JOURNAL OF BACTERIOLOGY, Feb. 2011, p. 932–943 Vol. 193, No. 40021-9193/11/$12.00 doi:10.1128/JB.00941-10Copyright © 2011, American Society for Microbiology. All Rights Reserved.

Three motAB Stator Gene Products in Bdellovibrio bacteriovorusContribute to Motility of a Single Flagellum during

Predatory and Prey-Independent Growth�†Karen A. Morehouse,‡§ Laura Hobley,‡ Michael Capeness, and R. Elizabeth Sockett*

Institute of Genetics, School of Biology, QMC Medical School, University of Nottingham, Nottingham, NG7 2UH, United Kingdom

Received 11 August 2010/Accepted 29 November 2010

The predatory bacterium Bdellovibrio bacteriovorus uses flagellar motility to locate regions rich in Gram-negative prey bacteria, colliding and attaching to prey and then ceasing flagellar motility. Prey are theninvaded to form a “bdelloplast” in a type IV pilus-dependent process, and prey contents are digested, allowingBdellovibrio growth and septation. After septation, Bdellovibrio flagellar motility resumes inside the preybdelloplast prior to its lysis and escape of Bdellovibrio progeny. Bdellovibrio can also grow slowly outside preyas long flagellate host-independent (HI) cells, cultured on peptone-rich media. The B. bacteriovorus HD100genome encodes three pairs of MotAB flagellar motor proteins, each of which could potentially form an innermembrane ion channel, interact with the FliG flagellar rotor ring, and produce flagellar rotation. In 2004,Flannagan and coworkers (R. S. Flannagan, M. A. Valvano, and S. F. Koval, Microbiology 150:649–656, 2004)used antisense RNA and green fluorescent protein (GFP) expression to downregulate a single Bdellovibrio motAgene and reported slowed release from the bdelloplast and altered motility of the progeny. Here we inactivatedeach pair of motAB genes and found that each pair contributes to motility, both predatorily, inside thebdelloplast and during HI growth; however, each pair was dispensable, and deletion of no pair abolishedmotility totally. Driving-ion studies with phenamil, carbonyl cyanide m-chlorophenylhydrazone (CCCP), anddifferent pH and sodium conditions indicated that all Mot pairs are proton driven, although the sequencesimilarities of each Mot pair suggests that some may originate from halophilic species. Thus, Bdellovibrio is a“dedicated motorist,” retaining and expressing three pairs of mot genes.

Bdellovibrio bacteriovorus is a small, predatory deltapro-teobacterium found ubiquitously in nature (30). Bdellovibriopreys upon a wide variety of Gram-negative bacteria, includingmany human, animal, and plant pathogens. It has a biphasicpredatory life cycle, alternating between a highly motile “at-tack phase” and a sessile intracellular growth phase (15). Bdel-lovibrio swims, using a single polar flagellum and chemotaxis,to prey-rich regions before colliding with, attaching to, andentering a suitable prey cell (10, 13, 16, 26, 27). The bdello-vibrio squeezes through a small pore in the prey outer mem-brane (6) and upon entry to the prey cell periplasm sheds itsflagellum and seals the pore in the prey outer membrane,forming a “bdelloplast.” It then begins to digest the prey cellcytoplasm, using the broken-down contents to grow into anelongated growth-phase cell which, upon exhaustion of theprey cell cytoplasmic contents, septates into multiple progeny.The progeny then become flagellate, and there are previousreports (8, 28) of flagellum-mediated motility within the rem-nants of the bdelloplast immediately prior to lysis of the preyouter membrane. After the bdelloplast is lysed, the progeny

Bdellovibrio bacteria are released as highly motile attack-phasecells, seeking more prey. A small percentage of Bdellovibriocells in a population can also grow host independently (HI) inrich media, with HI cells being morphologically diverse butusually flagellate (3, 5). Previous work has shown that whileflagellum-mediated motility is not required for prey entry, it isvital for efficient prey location and thus predation in liquidenvironments (10, 13).

The bacterial flagellum is a rigid helical propeller that isrotated from a membrane-localized motor complex and com-posed of more than 20 different structural proteins. Bacterialflagella are typically rotated by multiple transmembraneMotAB protein complexes that are conformationally altered asions flow through them down an ion motive gradient, which ismaintained by the electron transport system of the bacterialcytoplasmic membrane. The conformational alterations inMotAB proteins act upon the FliG rotor proteins to causerotation of the MS ring, rod, hook, and filament and hence tocause swimming (19).

The best-studied flagellar rotor/stator systems in Gram-neg-ative bacteria are those in Salmonella enterica serovar Typhi-murium and lab strains of Escherichia coli, both of which con-tain a single pair of motAB genes Recently there have beeninteresting studies reporting single flagella being driven bymultiple sets of stator proteins; these include the PomAB/MotAB stators in Shewanella oneidensis (20) and the MotAB/MotCD stators in Pseudomonas aeruginosa (29). Moreover,genome sequencing has revealed multiple copies of statorgenes, showing bacteria with two copies of motAB (includingthe gammaproteobacterium Yersinia pestis and the betapro-

* Corresponding author. Mailing address: Institute of Genetics,School of Biology, QMC Medical School, University of Nottingham,Nottingham NG7 2UH, United Kingdom. Phone: 0115 8230325. Fax:0115 8230313. E-mail: liz.sockett@nottingham.ac.uk.

† Supplemental material for this article may be found at http://jb.asm.org/.

‡ These authors contributed equally to this work.§ Present address: The Sainsbury Laboratory, Norwich Research

Park, Colney, Norwich NR4 7UH, United Kingdom.� Published ahead of print on 10 December 2010.

932

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

23

Dec

embe

r 20

21 b

y 17

7.10

.195

.24.

teobacterium Burkholderia cepacia), one copy of motAB andone copy of motCD (various Xanthomonas species and thebetaproteobacteria Chromobacterium violaceum), and threecopies of motAB and one copy of pomAB (the deltaproteobac-terium Desulfovibrio vulgaris) (29). In Pseudomonas aeruginosadeletion of a single pair of stator protein genes (either motABor motCD) did not reduce swimming speed, while deletingboth motAB and motCD resulted in cells that were unable toswim (29). That study did show that deletion of motCD (butnot motAB) resulted in a reduction in swarming motility andsuggested that the two pairs of stator proteins may be added tothe flagella motor in response to the need for either swimmingor swarming motility. An insightful study of the MotAB andPomAB stators in Shewanella oneidensis showed that a singlepolar flagellum can be powered by a hybrid motor containingstators powered by both hydrogen and sodium ions (20). Theauthors showed that both stator complexes contribute to swim-ming motility and suggested that the Mot stators benefit fromthe presence of the Pom system. They showed that hybridmotA pomB/pomA motB stators were nonfunctional but thathybrid motors containing a mix of both types of stators wereindeed functional and suggested that the ratios of each type ofstator within the motor alter depending upon the environmen-tal conditions.

We have previously shown that there is extensive duplicationof flagellar propeller genes in B. bacteriovorus and that flagellarmotility and chemotaxis are important for predatory encoun-ters with prey (13, 16). The role of a single MotA stator proteinin the predatory life cycle of B. bacteriovorus strain 109J waspreviously studied by Flannagan et al. (8), who reported thatdownregulation of expression of a single motA gene, by anti-sense RNA expression from a plasmid, in B. bacteriovorusstrain 109J delayed the escape of progeny Bdellovibrio cellsfrom the bdelloplast. They also reported an altered “slow-tumbling” swimming style of the progeny Bdellovibrio cells andmorphological abnormalities of the bdelloplasts.

Subsequent genome sequencing and analysis of a relatedstrain of B. bacteriovorus, type strain HD100 (2, 21), showedthere to be three sets of motAB genes, Bd0144-Bd0145,Bd3021-Bd3020, and Bd3254-Bd3253, along with gene dupli-cation of many other vital components of the flagellar struc-ture, including six copies of the filament subunit gene fliC (10,13) and two copies of the rotor component gene fliG (14),although not enough duplicated components to encode a fullyalternate flagellar structure. The Bd0144 motA gene of B. bac-teriovorus HD100 showed 100% identity, at DNA and proteinlevels, to the motA gene in B. bacteriovorus 109J described byFlannagan et al. (8), and there was also synteny with its sur-rounding genetic locus, including motB, between the twostrains.

We monitored gene transcription and constructed pairedmot gene deletions to examine the roles of each pair of motABstator gene products during both predatory and HI growth ofB. bacteriovorus HD100, and we found that while each contrib-uted to flagellum-mediated motility, no single pair of proteinswas essential. Thus, the wild-type B. bacteriovorus flagellummay be powered by a hybrid motor consisting of all three pairsof stator proteins and driven by hydrogen ions. Flagellum-mediated motility occurred within the remnants of the bdello-plast immediately prior to lysis, and deletion strains showed

that this was not dependent on a single pair of MotAB pro-teins. This study further emphasizes the importance of flagel-lum-mediated motility and a strategy of motility gene duplica-tion to Bdellovibrio survival and highlights the versatility of thebacterial flagellar motor in accommodating multiple proteinsfulfilling the same role.

MATERIALS AND METHODS

Bacterial strains and Bdellovibrio culturing. The bacterial strains used in thisstudy are listed in Table 1. Host-dependent (HD) Bdellovibrio was cultured asdescribed previously (13, 16) using E. coli S17-1 as prey, which contained theplasmid pZMR100 when appropriate to confer resistance to kanamycin. HDBdellovibrio was coincubated with E. coli S17-1 in Ca-HEPES buffer at 29°C withshaking at 200 rpm. Host-independent (HI) Bdellovibrio was isolated and grownas previously described (13) in PY broth (with shaking) or on PY plates (con-taining kanamycin at 50 �g/ml for selection when needed) at 29°C.

RT-PCR for detection of expression of motAB genes. Wild-type B. bacterio-vorus HD100 predatory-cycle RNA and host-independent HID13 RNA wereisolated as described previously (6, 13). For comparisons of attack-phase geneexpression in the motAB deletion strains, RNA samples were matched to 10ng/�l as described previously (12). Reverse transcription-PCR (RT-PCR) wascarried out (using 30 amplification cycles) as described in reference 6 using thefollowing primer pairs: for motA1, 5� CCACACCGAAGAAGAAGAGC 3� and5� ACGGCGTTTCAGTTTGTTTC 3�; for motA2, 5� ACGGGATCGTGCTTGTAATC 3� and 5� AGGGCATTTGTCAGAACGTC 3�; for motA3, 5� AGCGTACGGTCTGATTGGTC 3� and 5� GACACACACAATCGGAGGTG 3�; formotB1, 5� GTGCGCTATCTGGTGAAGGT 3� and 5� ACCTTGGAACTGTCGGTGAC 3�; for motB2, 5� AGCGGTGGAAGTGAAAGAGA 3� and 5� GAGGATGACTGGATCCGAAA 3�; and for motB3, 5� GGATGGCAGTGTGATGTCTG 3� and 5� GATCAATTTCACCGCGTTTT 3�. Ten microliters of thereaction mixture was then run on a 2% agarose gel.

Insertional inactivation of motAB genes. Each pair of motAB genes was am-plified with flanking DNA using KOD high-fidelity DNA polymerase (Novagen)and the following primers: for motAB1, 5� ATCAAGGATGAGCTCGCACAG3� and 5� AAGTGCGCGAGCTCTGCGCCGAGAT 3�; for motAB2, 5� GTCCGCTCTAGATGAAATCCA 3� and 5� GGATTTCTAGAGCAATTACGG 3�;and for motAB3, 5� ACGCCTGATAAGTGAGCTCCA 3� and 5� TGAAGAATTCATGGATCTCGCGG 3�. The resulting products were gel purified anddigested with the appropriate restriction enzymes, unique sites for which wereencompassed in the cloning primers (motAB1, SacI; motAB2, XbaI; and motAB3,EcoRI and SacI). These were cloned into the vector pUC19 (31) cut with thesame enzymes. A large portion of each pair of motAB genes was removed byrestriction digests of the pUC19 clones (motAB1 [BamHI], bp 348 of motA to bp615 of motB; motAB2 [PstI], bp 104 of motA to bp 781 of motB; and motAB3[HindIII and StuI and then blunted using cloned Pfu polymerase {Stratagene}],bp 266 of motA to bp 275 of motB) and replaced with a 1.3-kb kanamycinresistance cassette released from the vector pUC4K (32) using appropriaterestriction sites (motAB1, BamHI; motAB2, PstI; and motAB3, HincII) (summa-rized in Fig. 1). These constructs were then PCR amplified before being ligatedinto the conjugative suicide vector pSET151 (4), which was cut with BamHI andblunt ended. The pSET151-based constructs were conjugated into B. bacterio-vorus HD100 as described previously (16).

Gene deletions and replacements were confirmed by Southern blotting (24)using probes for the kanamycin cassette (to confirm presence), for the pSET151vector (to confirm absence), and for the respective pair of motAB genes withterminal flanking DNA (to confirm correct chromosomal location). They werefurther confirmed by PCR amplification of the genes of interest using a proof-reading polymerase and direct sequencing of the PCR product by MWG BiotechLtd. Sequencing data were then analyzed to confirm insertion of the kanamycincassette at the expected site and deletion of the relevant portions of the genes.

Electron microscopy. The flagellar morphology of each host-dependent Bdel-lovibrio motAB mutant was checked using transmission electron microscopy,although from other bacterial studies it was not expected that motAB genemutagenesis would alter flagellation, as motors are added after flagellar synthe-sis. Fifteen microliters of an attack-phase Bdellovibrio culture was applied to acarbon-Formvar grid (Agar Scientific) for 5 min. Cells were stained with 15 �l of0.5% uranyl acetate (URA) (pH 4.0) for 1 min. Representative cells were imagedusing a JEOL JEM1010 electron microscope.

Light microscopy. Cultures were visualized using a Nikon Eclipse E600 epi-fluorescence microscope with a 100� phase-contrast objective, and images and

VOL. 193, 2011 MOTOR PROTEINS IN BDELLOVIBRIO 933

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

23

Dec

embe

r 20

21 b

y 17

7.10

.195

.24.

videos were taken with a Hamamatsu Orca ER camera using the SimplePCIsoftware (version 5.3.1; Hamamatsu).

Assay of relative predatory efficiencies of motAB mutant Bdellovibrio strains onE. coli. Predatory (HD), attack-phase Bdellovibrio cells are too small to diffractlight and, as such, do not give a reading of optical density at 600 nm (OD600);thus, OD600 readings for predatory cultures indicate only the number of preycells and prey-derived bdelloplasts within cultures. In comparison, HI Bdellov-ibrio cells are larger and do give an OD600 reading. Matching the numbers ofattack-phase Bdellovibrio cells in cultures was achieved by using protein concen-tration (as determined by the Lowry protein assay [18]).

The predation efficiencies of predatory Bdellovibrio motAB mutant and wild-type strains over multiple rounds of infection were studied using cultures set upas follows. One milliliter of a fully prey-lysed Bdellovibrio predatory culture(Bdellovibrio cell numbers matched as described above) was added to 3 ml of a16-h culture of E. coli S17-1(pZMR100) and 50 ml Ca-HEPES buffer to give atypical predator/prey ratio of 1:20. The cultures were incubated at 29°C withshaking at 200 rpm, and the OD600 of the prey E. coli cells was measured at thestart and then every hour between 12 and 20 h, during which time the greatestdrop in prey OD was observed. For predation efficiency studies, during a singleround of infection, a predatory culture was set up using a method similar to thatfor synchronous prey infection described previously (7). In short, Bdellovibriocells were concentrated 20-fold and matched to the fliC1 merodiploid control byprotein concentration as determined by the Lowry assay (18), E. coli S17-1(pZMR100) was diluted to an OD600 of 1.0, and 4 ml of concentrated Bdellov-ibrio was added to 3 ml of diluted E. coli and 5 ml of fresh Ca-HEPES to give afinal starting ratio of at least five Bdellovibrio cells per E. coli prey cell. Cultureswere analyzed at each time point using light microscopy.

Testing Bdellovibrio motility within bdelloplasts. To visualize motility of Bdel-lovibrio postseptation but still within bdelloplasts, predatory cultures were set upusing cephalexin-treated E. coli, which produced larger bdelloplasts when in-fected by Bdellovibrio than untreated cells. Exponential-phase E. coli S17-1(pZMR100) cells were grown for 16 h to an OD600 of 2.86, diluted 1:100 in YTbroth plus kanamycin, incubated for 3.25 h until they reached an OD600 of 1.26,and then treated with cephalexin at a final concentration of 60 �g/ml for 90 min,reaching a typical final OD600 of 2.09; they were then washed in Ca-HEPESbuffer before addition to Bdellovibrio. Two milliliters of a 16-h Bdellovibrioculture, which had fully lysed prey, had 300 �l of cephalexin-treated, washed E.coli added. These cultures were then incubated for 4 h before being visualizedusing light microscopy, and individual bdelloplasts with postseptation swimmingprogeny Bdellovibrio were examined using time-lapse photomicroscopy.

Growth rate and motility of HI motAB mutant Bdellovibrio. Growth rates of HIBdellovibrio strains were measured by optical density at 600 nm (OD600), using aFluostar Optima plate reader (BMG Labtech). HI Bdellovibrio was pregrown inPY broth plus kanamycin and immediately prior to the experiment was dilutedin fresh PY plus kanamycin to an OD600 reading of 0.1 unit; 265 �l of the dilutedcultures was then added to each well of a 96-well Optiplate (Porvair SciencesLtd.) and the plate sealed with Breathe-Easy (Web Scientific) gas-permeable

TABLE 1. Strains and plasmids used in this study

Strain or plasmid Description Reference

StrainsE. coli

S17-1 thi pro hsdR hsdM� recA; integrated plasmid RP4-Tc::Mu-Kn::Tn7; used asdonor for conjugating plasmids into Bdellovibrio

23

DH5� F� endA1 hsdR17 (rK� mK

�) supE44 thi-1 recA1 gyrA (Nalr) relA1 �(lacIZYA-argF)U169 deoR�80dlac�(lacZ)M15; used as a cloning host strain

9

S17-1(pZMR100) S17-1 containing pZMR100 plasmid used to confer Kmr; used as Kmr prey forBdellovibrio

22

Bdellovibrio bacteriovorusHD100 Type strain, genome sequenced 21, 25HID13 Host-independent derivative of HD100 12fliC1merodiploid Merodiploid HD100 with wild-type and kanamycin-interrupted fliC1(Bd0604) C. Lambert, unpublished datafliC1merodiploid HI Host-independent derivative of fliC1 merodiploid A. Fenton, unpublished datamotAB1 mutant HD100 motAB1::Kmr This studymotAB1 HI mutant Host-independent derivative of motAB1 mutant This studymotAB2 mutant HD100 motAB2::Kmr This studymotAB2 HI mutant Host-independent derivative of motAB2 mutant This studymotAB3 HI mutant Host-independent HD100 derivative with motAB3::Kmr This studymotAB3 mutant Host-dependent derivative of motAB3 HI mutant This study

PlasmidspUC19 Ampr cloning vector 32pUC4K pUC vector with Kmr cassette 32pSET151 Suicide vector used for conjugation and recombination into Bdellovibrio genome 4pSETmotAB1 pSET151 suicide plasmid containing motAB1::aphII This studypSETmotAB2 pSET151 suicide plasmid containing motAB2::aphII This studypSETmotAB3 pSET151 suicide plasmid containing motAB3::aphII This study

FIG. 1. Construction of the insertion/deletion in each of the threepairs of motAB genes in the B. bacteriovorus HD100 genome. Arrowsshow the primer binding sites used for PCR amplification. The deletedsections of the motAB genes are between the two annotated restrictionsites, while the inserted 1.3-kb kanamycin resistance cassette (aphII) isalso shown.

934 MOREHOUSE ET AL. J. BACTERIOL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

23

Dec

embe

r 20

21 b

y 17

7.10

.195

.24.

sealing membrane. The plate was then incubated in the Fluostar plate reader at29°C with shaking at 200 rpm for 48 h, with an OD600 reading every 30 min (asHI-grown Bdellovibrio cells are large enough to give an OD600 value). To analyzemotility during growth, an identical plate was set up and incubated in a standardaerobic incubator under the same conditions, and samples were taken at theappropriate times for light microscopy.

Hobson BacTracker analysis of Bdellovibrio motAB mutant swimming behav-ior. The swimming motility of each host-dependent Bdellovibrio motAB mutantstrain was compared with that of the fliC1 merodiploid strain (wild type formotility and predation) using Hobson BacTracker (Hobson Tracking Systems,Sheffield, United Kingdom) analysis of mean run speeds (using the same settingsas described in reference 13, with the addition of a minimum run speed thresholdof 15 �m/s to reduce the influence of Brownian motion and tethered rotation onthe results). Bdellovibrio was grown in overnight predatory lysates allowing mul-tiple rounds of infection, and the resultant attack-phase progeny after prey lysiswere tracked at 22 h after inoculation. This was to allow all strains to havecompleted lysis of all bdelloplasts when the Bdellovibrio motility was monitored(for example, in Fig. 5b, predation is seen to be complete [and the OD600 of preyto be flat] for fliC1 merodiploid control motAB1 and motAB2 mutants and nearlycomplete for the motAB3 mutant by 20 h). To test the effects of different drivingions or inhibitors, immediately prior to tracking, Bdellovibrio cells were diluted3-fold in fresh Ca-HEPES (pH 7.6) containing NaCl, phenamil (Sigma), orcarbonyl cyanide 3-chlorophenylhydrazone (CCCP) (Sigma) as required to givethe appropriate final concentrations or with Ca-HEPES at the higher pH of 8.8to give a final testing pH of 8.2. Data on mean run speeds were collected from20 sets of 50 tracks for each strain under each condition tested, except forexperiments involving CCCP, for which 10 sets of 25 tracks were collected, andfor the motAB3 strain, for which 20 sets of 25 tracks were collected, due to thereduced percent motility of the population.

The percent motility of cultures was assayed by visualizing a minimum of 10fields of view, containing at least 100 attack-phase Bdellovibrio cells per field ofview, and comparing manually the number of cells swimming and the numberthat were nonmotile. Tracking software cannot detect these percent motilitydifferences for cultures with many small cells in them.

RESULTS

B. bacteriovorus HD100 has three pairs of motAB genes withdifferent phylogenetic origins. The Bdellovibrio bacteriovorusHD100 genome has three pairs of genes encoding MotABproteins located quite near the origin of replication on bothsides of the chromosome: we have designated them Bd0144/Bd0145 (motA1/motB1), Bd3021/Bd3020 (motA2/motB2), andBd3253/Bd3254 (motA3/motB3). In the initial annotation ofeach motA gene (21), they were found to encode either anextended N-terminal sequence (motA1/motA2) or a missingfirst transmembrane domain (motA3), but further sequenceanalysis revealed alternative potential start codons that recti-fied these issues and gave significant full-length homologies toMot proteins of diverse other bacteria. As mentioned aboveMotA1 of B. bacteriovorus HD100 was a 100% identical matchto the MotA of B. bacteriovorus 109J studied with antisenseknockdown by Flannagan and coworkers (8). We examined theprimary sequence similarities between the six BdellovibrioMotA and MotB protein sequences in comparison to MotAand MotB from the proton-driven E. coli motor and PomA andPomB from the Vibrio alginolyticus sodium-driven motor to seeif any obvious homologies suggesting a driving ion for eachMotAB type could be determined. Alignment (Fig. 2a) showsthat MotA3 resembles most closely the proton-driven MotAprotein sequences of E. coli and S. Typhimurium, along withthe P. aeruginosa MotA (as designated in reference 29), havingthe longer cytoplasmic loop between transmembrane regions 2and 3 encompassed in an extra 20 amino acids found betweenpositions 110 and 130 that is typical of MotA proteins. It isinteresting to note, though, that despite its Mot-like character,

MotA3 is the sole Bdellovibrio MotA which has a conservedaspartate residue (D175) at the position homologous to D148of PomA from the sodium-driven motor of V. alginolyticus.D148 in that PomA protein is part of the phenamil binding sitethat blocks sodium conductance in Pom-based motors. In con-trast to MotA3, MotA2 is more homologous to the “sodiumstator” PomA protein sequences of V. alginolyticus and V.parahaemolyticus, having a shorter cytoplasmic loop betweentransmembrane regions 2 and 3; MotA1 is intermediate be-tween the other two Bdellovibrio MotAs, having a shorter cy-toplasmic loop between transmembrane domains 2 and 3, sim-ilar to that seen in the PomA sequence of V. alginolyticus.

Comparison of the Bdellovibrio MotB protein sequenceswith the proton-driven stator protein MotB from E. coli andthe sodium-driven stator protein PomB from V. alginolyticuswas inconclusive, with the single transmembrane domain wellconserved between all sequences, and while the peptidoglycanbinding domain was more variable in each, there was still agreat deal of homology between sequences (Fig. 2b). Mostvariation lies between these two domains, in the periplasm-spanning region, with MotB1 being of similar length to E. coliMotB and both MotB2 and MotB3 of a longer length like thatfound in PomB of V. alginolyticus. Because of the inconclusivenature of these alignment results, we first tested each pair ofgenes for cross-complementation of E. coli motAB-defectivemutants, but we found that despite an almost identical codonusage, none of the genes complemented the E. coli mot mu-tants (data not shown). Thus, we decided to examine the ac-tivity of the motors produced in Bdellovibrio by deletion ofeach single pair of motAB genes, monitoring motility pheno-types in both predatory and HI lifestyles, and third, we testedthe ion specificity of the residual motors after deletion byaddition of proton motive force and sodium conductance in-hibitors CCCP and phenamil in the presence or absence ofdiverse sodium and pH conditions.

All six stator genes are expressed during the Bdellovibrio lifecycles, with motAB1 being upregulated toward the end of thepredatory cycle. Reverse transcription-PCR (RT-PCR) (Fig.3) showed that each motA and motB gene was expressed byboth HD and HI wild-type B. bacteriovorus HD100. Expressionof each of motA2, motB2, motA3, and motB3 was constitutiveacross the wild-type predatory cycle, while both motA1 andmotB1 were upregulated at 3 and 4 h postinfection, at whichpoint the wild-type Bdellovibrio cells were septating, producingflagella, and being released from the bdelloplast. The expres-sion of the fliC3 flagellin gene provided a control for thesynchrony of infection of the wild-type Bdellovibrio culture onthe prey; this is because we have previously shown that at 45min and 1 h of infection, fliC gene transcription and flagellarfilament synthesis cease while all the Bdellovibrio are growingintraperiplasmically (10). Interestingly, in contrast, the statormot transcripts are seen at all time points throughout the lifecycle.

Each pair of motAB genes can be individually inactivatedwithout abolishing either HD Bdellovibrio motility and preda-tion or HI growth and motility. Each pair of motAB genes wasindividually inactivated by deletion of extensive portions ofmotAB genes and replacement (Fig. 1) with a kanamycin re-sistance cassette. Both motAB1 and motAB2 deletion strainswere readily obtained in predatory cultures as host-dependent

VOL. 193, 2011 MOTOR PROTEINS IN BDELLOVIBRIO 935

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

23

Dec

embe

r 20

21 b

y 17

7.10

.195

.24.

(HD) strains (using methods as described in reference 13).However, despite repeated attempts, a motAB3 deletion straincould be obtained directly only as a host-independent (HI)strain, not directly in predatory culture. Despite this, when E.coli prey was added to the HI motAB3 strain, it invaded and

completed a predatory cycle, showing that predatory capabilitywas retained, but less successfully than for the motAB1 motAB2mutants. A motAB3 HD strain was obtained from a single(pure) plaque on an E. coli overlay plate after incubation of theHI motAB3 derivative with prey, and this strain was used in

FIG. 2. (a) Amino acid alignment of the MotA proteins from Bdellovibrio bacteriovorus HD100 (MotA1 � Bd0144, MotA2 � Bd3020, andMotA3 � Bd3254) with E. coli K-12 MG1655 MotA (AAC74959.1) and Vibrio alginolyticus PomA (AB004068). Sequences were aligned usingClustalW2 at http://www.ebi.ac.uk/Tools/clustalw2/index.html. The boxes highlight the four transmembrane regions (as identified in E. coli). (b)Amino acid alignment of the MotB proteins from Bdellovibrio bacteriovorus HD100 (BdmotB1 � Bd0145, BdmotB2 � Bd3019, and BdmotB3 �Bd3253) with E. coli K-12 MG1655 MotB (AAC74959.1) and Vibrio alginolyticus PomB (AB004068). Sequences were aligned using ClustalW2 athttp://www.ebi.ac.uk/Tools/clustalw2/index.html. The vertical box highlights the conserved D32 residue essential for function of all Mot/PomBs,while the first horizontal box indicates the single transmembrane domain and the second horizontal box the peptidoglycan binding region.

936 MOREHOUSE ET AL. J. BACTERIOL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

23

Dec

embe

r 20

21 b

y 17

7.10

.195

.24.

further characterizations in comparison to the predatorymotAB1 and motAB2 mutant strains.

The cell lengths of this motAB3 HD strain were slightlygreater than that of the wild type, but this is typical of HDstrains that are derived from HI strains by prey challenge. Aseach motAB deletion strain was kanamycin resistant, a fliC1merodiploid strain was used as a wild-type control. This straincontained both the original fliC1 gene and a kanamycin resis-tance cassette-disrupted gene and is a “reconstituted” wild-type strain for predation, growth rate, and motility. Electronmicroscopy (Fig. 4) showed that the cells of each motAB HDstrain had a single flagellum of wild-type length and waveform;thus, the motAB deletion did not affect flagellar production ormorphology.

Axenic growth (Fig. 5a) and motility were assayed for HIderivatives of the fliC1 merodiploid control, the motAB1 andmotAB2 strains produced as described previously (17), and theoriginal motAB3 HI strain. The axenic HI growth rate of eachmotAB mutant in PY medium was similar to that of the fliC1

merodiploid control, although each motAB deletion strainreached a higher final optical density. Light microscopy re-vealed that a percentage of each culture was motile at eachtime point tested (after 6, 10, 25, and 31 h of incubation,representing each stage of growth [lag, exponential, stationary,and decline phases, respectively]), although the actual percentmotility ranged from 1% to 30% in the fliC1 merodiploidcontrol and from 1% to 10% in each of the motAB deletionstrains. Thus, while motility was not abolished by deletion of asingle pair of motAB genes, the percent motility was decreasedin all cases compared to that of a wild-type control.

As Flannagan et al. (8) reported that downregulation of amotA1 homologue in B. bacteriovorus 109J resulted in signifi-cantly diminished predation due to delayed escape from bdel-loplasts, causing persistence of the downregulated motA1strain inside bdelloplasts for 30 h or more, we studied motilityof and predation by HD mutant strains. Motility analysis witha Hobson BacTracker (Table 2) showed that deletion ofmotAB1 or motAB2 resulted in reduced percent motility for

FIG. 2—Continued.

VOL. 193, 2011 MOTOR PROTEINS IN BDELLOVIBRIO 937

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

23

Dec

embe

r 20

21 b

y 17

7.10

.195

.24.

the culture, but not reduced swimming speeds compared towild-type levels, but that deletion of motAB3 resulted in sig-nificant reductions in both percent motility (from 98% for thewild-type fliC1 merodiploid to 25% for the motAB3 mutant)and swimming speed (from 63 �m/s for the wild type to 27�m/s for the motAB3 mutant). We have previously shown (13)that slower-swimming Bdellovibrio cells have reduced preda-tion efficiency as they collide with prey less frequently.

Twenty-four-hour E. coli predation assays consisting of mul-tiple rounds of infection (Fig. 5b), with an average startingpredator/prey ratio of 1:20, revealed that the predation effi-ciencies of the motAB1 and motAB2 mutants were not signif-icantly different from that of the fliC1 merodiploid control inthis experiment. The motAB1 strain seemed to have a smallreduction in predation at between 12 and 15 h, but the valuewas not statistically different from that for the control. ThemotAB3 mutant, with comparable starting numbers of viable,predatory Bdellovibrio cells, was significantly slower at preda-tion, reaching completion of prey lysis only after 19 h of incu-bation in comparison to 14 to 15 h for the wild-type fliC1merodiploid control in a typical 50-ml predatory culture, butthe motAB3 mutant gave a yield of predatory Bdellovibrio com-parable to that for the control when assayed by viable count(PFU) after 24 h of incubation (between 1 � 108 and 2 � 108

PFU/ml). Both the motAB1 and motAB2 strains were identicalto the wild-type fliC1 merodiploid in Bdellovibrio yield frompredatory cultures.

Prey entry and flagellum-mediated movement within bdel-loplasts. As we had found that contrary to the results of Flan-nagan and coworkers, (8), the B. bacteriovorus motAB1 strainwas not significantly slower at predation during multiplerounds of infection, a single round of infection by each of themotAB1 and motAB2 strains was compared to that by the fliC1merodiploid control by light microscopy in a “bdelloplast per-sistence assay.” Analysis of these single rounds of infection

(see Fig. S1 in the supplemental material), using a startingratio of a minimum of five predatory Bdellovibrio cells to oneprey E. coli cell, showed that the motAB1 mutant was slowerthan either the fliC1 merodiploid control or the motAB2 mu-tant at lysing the bdelloplast. Entry was seen to occur at thesame rate for all three strains (fliC1 merodiploid, motAB1, andmotAB2), and while all bdelloplasts were lysed at between 4and 6 h for the fliC1 and motAB2 samples, bdelloplasts wereseen in the motAB1 culture until after greater than 8 h ofincubation. However, an increase of free-swimming Bdello-vibrio cells was seen in the motAB1 infection culture after 6 h,suggesting that some bdelloplast lysis had occurred, liberatingthe motile progeny. This would account for the small, notsignificant reduction in predation efficiency seen in the 24-hexperiment described above.

Bdellovibrio cells have been observed by ourselves and others(28; R. E. Sockett lab, unpublished observations) to swimwithin bdelloplasts after septation is complete and before thebdelloplast membrane lyses. To assess whether any individualpair of MotAB proteins was responsible for this motility, late-stage bdelloplasts, made from Bdellovibrio-infected filamen-tous E. coli prey, were visualized using phase-contrast micros-copy, and videos of flagellum-mediated swimming motilitywithin bdelloplasts were taken (see Videos S1 to S4 in thesupplemental material). Swimming in bdelloplasts postsepta-tion and immediately prior to bdelloplast lysis was seen for the

FIG. 4. Electron microscopic images of the HD100 �motAB mu-tants. (a) fliC1 merodiploid wild-type control; (b) motAB1 mutant; (c)motAB2 mutant; (d) motAB3 mutant. Cells were stained with 0.5%uranyl acetate, pH 4. Scale bars show 1 �m.

FIG. 3. Agarose gel electrophoresis of RT-PCR products of eachmotA and motB gene on RNA isolated from a synchronous predatoryculture of B. bacteriovorus HD100 preying upon E. coli S17-1. Lanes:1,attack-phase wild-type HD100; 2, 15 min postinfection; 3, 30 minpostinfection; 4, 45 min postinfection; 5, 1 h postinfection; 6, 2 hpostinfection; 7, 3 h postinfection; 8, 4 h postinfection; 9, HID13; 10,no-template negative control; 11, E. coli S17-1 only; 12, wild-typeHD100 genomic DNA positive control.

938 MOREHOUSE ET AL. J. BACTERIOL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

23

Dec

embe

r 20

21 b

y 17

7.10

.195

.24.

fliC1 merodiploid control and for all three motAB deletionstrains, showing that no single pair of MotAB proteins is re-quired for swimming under bdelloplast conditions.

Expression of motAB gene pairs is changed by the deletion ofother motAB gene pairs. We monitored the level of transcrip-tion of each of the mot genes in matched total RNA concen-trations from attack-phase cells of wild-type and mot mutantbackgrounds and found that there was a significant downregu-lation of motA3 and motB3 gene expression in both themotAB1 and motAB2 mutants compared the wild type (Fig. 6,lanes 2 and 3 compared to lanes 1 for the motA3 and motB3

FIG. 5. HI and predatory growth of each motAB deletion strain alongside a fliC1 merodiploid (wild-type) control. (a) HI growth wasmeasured by optical density at 600 nm (in milli-OD units) from a starting OD600 of 0.1 for each culture. Points represent the means for 24individual samples, and error bars represent the 95% confidence interval around the mean. (b) Predation efficiencies of HD BdellovibriomotAB deletion mutants. The bdelloplast lysis rate of each strain as measured using optical density (OD600) is shown; a drop in ODcorresponds to lysis of prey cells.

TABLE 2. Motile percentage of population and swimming speedof attack-phase cells of each Bdellovibrio motAB mutant in

comparison to that of the fliC1 merodiploid (wild typefor motility) in Ca-HEPES buffer, pH 7.6

Strain Motile fraction (%) Mean swimming speed(�m/s) � SD

fliC1 merodiploid 98 63.2 � 5.5motAB1 mutant 75 66.1 � 3.8motAB2 mutant 50 63.6 � 5.3motAB3 mutant 25 26.5 � 1.8

FIG. 6. Agarose gel electrophoresis of RT-PCR products of thethree motA and motB genes on matched attack-phase RNA templates.Lanes: 0, attack-phase fliC1 merodiploid; 1, attack-phase wild-typeHD100; 2, attack-phase motAB1 mutant; 3, attack-phase motAB2 mu-tant; 4, attack-phase motAB3 mutant; 5, no template; 6, wild-typeHD100 genomic DNA positive control.

VOL. 193, 2011 MOTOR PROTEINS IN BDELLOVIBRIO 939

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

23

Dec

embe

r 20

21 b

y 17

7.10

.195

.24.

primers) but that this was not the case for the expression ofmotAB1 or motAB2. (It was not possible to compare expressionlevels across primer sets as they were of different designs andhybridization stringencies, nor was it possible to match RNAconcentrations and repeat the experiment across the predatorycycle because of contaminating prey RNA concentrations vary-ing.) The expression of fliC1 was constant across the mutants,coincident with the observation of single flagella on each strainin Fig. 4, and this was unaffected by the mot mutations.

Testing driving ions for motAB mutant flagella. Bdellovibriospecies are not alkalophilic bacteria, so they would not beexpected to have sodium-driven motors; however, the Mot

protein sequence alignments did show some Pom-like homol-ogy, so to show whether any of the Bdellovibrio MotAB pairsmight conduct sodium instead of protons, rather than beingPom-like Mot proteins that conduct protons, we tested theeffects of changing the level of sodium in the medium onmotility by using the ionophore CCCP to dissipate the protonmotive force and used the sodium channel blocker phenamil.As Fig. 7a shows, addition of phenamil significantly reducedthe motility of the wild-type fliC1 merodiploid control strainfrom 90% to 50%; however, the swimming speed of the cellsremaining motile was not statistically significantly reducedcompared to that for the control treated with dimethyl sulfox-

FIG. 7. Bdellovibrio motility in the presence of phenamil, NaCl, and CCCP. (a) Mean swimming speed (� standard deviation) and percentmotility in the presence of the sodium channel inhibitor phenamil. (b) Mean swimming speed in Ca-HEPES buffer at pH 8.2 with different NaClconcentrations. Error bars show the standard deviation around the mean. (c) Mean swimming speed (� standard deviation) and percent motilityin the presence of the proton channel inhibitor CCCP.

940 MOREHOUSE ET AL. J. BACTERIOL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

23

Dec

embe

r 20

21 b

y 17

7.10

.195

.24.

ide (DMSO). Interestingly, for none of the other three motABminus strains was such a drastic reduction in percent motilityseen on the addition of phenamil; indeed, for the motAB1 andmotAB3 mutants there was a modest increase in percent cul-ture motility upon addition of phenamil compared to that forthe DMSO control.

Although phenamil is reported to be a sodium channelblocker, some non-sodium channel effects have been reportedfor it, so we also tested the mean run speeds of the strains inconcentrations of sodium chloride from 0 to 50 mM at a con-stant alkaline pH of 8.2 (Fig. 7b). We saw no significant dif-ference in swimming speed for any of the strains, althoughthere was a small, nonsignificant rise in swimming speed for thefliC1 merodiploid control only at 5 mM NaCl; however, therewas no increase in percent motility of the strain after theaddition of 5 mM NaCl. We also tested the effect of thepresence or absence of 5 mM NaCl on predation efficiency butfound that it had no effect on any of the strains (data notshown). We found (Fig. 7c) that addition of the proton iono-phore CCCP to all of the strains abolished motility at a finalconcentration of 5 �M and reduced motility at 2 �M, suggest-ing that flagellar motility is driven by the proton motive force.Addition of 25 mM NaCl did not, however, significantly relievethe motility drop (in terms of speed or percent motility of theculture) as CCCP was added, indicating that there was nosufficient sodium motive force driving the flagella that couldsubstitute for the removal of the proton motive force.

DISCUSSION

Deletion of any pair of the three motAB genes of B. bacte-riovorus HD100 did not abolish flagellar motility, and all threemotAB single mutant strains retained predatory competence,although the percent motility and speed of a motAB3 Bd3253/Bd3254 deletion strain was significantly reduced compared tothose of wild-type and motAB1 and motAB2 mutant strains.This may suggest that conductance through a stator containingMotA3 and/or MotB3 causes rapid swimming of the attack-phase Bdellovibrio, which we studied in our experiments, andthus that the MotAB3 proteins are important to attack-phaseswimming by B. bacteriovorus HD100. Under our experimentalconditions, Bdellovibrio cells were swimming at average speedsof 70 to 75 �m s�1, although we have measured individualsingle cells swimming much faster than this at different timesafter release from prey. That the motAB3 mutation has thestrongest detrimental effect on speed and percent motility maysuggest that one or more of the MotAB3 proteins are moreabundant in the wild-type stator, possibly during the attackphase, or that one of the MotAB3 proteins has a packing/scaffolding role that most efficiently assembles the other Motproteins in the stator. Interestingly, all motAB mutants and thecontrol strain were motile both outside and inside the bdello-plast and during HI axenic growth, and thus we conclude thatnone of the gene pairs are retained to allow a specific growthmode of Bdellovibrio to occur. We suggest that possibly thethree motAB gene pair copies are selected for because theirproducts ensure that predatory and prey-independent growthmodes are always possible, even if natural mutations were todamage one mot gene pair. This allows Bdellovibrio to retaingrowth mode flexibility under conditions of changing prey

availability for predation versus organic matter availability forHI growth.

Flannagan and coworkers (8) had previously shown thatdownregulation of the motA1 homologue in Bdellovibrio bac-teriovorus strain 109J resulted in slow tumbling motility of thebacteria and long-delayed escape from E. coli bdelloplasts(with turbidity values of the E. coli bdelloplasts containing theBdellovibrio with the downregulated motA1 gene resemblingthat of uninfected E. coli prey for 30 h of infection), implicatingmotAB1 as being important in successful lysis of prey andrelease of progeny B. bacteriovorus 109J. We found that dele-tion of the motAB1 Bd0144 and -5 genes from B. bacteriovorusHD100 did not alter the speed or motile behavior of freeprogeny Bdellovibrio, nor did it prevent predation occurringefficiently, but we did find that there was a delay of approxi-mately 2 h in the bdelloplast release time in motAB1 mutantscompared to controls. Thus, we agree with Flannagan andcoworkers that deletion of motA1 in Bdellovibrio does slowpredator release from prey, but this is a minor effect in ourHD100 strain compared to their 109J strain (8). This mayimply that MotAB1 proteins are a more important or abundantcomponent of the flagellar motor than MotAB2 and -3 whenthe flagellum is synthesized in dividing Bdellovibrio cells insidethe bdelloplast.

The tumbling motility observed and the extreme effect onprey lysis that Flannagan and coworkers reported for themotA1 downregulated strain may have been due to strain dif-ferences or to the plasmid present in the 109J strain, as theauthors themselves discuss (8). As genome sequence and motgene expression data are not available for 109J, we cannot saywhether these differences were due to there being a differentsupporting complement of other motAB genes in the B. bacte-riovorus 109J genome compared to that of HD100. However,our RT-PCR primers for each HD100 mot gene (used for Fig.3 and 6) do amplify a band from genomic DNA of strain 109Jthat is similar in size to that seen for HD100 (data not shown).However, to test the roles of each MotAB protein pair forpredatory and HI growth in a strain where a full genomesequence was available (21), we continued to study the role ofeach motAB gene pair by deletion mutagenesis in strainHD100.

The finding that each HI motAB mutant strain reached ahigher final optical density when growing axenically than didthe fliC1 merodiploid control (Fig. 5a) suggested that possiblythe loss of any single pair of MotAB proteins may increase theproton flux through the ATP synthase, as less flux is beingdiverted through the missing MotAB protein pair that is notexpressed. This would, however, imply that all three MotABproteins normally contribute to the stator of the Bdellovibrioflagellum during HI growth as well as HD growth. This sug-gestion was supported by the transcriptional expression studiesin Fig. 3, which showed consistent HD and HI expression of allmotAB genes.

There was not a significant difference between the predatorydegradation of prey by the fliC1 merodiploid “reconstituted”Knr wild-type control and the motAB1 and motAB2 HD strains(Fig. 5b) after 20 h of incubation, and there was only a smalldifference in the HD motAB3 strain derived from the originalmotAB3 HI mutant; this suggested that even slower motilitywas sufficient for the cells to collide with prey and enter them

VOL. 193, 2011 MOTOR PROTEINS IN BDELLOVIBRIO 941

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

23

Dec

embe

r 20

21 b

y 17

7.10

.195

.24.

under our lab conditions. However, the fact that we could notisolate the motAB3 mutant originally as a predatory plaque onsoft agar overlays of E. coli lawns shows that the predatoryability of Bdellovibrio in soft agar is more affected by mutationswhich slow swimming than is predation in liquid cultures.

The differing sequence similarities between each MotABprotein pair and the Mot and Pom proteins of other bacteriaand the lack of extensive identity between any two BdellovibrioMotA or MotB proteins show that they may have been an-ciently acquired by lateral gene transfer from different bacte-ria. That they are all transcribed throughout the predatorycycle and during HI growth shows that they are beneficial tofitness. In Table 2 and Fig. 7a and 7c the different speed andpercent motility responses of each of the mutants lacking asingle MotAB pair suggest that motors containing differentpairs of MotAB proteins do have slightly different rotationalcharacteristics. The percent motility of cultures of the wild-type control and fliC1 merodiploid strains dropped more in thepresence of 50 �M phenamil than did that any of the singlemutants (with the motAB3 percent motility actually rising inresponse to phenamil). This may suggest that a cross-combi-nation of MotA and MotB proteins produced across differentmot gene clusters may produce a phenamil-sensitive site inwild-type motors. This is expected from work with alkalophilicbacteria which showed that mutations in both the MotA andMotB equivalent proteins together are required for phenamilresistance, implying that phenamil binds across the MotABproteins (11). It is interesting to note from the alignment ofBdellovibrio Mot proteins that solely MotA3 has a conservedamino acid, D175, with the D148 of Vibrio alginolyticus PomAwhich is implicated in the phenamil binding region; however,none of the Bdellovibrio MotB proteins have the equivalentresidue to Vibrio alginolyticus PomB P16, which was proposedto be in the vicinity of the other part of the phenamil bindingsite in Na�-driven motors (11). It is also possible that only inthe wild-type motor are all the Mot proteins present in aparticular functional conductive conformation and thereforeare more susceptible to channel blockage as part of the wild-type stator, rather than in the conformation in mutant statorswhere their conformation is altered by missing another Motprotein.

The phenamil inhibition may be indicative not of there beingany Na� conductance through Bdellovibrio motors but ratherof the ancient lateral gene transfer of pom genes into Bdello-vibrio from an alkalophilic bacterium and their modificationthrough natural selection to conduct protons. For instance, theregions in the MotAB proteins of the solely H�-conductingmotor of Rhodobacter sphaeroides corresponding to those thatbind phenamil in the PomAB proteins of the Na�-driven mo-tor of Vibrio alginolyticus were shown by Asai and coworkers, ina hybrid MomB protein coupled with a Rhodobacter MotAprotein, to confer phenamil sensitivity and thus binding despitethe motor conducting protons (1).

The observation of phenamil inhibition of a proton-drivenmotor in another bacterium fits with the lack of a significantchange in motility in increasing sodium concentrations at pH8.2 (Fig. 7b) and with the CCCP sensitivity of motility, unre-lieved by sodium (Fig. 7c). Thus, we conclude that the flagel-lum of Bdellovibrio is powered, in both predatory HD and in HIgrowth modes, by a complex derived from a functionally re-

dundant set of six MotAB proteins and that it is driven by theproton motive force. Selective deletion of each of the six motgenes in combination was beyond the scope of this study and isa technical challenge in Bdellovibrio, but our gene expressionand single motAB deletion studies have shown that some or allof the products of each of the three motAB gene clusterscontribute to flagellar rotation in predatory and HI growth.

Predatory growth does require active location of prey bymotility and taxis and fast motility to bring Bdellovibrio near toprey surfaces, so flagellar motility is “important” to Bdello-vibrio. We have previously shown that there is 6-fold duplica-tion of flagellar filament fliC genes in B. bacteriovorus HD100and that all of these FliC proteins contribute to the expressedflagellar filament structure (10, 13). Our current work on Motproteins further emphasizes that Bdellovibrio is a “dedicatedmotorist” in which the need to be motile, to be able to use thelarge chromosomal complement of predatory invasion genes toaccess an intrabacterial niche where feeding and growth arewithout competition, results in the retention of several activecopies of flagellar motor protein genes. This may ensure thatrandom natural mutagenic events do not cause it to “breakdown” and no longer be able to benefit from predatory inva-sion to grow.

ACKNOWLEDGMENTS

This was funded by BBSRC grant 42/P18196 to R.E.S. for K.A.M.and by Human Frontier Science Programme grant RGP0057/2005-C toR.E.S. for L.H.

We thank Carey Lambert for assistance with RT-PCR, AndrewFenton for assistance with video microscopy, and Marilyn Whitworthfor technical help.

REFERENCES

1. Asai, Y., I. Kawagishi, R. E. Sockett, and M. Homma. 2000. Coupling ionspecificity of chimeras between H�- and Na�-driven motor proteins, MotBand PomB, in Vibrio flagella. EMBO J. 19:3639–3648.

2. Barabote, R. D., S. Rendulic, S. C. Schuster, and M. H. Saier, Jr. 2007.Comprehensive analysis of transport proteins encoded within the genome ofBdellovibrio bacteriovorus. Genomics 90:424–446.

3. Barel, G., and E. Jurkevitch. 2001. Analysis of phenotypic diversity amonghost-independent mutants of Bdellovibrio bacteriovorus 109J. Arch. Micro-biol. 176:211–216.

4. Bierman, M., et al. 1992. Plasmid cloning vectors for the conjugal transfer ofDNA from Escherichia coli to Streptomyces spp. Gene 116:43–49.

5. Cotter, T. W., and M. F. Thomashow. 1992. Identification of a Bdellovibriobacteriovorus genetic locus, hit, associated with the host-independent phe-notype. J. Bacteriol. 174:6018–6024.

6. Evans, K. J., C. Lambert, and R. E. Sockett. 2007. Predation by Bdellovibriobacteriovorus HD100 requires type IV pili. J. Bacteriol. 189:4850–4859.

7. Fenton, A. K., C. Lambert, P. C. Wagstaff, and R. E. Sockett. 2010. Manip-ulating each MreB of Bdellovibrio bacteriovorus gives diverse morphologicaland predatory phenotypes. J. Bacteriol. 192:1299–1311.

8. Flannagan, R. S., M. A. Valvano, and S. F. Koval. 2004. Downregulation ofthe motA gene delays the escape of the obligate predator Bdellovibriobacteriovorus 109J from bdelloplasts of bacterial prey cells. Microbiology150:649–656.

9. Hanahan, D. 1983. Studies on transformation of Escherichia coli with plas-mids. J. Mol. Biol. 166:557–580.

10. Iida, Y., et al. 2009. Roles of multiple flagellins in flagellar formation andflagellar growth post bdelloplast lysis in Bdellovibrio bacteriovorus. J. Mol.Biol. 394:1011–1021.

11. Kojima, S., Y. Asai, T. Atsumi, I. Kawagishi, and M. Homma. 1999. Na�-driven flagellar motor resistant to phenamil, an amiloride analog, caused bymutations in putative channel components. J. Mol. Biol. 285:1537–1547.

12. Lambert, C., C. Y. Chang, M. J. Capeness, and R. E. Sockett. 2010. The firstbite—profiling the predatosome in the bacterial pathogen Bdellovibrio.PLoS One 5:e8599.

13. Lambert, C., et al. 2006. Characterizing the flagellar filament and the role ofmotility in bacterial prey-penetration by Bdellovibrio bacteriovorus. Mol. Mi-crobiol. 60:274–286.

14. Lambert, C., et al. 2009. A predatory patchwork: membrane and surfacestructures of Bdellovibrio bacteriovorus. Adv. Microb. Physiol. 54:313–361.

942 MOREHOUSE ET AL. J. BACTERIOL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

23

Dec

embe

r 20

21 b

y 17

7.10

.195

.24.

15. Lambert, C., K. A. Morehouse, C. Y. Chang, and R. E. Sockett. 2006.Bdellovibrio: growth and development during the predatory cycle. Curr.Opin. Microbiol. 9:639–644.

16. Lambert, C., M. C. Smith, and R. E. Sockett. 2003. A novel assay to monitorpredator-prey interactions for Bdellovibrio bacteriovorus 109 J reveals a rolefor methyl-accepting chemotaxis proteins in predation. Environ. Microbiol.5:127–132.

17. Lambert, C., and R. E. Sockett. 2008. Laboratory maintenance of Bdello-vibrio. Curr. Protoc. Microbiol. 7:7B 2.

18. Lowry, O. H., N. J. Rosebrough, A. L. Farr, and R. J. Randall. 1951. Proteinmeasurement with the Folin phenol reagent. J. Biol. Chem. 193:265–275.

19. Macnab, R. M. 2003. How bacteria assemble flagella. Annu. Rev. Microbiol.57:77–100.

20. Paulick, A., et al. 2009. Two different stator systems drive a single polarflagellum in Shewanella oneidensis MR-1. Mol. Microbiol. 71:836–850.

21. Rendulic, S., et al. 2004. A predator unmasked: life cycle of Bdellovibriobacteriovorus from a genomic perspective. Science 303:689–692.

22. Rogers, M., N. Ekaterinaki, E. Nimmo, and D. Sherratt. 1986. Analysis ofTn7 transposition. Mol. Gen. Genet. 205:550–556.

23. Simon, R., U. Preifer, and A. Puhler. 1983. A broad host range mobilisationsystem for in vivo genetic engineering: transposon mutagenesis in gramnegative bacteria. Biotechnology 9:184–191.

24. Southern, E. M. 1975. Detection of specific sequences among DNA frag-ments separated by gel electrophoresis. J. Mol. Biol. 98:503–517.

25. Stolp, H., and M. P. Starr. 1963. Bdellovibrio bacteriovorus gen. et sp. n., apredatory, ectoparasitic, and bacteriolytic microorganism. Antonie VanLeeuwenhoek J. Microbiol. Serol. 29:217–248.

26. Thomashow, L. S., and S. C. Rittenberg. 1985. Isolation and composition ofsheathed flagella from Bdellovibrio bacteriovorus 109J. J. Bacteriol. 163:1047–1054.

27. Thomashow, L. S., and S. C. Rittenberg. 1985. Waveform analysis andstructure of flagella and basal complexes from Bdellovibrio bacteriovorus109J. J. Bacteriol. 163:1038–1046.

28. Thomashow, M. F., and S. C. Rittenberg. 1979. Descriptive biology of thebdellovibrios, p. 115–138. In J. H. Parish (ed.), Developmental biology ofprokaryotes, 9th ed. University of California Press, Berkeley, CA.

29. Toutain, C. M., M. E. Zegans, and A. O’Toole, G. 2005. Evidence for twoflagellar stators and their role in the motility of Pseudomonas aeruginosa. J.Bacteriol. 187:771–777.

30. Varon, M., and M. Shilo. 1980. Ecology of aquatic bdellovibrios, p. 1–41. InM. R. Droop and H. W. Jannesch (ed.), Advances in aquatic microbiology,vol. 2. Academic Press, London, United Kingdom.

31. Vieira, J., and J. Messing. 1982. The pUC plasmids, an M13mp7-derivedsystem for insertion mutagenesis and sequencing with synthetic universalprimers. Gene 19:259–268.

32. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phagecloning vectors and host strains: nucleotide sequences of the M13mp18 andpUC19 vectors. Gene 33:103–119.

VOL. 193, 2011 MOTOR PROTEINS IN BDELLOVIBRIO 943

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

23

Dec

embe

r 20

21 b

y 17

7.10

.195

.24.