmodelfor ESCs culture and differentiation studies. It wasreported that the size and uniformity of EBs couldvastly influence stem cell fate [10–12]. Various meth-ods have been used to fabricate such cellular spheroid,basically including static suspension, hanging-dropand multiwell culture, most of which doesn’t involvebiomaterials. Static suspension method inoculate sus-pension of ESCs onto non-adhesive plate to allow cellsspontaneously aggregate into spheroid. Thismethod iseasy to operate, but showed limited control over theEBs size and shape due to the probability that ESCsencounter each other accidentally [13]. Hanging-dropis a common method to produce size-controlledhomogeneous EBs, where droplets of ESCs suspensionare pipetted onto the lid of a Petri dish and EBs wasgenerate by gravity after overturning the dish [14].However, manual pipetting is labor intensive and thereproducibility varies with operators. Multiwell cul-ture offers high-throughput solution for EB formationthrough cell aggregation in uniformly shaped micro-well arrays but requires expensive microwell cultureplates [10, 15]. Besides, there are few customizedmicrowell culture plates available in themarket.

Recent advances in bioprinting technologies facili-tated the precise deposition of ESCs in a reproduciblemanner. Xu et al [16] and Shu et al [17] printed ESCssuspension solution into 2D patterns as hanging-dropapproach for EB formation, without the cell-bioma-terial interaction. Corr and Xie [18, 19] applied laserdirect-write method in bioprinting of mouse ESCstogether with gelatin. ESCs maintained the plur-ipotency while proliferation and formed EB. EB sizecan be controlled by cell density and colony size. How-ever, these studies just generated 2D cellular arraywithout 3D cell–matrix interactions, and cell–cellinteraction happens within one drop but not amongdifferent drops. To better recapitulate the character-istics of in vivo cell microenvironment, 3D customizedcell/matrix construct with macro-porous structuremight be a preferred choice. To our knowledge, therehas been no report about bioprinting of ESCs into 3Dcell-laden constructs.

The extrusion-based temperature-sensitive 3Dbioprinting technology was developed in our lab andhas been utilized for bioprinting of hepatocytes [20],adipose tissue-derived stem cells (ADSCs) [21], C2C12cells [22], hela cells [23] and 293FT cells [24]. Mostcommonly used biomaterials for this technology aregelatin and alginate. Gelatin, a type of denatured col-lagen, is widely used as a coating for feeder layer-freemouse ES cell culture. Alginate, extracted from brown

algae, is proving to have a wide applicability in tissueengineering and drug delivery and also used in embed-ding mouse ESCs for EB formation [25]. It has beenproved in many studies that encapsulation of ESCs inhydrogels would direct EB formation with the main-tenance of pluripotency [26–28]. Hence, we hypothe-sized that the bioprinting of 3D ESC-laden constructwouldmaintain the stem cell pluripotency and addressthe challenges associated with the current methods forEB formation.

In this study, we investigated the feasibility ofapplying extrusion-based temperature-sensitive 3Dbioprinting technology in bioprinting of ESCs withhydrogels into 3D macro-porous structure, with themaintenance of viability, pluripotency, cell growthand to direct EB formation. Printing process para-meters were optimized to obtain a high cell survivalrate (90%) after printing process and construct forma-tion. Stem cell pluripotency was examined by theexpression of stem cell markers (octamer bindingtranscription factor 4 (Oct4), stage specific embryonicantigen 1 (SSEA1) and a homeodomain-bearing tran-scriptional factor (Nanog)) and the ability to formEBs.The regulation of EB formation in the 3D bioprintedconstruct was systematically compared with com-monly used methodology, where EB formation relieson cell aggregating as well as cell proliferation. Resultsdemonstrated that this novel technology generatedpluripotent, high-throughput, highly uniform andsize controllable EBs under static culture conditionwithout complex equipment. This study establishedthe feasibility of fabricating 3D in vitro tissue-likemodel using ESCs for the first time, creating engi-neered microenvironment for pluripotent stem cellswith the ability of placing cells and materials spatiallyin a reproduciblemanner.

2.Materials andmethods

2.1.Materials preparationGelatin (Sigma-Aldrich, G1890) and sodium alginate(Sigma-Aldrich, A0682) were dissolved in 0.5% (w/v)sodium chloride solution at the concentration of 15%(w/v) and 4% (w/v), respectively. Both the twosolutions were sterilized under 70 °C for 30 min forthree times with the interval time of 30 min. Thesterilized solutions were packed into 1.5 mL EP tubes,stored at 4 °Cand incubated at 37 °Cbefore use.

2.2. ES cell cultureUndifferentiated mES cell line (R1, obtained fromNaJie lab, Center for Stem Cell Biology and Regenera-tive Medicine, Tsinghua University, China) werecultured in DMEM (Gibco, 11960-044) supplementedwith 15% knock out TM SR serum replacement forESC/iPSCs (Gibco, 10828-028), 0.1 mM MEM non-essential amino acids (Gibco, 11140-050), 2 mMGlutaMax-1 (Gibco, 35050-061), 1 mM sodium

2

Biofabrication 7 (2015) 044101 LOuyang et al

pyruvate (Gibco, 11360-070), 100 UmL−1 penicillin/streptomycin (Gibco, 10378-016), 1000 UmL−1 leu-kemia inhibitory factor (LIF: ESGRO, ESG1106) and0.1 mMβ-mercaptoethanol. Cells were passaged every2 to 3 days with 0.025% trypsin/ethylene diamin tetra-acetate (EDTA) onto 0.1% gelatin-coated Petri dish.

2.3. Bioprinting and culture of 3DESC-ladenhydrogel constructESCs were bioprinted with matrix materials using anextrusion-based 3D bioprinter following the pre-viously established methods [24]. Briefly, 600 μL ofgelatin solution and 400 μL of alginate solution waswarmed under 37 °C for 20 min, gently mixed asmatrix material and used within 30 min ESCs wascollected, dispersed into single cells and 200 μL cellsuspension was gently mixed with matrix materialunder room temperature with the cell density of 0.5,1.0 and 2.0 million mL−1, respectively. 30 mm Petridishes were coated with 0.0125% (w/v) poly-L-Lysine(Sigma-Aldrich, P8920) and used as collecting plate inthe 3D bioprinting process. Within a temperature-controlled chamber of the 3D bioprinter, whosetemperature was set within the gelation region ofgelatin, the mixture of ESCs and matrix materials wasbioprinted into a cubic construct layer by layer in azigzag fashion. The nozzle insulation temperature andprinting chamber temperaturewere set at 25 °C/30 °Cand 4 °C/7 °C/10 °C, respectively, while nozzles withinner diameter of 160 μm/260 μm/410 μm/510 μmwere chose for printing. The dimensions of the cubicconstructwas 8 mm×8 mm,with six layers in height.After the temperature controlled bioprinting process,the printed 3D constructs were immersed in 100 mMcalcium chloride for 3 min for crosslinking, and thenwashed with phosphate buffer solution (PBS) for threetimes. The whole printing process was finished in30 min. The 3D crosslinked construct was cultured byESC culture medium in the atmosphere of 5% CO2 at37 °C. Culture medium was refreshed every 1 to 2days. The cellmorphologywas examined and recordedby an opticalmicroscope (Olympus, CX40).

2.4. Suspension andhanging-drop for EB formationSuspension cultures of EBs were initiated by resus-pending ESCs in culture medium, and cultivated insterile 30 mm Petri dishes coated with 2% agar(generating a low-adherence surface for suspensionculture)with final cell amount of 0.5million in 1.5 mLculture medium. Hanging-drop EBs were prepared bysuspending 104 cells/mL in culture medium in 20 μLdrops on the lid of a 100 mm Petri dish. Then the lidwas carefully inverted and put over the bottom of thedish filled with PBS to prevent the drops from dryingout. EBs formed using these two methods werecultured for 96 h and the EBs phase images werecaptured by an optical microscope (Olympus, CX40)every day.

2.5. Live/dead assayAfluorescent live/dead stainingwas used to determinecell viability in the 3D cell-laden constructs accordingto the manufacturer’s instructions. Briefly, sampleswere gently washed in PBS for 3 times. 1 μMCalcein-AM (Sigma-Aldrich, 17783) and 2 μM propidiumiodide (Sigma-Aldrich, P4170) were used to stain livecells (green) and dead cells (red) for 15 min whileavoiding light. A laser scanning confocal microcopysystem (LSCM, Nikon, Z2) was used for imageacquisition. Cell viability was counted by count/sizetool of Image-Pro-Plus and calculated by dividing thetotal number of cells by green stained cells. Threerandomfields were counted for each sample.

2.6. EBharvestTo harvest the EBs in the construct, the 3D constructswere dissolved by adding 55 mM sodium citrate and20 mM EDTA in 150 mM sodium chloride [29] for5 min, while gently shake the Petri dish for betterdissolving. After being transferred to 1.5 mL EP tubes,the EB suspensions were centrifuged under 200 rpmfor 3 min, and the supernatant liquid was removed toharvest EBs for further analysis.

2.7. Cell proliferation analysisCell counting kit-8 (Dojindo, CCK-8) was used todetermine the proliferation of ESCs in monolayerculture (2D) and printed construct (3D) as previouslystated [24]. 3D construct samples were divided intotwo treatment groups: with ESCs embedded in the 3Dhydrogel construct (labeled as ‘in situ’), and with ESCsharvested from the construct (labeled as ‘harvest’).Both 2D and 3D samples were incubated with 80 μLCCK-8 solution in 800 μL culture medium for 2 h at37 °C. Then 110 μL supernatant were transferred toone well of 96-well plate in a microplate reader (BIO-RAD, Model 680) to read optical density (OD) at450 nm wavelength. EB volume, which was deter-mined by the function V=πd3/6 (V means EBvolume, dmeans EB diameter), was also used to assesscell growth in 3D constructs. OD value from CCK-8and EB volume were normalized to the data of day 1through dividing data of day 1 by that of each day forcomparison. Three samples were tested for eachgroup.

2.8. EBmorphology analysisTo assess the EB morphology, the collected EBs wereresuspended in 500 μL PBS. Afterwards the EB sus-pension were transferred to a 35 mm Petri dish. Thedish was gently shaken so that EBs distributed evenlyon the bottom. To capture the micro-images of EBs,an optical imaging system (Olympus CK40) was used.EB diameter and circularity were measured to char-acterize the EB morphology. EB diameter (D) isdefined by the equation D=(4A/π)1/2, where Ameans the area of EB cross-section. EB circularity (C)

3

Biofabrication 7 (2015) 044101 LOuyang et al

is determined by the equation C=4πA/L2, where Lmeans the perimeter of EB cross-section. To calculatethe geometrical parameters like A and L, the geome-trical outline of EB cross-section was extracted usingan image recognition program inMatlab (supplement1). 250 EBs were used for data statistics for eachprocess parameters configuration. In addition, thisprogram was also used in the semi-quantitativeanalysis for calculating area occupied by EB in theconstruct through dividing the area of grid hydrogelstructure by the area of all EBs.

2.9. Immunohistochemical analysisTo examine the pluripotency of EBs in the 3Dconstruct, EBs were harvested, fixed with 4% parafor-maldehyde for 20 min and permeabilized with 0.1%Triton-X 100 in PBST (0.1% Tween in PBS) for30 min. After blockingwith 5%bovine serum albumin(BSA) in PBST for 1 h, the EBswere incubatedwith theprimary antibodies Oct4 (abcam, ab19857) and SSEA1(abcam, ab16285) for 12 h at 4 °C. The EBs werewashedwith PBST and then incubatedwith the secondantibodies Alexa Fluor® 594 (abcam, ab150080) andAlexa Fluor® 488 (abcam, ab150113) for 2 h. Thecontrols were performed by replacing the primaryantibodies with corresponding immunoglobulin Gantibodies. The EBs were then washed with PBST andstained with DAPI. All images were analyzed usingNikonZ2 confocalmicroscope.

2.10. Flow cytometry analysisCollected EBswere washed twice with PBS for 3 min atroom temperature followed by StemPro® Accutase(Cell dissociation reagent, Life technologies, A11105-01) treatment for 5 min at 37 °C to dissociate EB tosingle cells. After centrifugation with 1000 rpm for3 min, the cells were fixed, permeabilized and blockedas stated above. Then, the cells were incubatedwith theprimary and second antibodies to mark Oct4 andSSEA1 separately, according to the manufacturer’sinstruction. The controls were performed by replacingthe primary antibodies with PBS. After resuspensionin sorting buffer (0.1% BSA in PBS), the cells wereanalyzed using a flow cytometer (FACSAria III, BDBiosciences).

2.11. RNA isolation and quantitative real timepolymerase chain reaction (qRT-PCR)After washing by PBS for three times, 1 mL Trizol(Invitrogen) was added to each sample, followed by a10 min incubation one ice and 1 min stirring tocomplete homogenization. The mixtures were thentransferred to 1.5 mL EP tube, supplemented with200 μL chloroform followed by vigorous shaking and5 min incubation at room temperature. Samples werethen centrifuged at 12 000 rpm and 4 °C for 15 minand upper aqueous layer was collected to a new tube.RNA was isolated through being blended with iso-propanol and followed by 15 min incubation at roomtemperature. After centrifuging at 12 000 rpm and4 °C for 10 min, the supernatant was removed and theRNAwas washedwith 75% ethanol. After centrifugingat 7500 rpm and 4 °C for 5 min, the collected RNAwasdissolved in DEPC water. The concentration of RNAwas determined by measuring the absorbance at260 nm in a spectrophotometer (Thermo Scientific)and the purity of RNA was estimated from the ratio ofreadings at 260 nmand 280 nm.

RNA samples were transcribed to cDNAusing Pri-meScript™ II 1st strand cDNA Synthesis Kit(TaKaRa). qRT-PCR was performed on a real timePCRdetection system (CFX96, Bio-Rad)withMaximaSYBR Green qPCR master mix (Thermo Scientific) intriplicate as per manufacturer’s instructions. Relativeexpression was determined by delta-delta Ct methodwith the expression of GADPH as housekeeping refer-ence. The sequence of the gene specific primers forPCR were as follows: GAPDH, (5′ primer) CATCAC-CATCTTCCAGGAGC and (3′ primer) ATGCCAG-TAGCTTCCCGTC; Oct4, (5′ primer)GAAGCAGAAGAGGATCACCTTG and (3′ primer)TTCTTAAGGCTGAGCTGCAAG; Nanog, (5′ pri-mer) CCTCAGCCTCCAGCAGATGC and (3′ pri-mer) CCGCTTGCACTTCACCCTTTG. Schematicrepresentation of this research was demonstrated infigure 1.

2.12. Statistical analysisAll results were presented as the mean ± standarddeviation. Statistical analysis was performed usingtwo-way analysis of variance in conjugation with aBonferroni post-hoc test and a student t-test inGraphpad Prism. Statistical significance was defined as

Figure 1. Schematic representation of this research.

4

Biofabrication 7 (2015) 044101 LOuyang et al

*p<0.05, **p<0.01, and ***p<0.001. Three inde-pendent trials were carried out unless otherwise stated.

3. Results

3.1. 3Dbioprinting and cell viability optimizationIn this study, many process parameters, e.g. nozzleinner diameter, nozzle insulation temperature andchamber temperature were examined to optimize cellviability after 3D construct fabrication. It was demon-strated that larger nozzle diameter resulted in highercell viability (figure 2(A)). Specially, the cell viabilityunder Nozzle-160 μm (81.59%±1.74%) was lowerthan those under Nozzle-260 μm (88.06%±1.98%),Nozzle-410 μm (89.59%±0.71%) and Nozzle-510 μm (90.84%±1.02%), with significant differ-ences. Nozzle diameter of 260 μm, 410 μm and510 μm showed no significant differences in terms ofcell viability.

Insulation and chamber temperatures were alteredto study their influences on cell viability (figure 2(B)).As a positive control, ESCs/hydrogel mixture withoutbioprinting were stained with fluorescence live/deadreagent, and showed 93.14%±1.31% cell viability.When insulation temperature was set at 25 °C (labeledas ‘Insu-25 °C’), cell viability increased with the cham-ber temperature from 55.52%±2.37% under 4 °C(labeled as ‘Cham-4 °C’) to 78.22%±2.55% under10 °C (labeled as ‘Cham-10 °C’) with significant dif-ferences. When the insulation temperature was set at30 °C (labeled as ‘Insu-30 °C’), nearly 90% ESCs

remained alive under the chamber temperature of7 °C and 10 °C (labeled as ‘Cham-7 °C’ and ‘Cham-10 °C’), significantlymore than that under Cham-4 °C(72.40%±2.46%). To achieve both high ESC viabi-lity and a clear construct configuration, the processparameter combination of Nozzle-260 μm, Cham-10 °Cand Insu-30 °Cwas chosen.

After culturing for three days, few cells were founddead, which were isolated from living EBs(figure 2(C)). On day 5 and day 7, a few dead cells wereobserved on the edge of EBs. About 5% ESCs werestained dead on day 7. As the static culturing con-tinued, 9.69%±1.77%, 17.72%±2.91% and40.64%±2.06%were found dead on day 8, day 9 andday 10, respectively (supplement 2). So, we chose 7days as the culture period in the following analysis.

3.2. Construct structural stability and EB formationA 3D cellular construct with the cross section of8 mm×8 mm and height of 1 mm was fabricatedunder the optimized process parameter. The 3Dconstruct demonstrated macro-porous grid structurein which the hydrogel threads were evenly distributedaccording to the computer design (figure 3(A)). Boththe width of the threads and the gap between thethreads were homogeneous, that is728.2 μm±24.9 μm and 424.3 μm±17.8 μm,respectively, suggesting 3D cellular construct forma-tion in a highly controlled manner. ESCs wereembedded uniformly in the hydrogel matrix threads,developing a specific 3Dmicroenvironment.

Figure 2.The influence of bioprinting parameters on ESC viability is determined by fluorescence live/dead staining. (A)The influenceof printing nozzle inner diameter on ESC viability (Insu-30 °CandCham-10 °C). (B)The influence of nozzle insulation temperatureand chamber temperature on ESC viability. Insu-25 °Cmeans keeping the nozzle insulation temperature at 25 °C.Cham-4 °Cmeanssetting the chamber temperature at 4 °C, and so as others. (C)Thefluorescent staining images show the live (green) and dead (red)cells at different days during culture period. Scale bar: 100 μm.

5

Biofabrication 7 (2015) 044101 LOuyang et al

During the culture period, ESCs tended to grow asspheroid cellular aggregates, also known as EB. Thecell density in the 3D hydrogel construct were deter-mined by the initial cell density in the ESC/alginate/gelatin mixture and showed significant influence onthe yield and density of EBs formed in the construct(figure 3(B)). It was demonstrated by semi-quantita-tive analysis of figure 3(B) that, the percentage of areaoccupied by EBs varied from 52% to 85% when initialcell density changed from 0.5 mln mL−1 to2.0 mln mL−1 . Most of the EBs were contained in thehydrogel threads in the culturing period. However,when the initial cell density was as high as2.0 mln ml−1, some of the EBs were observed runningoff from the threads into the throughout holes.

3.3. Cell proliferationESCs formed spheroid EBs in the 3D hydrogelconstruct and the diameter of the EBs enlarged withculturing time while keeping their spatial location inthe hydrogel thread, indicating EB formation by ESCproliferation rather than aggregation (figure 4(A)).Compared with traditional 2D culture, ESCs showeddifferent proliferation rate indicated by the OD valuemeasure by CCK-8 kit (figure 4(B)). The normalizedOD value of the 3D in situ group grew faster than thatof 2D from day 1 to day 3, while slowing down afterday 3 and being much less than that of 2D at day 7.However, 3D harvest group showed a generally fastergrowth rate than 2D during the one week culturing,with a significant difference. In addition, the diameter

Figure 3. Images of the printed cellularmodel with grid structure. (A) Full view of the cellular construct. (B)Phase-contrast imagesdemonstrating the cellmorphology and distribution of different cell density at day 3, day 5 and day 7. Scale bar: 1 mm.

6

Biofabrication 7 (2015) 044101 LOuyang et al

of EB was also measured to indicate ESC proliferationrate. When comparing the normalized EB volumewith normalized 2D OD value, 3D samples alsomaintained a significantly faster growth rate than 2D,though the EB volume had huge variance (figure 4(B)).

3.4. ESCs pluripotencymaintenancePluripotency markers, i.e. Oct4, SSEA1 and Nanogwere analyzed to determine the pluripotency main-tenance of ESCs after 7 day culture in the 3D hydrogelconstruct. Immunofluorescence staining and flowcytometry analysis showed that almost all of the cellswithin the EB were successfully stained both Oct4 andSSEA1. Because of the limitation of confocal capacitywhen dealing with large scale aggregates, the centralpart of the EB was darker than the edge (figure 5(A)).

Flow cytometry analysis demonstrated that 97.2% and99.0% cells were positively stained with Oct4 andSSEA1 respectively (figure 5(B)). The qRT-PCR resultsdemonstrated that the gene expression level of Oct4and Nanog in our 3D samples were close to those in2D (within the deviation of±3%), without significantdifference, confirming that cells have maintainedpluripotency (figure 5(C)).

3.5. EBmorphologyEBs were harvested from the 3D hydrogel construct atdifferent time intervals to analyze EB morphology(figure 6(A)). Most of the EBs were separated withoutfusion. The center part of the EBswas darker than edgepart, especially at day 5 and day 7, indicating the 3Dsphere structure of EBs. Through analyzing the size of

Figure 4.EB growing and cell proliferation. (A)Magnified images of the same location in 3Dprinted cellular construct at differenttimes. (B)ESCproliferation in the 3D construct comparedwith 2D culture. All the date were normalized to the value of day 1. Scalebar: 200 μm.

Figure 5.ESC pluripotency at day 7was determined byCLSM, flow cytometry and qRT-PCR. (A) Immunofluorescence images of EBsstainedwithOct4, SSEA1 andDAPI. (B)Quantification of 3Ddissociated cellsmarkedwithOct4 and SSEA1 by using flow cytometry.(C)Gene expression ofOct4 andNanog in 3D versus 2Dby using qRT-PCR. Scale bar: 50 μm.

7

Biofabrication 7 (2015) 044101 LOuyang et al

250 random EBs for each sample, the histogram of EBdiameter were obtained, showing a Gauss distributioncurve (figure 6(B)). The results demonstrated that theEB size increased significantly from about 50 μm toabout 110 μm when the construct was cultured fromday 3 to day 7 (figure 6(C)). Cell density had littleinfluence on EB average size. However, increased celldensity would result in the reduction of the uniformityof EB size, especially at day 7; the EB diameter of2.0 mln mL−1 group at day 7was vastly heterogeneous,with a deviation of 42.30 μm, which was much morethan those of other two groups.

Circularity was measured to assess the quality ofEBs (figure 6(D)). For the 0.5 mln mL−1 group, mostof the EBs were close to a standard spheroid with thecircularity centered in 0.9 for the three time points. Asto the other two groups, the circularity at day 3 is simi-lar to that of 0.5 mln mL−1 group, while the circularityfrequency peaks had a significant decrease at day 5 andday 7. In particular, about 20% EBs had a circularityunder 0.8 at day 5 and day 7 for the 2.0 mln mL−1

group. In general, the circularity decreased with theincrease of culture time and initial cell density in thehydrogel (figure 6(E)).

3.6. Comparisonwith other EB formationmethodsConsidering this was a novel methodology of EBformation, we systematically compared the commonlyused static suspension and hanging dropmethodswiththe 3D bioprinting method for EB formation. Asdemonstrated by the phase-contrast images(figure 7(A)), EBs generated by static suspensionmethod showed more uncontrollable morphology

rather than round spheroid. The distribution of EBdiameter clearly demonstrated that 3D bioprintingtechnology generated EBs with higher uniformitycompared with static suspension technology, espe-cially for the larger EB diameter, i.e. 60∼70 μm and100∼110 μm regions (figure 7(B)). In particular, theEBs with 30∼50 μm diameter presented vastlyirregular shape in suspension technology, which wasconfirmed by the circularity curve (figure 7(C)). Onthe other hand, EBs generated by 3D bioprintingtechnology showed higher circularity regardless of thediameter regions, suggesting more regular shape(figure 7(C)). More characteristic like EB formingmotivation, size control method, EB diameter range,uniformity, yield, operation complexity were com-pared among 3D bioprinting technology, static sus-pension technology and hanging drop technology, aslisted in table 1.

4.Discussion

3D cell culture environment and tissue-like modelshave drawn great attention because they can be tunedto promote certain levels of cell differentiation andtissue organization, which is difficult in traditional 2Dculture systems for their failing to reconstitute thein vivo cellular microenvironment [30, 31]. Various3D culture systems have been developed to study thecellular behavior affected by spatial and temporal cell–cell and cell–matrix interactions. Among these meth-ods, 3D bioprinting, typically containing jet-, laser-and extrusion-based methods, is a promising

Figure 6.EB formation in different cell density: (A) optical images of released EBs at different days. (B)EBdiameter and (C)EBcircularity distributions at different days. Summary of the (D)diameter and (E) circularity. 250 EBswere applied for diameter andcircularitymeasurements for each group. Scale bar: 200 μm.

8

Biofabrication 7 (2015) 044101 LOuyang et al

technique to manipulate cells/matrix deposition andultimately generate 3D complex tissues or organs. Thistechnique have been used in printing cells derivedfrom adult, embryonic and even tumor tissues fortissue engineering and drug screening applications.With the capacity to expand unlimitedly in vitro anddifferentiate into a variety of therapeutic cell types,ESCs have generated great enthusiasm and are beingapplied in bioprinting studies until recently. As arelatively sensitive cell type, ESCs might suffer greaterproblems in a printing process compared with othertypes of cells. Several studies had been conducted to

print ESCs, maintaining their viability and pluripo-tency [16–19]. Instead of creating 3D tissue-likeconstructs, these studies were more likely to generatecellular droplet array with precise control of distribu-tion. Here we described the work of establishing a 3DESC-laden hydrogel construct using extrusion-basedbioprinting technology. The results demonstratedhigh proliferation rate of pluripotent ESCs in thehydrogel construct, and a versatile technology forgenerating highly uniform and high throughput EBs.

Cell viability after 3D bioprinting and constructformation was determined when evaluating the

Figure 7.Comparison of static suspension and 3Dbioprinting technology for generating EBs. (A)Phase-contrast images showing themorphology of EBs generated by static suspension technology and 3Dbioprinting technology. (B)The EBdiameter histogramspresented the distribution of EB size with aGauss distribution fitting. (C)The circularity curves contrasted the EB qualities.

Table 1.Comparison of three EB formingmethods.

Hanging-drop Suspension 3Dprint

Formingmechanism Aggregation by gravity Self-aggregation Proliferation

Size control Time and cell density Time and cell density Mainly time

Diameter range 50∼500 μm 50∼500 μm 30∼200 μmUniformity High Low Medium-high

Yield Low High High

Operation Time-consuming for seeding andmed-

ium refresh

Complex formedium

refresh

Time-saving and easy formedium

refresh

9

Biofabrication 7 (2015) 044101 LOuyang et al

limitations of bioprinting ESCs. Cells would be lysedor damaged due to osmotic effects in the solution, heatincrease and mechanical stress during printing. In theprotocol presented in this work, about6.86%±1.31% cells were dead during the cell/hydrogel solution preparation process before 3D bio-printing (figure 2(B)). We assumed this was caused bycell dissociation process, together with the osmosisand stirring operation of hydrogel materials. In aninkjet printing study, 15% Chinese Hamster Ovarycells were detected dead before printing process [32].Thermal effects of the ejector reservoir in the inkjetprinting process and laser force in laser-based printingwould be the cause of cell death, in addition to theimpact force when cellular droplets were jetted to arigid substrate in a very short time. Under a differentfabricating strategy, the extrusion-based bioprinterextruded the cell-laden cylinders softly on the sub-strate and controlled the temperature under 30 °C,without the concerns about the thermal and sharplyimpacting effects. However, cells would inevitably suf-fer from shear force when the cell-laden hydrogelswere continuously extruded through a limited space inthe nozzle. We hypothesized that nozzle size andhydrogel viscosity would influence shear force andhence influence cell viability. The cell viability data ofdifferent nozzle sizes, chamber and insulation tem-peratures supported this hypothesis (figures 3(A) and(B)). In our previous study, more than 90% Hela cellswere alive after bioprinting under the parameters ofInsu-25 °C/Cham-4 °C and Nozzle-260 μm [23],while the viability of ESCs was only 55.52%±2.37%under the same parameter combination. Whenincreasing the insulation and chamber temperature to30 °C and 10 °C respectively, the viability showed asignificant increase to 90%. Taking into the account ofcell death before bioprinting, optimized parametersled to only 5% cell death during printing, indicating abroad future applicability of this technique to variouscell types ranging from tumor cells to ESCs. Addition-ally, few dead cells were observed during one-weekculture period (figure 3(C)). On the other hand, whenthe culture period was extended to more than 7 days,more and more ESCs suffered from apoptosis andlysis, possibly due to contact inhabitation and insuffi-cientmass transfer to the center of EBwith the increas-ing of EB size. Therefore, 7 days was chose as theexperiment timewindow for this study.

Apart from cell viability, the maintenance of plur-ipotency is another essential criterion for ESCs regula-tion and application. The results ofimmunofluorescence staining and FACS analysisshowed a high expression rate (98%) of stem cell plur-ipotent markers Oct4 and SSEA1 at day 7 (figure 4),indicating that cells remained undifferentiated stateduring the whole experimental period. Naturally, itcan be inferred that the printing process also had littleinfluence on ESCpluripotency.

In the cell-laden hydrogel culture system, both thecell type and matrix material could influence cellgrowth. Human mesenchymal stem cells remainedalive but did not proliferate when encapsulated in algi-nate [33, 34]. While human ADSCs could proliferatedfor a short period of time in alginate hydrogel micro-spheres but showed significantly higher proliferationrate in gelatin/alginate microspheres [35]. As a widelyused hydrogel, alginate has the disadvantages of lowcell adhesiveness and poor support for cell prolifera-tion [36]. Adding gelatin would improve the cellularadhesive condition and hence favor cell expansion. Inthis study, the fabricated multilayered constructsoffered a 3D microenvironment surrounded by gela-tin/alginate materials for ESCs to adhere, self-renew,and cellular spheroid, termed EB, was generated in situbecause of cell proliferation. Once EB was formed, thespheroid structure supported expansion of sub-populations with differing proliferation, nutrition andoxygenation status compared with conventionalmonolayer system. It is reported that the proliferationof mouse ESCs was higher when embedded in fibringels versus 2D suspension culture [27]. Similarly, inthis study, ESCs in 3D constructs proliferated fasterthan 2D culture sample when being released fromhydrogel to read OD value. This operation was aimedto avoid the influence of interactions between reagentmolecular and matrix materials (figure 6 and supple-ment 3). Additionally, the enlargement of EB dia-meter, which also reflected ESC proliferation,confirmed this result (figure 6).

Typically stimulated via generation of EBs, ESCdifferentiation depends on numerous cues through-out the EB environment, including EB size and shape,as well as their uniformities. In general, several char-acteristics should be concerned for EB formation sys-tem, including reproducibility, symmetry, ease of useand scalability [37]. In the traditional EB formationmethodology, like suspension and hanging-drop, EBswere created via cell gathering and proliferation. Inthesemethods, it was essential to get a balance betweenallowing necessary ESC aggregation for EB formationand preventing EB agglomeration for efficient cellgrowth and differentiation [14]. Static suspension cul-tures produced a large number of EBs with simpleoperation, but the size and shape of the resulting EBswere highly uncontrollable and irregular due to thetendency of EBs to agglomerate after initial formation,as shown in figure 7. Hanging-drop method served asa golden tool to generate uniform and reproducibleEBs with fully aggregating of cells under gravity andnon-agglomeration of EBs in different drops. How-ever, it faced the intrinsic limitation of scalability. The3Dbioprintingmethod presented in this study addres-sed some of the problems, producingmassively homo-geneous EBs with regular shape and controllableshape. In this 3D cell-laden hydrogel system, ESCswere immobilized and restricted to aggregate witheach other, and would not agglomerate until they are

10

Biofabrication 7 (2015) 044101 LOuyang et al

large enough to connect with each other. When theinitial cell density was increased, the average distancebetween two original EBs was closer and these EBs aremore likely to agglomerate with each other while pro-liferation, which is also one of the concerns when wechoose the experiment time period. As a result, the EBuniformity of 2.0 mln mL−1 group was not that goodas those of 0.5 mln mL−1 and 1.0 mln mL−1 groups,especially after culturing for oneweek (figure 6).With-out the initial cell aggregating, the size of EBs in ourmodel was mainly determined by the culture time.Also, it would take longer to reach the same scale of EBdiameter compared with suspension method, prob-ably due to the physical constrain of the matrix mate-rial. For example, it took 5 days and 2 days to get EBsranging 60∼70 μm for 3D printing and suspensionmethods, respectively (figure 7). Besides, thanks to theinterconnected channels design in the 3D constructwhich allowed mass transfer, EBs could be producedin a large scale by changing the construct volume andcell density. In the six-layer construct with 1.0 millioncells per milliliter for example, EBs got a stable yield ofabout 3000 cm−2, while the EB yield by suspensiontechnology was about 900 cm−2 (seeding 0.5 millioncells in a 35 mm dish) and no more than 10 EBs [38]could be produced in 1 cm2 area in hanging-dropmethod, which was also demonstrated by our experi-ments (supplement 4).

In summary, this study presented the highthroughput production of pluripotent, uniform, reg-ular and controllable EBs with the diameter smallerthan 150 μm during one week culture. In a gelatin-based laser printing method, EBs with the diameter ofabout 100 μm were also generated to avoid EBagglomeration in gels [19]. EBs with different sizeexhibit different gene expression and differentiationfate. Park et al [39] found that 100 μmdiameter EBs ofmouse ESCs expressed increased ectoderm markerswhile 500 μm diameter EBs expressed endoderm andmesoderm markers. Furthermore, Messana et al [12]demonstrated that mouse ESCs derived from smallEBs (<100 μm) had a greater chondrogenic potentialthan those from larger EBs. Hwang [10] reported thathuman endothelial cell differentiation was increasedin smaller EBs (150 μm) while cardiogenesis wasenhanced in larger EBs (450 μm). However, large EBsmight be associated with limited mass transfer and thediffusion of biochemical through EBs is demonstratedto be linked to differentiation of ESCs [40]. While theeffect of EB size on differentiation remains to beshown in our model, we hypothesize that EBs with thediameter smaller than 150 μm would mediate specificdifferentiation trajectory, which will be confirmed inthe futurework.

Demonstrating the advantages of reproducibility,high throughput, regular shape and controlled size, webelieve this is a versatile technology for EB generation.

But, this 3D printing system does not serve as an EBformation method solely. The ESC-laden hydrogel 3Dconstruct can be dissolved at a proper time point toharvest massive EBs with desired size for ES cellresearch. Or, the ESC-laden hydrogel 3D constructcan be maintained to perform 3D ESC differentiationstudies to explore the regulation of EB size, matrixmaterial and 3D structure on ESC differentiationlineages. Furthermore, this technology hold thepotential to serve as a versatile tool for the generationof tissue-like structure and organ/tissue on chip basedon controlled ESCdifferentiation.

5. Conclusion

In this study, we reported successful bioprinting ofmouse ESCs with hydrogel into a 3D multilayeredconstruct for the first time. Extrusion-based bioprint-ing technology was applied. Upon parameter optimi-zation, ESCs demonstrated high viability of 90% after3D printing and construct formation. Cells continuedself-renewal in the construct and exhibited a higherproliferation rate compared with conventional 2Dculture. 98% cells expressed the canonical pulripotentmarkers Oct4 and SSEA1 at day 7, indicating thatmostof the ESCs remained undifferentiated state afterprinting and culturing. Large quantities of uniformEBs with regular shape and adjustable size weregenerated through cell proliferation, while avoidingEBs agglomeration. This work indicated the feasibilityof fabricating complex 3D tissue-like model based onpluripotent stem cells for applications in pharmacy,regenerative medicine, stem cell expansion and biol-ogy studies.

Acknowledgments

The authors acknowledge the funding supports fromthe National Natural Science Foundation of China(No. 51235006), the National High TechnologyResearch and Development Program of China-863Program (No. 2012AA020506), the IndependentScientific Research Program of Tsinghua University(No. 2014z21030) and the Beijing Municipal Science& Technology Commission Key Project (No.Z141100002814003). This work was also supported bythe National Natural Science Foundation of ChinaGrant 31171381 and the National Basic ResearchProgram of China, 973 program grant 2012CB966701to (JN), and the funding of the Tsinghua-PekingCenter for Life Sciences.

References

[1] MurryCE andKeller G 2008Differentiation of embryonicstem cells to clinically relevant populations: lessons fromembryonic developmentCell 132 661–80

11

Biofabrication 7 (2015) 044101 LOuyang et al

[2] Dang SM,Gerecht-Nir S, Chen J, Itskovitz-Eldor J andZandstra PW2004Controlled, scalable embryonic stem celldifferentiation culture Stem cells 22 275–82

[3] Watt FMandHoganB LM2000Out of Eden: stem cells andtheir niches Science 287 1427–30

[4] ZhangH,Dai S, Bi J and LiuKK2011 Biomimetic three-dimensionalmicroenvironment for controlling stem cell fateInterface Focus 1 792–803

[5] Guilak F, CohenDM, Estes B T,Gimble JM, LiedtkeWandChenC S 2009Control of stem cell fate by physical interactionswith the extracellularmatrixCell StemCell 5 17–26

[6] FennemaE, RivronN, Rouwkema J, van BlitterswijkC andde Boer J 2013 Spheroid culture as a tool for creating 3Dcomplex tissuesTrends Biotechnol. 31 108–15

[7] YaoR,Wang J Y, Li XK, JungD J, QiH, KeeKK andDuYN2014Hepatic differentiation of human embryonic stem cells asmicroscaledmultilayered colonies leading to enhancedhomogeneity andmaturation Small 10 4311–23

[8] Hurtley S 2009 Location, locaton, location Science 326 1205[9] Ruiz SA andChenC S 2008 Emergence of patterned stem cell

differentiationwithinmulticellular structures Stem cells 262921–7

[10] HwangY S, ChungBG,OrtmannD,Hattori N,MoellerHCandKhademhosseini A 2009Microwell-mediatedcontrol of embryoid body size regulates embryonic stem cellfate via differential expression ofWNT5a andWNT11 Proc.Natl Acad. Sci. USA 106 16978–83

[11] MummeryC L, Zhang J, Ng E S, Elliott DA, Elefanty AG andKampT J 2012 Differentiation of human embryonic stem cellsand induced pluripotent stem cells to cardiomyocytes: amethods overviewCirc. Res. 111 344–58

[12] Messana JM,HwangN S, Coburn J, Elisseeff JH andZhangZ2008 Size of the embryoid body influences chondrogenesis ofmouse embryonic stem cells J. Tissue Eng. RegenerativeMed. 2499–506

[13] Dang SM,KybaM, Perlingeiro R,DaleyGQ andZandstra PW2002 Efficiency of embryoid body formation andhematopoietic development from embryonic stem cells indifferent culture systemsBiotechnol. Bioeng. 78 442–53

[14] Rungarunlert S, TechakumphuM, PirityMK andDinnyes A2009 Embryoid body formation from embryonic and inducedpluripotent stem cells: benefits of bioreactorsWorld J. StemCells 1 11–21

[15] MoellerHC,MianMK, Shrivastava S, Chung BG andKhademhosseini A 2008Amicrowell array system for stem cellcultureBiomaterials 29 752–63

[16] XuF, Sridharan B,Wang S, GurkanUA, SyverudB andDemirci U 2011 Embryonic stem cell bioprinting for uniformand controlled size embryoid body formationBiomicrofluidics5 22207

[17] Faulkner-Jones A,Greenhough S, King J A, Gardner J,Courtney A and ShuW2013Development of a valve-based cellprinter for the formation of human embryonic stem cellspheroid aggregatesBiofabrication 5 015013

[18] RaofNA, Schiele NR, Xie Y, ChriseyDB andCorrDT2011Themaintenance of pluripotency following laser direct-writeofmouse embryonic stem cellsBiomaterials 32 1802–8

[19] Dias AD,Unser AM,Xie Y, ChriseyDB andCorrDT 2014Generating size-controlled embryoid bodies using laser direct-writeBiofabrication 6 025007

[20] YanY et al 2005 Fabrication of viable tissue-engineeredconstructs with 3D cell-assembly techniqueBiomaterials 265864–71

[21] YaoR, Zhang R J, YanYN andWangXH2009 In vitroangiogenesis of 3D tissue engineered adipose tissue J. Bioact.Compat. Polym. 24 5–24

[22] Zhang T, YanKC,Ouyang L L and SunW2013Mechanicalcharacterization of bioprinted in vitro soft tissuemodelsBiofabrication 5 045010

[23] ZhaoY, YaoR,Ouyang L,DingH, Zhang T, ZhangK,Cheng S and SunW2014Three-dimensional printing ofHelacells for cervical tumormodel in vitro Biofabrication 6 035001

[24] Ouyang L, YaoR,ChenX,Na J and SunW2015 3Dprinting ofHEK293FT cell-laden hydrogel intomacroporous constructswith high cell viability and normal biological functionsBiofabrication 7 015010

[25] Magyar J P,NemirM, Ehler E, SuterN, Perriard J C andEppenbergerHM2001 Mass production of embryoid bodiesinmicrobeadsAnn.NewYork Acad. Sci. 944 135–43

[26] Dang SM,KybaM, Perlingeiro R,DaleyGQ andZandstra PW2002 Efficiency of embryoid body formation andhematopoietic deelopment from embryonic stem cells indifferent culture systemsBiotechnol. Bioeng. 78 442–53

[27] LiuH,Collins S F and suggs L J 2006Three-dimensionalculture for expansion and differentiaion ofmouse embryonicstem cellsBiomaterials 27 6004–14

[28] Gerecht S, Burdick J A, Ferreira L S, Townsend SA,Langer R andVunjak-Novakovic G 2007Hyaluronic acidhydrogel for controlled self-renewal and differentiation ofhuman embryonic stem cells Proc. Natl Acad. Sci. USA 10411298–303

[29] Gaetani R, Doevendans PA,Metz CHG, Alblas J,Messina E,Giacomello A and Sluijtera J PG2012Cardiac tissueengineering using tissue printing technology and humancardiac progenitor cellsBiomaterials 33 1782–90

[30] HuhD,HamiltonGAand IngberDE 2011 From3D cellculture to organs-on-chipsTrends Cell Biol. 21 745–54

[31] YaoR,DuY, Zhang R, Lin F and Luan J 2013A biomimeticphysiologicalmodel for human adipose tissue by adipocytesand endothelial cell cocultures with spatially controlleddistributionBiomed.Mater. 8 045005

[32] XuT, Jin J, Gregory C,Hickman J J and BolandT 2005 Inkjetprinting of viablemammalian cellsBiomaterials 26 93–9

[33] Markusen J F,MasonC,Hull DA, TownMA,Tabor AB,ClementsM, Boshoff CHandDunnill P 2006 Behavior ofadult humanmesenchymal stem cells entrapped in alginate-GRGDYbeadsTissue Eng. 12 821–30

[34] TangM,ChenW,WeirMD, Thein-HanWandXuHH2012Human embryonic stem cell encapsulation in alginatemicrobeads inmacroporous calciumphosphate cement forbone tissue engineeringActa Biomater. 8 3436–45

[35] YaoR, Zhang R, Luan J and Lin F 2012Alginate and alginate/gelatinmicrospheres for human adipose-derived stem cellencapsulation and differentiationBiofabrication 4 025007

[36] YaoR, Zhang R, Lin F and Luan J 2013Biomimetic injectableHUVEC-adipocytes/collagen/alginatemicrosphere co-cultures for adipose tissue engineeringBiotechnol. Bioeng. 1101430–43

[37] UngrinMD, Joshi C,NicaA, BauwensC andZandstra PW2008Reproducible, ultra high-throughput formation ofmulticellular organization from single cell suspension-derivedhuman embryonic stem cell aggregates PLoSOne 3 e1565

[38] KurosawaH2007Methods for inducing embryoid bodyformation: in vitro differentiation system of embryonic stemcells J Biosci Bioeng. 103 389–98

[39] Park J, ChoCH, ParashuramaN, Li Y, Berthiaume F,TonerM, Tilles AWandYarmushML 2007Microfabrication-basedmodulation of embryonic stem cell differentiation LabChip 7 1018–28

[40] VanWinkle A P,Gates ID andKallosMS 2012Mass transferlimitations in embryoid bodies during human embryonic stemcell differentiationCells Tissues Organs 196 34–47

12

Biofabrication 7 (2015) 044101 LOuyang et al