Topics in Topics in InformaticsInformaticsSpring 2005, SJCSpring 2005, SJC

About the InstructorAbout the Instructor• Instructor Dr. Hong Zhou• Office McDonough 317• Office Hours MWF 10:00 – 11:00am• Email: hzhou@sjc.edu, Phone: 231-5826• Syllabus

• You can all me either:– Hong– Dr. Hong– Dr. Zhou

What is Informatics?What is Informatics?• Search for ‘What is informatics’ at

http://www.google.com, we got different definitions.

• Basically, the study and application of the knowledge and skills of data/information flow and manipulation (including storage, retrieval, analysis, and construction/deriving, etc).

InformaticsInformatics• Data obtaining• Data flow and control• Data representation (records) and

storage• Data retrieval/mining• Data analysis• Data derivation (generating new data

from existing data via analysis)

What Will You LearnWhat Will You Learn• Obtaining reliable data.• Data Management (Data Storage and

Representation, Retrieval) database.

• Introduction to Bioinformatics.• Introduction to Health Informatics.

Part IPart I Obtaining Reliable Obtaining Reliable DataData

• Complex and precise communication is something distinguishing us from non-human.

• The world development is somehow the development of our understanding, i.e. information of the universe including our social systems.

• Information and its uses are the center of such development.

Information vs DataInformation vs Data• What is in your mind when we talk

about “INFORMATION”?• Is information touchable, visible?• To my understanding, data is the

description of information, and information is the interpretation of data.

• So, let’s deal with the description data, in this class.

What is Data?What is Data?• When we talk about data, the first

image in our mind might be numbers such as 5, 87, 98.34, etc.

• However, are the numbers 5, 87, 98.34 meaningful/informative?

Data with ContextData with Context• Pure numbers are meaningless for us.• Numbers with context are meaningful,

however.• For example, 5 pounds of sugar.• So, in this class, we are talking about

meaningful data and ignore all meaningless data. (Are we meaningful persons?)

Quick QuestionsQuick QuestionsAre following ‘data’ meaningful?• 20• 20 years• A 20 years old girl• A 20 years old girl named Amie• A 20 years old girl named Amie who

is a SJC student.

Data TargetData Target• Data is used to describe a subject.• For example, age, height, weight,

gender, profession, are description of a person.

• Medical record is a description of a patient

Quick QuestionQuick Question

Ford V6 White 4 door Sedan

Amie Female

9/1986

CSC SJC

What are the targets of the following two rows of data?

What is RELIABLE?What is RELIABLE?• When we talk about reliable data,

what does that mean?• Let’s discuss this issue at two levels:

– Individual level– Group/population level (statistics)

Individual LevelIndividual Level• Reliable data means that the data is

‘closely’ related to the individual (or event) and ‘precisely’ describes the individual (or event).

• A computer of 3.2 ghz CPU, 512 mb RAM, 512 kb cache, etc.

Group/Population LevelGroup/Population Level• ‘Reliable’ is more meaningful at the

group level.• Can a specific medical diagnose of a

patient be representative of all patients with the same symptom?

• Probably not.

Statistical ThinkingStatistical Thinking• One powerful approach to analyze data is

statistics.• We measure the reliability (significance) of

data in the sense of statistics.• Statistical thinking is to use data to build

our understanding, gain insights, and draw conclusions or make inferences.

• Not drawing conclusion from an incident.

Principles in Statistical Principles in Statistical ThinkingThinking

• Count on data instead of an incident• Where the data is from matters.• Lurking variables• Variation is everywhere• Conclusions are not absolutely

certain

Count on large amount of data Count on large amount of data instead of a few incidentsinstead of a few incidents

• Famous fortune teller• The thumb of a monk

Where data is fromWhere data is from• Group data can be collected from

surveys or observations, or obtained from experiments.

• When collecting data, where the data come from is important. For example, once there is a question “If you had it to do over again, would you have children?” 70% from the written responses are NO. Is this piece information reliable?

Lurking VariablesLurking Variables• Is music practice improving test

scores?• What is behind?

The Importance of RANDOMThe Importance of RANDOM• The key factor in data collection is the

RANDOM concept, i.e. the data has to be randomly collected with no bias.

• Suppose that you are doing a survey of 2004 election prediction from 10000 people in USA, how are you going to pick the 10000 persons? Only in schools? Only in New York? Only women? Avoid as much as bias as you can.

ExperimentsExperiments• Some reliable data can only be produced

by experiments, especially in science.• For example, in biology, to pin down the

function of a gene, you have to knock out the gene or depress it and check the phenotype changes. After that, you have to recover the gene and verify if the phenotype also recovers. Such experiments are very convincing, but expensive.

Another ExperimentAnother Experiment• It once was believed that women who take

hormones after menopause reduce the risk of heart attack. The belief was resulted from the studies that simply compared women who were taking hormones with others who were not. Are such study results reliable?

• Such experiments lack proper Controls, which are the essential in all experiments.

• How are you going to design an experiment for this study?

Reliable Data cont’dReliable Data cont’d• It is not a simple task to obtain

reliable data, it requires extensive consideration and design.

• Some experiment results may look convincing at some time, but may lose their reliability over time or when the environment changes. For example, the third stop light of cars.

DiscussionDiscussion• Is absence of evidence the evidence

of absence?

Project 1Project 1• Write a paragraph to discuss the claim “Absence

of evidence is evidence of absence”. Please make your own judgment as the grading is based on your argument.

• Design a simple survey to collect opinions about terminating death penalty. Be aware of the importance of “RANDOM”. Write a short paragraph to argument that the data collected by your survey is reliable.

• Points: 100.• Due Date: Feb 1st, 2005. • Submit your work in the digital drop box in

Blackboard.

Part II Data StoragePart II Data Storage• Can all information be recorded as

data? Let’s start the discussion.– Feeling– Knowledge– Intelligence

Personal IdeasPersonal Ideas• My understanding: Yes, just some of

them are too complicated or too difficult to manifest precisely.

• And that is whey we have IQ test, MQ (motivational quotient), EQ, etc.

Where to storeWhere to store• Data is stored somewhere.

– Minds– Books (paper documents)– Computers– Etc

• Let’s compare the three storage methods, which one you think more lasting or appropriate?

Passing WordsPassing Words• In ancient time, knowledge is passed in words

generation by generation.• Here is a story about passing by words:

– General called the captain telling “tonight at 7:00pm, the Halley comet will pass your camp in the sky. Organize your soldiers to watch”.

– Captain informed his lieutenant: “Tonight at 7:00pm, the Halley comet will pass our camp in the sky and the general is coming to watch with our soldiers.”

– The lieutenant informed the sergeant: “Tonight at 7:00pm, the general will accompany Halley comet passing over our camp, organize the soldiers”

– The sergeant to soldiers: “Tonight at 7:00pm, general Halley will pass over our camp in sky and we are going to watch that”.

Data StorageData Storage• Paper storage:

– Size and cost– Transportation

• Computer:– Signature legal effect– Hacking– What if computers are

down?• However, if data is not

organized, it is difficult to make use of. So, data storage strategy is important.

• In this class, we talk about data storage by using computer technology.

Ways to storeWays to store• Data storage is a big, and probably

the largest issue related to computer data manipulation.

• Different database structures, different database managements, online storage, etc.

Chapter 1. File structureChapter 1. File structure• Hierarchical

structure• Easy to deal with the

hierarchical relationships.

• For example, the administration is a hierarchical structure.

• Let me use the DOD/NIMA VPF structure as an example

root

Folder 1 Folder 2 files

subfolders files

VPF StructureVPF Structure• DOD (Department of Defense) and

NIMA (National Image and Mapping Agency) sponsored the VPF development (Vector Product Format) Nickname: very poor format

• It is used to store the earth ground information and provide a digital map.

VPF structureVPF structure

Database

Library • Library

Coverage Coverage Coverage

File1 File1 File1 File1 File1

Navigation in Hierarchical Navigation in Hierarchical StructureStructure

What is the purpose of Index?

Project 2Project 2• Create a hierarchical file structure to

store some your works in SJC. • This is the way I prefer: organize your

works based on the classes you take.• If you have other ways, that is ok as

long as they are organized well.• Show me in class what you have done.• Points: 100

Chapter 2 XMLChapter 2 XML• Extensible Markup Language• Purpose:

– Data transportation– Data representation– Data storage

• Why we should talk about it here? Because the data inside a XML file is hierarchical

What XML Promises?What XML Promises?• Data portability• Programming language Java promises the

portability of programs.• However, programs are working on data.

Before XML, data is not portable, communication among systems, agencies are extremely difficult.

• XML allows systems to communicate using a standard means of data representation.

HTML?HTML?• HTML is the portable language for

browsers.• It is a standard.• However, it governs how information

is displayed in a browser with defined formats and defined tags.

The Difficulties XML facesThe Difficulties XML faces• XML has some defined formats• But doesn’t have defined tags.• User defined tags• Unlimited types of data.

Solution (Partially)Solution (Partially)• Make the information self-explained.• You have to invent your own tags!

A Simple ExampleA Simple Example<person>

<lastname>Fonship</lastname><firstname>Michele</firstname><gender>female</gender><education type=“elementary”>

<start-date>9/1980</start-date><stop-date>5/1985</stop-date><school>Badley school</school>

</education></person>

Tips about XML formatTips about XML format• A tag is case sensitive• A starting tag must have a closing

tag to match• All XML elements must be properly

nested.• All XML documents must have a root

element.• Attribute values must always be

quoted.

Comments in XMLComments in XML• Comments in XML• The syntax for writing comments in

XML is similar to that of HTML.• <!-- This is a comment --> • A sample XML file.

XML Element NamingXML Element Naming• Names can contain letters, numbers,

and other characters • Names must not start with a number

or punctuation character • Names must not start with the letters

xml (or XML or Xml ..) • Names cannot contain spaces.

Is it valid or not?Is it valid or not?

<students>

<one student>

<first name>Rose</first name>

<last name>Washington</last name>

</one student>

</students>

Element ContentElement Content• An XML element is everything from

(including) the element's start tag to (including) the element's end tag.

• An element can have element content, mixed content, simple content, or empty content. An element can also have attributes.

Is this valid?Is this valid?

<food>

<vegetable></vegetable>

<fruit>apple</fruit>

</food>

Child Elements vs. AttributesChild Elements vs. Attributes

<person sex="female">

<firstname>Anna</firstname> <lastname>Smith</lastname>

</person>

<person>

<sex>female</sex> <firstname>Anna</firstname> <lastname>Smith</lastname>

</person>

Disadvantages of AttributesDisadvantages of Attributes• attributes cannot contain multiple values (child

elements can) • attributes are not easily expandable (for future

changes) • attributes cannot describe structures (child

elements can) • attributes are more difficult to manipulate by

program code • attribute values are not easy to test against a

Document Type Definition (DTD) - which is used to define the legal elements of an XML document

Using Child Elements?Using Child Elements?• So, it is a good idea to use Child

Elements other than Attributes.• Check this out. Tell which way you

prefer.• Can this file work? What is wrong?

A case for AttributeA case for Attribute• What is metadata? Data about data.

For example, your SJC student ID is a metadata about you since it does not describe you.

<publisher id=“p1”>

<name>O’Reilly</name>

<address>somewhere</address>

</publisher>

Is this valid?Is this valid?

<teacher>

<course>Eng100</course>

<course id=5>Math100</course>

<office Hour>2:00-3:00pm<office Hour>

<office>McDonough Hall 211 </Office>

</teacher>

What are the errors?

More about XMLMore about XML• Now we have so called “XML database” whose

basic element is XML document. It is not very successful yet.

• Remember that XML does not really do anything except describing data.

• We have to interpret whatever it is describing. In the sense of computer software, the user has to develop software to interpret.

• What are DTD and XML schema?• What are the disadvantages of XML? Please

discuss about it.

Analyze the XML fileAnalyze the XML file• Example XML file• Let’s discuss the weakness of this

file.• What do you suggest?• How do you think about my solution?

In class exerciseIn class exercise• Given the data shown in Access

database, can we store the same data in XML format? Please try it in class. Thanks.

Useful Sites about XMLUseful Sites about XML• http://www.w3schools.com/xml/• http://www.xml.org

XML in Uses?XML in Uses?• BBC topic news are also available

online via XML. Example.• XML at work.• XML in commerce?• What is GML and SGML?

Project 3Project 3• Here are the requirements, which are

also available in Blackboard.• Discussion: will XML really be the

standard of data transportation or data storage?

Part 3 DatabasePart 3 Database• Instead of listing it as Chapter 3, it is

listed as Part 3, which shows that this is a big issue.

Chapter 1Chapter 1 Database HistoryDatabase History

• Hierarchical database• Network database• Relational database• Object-oriented database• Object-oriented relational database• XML database• etc

Relational DatabaseRelational Database• The major database in use.• Based on the relations between data

items.• Key element: tables.• Available relational databases: Oracle,

DB2, Sybase, MS SQL Server, Access, MySQL, etc.

• A site about evaluation.• The instructor’s database work.

Records and AttributesRecords and Attributes• A table has multiple records, each

has multiple values.• For example.• The attributes define the data types.

All data in that column must conform to the given data types.

Primary KeyPrimary Key• The primary key of a relational table uniquely

identifies each record in the table. It can either be a normal attribute that is guaranteed to be unique (such as Social Security Number in a table with no more than one record per person) or it can be generated by the DBMS (such as a globally unique identifier, or GUID, in Microsoft SQL Server). Primary keys may consist of a single attribute or multiple attributes in combination

• For example, in the table example, the primary key is “Student#”.

• Every table must have Primary Key defined.

Primary Key (2)Primary Key (2)• Guess what would be the Primary

Key in the SJC database for students?• Will it be ok to use your name (last

name and first name) as the primary key?

Create a table for …Create a table for …• Smith, Jack, male, 8/15/1989, 421865241, Forrest,

Shoplifting, Linda Luke, (860)321-9086, 105.• Marsa, Rose, female, 7/1/1988, 3245691877, Jones, Dog

fighting, Nancy Charles, (860)321-9088, 106.• Lese, Sam, male, 3/21/1986, 425423785, Hartford, Dwell

breaking, Linda Luke, (860)321-9086, 105.• Haly, Rachel, female, 3/25/1989, 423671841, Hartford,

misconduct, Linda Luke, (860)321-9086, 105.• Horse, James, male, 11/2/1987, 765213456, Lama,

misconduct, Nancy Charles, (860)321-9088, 106.• Lincoln, George, male, 10/5/1988, 324342342, Jones,

fighting, Linda Luke, (860)321-9086, 105.• Doom, Jade, female, 9/9/1988, 423213495, Hartford,

misconduct, Nancy Charles, (860)321-9088, 106.

TableTableSS• Surely we will deal with multiple

database tables concerning any complete datasets.

• When dealing with complicate datasets, first thing is to categorize the data into groups with each group represented by a table.

• The second thing is to find and build the relationships between the tables.

Analyze the dataAnalyze the data• How many categories we have? • Let’s use UML to clear the data

relationship!• UML is Unified Modeling Language

which arises in 1990’s. It derived from the three greatest minds of system modeling.

• It is the standard language used to analyze system design.

PracticePractice• The UML diagram• What tables you would construct for

the data in the XML file?• Do this exercise in class.

RelationshipRelationship• Now let’s talk about the relationship

types One-to-OneOne-to-many vs many-to-oneMany-to-many

One-OneOne-One• SSN – Person

SSN Person1

1

One-ManyOne-Many• Bank accounts person (one

person can have multiple accounts, but one account belongs to one person/family).

Bank account person*

1

Many-ManyMany-Many• Course-Student. A student may take

multiple courses, and a course may be taken by multiple students.

Foreign KeyForeign Key• A foreign key is a relationship or

link between two tables which ensures that the data stored in a database is consistent.

• The foreign key link is set up by matching columns in one table (the child) to the primary key columns in another table (the parent).

• Referential Integrity

Foreign Key Example 1Foreign Key Example 1

studentID

First name

Last name

Major

SSN

Gender

DOB

Table Students

playerID

First name

Last name

Position number

Basket Ball playersPK

PK

parent child

One-to-one

Foreign Key Example 2Foreign Key Example 2• Given a table about instructors

whose columns are ID, first name and last name.

• Suppose the basic information of a offered course is the instructor and the course name.

Cont’dCont’d

ID

First name

Last name

Course name

Instructor

1 *

One-Many

Cont’dCont’d• Look at this example.

Exercise in DepthExercise in Depth• UML diagram of the exercise.• Now, how to define the tables that

can properly represent the UML diagram?

Common RulesCommon Rules• One object (entity) one table• One attribute one column• Additional PK – optional in some

cases.

How to define Relations How to define Relations between Tables?between Tables?

• First of all, we have to know that Parents come before children. Tables that can be built without referencing other tables/data could be used as parent table.

• For example, student table vs basket ball player table.

Relations cont’dRelations cont’d• In case of One-One relation, the

parent table is the table that can be built without referencing any data in the child table. The child table must be the table that references data in the parent table.

ExampleExample

studentID

First name

Last name

Major

SSN

Gender

DOB

playerID

First name

Last name

Position number

Relation cont’dRelation cont’d• In case of One-Many, the One must

be the parent table, and the Many must be the child table

ExampleExample

BookID

Title

Author

Publish year

Publisher ID

PublisherID

Name

Address

parentchild

Many-One

Many-ManyMany-Many• It is pretty hard to express the Many-

Many relations between two tables. • For example, students Courses

relationship.• How are we going to do it?

SolutionSolution• Make use of another table! In this

case, we have three tables. One for students only, one for courses only, and one to link students with courses.

Solution ExampleSolution Example

studentID

lastname

firstname

DOB

gender

Course#

Title

LocationStudentID

Course#

The full table constructionThe full table construction• Let’s work on this data to build the

whole tables!

• Now, let’s do this project 4!

Sword, a real applicationSword, a real application• Publicly information about Sword.• A success story of data

representation, storage and management in Mississippi.

• Please form 2 or 3 groups for the coming projects since they are kind of complicated. Inform me of the group members in the next class. Thanks.

Discussion of Sword in ClassDiscussion of Sword in Class• The sword data scenario

Chapter 2 Access Basics IChapter 2 Access Basics I• Please form 2 or 3 groups to for the

coming projects since they are kind of complicated. Inform me of the group members in the next class. Thanks.

• Every student is supposed to collect at least 2 restaurant menus of the Hartford area. Keep them for later use.

Basics (1)Basics (1)• Open and save an Access database.• Create a table in Design View.• To create good tables, we need to

understand our data first. Let’s have a look at the existing data in next slide.

TryTry• Create a table to hold the information below?• Smith, Jack, male, 8/15/1989, 421865241, Forrest,

Shoplifting, Linda Luke, (860)321-9086, 105.• Marsa, Rose, female, 7/1/1988, 3245691877, Jones, Dog

fighting, Nancy Charles, (860)321-9088, 106.• Lese, Sam, male, 3/21/1986, 425423785, Hartford, Dwell

breaking, Linda Luke, (860)321-9086, 105.• Haly, Rachel, female, 3/25/1989, 423671841, Hartford,

misconduct, Linda Luke, (860)321-9086, 105.• Horse, James, male, 11/2/1987, 765213456, Lama,

misconduct, Nancy Charles, (860)321-9088, 106.• Lincoln, George, male, 10/5/1988, 324342342, Jones,

fighting, Linda Luke, (860)321-9086, 105.• Doom, Jade, female, 9/9/1988, 423213495, Hartford,

misconduct, Nancy Charles, (860)321-9088, 106.

Try cont’dTry cont’d• First, primary key!• Continue the building of one table for

all the data.• After done, save the work and give

the table a sensible name.

Create Table: wizardCreate Table: wizard• Let’s explore the table creation

function of Access: we can create table by Wizard, i.e. with templates.

Create Multiple TablesCreate Multiple Tables• Based on the UML diagram of the

data, let’s create multiple tables.

Student

NameDOBGenderMajor

Course

Course #Location

Instructor

NameOfficeGender

N : MN

M

N

1

NormalizationNormalization• Normalization in database means to

remove the redundant data to improve data storage efficiency, data integrity and scalability.

• It is essential• Good online explanation

3 Level Normalization3 Level Normalization• The first level of normalization removes

redundant data horizontally, i.e. no repeated columns.

• The second level of normalization removes redundant data vertically, i.e. no repeated data in rows.

• The third level of normalization organize data that does not depend on the primary key into another table.

NormalizationNormalization• Totally there are 5 levels of

normalization.• It is absolutely necessary to apply

the 1st and 2nd levels of normalization.

• The 3rd level is applied sometimes.• Don’t bother with the 4th or 5th levels

of normalization

ExerciseExercise• What is the normalization level of the

database constructed?

Student

NameDOBGenderMajor

Course

Course #Location

Instructor

NameOfficeGender

N : MN

M

N

1

Basics (2): Simple QueryBasics (2): Simple Query• Based on the constructed table, let’s have

some fun with Query.• Query is a programming language called

SQL (structured query language).• SQL is a standard interactive and

programming language for getting information from and updating a database.

• Click here to learn more?

Create QueryCreate Query• Create Query in design view• Create Query by using wizard• View the result sheet.

Query SyntaxQuery Syntax• Though we now know how to create

simple queries graphically, we still need to understand the syntax.

• SELECT sth FROM somethere.

Select * from classes;

Select ID from classes;

Select classes.ID, lastname from classes;

Set ConditionsSet Conditions• SELECT something FROM somewhere

WHERE conditions-are-met– Select * from students where gender=0;– Select * from students where

lastname=‘Smith’;– Select * from students where DOB

between #1/1/1988# and #1/1/1990#

Set ConditionsSet Conditions• Select * from students where

lastname like ‘Smi*’;• Select * from students where

lastname like “*smi*”;• SELECT * FROM students WHERE

gender=0 AND lastname like “*smi*”;

• Be aware in standard SQL, LIKE ‘%smi%’;

JOINJOIN• In many cases, we need to fetch data from

multiple tables. Thus, we need to bind together the data from the tables. The binding is based on some keys, usually the primary key or some other unique data items.

• Good online material (but be aware that this is for standard SQL, not for Access!)

• FOR Microsoft inquiry, please go to: http://msdn.microsoft.com/

Join in AccessJoin in Access• Select sth1, sth2 from table1 INNER JOIN

table2 ON table1.key1 = table2.key2.• For example:Select students.* from (students INNER JOIN

studentscourses ON students.ID = studentscourses.studentID) where studentscourses.courseNum=‘Comp200’

Other JOINSOther JOINS• There are two different types of JOIN:

– INNER JOIN– OUTER JOIN

• LEFT JOIN• RIGHT JOIN

Let’s not deal with OUTER JOIN in this class to make it simple.

INNER JOININNER JOIN• INNER JOIN only join the records that

both tables have the corresponding key!.

• See the MSDN explanation

Sort the ResultsSort the Results• You can order the results in

ascending or descending order.

1. Select * from students order by studentID desc;

2. Select * from students order by lastname; (if it is ascending order, you don’t need to specify it)

SubquerySubquery• Inside a query, we can have another

query to provide some information for a condition, i.e. we have subquery(s) inside a query.

Select * from students where studentID in (select studentID from studentscourses where coursenumber=“Comp200”);

FunctionsFunctions• Access query could use built-in

functions. For example, MAX, MIN, COUNT, etc. Let’s experience COUNT.

Question: how to find the number of students who are taking courses currently in the school?

OthersOthers• SO far, we have been dealing with SELECT

queries. There are other types:• CREATE – create tables• INSERT – insert rows• DROP – drop tables• DELETE – delete rows• ALTER - change the table structures• Etc.

Sample DatabaseSample Database• Here is a sample database with some

queries constructed. Might be useful as references.

• Remember that this class is not only for database, so we cannot go very deep into database issues. If you have more interests in database, I may be able to offer a class specifically on database.

Project 5Project 5• Project 5 requests you to construct a

database for a group of restaurant. Please use UML diagram to analyze the data first, then construct your database. Also, please provide some queries. -- Imaging that you are provide a hotline services for customer inquiries about food services in Hartford area.

Part 4Part 4 BioinformaticsBioinformatics• What is bioinformatics?The study of the application of computer and

statistical techniques to the management of biological information

The science of creating and managing biological databases to keep track of, and eventually simulate, the complexity of living organisms.

There exist different definitions, though.

The Possible Role of The Possible Role of Bioinformatics?Bioinformatics?

• Look over the history of biology, different approaches are used over the time.

• Initially “Guessing” Observation Dissection.

• Mendal started genetic experiments.• Biochemists used organics to clear out the

metabolic pathways.• Molecular biology is another approach now

used to decode the life secrets.• Is it the time for bioinformatics as another

approach?

Several Foundations of Several Foundations of BioinformaticsBioinformatics

• Lives are from the same ancestors, ‘either evolved or created’. That means that knowledge obtained on one form of life may be applied to other forms. In fact, molecular biology started from bacteria, then yeast, then mammal. database

• Publicly available data resources.• Human Genome Project

Publicly ResourcesPublicly Resources• I am not sure how many biological

research laboratories we have in the world, it must be MANY MANY.

• No other science has equal or even close amount of research laboratories.

• The largest amount of research funds from government, states, private corporations, etc.

Most famous AgenciesMost famous Agencies• NIH (National Institute of Health)• WHO (World Health Organization)• Others …

Huge Amount of InformationHuge Amount of Information• All the scientists in the world generated

large amount of scientific information, and it is likely much of them is repeated.

• Communication among scientists become extremely important.

• That is why there are so many publicly available biological resources.

• Internet plays a critical role in the information sharing.

Internet’s InformationInternet’s Information1. Access to information for anyone with an

Internet browser.2. The data stored in centralized database

us redundant by a factor of about 2.5, which provides a quality control.

3. Information from yeast (for example) could be helpful in finding/understanding homologous genes/pathways in humans (comparative genomics).

Human Genome ProjectHuman Genome Project• HGP.• Without HGP, there is no real

Bioinformatics.• Bioinformatics boosted up after large

amount of Human Genome are decoded how to use these DNA information? Computer technologies!

Bioinformatics and EvolutionBioinformatics and Evolution

Ancestor

Child A Child B Child C

Child Aa Child Ab Child Ba Child Bb

ChildAa-1 ChildBa-1

Mutations

MutationsMutations• Mutations that occur in germ cells

will be passed on to the next generation, like any other DNA sequences.

• So, as time and generations go by, a DNA sequence will acquire more and more mutations and resemble less and less the original DNA sequence.

Need to know where fromNeed to know where from• From an evolutionary perspective, we

cannot know where we are going unless we know where we have been. Before, the study of human evolution was largely the province of paleoanthropologists who studied the fossil record.

• However, gene comparisons now become the major and more accurate techniques using computer technologies/bioinformatics

Do you know …Do you know …• We all started from Africa?• Using the Mitochondrial DNA analysis

among women from different nations, it is found that African people have larger variations in DNA sequence oldest group has the greatest genetic diversity African is the oldest population the ancestor.

Bioinformatics with AIDSBioinformatics with AIDS• Analysis of the human genome

guides AIDS research. Some persons long-infected with HIV have not shown any symptoms of the disease. Studies found that these people possess a variant of a receptor CCR5 Rarely in Asian and African guess it may come to European in 14th century.

Tools of BioinformaticsTools of Bioinformatics• Gene Predication Software• Sequence Alignment Software• Molecular Phylogenetics• Molecular Modeling and 3-D

Visualization.

NCBINCBI• National Center for Biotechnology

Information.– PubMed (Medline)– Entrez– BLAST– OMIM– Books– TaxBrowser– Structure

PubMedPubMed• Access to the Medline database largest

biomedical literature source.• Medline database contains citations and

abstracts from more than 4600 biomedical journals published in USA and other countries.

• Searches are commonly conducted using a keyword(s), author names, publication date, and/or journal titles.

EntrezEntrez• A search and retrieval system that

integrates all of the databases available at NCBI. These databases include nucleotide sequences, protein sequences, genomes, molecular structure and PubMed.

• GenBank, DNA DataBank of Japan, European Molecular Biology Laboratory make up the International Nucleotide Sequence Database Collaboration. These organizations exchange data every day.

• Search for Bcl2 as an example.

BLASTBLAST• Basic Local Alignment Search Tool.

Sequence 1…AGTTCGATAGCTAAGGTCGG…Sequence 2…AGTTCGATAGCTATGGTCGG…

BLASTBLAST

Sequence 3…AGTTCGATAGCTAAGGTCGG…Sequence 4…AGTTCGATAGCTAGGTCGGG…

BLAST – Another LookBLAST – Another Look

Sequence 3…AGTTCGATAGCTAAGGTCGG…Sequence 4…AGTTCGATAGCTA–GGTCGG…

Use BLASTUse BLAST• Click here.• Let’s choose blastn.• Now, let’s practice its uses.

OMIMOMIM• Online Mendelian Inheritance in Man• It is a database containing

information about human genes and genetic disease. This resources is often used by physicians and researchers interested in genetic diseases.

BooksBooks• NCBI collaborates with authors and

publishers to create a virtual bookshelf.

TaxBrowserTaxBrowser• The taxonomy site contains a

classification of all the organisms that are represented by sequences in the public databases, including model organisms commonly used in molecular biology.

StructureStructure• The structure site features the

Molecular Modeling Database (MMDB), which contains macromolecular 3-D structures as well as tools to analyze them. Included in the MMDB are experimentally determined structures obtained from the protein data bank.

Cn3D4.1Cn3D4.1• You can download it.• It reads MMDB instead of PDB file.

This is because MMDB will ensures the correctness of the read PDB file.

• The Link

Applications of Applications of BioinformaticsBioinformatics

• Forensic Science• Agriculture• Medicine• Pharma/Biotechnology• Environmental Science• Ethical Legal, and Social ISsues

Forensic ScienceForensic Science• Minisatellites consists of short DNA

sequences that repeat in tandem. The number of repeats & the sequence within each repeat can exhibit wide variation in a population. Techniques based on this were developed to identify individuals. E.g. FBI established Combined DNA Index System (CODIS) that contains profiles of convicted offenders.

Forensic ScienceForensic Science• DNA testing is now the standard

technique for confirm paternity.• Is also a technique to identify

criminals and victims.• Computer technology is essential to

search through the database for the identification.

AgricultureAgriculture• Genome projects for major crop

plants are well underway:Pest controlSeed qualityPlant micronutrients (golden rice)Etc.

MedicineMedicine• The ability to correlate genetic data

with medical records promises to improve our understanding of disease and improve treatments.

• Microarray cancer classification• Associating SNPs with disease helps

scientists to identify genes that play roles in disease progression.

Pharma/BiotechnologyPharma/Biotechnology• Bioinformatics is providing a complete list

of candidate genes for drug discovery. The tools of functional genomics are being used to establish the metabolic roles played by the candidate gene products.

• Pharmaceutical companies are using bioinformatics to search for new antibiotics.

Cont’dCont’d• Advances in genomics are expanding

the range of drug targets and are shifting the discovery effort from direct screening programs to rational target-based drug designs.

Environmental SciencesEnvironmental Sciences• Global biodiversity.• Global Biodiversity Information

Facility (GBIF)• How to analyze these diversity and

make use of them.• Computer software to monitor

environmental changes, via birds and other animals’ behaviors.

Ethical, Legal and Social Ethical, Legal and Social IssuesIssues

• Anonymous databases include nonidentifiable genetic data.

• Non-anonymous databases its data could be linked to individuals.

• An ethical concern most relevant to non-anonymous databases is Informed Consent.

Informed ConsentInformed Consent• Informed consent is the ethical

practice of respecting individual autonomy and protecting an individual from harm. It refers to a process whereby an individual freely and knowingly weighs the risks and benefits of donating a tissue or DNA sample for research purposes.

Privacy & ConfidentialityPrivacy & Confidentiality• Personal privacy is an important

aspect of informed consent. Privacy is the right to control access to information about oneself.

• Confidentiality is the obligation for those who obtain information about individuals to protect the privacy of that information.

MoreMore• If society is to gain the most from

genomic biology, then the public must be able to rationally consider scientific issues. They should not place a blind trust in scientists, nor should they dismiss new technologies out of hand.

In-Class ExerciseIn-Class Exercise• Human Genome is sequenced via the

“shortgun” approach in which human chromosomes were randomly cut into pieces.

• Each DNA pieces are sequenced separately.

• Computer technology is then used to find the overlap and construct the contiguous sequence.

In-Class ExericesIn-Class Exerices• Group 1• Group 2• Group 3• Each group will constitute two

fragments and all groups work together for the final sequences.

• For simplicity, we are dealing with only one strand for simplicity.