title: experimental arthritis inhibits the insulin-like growth factor-i

Title: Experimental arthritis inhibits the insulin-like growth factor-I (IGF-I) axis and induces muscle wasting through cyclooxygenase-2 (COX-2) activation

Authors: Miriam Granado, Ana I Martín, Mª Ángeles Villanúa, and Asunción López-Calderón. Departamento Fisiología, Facultad de Medicina, Universidad Complutense. 28040 Madrid. Spain.

Abbreviated title: COX-2, IGF-I axis and muscular wasting in arthritis

CORRESPONDING AUTHOR AND REPRINT REQUESTS: A. López-Calderón.

Dpt Fisiología, Fac Medicina.Univ Complutense.28040, Madrid.Phone: 3491-3941491FAX: 3491-3941628e-mail: [email protected]

of 46Articles in PresS. Am J Physiol Endocrinol Metab (February 6, 2007). doi:10.1152/ajpendo.00502.2006

Copyright © 2007 by the American Physiological Society.

COX-2, IGF-I axis and muscular wasting in arthritis

2

ABSTRACT

Chronic arthritis induces cachexia associated with an inhibition of the GH-IGF-I

system and an activation of the E3 ubiquitin-ligating enzymes MAFbx and MuRF1 in

the skeletal muscle. The aim of this work was to study the role of COX-2 in chronic

arthritis-induced cachexia. Arthritis was induced in rats by Freund’s adjuvant

injection, and the effect of two COX inhibitors; indomethacin, a nonspecific inhibitor,

and meloxicam, a selective COX-2 inhibitor, on pituitary GH, and on liver and serum

IGF-I levels were tested. Arthritis decreased body weight gain and GH and liver IGF-I

gene expression. In the arthritic rats, both inhibitors, indomethacin and meloxicam,

prevented the inhibitory effect of arthritis on body weight gain. Indomethacin and

meloxicam administration to arthritic rats increased pituitary GH and liver IGF-I

mRNA as well as serum levels of IGF-I. These data suggest that induction of COX-2

during chronic inflammation is involved in the inhibition of the GH-IGF-I axis and in

the body weight loss. In the gastrocnemius muscle, arthritis increased the gene

expression of TNF-α, the E3 ubiquitin-ligating enzymes MAFbx and MuRF1 as well

as of IGF-I and IGFBP-5. Inhibition of COX-2 by meloxicam administration increased

gastrocnemius weight and decreased MAFbx, MuRF1, TNF-α and IGFBP-5 gene

expression. In summary, our data indicate that chronic arthritis-induced cachexia and

muscle wasting are mediated by the COX-2 pathway resulting in a decreased GH-

IGF-I secretion and increased expression of MAFbx and MuRF1 mRNA.

KEY WORDS: indomethacin, meloxicam, TNF-α, MuRF1, MAFbx,

of 46


3

INTRODUCTION

Chronic inflammation is associated with a decrease in body weight and

cachexia. One of the numerous factors that can be involved in inflammatory

cachexia is the neuroendocrine system. The neuroendocrine response to

inflammation is characterized by an increase in the secretion of catabolic hormones

such as glucocorticoids and a decreased secretion of anabolic factors such as

insulin-like growth factor-I (IGF-I) (24). These modifications, together with the

increased release of cytokines, can result in hypermetabolism and a decrease in

body weight.

Adjuvant-induced arthritis is an experimental model of rheumatoid arthritis that

is induced in rats by an intradermal injection of Freund’s adjuvant. Ten days after

adjuvant injection rats start to lose body weight even before the external signs of the

illness are manifested (37). Cachexia and hypermetabolism have also been reported

in rheumatoid arthritis patients (52). Rheumatoid cachexia has been postulated as

an important contributor in increasing morbidity and premature mortality in

rheumatoid arthritis patients (62). Cachexia in experimental arthritis is associated

with a decreased secretion of the growth hormone (GH)-IGFI axis, whereas GH

administration to arthritic rats is able to increase body weight gain (28). The

increased production of cytokines, mainly tumor necrosis factor-α (TNF-α) seems

also to be involved in inflammatory cachexia, since the neutralization of TNF-α in

arthritic rats increases body weight gain as well as pituitary GH and liver IGF-I gene

expression (21).

Possible factors that can mediate the cachetic effect of TNF-α are

prostaglandins. Pro-inflammatory cytokines induce the production of prostaglandin

E2 (PGE2), which plays an important role in the inflammatory response.

of 46


4

Cyclooxygenases (COXs) are the key enzymes in regulating the biosynthesis of

prostaglandins. There are two COX isoforms, encoded by different genes, COX-1

which is constitutively expressed and COX-2 which is inducible by pro-inflammatory

cytokines and other stimuli. COX-2-induced synthesis of prostaglandins has been

associated with chronic inflammation including arthritis, since the anti-inflammatory

effect of selective COX-2 inhibitors is as effective as non-selective inhibitors (17).

However, the role of COX-1 in inflammation has also been proposed (13).

Body weight loss in cachexia is secondary to muscle wasting and to

enhanced protein breakdown by the ubiquitin-proteasome proteolitic pathway (34).

MAFbx (Muscle Atrophy F-box) and MuRF1 (Muscle Ring Finger 1) are muscle

specific E3 ubiquitin-ligating enzyme that play an important role in muscle atrophy,

and serve as early markers of skeletal muscle atrophy, aiding in the diagnosis of

muscle disease. MAFbx overexpression in C2C12 cells induces a decrease in

myotube diameter, and mice deficient in MAFbx or MuRF1 are resistant to

denervation induced muscle atrophy (5). In addition, MAFbx and MuRF1 mRNA are

increased in atrophying muscle of many inflammatory conditions including sepsis

(64) and chronic arthritis (20).

Proinflammatory cytokines such as IL-1 and TNF-α have been reported to

increase muscle protein proteolysis by the ubiquitin-proteasome pathway (for review

see 1). In addition to cytokines, the increased activity of COX can be responsible for

muscle wasting and cachexia. Activation of COX-2 pathways has been observed in

several cachetic states conditions such as cancer and sepsis (15, 19). COX

inhibitors are able to ameliorate cancer cachexia and to improve body composition

both in experimental animals and humans (15, 26, 39). Inhibition of COX activity

prevents muscular wasting in cancer and reduces the ubiquitin ligases (25).

of 46


5

However, the anti-cachexic effect of the inhibitors of prostaglandin synthesis has

been reported in several types of cancer, whereas they are unable to prevent cancer

cachexia in others (23).

The use of non-steroidal anti-inflammatory drugs (NSAIDS) or unspecific COX

inhibitors has possible side effects on gastrointestinal function and hematological

tissues especially in chemotherapy treatments in cancer patients. However, NSAIDS

are widely used in inflammatory conditions such as rheumatoid arthritis due to their

effective anti-inflammatory activity. Accordingly, the aim of this work was to elucidate

the effect of COX inhibition on experimental arthritis-induced cachexia. For that

reason, we compared the response in arthritic rats to treatment with an unspecific

COX inhibitor, indomethacin, and a COX-2 inhibitor, meloxicam, on body weight, on

the GH-IGF-I system and in the gene expression of the E3 ubiquitin-ligating

enzymes, MAFbx and MuRF1, in skeletal muscle. We have previously observed that

arthritis increases TNF-α and IGF binding protein-5 (IGFBP-5) gene expressions in

the gastrocnemius (20). Since they can be a negative regulators of IGF-I signaling

and of muscular growth, the expression of these two genes were also analyzed.

MATERIAL AND METHODS

Arthritic and control male Wistar rats were purchased from Charles River

(Barcelona, Spain) weighing 150-175 g (6 weeks old) at the beginning of the

experiment. Arthritis was induced in the rats by a intradermal injection of 1 mg heat-

inactivated Mycobacterium butyricum in incomplete Freund’s adjuvant in the right

paw. Control animals were injected with mineral oil. Rats were housed 3-4 per cage

under controlled conditions of light (lights on from 7:30 to 19:30 h) and temperature

(22 ± 2º C). Food and water were available "ad libitum". Assessment of arthritis was

of 46


6

performed by measuring the arthritis index of each animal, which was scored by

grading each paw from 0 to 4. Grading was determined as: 0- no erythema or

swelling. 1- slight erythema or swelling of one or more digits. 2- swelling of entire

paw. 3- erythema and swelling of the ankle. 4- ankylosis, incapacity to bend the

ankle. The severity score was the sum of the clinical scores of each limb, the

maximum value being 16. The procedures followed the guidelines recommended by

the EU for the care and use of laboratory animals, and were approved by the

University animal care committe.

Indomethacin administration

On day 15 after adjuvant injection, control and arthritic rats were randomly

divided into 2 groups; one was injected daily with the unspecific COX inhibitor

indomethacin (4 mg/ kg sc Sigma, Madrid, Spain) and the second was injected with

vehicle (250 µl of 0.5% NaHCO3). Indomethacin dose was selected after a study

showing that this dose prevents muscle wasting in cancer and weight loss in arthritic

rats (25, 58). Body weight, food intake and the arthritis index scores were examined

daily. Food intake per cage was calculated by measuring the difference between the

initial and the remaining amount of pellets in the feeder, and expressed as g per rat

per 100 g body weight per day. All rats were killed by decapitation 22 days after

adjuvant or vehicle injection and after 8 days of indomethacin treatment, 2.5 h after

the last injection. Trunk blood was collected in cooled tubes, allowed to clot,

centrifuged and the serum was stored at -20º C until IGF-I assay was performed and

at - 80º C until PGE2 analysis was performed. The left hind paw was amputated at

the ankle level, and the volume measured by water displacement. Immediately after

decapitation the pituitary and the liver were removed, dissected, frozen in liquid

nitrogen and stored at -80 C until ribonucleic acid (RNA) extraction.

of 46


7

Meloxicam administration

The effect of meloxicam administration, a COX-2 inhibitor, was examined. On

day 15 arthritic and control rats were divided into two groups; one was injected with

meloxicam (1 mg/kg sc, Sigma), and the second received 250 µl of saline sc, from

day 16 to 22. This dosage was selected, since it was reported to be close to an

optimal anagelsic dose as previously described (54). Rats were injected, weighed

and the arthritis score index and the food intake were examined daily. None of the

rats died during the experimental procedures. On day 22 after adjuvant injection rats

were killed and blood was allowed to clot, centrifuged and the serum was stored until

IGF-I and PGE2 assays were performed. The left hind paw volume, gastrocnemius

muscle, pituitary, kidney and heart weights were measured. The pituitary, liver and

gastrocnemius muscle were dissected, frozen in liquid nitrogen and stored at -80 C

until ribonucleic acid (RNA) extraction.

Serum IGF-I and PGE2

Serum IGF-I concentrations were measured by a double-antibody RIA. Serum

IGF-I binding proteins (IGFBPs) were removed by acid-ethanol extraction. The IGF-I

antiserum (UB2-495) was a gift from Dr. Underwood and Dr. Van Wyk, and it is

distributed by the Hormone Distribution Program of NIDDK through the National

Hormone and Pituitary Program. Levels of IGF-I were expressed in terms of IGF-I

from Gropep Ltd. (Adelaide, Australia). The intra-assay coefficient of variation was

8%. Samples from one experiment were run in the same assay.

Serum concentrations of PGE2 were measured by an enzymeimmunoassay

(EIA) system using a commercial kit (Amersham Biosciences, Buckinghamshire, UK)

of 46


8

following the manufacturer’s instructions (http://amersham.com).

Real-time PCR

RNA was extracted by the guanidine thiocyanate method using a commercial

kit (UltraspecTM RNA, Biotecx Laboratories Inc. Houston, Texas, USA). The integrity

of the RNA was confirmed using agarose gel electrophoresis. For RT-PCR analysis,

2 µg pituitary, liver or skeletal muscle total RNA was reverse-transcribed in a total

volume of 30 µl at 37ºC for 15 min with 125 U of MMLV reverse transcriptase

(Maxim Biotch Inc, San Francisco, CA, USA).

Primers for PCR (table 1), were obtained from Qiagen (Valencia, CA, USA)

from previously published sequences of IGF-I, TNF-α and MuRF1 (16),

hypoxanthine-guanine phosphorybosyl transferase (Hprt) (47), COX-2 (6) or by

using the rat GenBank and the EXIQON ProbeLibrary GH, IGFBP-5 and MAFbx.

Primers were designed to span a single sequence derived from two exons (i.e.,

separated by an intron in genomic DNA and primary RNA transcripts to minimize

amplification).

Each real-time PCR reaction contained 10 ng of synthesized cDNA, 1x

Takara SYBR Green Premix Ex Taq (Takara BIO INC, Japan), and 300 nM forward

and reverse primers for the candidate gene in a reaction volume of 25 µl. Reactions

were carried out on a SmartCycler® (Cepheid, Sunnyvale, CA, USA).

Parameters included an initial activation of hotStarTaq DNA polymerase at

95º C for 15 min, followed by 40 cycles of denaturation at 94ºC for 15 s, annealing at

60º C and extension at 72 ºC for 30 s. Specific amplification was confirmed by the

presence of one single peak in the melting curve plots. In addition, the PCR products

were analyzed by agarose gel electrophoresis. Results were calculated as percent of

of 46


9

control rats, using the cycle threshold 2(∆∆Ct) method (36) with the Hprt as reference

gene.

Statistical analysis

All data are presented as the mean ± SEM. Statistics were computed using

the statistics program STATGRAPHICS plus for Windows. Differences among

experimental groups were analyzed by one-way (organ weights) or two-way analysis

of variance. Where there were differences among the groups, post-hoc comparisons

were made by using the unpaired Student’s t-test. Significance was assumed when

P<0.05.

of 46


10

RESULTS

Arthritis induced a significant increase in COX-2 gene expression (P<0.01) in

all the tissues analyzed; pituitary, liver and skeletal muscle (Fig.1). As expected,

when the serum concentration of PGE2 was measured in arthritic rats treated with

the two COX inhibitors, both treatments were able to induce a significant (P<0.01)

decrease in the serum levels of PGE2 (Fig.2).

Three rats from the arthritic group injected with indomethacin died during the

experiment, whereas none of the arthritic rats injected with vehicle or meloxicam

died during the entire experimental procedure. In the control group injected with

indomethacin one rat died and two rats were excluded from the experiment because

they started to lose weight and have ascites. Indomethacin administration to arthritic

rats dramatically decreased arthritis index scores (Fig. 3), being significantly lower

than in the arthritic rats injected with vehicle on the third day of indomethacin

treatment (and 17 days after adjuvant injection). Arthritis increased the paw volume

(P<0.01), and indomethacin treatment reduced paw volume in arthritic rats (P<0.01,

Fig. 3), whereas indomethacin administration had no effect on paw volume in control

rats. The anti-inflammatory effect of treatment with meloxicam was similar to that of

indomethacin (Fig.4). Meloxicam administration decreased the external signs of the

arthritis, measured as arthritis scores, from the first day of treatment. This difference

was significant starting from the third day of treatment (Fig. 4). Meloxicam

administration for eight days also decreased the paw volume in the arthritic rats

P<0.01, but not in controls.

The effect of arthritis and indomethacin administration on body weight and

food intake is shown in Fig. 5. Arthritic rats had lower body weight than control rats

of 46


11

when starting the indomethacin treatment 15 days after adjuvant injection. In the

arthritic rats injected with vehicle, the body weight gain during the 8 days of

treatment was lower than that of control rats injected with vehicle (P<0.01). In both

experiments, arthritis decreased (P<0.01) the cumulative food intake during the 8

days of treatment (Fig. 5 and 6), but this effect was not significant during the last two

days of treatment before the rats were sacrificed (Fig. 5 and 6). Indomethacin

induced a significant increase in body weight in arthritic rats starting 24 h after

administration. Moreover, indomethacin prevented the inhibitory effect of arthritis on

body weight gain, since the arthritic rats injected with indomethacin had a cumulative

body weight similar to that of control rats injected with vehicle, although the absolute

body weight remained lower than the control rats injected with vehicle (Fig. 5). In

contrast, indomethacin administration to non-arthritic rats induced a decrease in food

intake (P<0.01, Fig. 5) and in body weight gain, where the cumulative body weight

gain during the 8 days of treatment was lower than that of the arthritic rats injected

with indomethacin (Fig. 5).

The effect of meloxicam administration on body weight and food intake is

shown in Fig. 6. Meloxicam administration to arthritic rats prevented the inhibitory

effect of arthritis on body weight, since the evolution of body weight during the 8

days of treatment in the arthritic rats injected with meloxicam was similar to that of

the control rats. Meloxicam administration had no appreciable effect on food intake in

control rats, but induced a marked increase in food intake in arthritic rats (P<0.01),

even at higher levels than the food intake observed in control rats (Fig 6).

In the group treated with vehicle, arthritis induced a significant decrease in

pituitary GH (P<0.05) and liver IGF-I (P<0.01) gene expression, as well as in serum

concentrations of IGF-I (P<0.01, Fig. 7). As observed with food intake and body

of 46


12

weight, indomethacin administration decreased serum concentrations of IGF-I and

IGF-I gene expression in the liver (P<0.01) in control rats. There was a significant

decrease in serum IGF-I levels in the control rats that received indomethacin. In

contrast, in arthritic rats indomethacin administration increased serum concentrations

of IGF-I (P<0.05) and liver IGF-I mRNA, although this increase was not statistically

significant. Indomethacin treatment did not modify pituitary GH mRNA in control rats

but blunted the inhibitory effect of arthritis on pituitary GH mRNA.

In contrast with the data obtained with the indomethacin treatment, meloxicam

administration to control rats did not modify liver IGF-I mRNA or serum

concentrations of IGF-I (Fig. 8). In arthritic rats, meloxicam administration increased

the serum concentration of IGF-I as well as its gene expression in the liver, reaching

levels similar to those observed in the control rats (Fig. 8). Similarly, meloxicam

administration also blunted the inhibitory effect of arthritis on GH mRNA (Fig 8).

Due to the observed side effects of indomethacin, and taking into account that

in the arthritic rats the effect of indomethacin and meloxicam on body weight and on

the GH-IGF-I axis was similar, we studied the skeletal muscle response only in the

rats treated with meloxicam. The effect of arthritis and meloxicam administration to

arthritic rats on gastrocnemius, heart, kidney and pituitary weights is shown in Fig. 9.

Arthritis decreased the weight of all organs studied, but there were differences

among them. Arthritis induced a dramatic decrease in skeletal muscle, where the

gastrocnemius was 28 % (P<0.01) of gastrocnemius weight of the control rats

injected with saline. The weight of organs such as the heart, kidney and pituitary

were also decreased by arthritis, but their decreases were lower (73 - 84 % of control

values) than that of skeletal muscle decrease. In the control rats meloxicam

administration had no effect in all the organs analyzed (data not shown). These data

of 46


13

indicate that the inhibitory effect of arthritis on body weight is mainly due to skeletal

muscle atrophy. Similarly, the stimulatory effect of meloxicam on body weight in

arthritic rats is concomitant with an increase in the weight of the organs studied,

where this effect is more marked in skeletal muscle weights than in kidney, heart or

pituitary weights (Fig. 9).

The effect of arthritis on IGF-I gene expression in the gastrocnemius is

different than in the liver, since IGF-I mRNA was higher (P<0.05) in arthritic rats than

in control rats injected with saline (Fig.10). Meloxicam treatment, although it

increased IGF-I mRNA in the gastrocnemius, the increase had not statistical

significance in control or in arthritic rats. Arthritis also induced an increase (P<0.01)

in IGFBP-5 mRNA in the gastrocnemius (Fig. 10). Meloxicam administration did not

modify the IGFBP-5 mRNA in the gastrocnemius of control rats, whereas it

decreased the IGFBP-5 mRNA in the arthritic rats reaching levels similar to those of

control rats.

The effect of meloxican administration on MAFbx and MuRF1 gene

expression in the gastrocnemius of control or arthritic rats is shown in Fig. 11. In the

control rats meloxicam administration did not modify MAFbx, MuRF1 or mRNAs.

Arthritis induced a significant increase in MAFbx (P<0.01) and MuRF1 (P<0.05)

mRNAs in the gastrocnemius, and meloxicam treatment totally prevented the effect

of arthritis on these mRNAs (Fig. 11).

Arthritis also induced an increased on TNF-α gene expression in skeletal

muscle (Fig. 12). Meloxicam administration did not modify the TNF-α mRNA in

control rats, whereas in arthritic rats meloxicam induced a significant decrease in

TNF-α mRNA reaching control values.

of 46


14

DISCUSSION

Our data show that arthritis increases COX-2 gene expression, whereas

inhibition of COX-2 activity prevents arthritis-induced muscle wasting and the

increase in the E3 ubiquitin-ligating enzymes MAFbx and MuRF1. These effects are

associated with an amelioration of the GH-IGF-I axis and a decrease in the gene

expression of IGFBP-5 and TNF-α in the skeletal muscle. Taking into account that

the anti-inflammatory effect of both treatments, indomethacin, a non-selective

inhibitor, and meloxicam, a preferential selective COX-2 inhibitor, was similar. The

inhibitory effect of arthritis on the GH-IGF-I system and on body and skeletal muscle

weights seems to be mediated through activation of the COX-2 pathway.

The anti-anorexigenic effect of COX inhibitors is well known, and it has been

postulated that eicosanoids are more important in anorexia than host cytokines (51).

In the present data, the two COX inhibitors increased food intake and body weight

gain in the arthritic rats. The anti-anorexigenic effect of indomethacin in the arthritic

rats contrasts with its effect in control rats, in which indomethacin decreased food

intake, body weight gain, IGF-I gene expression in the liver and circulating IGF-I.

Toxicity to indomethacin but not to meloxicam was observed, as indicated by

mortality and a decrease in body weight gain in the control rats injected with

indomethacin. A toxic effect of 5 mg/kg indomethacin has previously been reported,

but without mortality (17). In arthritic rats undergoing treatment with a lower

indomethacin dosage (3 mg/kg), one group did not report having adverse effects of

indomethacin (49), whereas other one reported mortality (58). Indomethacin side

effects have been attributed to gastrointestinal damage due to COX-1 inhibition. A

detrimental effect of a COX-1 inhibitor on body weight has been reported, since

COX-1 inhibition or genetic inactivation of COX-1 augmented and prolonged body

of 46


15

weight loss during inflammation (29). In control rats injected with indomethacin the

gastrointestinal damage can be the cause of the decrease in food intake. The

decrease in body weight gain and in IGF-I gene expression in the control rats

injected with indomethacin can be related to the decrease in food intake. According

to this, pituitary GH gene expression is not affected by indomethacin in the control

rats, since GH is not as related to food intake as IGF-I is.

Although the rats in this study were not pair-fed, we have previously found

that the inhibitory effect of arthritis on body weight and IGF-I is not due to anorexia,

since pair-fed rats gained similar body weight to control rats fed “ad libitum” (38). A

possible explanation is that the anorexic effect of arthritis is small, the food intake is

90% that of the control rats, whereas the body weight gain is 11% of the control rats,

during the 8 days of the experiment. In addition, there is no difference in food intake

from day 21 to 23 (the last two days before sacrificing the animals) between arthritic

and control rats injected with vehicle. Furthermore, rhGH administration to arthritic

rats increased body weight gain without increasing food intake (28). On the contrary,

anti-TNF-α administration to arthritic rats increases food intake to control levels, but

the body weight gain was still lower than the control rats (21). In cancer it has been

reported that initially body wasting occurs independently of anorexia (7, 25, 63). In

other cachectic conditions such as lipopolysaccharide (LPS) administration, the

mechanism by which LPS reduces food intake is also dissociated from its effect on

weight loss (42). All these data indicate that in addition to the decrease in food

intake, the decrease in body weight in adjuvant-arthritis is related to other

mechanisms.

The effect of both COX inhibitors on body weight in the arthritic rats can be

of 46


16

secondary to its effect on GH and IGF-I, since the immunosuppesor cyclosporine A

blocks the inhibitory effect of arthritis on circulating GH and IGF-I and also prevents

the inhibitory effect of arthritis on body weight (59). Taking into account that

exogenous GH is able to counteract the decline in skeletal muscle function in chronic

cardiac failure (14), part of the effect of meloxicam in preventing cachexia can be

secondary to the increased gene expression on GH, and liver and serum IGF-I. The

inhibitory effect of arthritis on GH does not seem to be mediated by the increased

release of PGE2, since this prostanoid has been reported to be a GH secretagogue

(12, 43). A stimulatory effect of lipoxygenase products on pituitary GH synthesis and

secretion has also been reported (12, 53). Therefore, the inhibitory effect of arthritis

on pituitary GH can be secondary to another inhibitory substance that is released

after COX-2 activation. In the liver COX-2 upregulation potentiates liver injury

induced by allyl alcohol, where PGD2, but not PGE2, has a similar effect in isolated

hepatocytes (19). A direct inhibitory effect of prostaglandin A and J on IGF-I gene

expression has been reported (9, 10), whereas PGE2 have a stimulatory effect on

IGF-I gene expression in osteoblasts (8, 54). Therefore, it is also possible that

another prostaglandin different from PGE2 inhibits the pituitary GH and liver IGF-I

during inflammation.

IGF-I has a prominent role in muscle hypertrophy, but when chronically

deactivated it has also an important role in muscle atrophy (31). Accordingly, the

increased IGF-I mRNA in skeletal muscle of arthritic rats contrasts with the notable

muscle wasting induced by arthritis. One possible explanation for this fact is that

muscular IGFBP-5 might inhibit IGF-I activity in skeletal muscle by preventing its

interaction with the IGF-I receptor. In addition to its IGF-I-dependent action, IGFBP-5

is also able to decrease cell proliferation by an IGF-I-independent effect in myoblast

of 46


17

cultures (44). Similarly, transgenic mice overexpressing IGFBP-5 show growth

retardation and decreased skeletal muscle mass relative to body weight (57). In the

present data COX-2 inhibition in arthritic rats decreased IGFBP-5 mRNA in the

skeletal muscle. It is possible that meloxicam directly decreases IGFBP-5 gene

expression by decreasing prostanoid biosynthesis in skeletal muscle. A stimulatory

effect of PGE2 on IGFBP-5 in osteoblast cells has also been described (46).

Moreover, PGE2-responsive elements have been reported in the IGFBP-5 promoter

(4, 40). Changes in pituitary GH secretion can also modify muscular IGFBP-5

mRNA, since GH inhibits the expression of IGFBP-5 in mammary epithelial cells

(56).

Local COX-2 pathways can play an important role in muscle wasting. Arthritis

increases COX-2 and specific E3 ubiquitin-ligating enzymes, MAFbx and MuRF1,

gene expression in the muscle. In septic patients, an increase in COX-2 and

activation of the ubiquitin proteolitic pathway in muscle have been reported (50). In

addition, COX-2 inhibition by celecoxib decreases muscle weakness in elderly

patients with acute inflammation (35). The preservation of muscle mass in the

arthritic rats injected with meloxicam was associated with a decrease in the muscular

expression of both atrogenes. These results suggest that the COX-2 pathway is

involved the upregulation of MAFbx and MuRF1 during chronic arthritis. Taking into

account that these genes are considered as markers of skeletal muscle atrophy, our

data suggest that COX-2 pathway is involved in muscular wasting.

It is possible that the improvement in mobility, rather than the decrease in

prostaglandins “per se”, may lead to the observed changes in gene expression in the

gastrocnemius. We cannot exclude this possibility, because we did not measure

mobility. However, this does not seem to be the cause, since with systemic anti-TNF-

of 46


18

α administration, inflammation was also decreased in a similar way (21), but no

modifications in IGFBP-5, MAFbx or MuRF1 mRNA or gastrocnemius weight were

observed (22). Taking into account that TNF-α is also an important trigger of

muscular atrophy and it upregulates MAFbx and MuRF1 gene expression (31, 35),

the lack of effect of systemic anti-TNF-α in preventing muscular wasting was

unexpected (22). A possible explanation can be that the “in vivo” anti-TNF-α therapy

is not able to suppress COX activity in the muscle, as is the case of the synovial

tissue from rheumatoid arthritis patients (33). These data emphasize the importance

of the COX pathway in the inflammatory cachexia. Another explanation could be that

muscle proteolysis by the ubiquitin-proteasome pathway is activated by local TNF-α

rather than by circulating TNF-α, since systemic anti-TNF-α therapy is not able to

prevent the increased gene expression of TNF-α in the gastrocnemius muscle (22).

In the present data, normalization of MuRF1 and MAFbx is associated with a

decrease in muscular TNF-α, which means that there is a relationship between

prostaglandin inhibition and TNF-α gene expression. Supporting these data,

normalization of TNF-α gene expression by NSAID administration has previously

been reported in cancer (32), in endotoxemic rats (3), in diabetic retinopathy (30),

and has been explained by the inhibitory effect of the NSAIDs on NFkB signaling.

NF-kB plays an important role in muscle atrophy as well. It is upregulated in

muscle in several conditions of muscle wasting such as disuse, sepsis, cancer and

angiotensin administration (27, 48, 55 60). Blockade of NF-kB prevents muscle

atrophy, and transgenic mice with activated NF-kB have muscle wasting and

increased MuRF1 gene expression (11). All these data indicate that NF-kB is a

central component of the muscular atrophy process involved in the activation of

proteolytic pathways. Taking into account that meloxicam inhibits the activation of

of 46


19

NF-kB (2, 30, 61), this can be one of the mechanisms by which meloxicam

prevented arthritis-induced increase of MAFbx and MuRF1 expression and muscle

wasting.

In conclusion, our data suggest that over-activation of COX-2 is responsible

for chronic inflammation-induced cachexia, through an inhibition of the GH-IGF-I axis

and an activation of the ubiquitin-proteasome pathway and muscle wasting. At

muscular level, COX-2 seems to be also involved in the increase in local IGFBP-5

and TNF-α gene expression that contribute to the activation of the MAFbx and

MuRF1 ubiquitin-ligases. These findings have implications not only on the

knowledge of the mechanism leading to cachexia in chronic inflammation, but on

therapeutic strategies in managing chronic arthritis.

ACKNOWLEDGMENTS

The authors are indebted to Antonio Carmona for technical assistance and to

Christina Bickart for the English correction of the manuscript.

GRANTS

This work was supported by Programa Nacional de Promoción General del

Conocimiento, Plan Nacional de Investigación Científica, from Ministerio de

Educación Ciencia (BFI-2003-02149), by a grant from Universidad

Complutense/SantanderCentralHispano PR27/05-14055, and a Fellowship from

Ministerio de Educación y Ciencia to M Granado (FPU, AP2003-2564).

of 46


20

REFERENCES

1. Argiles JM, Busquets S, López-Soriano FJ. The pivotal role of cytokines in

muscle wasting during cancer. Int J Biochem Cell Biol 37: 1609-1619, 2005

2. Asano K, Sakai M, Matsuda T, Tanaka H, Fujii K, Hisamitsu T. Suppression of

matrix metalloproteinase production from synovial fibroblasts by meloxicam in-vitro. J

Pharm Pharmacol 58: 359-66, 2006.

3. Azab AN, Kobal S, Rubin M, Kaplanski J. Effects of nimesulide, a selective

cyclooxygenase-2 inhibitor, on cardiovascular alterations in endotoxemia. Cardiology

103: 92-100, 2005.

4. Beattie J, Allan GJ, Lochrie JD, Flint DJ. Insulin-like growth factor-binding

protein-5 (IGFBP-5): a critical member of the IGF axis. Biochem J 395: 1-19, 2006.

5. Bodine SC, Latres E, Baumhueter S, Lai VK, Nunez L, Clarke BA,

Poueymirou WT, Panaro FJ, Na E, Dharmarajan K, Pan ZQ, Valenzuela DM,

DeChiara TM, Stitt TN, Yancopoulos GD, Glass DJ. Identification of ubiquitin

ligases required for skeletal muscle atrophy. Science 294: 1704-1708, 2001.

6. Bianchi A, Moulin D, Sebillaud S, Koufany M, Galteau MM, Netter P, Terlain

B, Jouzeau JY. Contrasting effects of peroxisome-proliferator-activated receptor

(PPAR)gamma agonists on membrane-associated prostaglandin E2 synthase-1 in

IL-1beta-stimulated rat chondrocytes: evidence for PPARgamma-independent

inhibition by 15-deoxy-Delta12,14prostaglandin J2. Arthritis Res Ther 7:

R1325-R1337, 2005.

7. Bibby MC, Double JA, Ali SA, Fearon KC, Brennan RA, Tisdale MJ.

Characterization of a transplantable adenocarcinoma of the mouse colon producing

cachexia in recipient animals. J Natl Cancer Inst 78: 539-546, 1987.

of 46


21

8. Bichell DP, Rotwein P, McCarthy TL. Prostaglandin E2 rapidly stimulates

insulin-like growth factor-I gene expression in primary rat osteoblast cultures:

evidence for transcriptional control. Endocrinology 133: 1020-1028, 1993.

9. Bui T, Kuo C, Rotwein P, Straus DS. Prostaglandin A2 specifically represses

insulin-like growth factor-I gene expression in C6 rat glioma cells. Endocrinology

138: 985-993, 1997.

10. Bui T, Straus DS. Effects of cyclopentenone prostaglandins and related

compounds on insulin-like growth factor-I and Waf1 gene expression. Biochim

Biophys Acta 1397: 31-42, 1998

11. Cai D, Frantz JD, Tawa NE Jr, Melendez PA, OH BC, Lidov HG, Hasselgren

PO, Frontera WR, Lee J, Glass DJ, Shoelson SE. IKKbeta/NF-kappaB activation

causes severe muscle wasting in mice. Cell 119: 285-298, 2004.

12. Canonico PL, Speciale C, Sortino MA, Cronin MJ, MacLeod RM, Scapagnini

U. Growth hormone releasing factor (GRF) increases free arachidonate levels in the

pituitary: a role for lipoxygenase products. Life Sci 38: 267-272, 1986.

13. Chillingworth NL, Morham SG, Donaldson LF. Sex differences in inflammation

and inflammatory pain in cyclooxygenase-deficient mice. Am J Physiol Regul Integr

Comp Physiol Mar 291: R327-R334, 2006.

14. Dalla Libera L, Ravara B, Volterrani M, Gobbo V, Della Barbera M, Angelini

A, Danieli Betto D, Germinario E, Vescovo G. Beneficial effects of GH/IGF-1 on

skeletal muscle atrophy and function in experimental heart failure. Am J Physiol Cell

Physiol 286: C138-C144, 2004.

15. Davis TW, Zweifel BS, O'Neal JM, Heuvelman DM, Abegg AL, Hendrich TO,

Masferrer JL. Inhibition of cyclooxygenase-2 by celecoxib reverses tumor-induced

of 46


22

wasting. J Pharmacol Exp Ther 308: 929-934, 2004.

16. Dehoux M, Van Beneden R, Pasko N, Lause P, Verniers J, Underwood L,

Ketelslegers JM and Thissen JP. Role of the insulin-like growth factor I decline in

the induction of atrogin-1/MAFbx during fasting and diabetes. Endocrinology 145:

4806-4812, 2004.

17. Egan CG, Lockhart JC and Ferrell WR. Pathophysiology of vascular

dysfunction in a rat model of chronic joint inflammation. J Physiol 557: 635-643,

2004.

18. Fafeur V, Tiberghien C, Haour F, Dray F. Control of growth hormone release

by growth hormone-releasing factor and prostaglandin E2 in a system of perfused rat

anterior pituitary cells. Reprod Nutr Dev 28: 229-231, 1988.

19. Ganey PE, Barton YW, Kinser S, Sneed RA, Barton CC, Roth RA.

Involvement of cyclooxygenase-2 in the potentiation of allyl alcohol-induced liver

injury by bacterial lipopolysaccharide. Toxicol Appl Pharmacol 174: 113-121, 2001.

20. Granado M, Priego T, Martín AI, Villanúa MA, López-Calderón A. Ghrelin

receptor agonist GHRP-2 prevents arthritis-induced increase in E3 ubiquitin-ligating

enzymes MuRF1 and MAFbx gene expression in skeletal muscle. Am J Physiol

Endocrinol Metab 289: E1007-E1014, 2005.

21. Granado M, Priego T, Martín AI,Vara E, López-Calderón A, Villanúa MA.

Anti-tumor necrosis factor agent PEG-sTNFRI improves the growth hormone/insulin-

like growth factor-I system in adjuvant-induced arthritic rats. Eur J Pharmacol 536:

204-210, 2006.

of 46


23

22. Granado M, Martín AI, Priego T, López-Calderón A, Villanúa MA. TNF

blockade did not prevent the increase of muscular MuRF-1 and MAFbx in arthritic

rats. J Endocrinol 191: 319-326, 2006.

23. Graves E, Ramsay E, McCarthy DO. Inhibitors of COX activity preserve

muscle mass in mice bearing the Lewis lung carcinoma, but not the B16 melanoma.

Res Nurs Health 29: 87-97, 2006.

24. Heemskerk VH, Daemen MA, Buurman WA. Insulin-like growth factor-1 (IGF-1)

and growth hormone (GH) in immunity and inflammation. Cytokine Growth Factor

Rev. 10: 5-14, 1999.

25. Hitt A, Graves E, McCarthy DO. Indomethacin preserves muscle mass and

reduces levels of E3 ligases and TNF receptor type 1 in the gastrocnemius muscle of

tumor-bearing mice. Res Nurs Health 28: 56-66, 2006.

26. Hussey HJ, Tisdale MJ. Effect of the specific cyclooxygenase-2 inhibitor

meloxicam on tumour growth and cachexia in a murine model. Int J Cancer 87: 95-

100, 2000.

27. Hunter RB, Stevenson E, Koncarevic A, Mitchell-Felton H, Essig DA,

Kandarian SC. Activation of an alternative NF-kappaB pathway in skeletal muscle

during disuse atrophy. FASEB J 16: 529-38, 2002.

28. Ibáñez de Cáceres I, Villanúa MA, Soto L, Martín I and López-Calderón A.

IGF-I and IGF-I-binding proteins in rats with adjuvant-induced arthritis given

recombinant human growth hormone. J Endocrinol 165: 537-544, 2000.

29. Johnson PM, Vogt SK, Burney MW, Muglia LJ. COX-2 inhibition attenuates

anorexia during systemic inflammation without impairing cytokine production. Am J

Physiol Endocrinol Metab 282: E650-E656, 2002.

30. Joussen AM, Poulaki V, Mitsiades N, Kirchhof B, Koizumi K, Dohmen S,

of 46


24

Adamis AP. Nonsteroidal anti-inflammatory drugs prevent early diabetic retinopathy

via TNF-alpha suppression. FASEB J 16: 438-440, 2002.

31. Kandarian SC, Jackman RW. Intracellular signaling during skeletal muscle

atrophy. Muscle Nerve 33: 155-165, 2006.

32. Konturek PC, Rembiasz K, Burnat G, Konturek SJ, Tusinela M, Bielanski W,

Rehfeld J, Karcz D, Hahn E. Effects of cyclooxygenase-2 inhibition on serum and

tumor gastrins and expression of apoptosis-related proteins in colorectal cancer. Dig

Dis Sci 51: 779-787, 2006.

33. Korotkova M, Westman M, Gheorghe KR, af Klint E, Trollmo C, Ulfgren AK,

Klareskog L, Jakobsson PJ. Effects of antirheumatic treatments on the

prostaglandin E2 biosynthetic pathway. Arthritis Rheum 52: 3439-3447, 2005.

34. Lecker SH, Jagoe RT, Gilbert A, Gomes M, Baracos V, Bailey J, Price SR,

Mitch WE and Goldberg AL. Multiple types of skeletal muscle atrophy involve a

common program of changes in gene expression. FASEB J 18: 39-51, 2004.

35. Li YP, Chen Y, John J, Moylan J, Jin B, Mann DL, Reid MB. TNF-alpha acts

via p38 MAPK to stimulate expression of the ubiquitin ligase atrogin1/MAFbx in

skeletal muscle. FASEB J 19: 362-370, 2005.

36. Livak KJ and Schmittgen TD. Analysis of relative gene expression data using

real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25: 402-

408, 2001.

37. López-Calderón A, Soto L, Martín AI. Chronic inflammation inhibits GH

secretion and alters the serum insulin-like growth factor system in rats. Life Sci 65:

2049-2060, 1999.

38. López-Calderón A, Ibañez de Cáceres I, Soto L, Priego T, Martín AI and

Villanúa MA. The decrease in hepatic IGF-I gene expression in arthritic rats is not

of 46


25

associated with modifications in hepatic GH receptor mRNA. Eur J Endocrinol 144:

529-534, 2001.

39. Lundholm K, Daneryd P, Korner U, Hyltander A, Bosaeus I. Evidence that

long-term COX-treatment improves energy homeostasis and body composition in

cancer patients with progressive cachexia. Int J Oncol 24: 505-512, 2004.

40. McCarthy TL, Casinghino S, Mittanck DW, Ji CH, Centrella M, Rotwein P.

Promoter-dependent and -independent activation of insulin-like gr owth factor

binding protein-5 gene expression by prostaglandin E2 in primary rat osteoblasts. J

Biol Chem 271: 6666-6671, 1996.

41. Mets T, Bautmans I, Njemini R, Lambert M, Demanet C. The influence of

celecoxib on muscle fatigue resistance and mobility in elderly patients with

inflammation. Am J Geriatr Pharmacother 2: 230-238, 2004.

42. Ogimoto K, Harris Jr. MK, Wisse BE. MyD88 is a key mediator of anorexia,

but not weight loss, induced by lipopolysaccharide (LPS) and interleukin-1beta

(IL1beta). Endocrinology 147: 4445-4453, 2006.

43. Ojeda SR, Jameson HE, McCann SM. Prostaglandin E2 (PGE2)-induced

growth hormone (GH) release: effect of intrahypothalamic and intrapituitary implants.

Prostaglandins 13: 943-955, 1977.

44. Pampusch MS, Xi G, Kamanga-Sollo E, Loseth KJ, Hathaway MR, Dayton

WR, White ME. Production of recombinant porcine IGF-binding protein-5 and its

effect on proliferation of porcine embryonic myoblast cultures in the presence and

absence of IGF-I and Long-R3-IGF-I. J Endocrinol 185: 197-206, 2005.

45. Pash JM, Delany AM, Adamo ML, Roberts CT Jr, LeRoith D, Canalis E.

Regulation of insulin-like growth factor I transcription by prostaglandin E2 in

osteoblast cells. Endocrinology 136: 33-38, 1995.

of 46


26

46. Pash JM, Canalis E. Transcriptional regulation of insulin-like growth factor-

binding protein-5 by prostaglandin E2 in osteoblast cells. Endocrinology 137: 2375-

2382, 1996.

47. Peinnequin A, Mouret C, Birot O, Alonso A, Mathieu J, Clarencon D, Agay

D, Chancerelle Y & Multon E. Rat pro-inflammatory cytokine and cytokine related

mRNA quantification by real-time polymerase chain reaction using SYBR green.

BMC Immunology 5: 3-10, 2004.

48. Penner CG, Gang G, Wray C, Fischer JE, Hasselgren PO. The transcription

factors NF-kappab and AP-1 are differentially regulated in skeletal muscle during

sepsis. Biochem Biophys Res Commun 281: 1331-1336, 2001.

49. Philippe L, Gegout-Pottie P, Guingamp C, Bordji K, Terlain B, Netter P,

Gillet P. Relations between functional, inflammatory, and degenerative parameters

during adjuvant arthritis in rats. Am J Physiol 273: R1550-R1556, 1997.

50. Rabuel C, Renaud E, Brealey D, Ratajczak P, Damy T, Alves A, Habib A,

Singer M, Payen D, Mebazaa A. Human septic myopathy: induction of

cyclooxygenase, heme oxygenase and activation of the ubiquitin proteolytic

pathway. Anesthesiology 101: 583-590, 2004.

51. Ross JA, Fearon KC. Eicosanoid-dependent cancer cachexia and wasting. Curr

Opin Clin Nutr Metab Care 5: 241-248, 2002.

52. Roubenoff R, Roubenoff RA, Cannon JG, Kehayias JJ, Zhuang H, Dawson-

Hughes B Dinarello CA, Rosenberg IH. Rheumatoid cachexia: cytokine-driven

hypermetabolism and loss of lean body mass in chronic inflammation. J Clin Invest

93: 2379-2386, 1994.

53. Roudbaraki MM, Drouhault R, Bacquart T, Vacher P. Arachidonic acid-

of 46


27

induced hormone release in somatotropes: involvement of calcium.

Neuroendocrinology 63: 244-256, 1996.

54. Roughan JV, Flecknell PA. Evaluation of a short duration behaviour-based

post-operative pain scoring system in rats. Eur J Pain 7: 397-406, 2003.

55. Russell ST, Wyke SM, Tisdale MJ. Mechanism of induction of muscle protein

degradation by angiotensin II. Cell Signal 18: 1087-1096, 2006.

56. Sakamoto K, Yano T, Kobayashi T, Hagino A, Aso H, Obara Y. Growth

hormone suppresses the expression of IGFBP-5, and promotes the IGF-I-induced

phosphorylation of Akt in bovine mammary epithelial cells. Domest Anim Endocrinol.

Apr 18 [Epub ahead of print], 2006.

57. Salih DA, Tripathi G, Holding C, Szestak TA, Gonzalez MI, Carter EJ, Cobb

LJ, Eisemann JE, Pell JM. Insulin-like growth factor-binding protein 5 (Igfbp5)

compromises survival, growth, muscle development, and fertility in mice. Proc Natl

Acad Sci U S A 101: 4314-4319, 2004.

58. Shelton DL, Zeller J, Ho W-H, Pons J, Rosenthal A. Nerve growth factor

mediates hyperalgesia and cachexia in auto-immune arthritis. Pain 116: 8-16, 2005.

59. Soto L, Martín AI, Vara E, López-Calderón A. Cyclosporin a treatment is able

to revert the decrease in circulating GH and IGF-I and the increase in IGFBPs

induced by adjuvant arthritis. Horm Metab Res 33: 590-595, 2001.

60. Tisdale MJ. Protein loss in cancer cachexia. Science 289: 2293-2294, 2000.

61. Yamamoto Y, Yin MJ, Lin KM, Gaynor RB. Sulindac inhibits activation of the

NF-kappaB pathway. J Biol Chem 274: 27307-27314, 1999.

62. Walsmith J, Abad L, Kehayias J, Roubenoff R. Tumor necrosis factor-alpha

production is associated with less body cell mass in women with rheumatoid arthritis.

of 46


28

J Rheumatol 31: 23-29, 2004.

63. Wang W, Lonnroth C, Svanberg E, Lundholm K. Cytokine and

cyclooxygenase-2 protein in brain areas of tumor-bearing mice with prostanoid-

related anorexia. Cancer Res 61: 4707-4715, 2001.

64. Wray CJ, Mammen JM, Hershko DD, Hasselgren PO. Sepsis upregulates the

gene expression of multiple ubiquitin ligases in skeletal muscle. Int J Biochem Cell

Biol. 35: 698-705, 2003.

of 46


29

LEGEND OF FIGURES

Fig. 1. Effect of adjuvant-induced arthritis on COX-2 gene expression in the pituitary,

liver and skeletal muscle (gastrocnemius). Tissues were obtained on day 23 after

adjuvant injection. COX mRNA was measured by real-time PCR as described in

material and methods. Results are expressed as percentage of the control (non-

arthritic) rats for at least 7 rats per group. **P<0.01 vs. control rats.

Fig. 2. Serum concentration of PGE2 in arthritic rats treated with the COX inhibitors

indomethacin and meloxicam (gray bars) or with vehicle (white bars). Both inhibitors

decreased the serum concentrations of PGE2 in arthritic rats. Values shown are the

mean ± SEM for 8-10 rats per group.ºº P<0.01 vs. respective group injected with

vehicle.

Fig. 3. Evolution of arthritis scores (upper panel) and paw volume (lower panel) in

arthritic rats (AA) or control rats injected with indomethacin (4 mg/kg sc) or vehicle

(250 µl) for 8 days (treatments started 15 days after adjuvant injection). Values

shown are the mean ± SEM (n=8-10 rats). There was an interaction between the

effect of arthritis and indomethacin on paw volume (F1,31 = 11, P<0.01), since

indomethacin decreased paw volume in arthritic rats, but not in control rats.

**P<0.01, vs. control rats injected with vehicle, ++P<0.01 vs. control rats injected

with indomethacin, º P<0.05 , ºº P<0.01 vs. arthritic rats injected with vehicle.

Fig. 4. Evolution of arthritis scores (upper panel) and paw volume (lower panel) in

arthritic rats (AA) or control rats injected with meloxicam (1 mg/kg sc) or saline for 8

of 46


30

days (treatments started 15 days after adjuvant injection). Values shown are the

mean ± SEM (n=10-12 rats). There was an interaction between the effect of arthritis

and meloxicam on paw volume (F1,36 = 15, P<0.01), since meloxicam decreased paw

volume in arthritic rats, but not in control rats. **P<0.01, vs. control rats injected with

vehicle, ++P<0.01 vs. control rats injected with meloxicam, ºº P<0.01 vs. arthritic rats

injected with saline.

Fig. 5. Effect of 8-day indomethacin administration (4 mg/kg sc) on cumulative body

weight gain (A), absolute body weight evolution (B), daily food intake during the 8

days (C) or during the last 2 days of treatment (D), in control or arthritic (AA) rats.

There was an interaction between the effect of arthritis and indomethacin on body

weight gain (F1,33 = 37, P<0.01) and on food intake during the 8 days (F1,24 = 41,

P<0.01) or during the last 2 days (F1,24= 40, P<0.01) of treatment, since

indomethacin decreased the body weight gain and food intake in control rats,

whereas it increased body weight gain and food intake in arthritic rats. Values

represent the mean ± SEM for n= 6-12. **P<0.01 vs. control rats injected with

vehicle, ºP<0.05 ººP<0.01 vs. arthritic rats injected with vehicle, ++ P<0.01 vs. control

rats injected with indomethacin.

Fig. 6. Effect of 8-day meloxicam administration (1mg/kg sc) on cumulative body

weight gain (A), absolute body weight evolution (B), daily food intake during the 8

days (C) or during the last 2 days of treatment (D), in control or arthritic (AA) rats.

There was an interaction between the effect of arthritis and meloxicam on body

weight gain (F1,36 = 25, P<0.01) and on food intake during the 8 days (F1,24 = 16,

P<0.01) or during the last 2 days (F1,20= 44, P<0.01) of treatment, since meloxicam

of 46


31

increased the body weight gain and food intake in arthritic rats but not in control rats.

Values represent the mean ± SEM for n= 4-12. *P<0.05, **P<0.01 vs. control rats

injected with vehice,º P<0.5 ºº P<0.01 vs. arthritic rats injected with vehicle, ++

P<0.01 vs. control rats injected with meloxicam.

Fig. 7. Effect of indomethacin administration over 8 days on pituitary GH mRNA (A)

liver IGF-I mRNA (B) and on serum concentrations of IGF-I (C) in control or in

arthritic (AA) rats. mRNAs were quantified using real-time RT-PCR as described in

material and methods and are presented as percentage of the mean value in control

group injected with vehicle. There was an interaction between the effect of

indomethacin and arthritis on liver IGF-I mRNA (F1,24 = 11, P<0.01) and on serum

concentrations of IGF-I (F1,32 = 17, P<0.01), since arthritis decreased circulating

IGF-I and its gene expression in the liver in vehicle injected rats, but not in the rats

treated with indomethacin. Values represent the mean ± SEM for n= 7-10. *P<0.05,

**P<0.01 vs. control rats injected with vehicle, º P<0.05 vs. arthritic rats injected with

vehicle.

Fig. 8. Effect of meloxicam treatment over 8 days on pituitary GH mRNA (A), liver

IGF-I mRNA (B) and on serum concentrations of IGF-I (C) in control or in arthritic

(AA) rats. mRNAs were quantified using real-time RT-PCR as described in material

and methods and are presented as percentage of the mean value in control group

injected with vehicle. There was an interaction between the effect of meloxicam and

arthritis on serum concentrations of IGF-I (F1,35 = 5, P<0.05), since arthritis

decreased serum concentration of IGF-I in the rats treated with saline but not in the

group treated with meloxicam. Values represent the mean ± SEM for n= 7-10.

of 46


32

*P<0.05, **P<0.01 vs. control rats injected with vehicle, ºP<0.05 vs. arthritic rats

injected with vehicle.

Fig. 9. Weight of gastrocnemius, heart, kidney and pituitary of arthritic rats injected

with vehicle (AA-vehicle) or meloxicam (AA-meloxicam, 1 mg/kg sc). Data are

expressed as percentage of the weight of the control rats injected with vehicle, for 10

rats per group. **P<0.01 vs. control rats injected with vehicle, ºº P<0.01 vs. arthritic

rats injected with saline.

Fig. 10. Effect of meloxicam administration on IGF-I (upper panel) or IGFBP-5 mRNA

(lower panel) in the gastrocnemius of control or arthritic (AA) rats. mRNAs were

quantified using real-time RT-PCR as described in material and methods and are

presented as percentage of the mean value in control group injected with vehicle.

There was an interaction between the effect of arthritis and meloxicam on IGFBP-5

mRNA (F1,33 = 7.2, P<0.05), since arthritis increased the IGFBP-5 mRNA in the

gastrocnemius of the rats injected with vehicle, but not in those injected with

meloxicam. Results are expressed as means ± SEM for n=8-10 per group; *P<0.05,

** P<0.01 vs. control rats injected with vehicle, ºº P<0.01 vs. arthritic rats injected

with vehicle.

Fig.11. MAFbx (upper panel) and MuRF1 (lower panel) mRNAs in gastrocnemius of

control and arthritic (AA) rats, injected with vehicle or 1 mg/kg meloxicam for 8 days.

MAFbx and MuRF1 mRNA were analyzed by real-time PCR, and the data were

normalized to the expression of Hprt RNA. There was an interaction between the

effects of arthritis and meloxicam administration on MAFbx (F1,32 = 25, P<0.01) and

of 46


33

on MuRF1 (F1,30 = 8, P<0.01) gene expression in the gastrocnemius, since arthritis

increased both mRNAs in vehicle but not in meloxicam treated rats. Results

represent means ± SEM for 7-10 rats per group. ** P<0.01 * P<0.05 vs. control rats

injected with vehicle, ºº P<0.01, º P<0.05 vs. arthritic rats injected with vehicle.

Fig. 12 Effect of meloxicam administration (1 mg/kg for 8 days) on TNF-α mRNA in

control and arthritic (AA) rats. mRNAs were quantified using real-time PCR as

described in material and methods and are presented as percentage of the mean

value in control group injected with vehicle. There was an interaction between the

effect of arthritis and meloxicam on TNF-α mRNA (F1,30 = 5, P<0.05), since

meloxicam decreased TNF-α in arthritic rats, whereas it had no effect in control rats.

Results represent means ± SEM for 8-9 rats per group. ** P<0.01 vs. control rats

injected with vehicle, ºº P<0.01 vs. arthritic rats injected with vehicle.

of 46


34

Table I. Primers for real-time PCR

Gene Forward Primer (5' to 3') Reverse Primer (5' to 3') Product bp

GH TCTGCTTCTCAGAGACCATCC GCGAAGCAATTCCATGTCA 77

IGF-I

GCTATGGCTCCAGCATTCG TCCGGAAGCAACACTCATCC 62

IGFBP-5

GGCGAGCAAACCAAGATAGA GGTCTCCTCAGCCATCTCG 75

COX-2

TACAAGCAGTGGCAAAGGCC CAGTATTGAGGAGAACAGATGGG 303

TNF GCCACCAGCTCTTCTGTCT GTCTGGGCCATGGAACTGAT 100

MAFbx GAACAGCAAAACCAAAACTCAGTA GCTCCTTAGTACTCCCTTTGTGAA 74

MuRF1 TGTCTGGAGGTCGTTTCCG ATGCCGGTCCATGATCACTT 58

HPRT CTCATGGACTGATTATGGACAGGAC GCAGGTCAGCAAAGAACTTATAGCC 122

of 46

title: experimental arthritis inhibits the insulin-like growth factor-i

Documents